From a8935c99fc0bedbb7851b1223511dd58a1ad048d Mon Sep 17 00:00:00 2001 From: Chris Hartl Date: Thu, 18 Aug 2011 15:28:35 -0400 Subject: [PATCH] dding docs for DepthOfCoverage and ValidationAmplicons --- .../coverage/DepthOfCoverageWalker.java | 46 ++++++++++-- .../validation/ValidationAmplicons.java | 72 ++++++++++++++++--- 2 files changed, 104 insertions(+), 14 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageWalker.java index 90036407f..7fe16c9df 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageWalker.java @@ -51,14 +51,48 @@ import java.io.PrintStream; import java.util.*; /** - * A parallelizable walker designed to quickly aggregate relevant coverage statistics across samples in the input - * file. Assesses the mean and median granular coverages of each sample, and generates part of a cumulative - * distribution of % bases and % targets covered for certain depths. The granularity of DOC can be set by command - * line arguments. + * Toolbox for assessing sequence coverage by a wide array of metrics, partitioned by sample, read group, or library * + *

+ * DepthOfCoverage processes a set of bam files to determine coverage at different levels of partitioning and + * aggregation. Coverage can be analyzed per locus, per interval, per gene, or in total; can be partitioned by + * sample, by read group, by technology, by center, or by library; and can be summarized by mean, median, quartiles, + * and/or percentage of bases covered to or beyond a threshold. + * Additionally, reads and bases can be filtered by mapping or base quality score. + * + *

Input

+ *

+ * One or more bam files (with proper headers) to be analyzed for coverage statistics + * (Optional) A REFSEQ Rod to aggregate coverage to the gene level + *

+ * + *

Output

+ *

+ * Tables pertaining to different coverage summaries. Suffix on the table files declares the contents: + * - no suffix: per locus coverage + * - _summary: total, mean, median, quartiles, and threshold proportions, aggregated over all bases + * - _statistics: coverage histograms (# locus with X coverage), aggregated over all bases + * - _interval_summary: total, mean, median, quartiles, and threshold proportions, aggregated per interval + * - _interval_statistics: 2x2 table of # of intervals covered to >= X depth in >=Y samples + * - _gene_summary: total, mean, median, quartiles, and threshold proportions, aggregated per gene + * - _gene_statistics: 2x2 table of # of genes covered to >= X depth in >= Y samples + * - _cumulative_coverage_counts: coverage histograms (# locus with >= X coverage), aggregated over all bases + * - _cumulative_coverage_proportions: proprotions of loci with >= X coverage, aggregated over all bases + *

+ * + *

Examples

+ * 
+ * java -Xmx2g -jar GenomeAnalysisTK.jar \
+ *   -R ref.fasta \
+ *   -T VariantEval \
+ *   -o file_name_base \
+ *   -I input_bams.list
+ *   [-geneList refSeq.sorted.txt] \
+ *   [-pt readgroup] \
+ *   [-ct 4 -ct 6 -ct 10] \
+ *   [-L my_capture_genes.interval_list]
+ *
* - * @Author chartl - * @Date Feb 22, 2010 */ // todo -- cache the map from sample names to means in the print functions, rather than regenerating each time // todo -- support for granular histograms for total depth; maybe n*[start,stop], bins*sqrt(n) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java index 61149e5d9..cd2891874 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java @@ -30,21 +30,77 @@ import java.util.LinkedList; import java.util.List; /** - * Created by IntelliJ IDEA. - * User: chartl - * Date: 6/13/11 - * Time: 2:12 PM - * To change this template use File | Settings | File Templates. + * Creates FASTA sequences for use in Seqenom or PCR utilities for site amplification and subsequent validation + * + *

+ * ValidationAmplicons consumes a VCF and an Interval list and produces FASTA sequences from which PCR primers or probe + * sequences can be designed. In addition, ValidationAmplicons uses BWA to check for specificity of tracts of bases within + * the output amplicon, lower-casing non-specific tracts, allows for users to provide sites to mask out, and specifies + * reasons why the site may fail validation (nearby variation, for example). + *

+ * + *

Input

+ *

+ * Requires a VCF containing alleles to design amplicons towards, a VCF of variants to mask out of the amplicons, and an + * interval list defining the size of the amplicons around the sites to be validated + *

+ * + *

Output

+ *

+ * Output is a FASTA-formatted file with some modifications at probe sites. For instance: + * 

+ * >20:207414 INSERTION=1,VARIANT_TOO_NEAR_PROBE=1, 20_207414
+ * CCAACGTTAAGAAAGAGACATGCGACTGGGTgcggtggctcatgcctggaaccccagcactttgggaggccaaggtgggc[A/G*]gNNcacttgaggtcaggagtttgagaccagcctggccaacatggtgaaaccccgtctctactgaaaatacaaaagttagC
+ * >20:792122 Valid 20_792122
+ * TTTTTTTTTagatggagtctcgctcttatcgcccaggcNggagtgggtggtgtgatcttggctNactgcaacttctgcct[-/CCC*]cccaggttcaagtgattNtcctgcctcagccacctgagtagctgggattacaggcatccgccaccatgcctggctaatTT
+ * >20:994145 Valid 20_994145
+ * TCCATGGCCTCCCCCTGGCCCACGAAGTCCTCAGCCACCTCCTTCCTGGAGGGCTCAGCCAAAATCAGACTGAGGAAGAAG[AAG/-*]TGGTGGGCACCCACCTTCTGGCCTTCCTCAGCCCCTTATTCCTAGGACCAGTCCCCATCTAGGGGTCCTCACTGCCTCCC
+ * >20:1074230 SITE_IS_FILTERED=1, 20_1074230
+ * ACCTGATTACCATCAATCAGAACTCATTTCTGTTCCTATCTTCCACCCACAATTGTAATGCCTTTTCCATTTTAACCAAG[T/C*]ACTTATTATAtactatggccataacttttgcagtttgaggtatgacagcaaaaTTAGCATACATTTCATTTTCCTTCTTC
+ * >20:1084330 DELETION=1, 20_1084330
+ * CACGTTCGGcttgtgcagagcctcaaggtcatccagaggtgatAGTTTAGGGCCCTCTCAAGTCTTTCCNGTGCGCATGG[GT/AC*]CAGCCCTGGGCACCTGTNNNNNNNNNNNNNTGCTCATGGCCTTCTAGATTCCCAGGAAATGTCAGAGCTTTTCAAAGCCC
+ *
+ * are amplicon sequences resulting from running the tool. The flags (preceding the sequence itself) can be: + * + * Valid // amplicon is valid + * SITE_IS_FILTERED=1 // validation site is not marked 'PASS' or '.' in its filter field ("you are trying to validate a filtered variant") + * VARIANT_TOO_NEAR_PROBE=1 // there is a variant too near to the variant to be validated, potentially shifting the mass-spec peak + * MULTIPLE_PROBES=1, // multiple variants to be validated found inside the same amplicon + * DELETION=6,INSERTION=5, // 6 deletions and 5 insertions found inside the amplicon region (from the "mask" VCF), will be potentially difficult to validate + * DELETION=1, // deletion found inside the amplicon region, could shift mass-spec peak + * START_TOO_CLOSE, // variant is too close to the start of the amplicon region to give sequenom a good chance to find a suitable primer + * END_TOO_CLOSE, // variant is too close to the end of the amplicon region to give sequenom a good chance to find a suitable primer + * NO_VARIANTS_FOUND, // no variants found within the amplicon region + * INDEL_OVERLAPS_VALIDATION_SITE, // an insertion or deletion interferes directly with the site to be validated (i.e. insertion directly preceding or postceding, or a deletion that spans the site itself) + *

+ * + *

Examples

+ * 

+ *    java
+ *      -jar GenomeAnalysisTK.jar
+ *      -T ValidationAmplicons
+ *      -R /humgen/1kg/reference/human_g1k_v37.fasta
+ *      -BTI ProbeIntervals
+ *      -ProbeIntervals:table interval_table.table
+ *      -ValidateAlleles:vcf sites_to_validate.vcf
+ *      -MaskAlleles:vcf mask_sites.vcf
+ *      --virtualPrimerSize 30
+ *      -o probes.fasta
+ * 
+ *
+ * @author chartl
+ * @since July 2011
  */
 @Requires(value={DataSource.REFERENCE})
 public class ValidationAmplicons extends RodWalker {
-    @Input(fullName = "ProbeIntervals", doc="Chris document me", required=true)
+    @Input(fullName = "ProbeIntervals", doc="A collection of intervals in table format with optional names that represent the "+
+                                            "intervals surrounding the probe sites amplicons should be designed for", required=true)
     RodBinding probeIntervals;
 
-    @Input(fullName = "ValidateAlleles", doc="Chris document me", required=true)
+    @Input(fullName = "ValidateAlleles", doc="A VCF containing the sites and alleles you want to validate. Restricted to *BI-Allelic* sites", required=true)
     RodBinding validateAlleles;
 
-    @Input(fullName = "MaskAlleles", doc="Chris document me", required=true)
+    @Input(fullName = "MaskAlleles", doc="A VCF containing the sites you want to MASK from the designed amplicon (e.g. by Ns or lower-cased bases)", required=true)
     RodBinding maskAlleles;