From b0a4cb9f0cf2f9631b54d8b64be478c8a14f8a86 Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Wed, 4 Jun 2014 01:33:29 -0400 Subject: [PATCH 1/7] Added close sample and allele list data-structures and utility classes --- .../gatk/genotyping/AlleleList.java | 40 ++ .../gatk/genotyping/AlleleListUtils.java | 306 ++++++++++++++++ .../gatk/genotyping/IndexedAlleleList.java | 95 +++++ .../gatk/genotyping/IndexedSampleList.java | 96 +++++ .../gatk/genotyping/SampleList.java | 43 +++ .../gatk/genotyping/SampleListUtils.java | 197 ++++++++++ .../gatk/utils/collections/IndexedSet.java | 342 ++++++++++++++++++ .../genotyping/AlleleListPermutation.java | 35 ++ .../gatk/utils/collections/Permutation.java | 103 ++++++ 9 files changed, 1257 insertions(+) create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java create mode 100644 public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java create mode 100644 public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/collections/Permutation.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java new file mode 100644 index 000000000..2f124ed91 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java @@ -0,0 +1,40 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; + +/** + * Created by valentin on 5/12/14. + */ +public interface AlleleList { + + public int alleleCount(); + + public int alleleIndex(final A allele); + + public A alleleAt(final int index); + +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java new file mode 100644 index 000000000..380a20379 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java @@ -0,0 +1,306 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; + +import java.util.AbstractList; +import java.util.List; + +/** + * Utils operations on {@link AlleleList} instances. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class AlleleListUtils { + + /** + * Checks whether two allele lists are in fact the same. + * @param first one list to compare. + * @param second another list to compare. + * + * @throws IllegalArgumentException if if either list is {@code null}. + * + * @return {@code true} iff both list are equal. + */ + public static boolean equals(final AlleleList first, final AlleleList second) { + if (first == null || second == null) + throw new IllegalArgumentException("no null list allowed"); + final int alleleCount = first.alleleCount(); + if (alleleCount != second.alleleCount()) + return false; + + for (int i = 0; i < alleleCount; i++) { + final A firstSample = first.alleleAt(i); + if (firstSample == null) + throw new IllegalStateException("no null samples allowed in sample-lists: first list at " + i); + final A secondSample = second.alleleAt(i); + if (secondSample == null) + throw new IllegalArgumentException("no null samples allowed in sample-list: second list at " + i); + if (!firstSample.equals(secondSample)) + return false; + } + + return true; + } + + /** + * Resolves the index of the reference allele in an allele-list. + * + *

+ * If there is no reference allele, it returns -1. If there is more than one reference allele, + * it returns the first occurrence (lowest index). + *

+ * + * @param list the search allele-list. + * @param
allele component type. + * + * @throws IllegalArgumentException if {@code list} is {@code null}. + * + * @return -1 if there is no reference allele, or a values in [0,{@code list.alleleCount()}). + */ + public static int indexOfReference(final AlleleList list) { + if (list == null) + throw new IllegalArgumentException("the input list cannot be null"); + final int alleleCount = list.alleleCount(); + for (int i = 0; i < alleleCount; i++) + if (list.alleleAt(i).isReference()) + return i; + return -1; + } + + + /** + * Returns a {@link java.util.List} unmodifiable view of a allele-list + * @param list the sample-list to wrap. + * + * @throws IllegalArgumentException if {@code list} is {@code null}. + * + * @return never {@code null}. + */ + public static List asList(final AlleleList list) { + if (list == null) + throw new IllegalArgumentException("the list cannot be null"); + return new AsList(list); + } + + /** + * Simple list view of a sample-list. + */ + private static class AsList extends AbstractList { + + private final AlleleList list; + + private AsList(final AlleleList list) { + this.list = list; + + } + + @Override + public A get(int index) { + return list.alleleAt(index); + } + + @Override + public int size() { + return list.alleleCount(); + } + } + + + /** + * Returns a permutation between two allele lists. + * @param original the original allele list. + * @param target the target allele list. + * @param the allele type. + * + * @throws IllegalArgumentException if {@code original} or {@code target} is {@code null}, or + * elements in {@code target} is not contained in {@code original} + * + * @return never {@code null} + */ + public static AlleleListPermutation permutation(final AlleleList original, final AlleleList target) { + if (equals(original,target)) + return new NonPermutation<>(original); + else + return new ActualPermutation<>(original,target); + } + + private static class NonPermutation implements AlleleListPermutation { + + private final AlleleList list; + + public NonPermutation(final AlleleList original) { + list = original; + } + + @Override + public boolean isPartial() { + return false; + } + + @Override + public boolean isNonPermuted() { + return true; + } + + @Override + public int toIndex(int fromIndex) { + return fromIndex; + } + + @Override + public int fromIndex(int toIndex) { + return toIndex; + } + + @Override + public int fromSize() { + return list.alleleCount(); + } + + @Override + public int toSize() { + return list.alleleCount(); + } + + @Override + public List fromList() { + return asList(list); + } + + @Override + public java.util.List toList() { + return asList(list); + } + + + @Override + public int alleleCount() { + return list.alleleCount(); + } + + @Override + public int alleleIndex(final A allele) { + return list.alleleIndex(allele); + } + + @Override + public A alleleAt(final int index) { + return list.alleleAt(index); + } + } + + private static class ActualPermutation implements AlleleListPermutation { + + private final AlleleList from; + + private final AlleleList to; + + private final int[] fromIndex; + + private final boolean nonPermuted; + + private final boolean isPartial; + + private ActualPermutation(final AlleleList original, final AlleleList target) { + this.from = original; + this.to = target; + final int toSize = target.alleleCount(); + final int fromSize = original.alleleCount(); + if (fromSize < toSize) + throw new IllegalArgumentException("target allele list is not a permutation of the original allele list"); + + fromIndex = new int[toSize]; + boolean nonPermuted = fromSize == toSize; + this.isPartial = !nonPermuted; + for (int i = 0; i < toSize; i++) { + final int originalIndex = original.alleleIndex(target.alleleAt(i)); + if (originalIndex < 0) + throw new IllegalArgumentException("target allele list is not a permutation of the original allele list"); + fromIndex[i] = originalIndex; + nonPermuted &= originalIndex == i; + } + + this.nonPermuted = nonPermuted; + } + + @Override + public boolean isPartial() { + return isPartial; + } + + @Override + public boolean isNonPermuted() { + return nonPermuted; + } + + @Override + public int toIndex(int fromIndex) { + return to.alleleIndex(from.alleleAt(fromIndex)); + } + + @Override + public int fromIndex(int toIndex) { + return fromIndex[toIndex]; + } + + @Override + public int fromSize() { + return from.alleleCount(); + } + + @Override + public int toSize() { + return to.alleleCount(); + } + + @Override + public List fromList() { + return asList(from); + } + + @Override + public List toList() { + return asList(to); + } + + @Override + public int alleleCount() { + return to.alleleCount(); + } + + @Override + public int alleleIndex(final A allele) { + return to.alleleIndex(allele); + } + + @Override + public A alleleAt(final int index) { + return to.alleleAt(index); + } + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java new file mode 100644 index 000000000..14de94818 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java @@ -0,0 +1,95 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.utils.collections.IndexedSet; + +import java.util.Collection; + +/** + * Allele list implementation using and indexed-set. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IndexedAlleleList implements AlleleList { + + private final IndexedSet alleles; + + /** + * Constructs a new empty allele-list + */ + public IndexedAlleleList() { + alleles = new IndexedSet<>(); + } + + /** + * Constructs a new allele-list from an array of alleles. + * + *

+ * Repeats in the input array will be ignored (keeping the first one). The order of alleles in the + * resulting list is the same as in the natural traversal of the input collection. + * + *

+ * @param alleles the original allele array + * + * @throws java.lang.IllegalArgumentException if {@code alleles} is {@code null} or contains {@code null}s. + */ + public IndexedAlleleList(final A ... alleles) { + this.alleles = new IndexedSet<>(alleles); + } + + /** + * Constructs a new allele-list from a collection of alleles. + * + *

+ * Repeats in the input collection will be ignored (keeping the first one). The order of alleles in the + * resulting list is the same as in the natural traversal of the input collection. + * + *

+ * @param alleles the original allele collection + * + * @throws java.lang.IllegalArgumentException if {@code alleles} is {@code null} or contains {@code null}s. + */ + public IndexedAlleleList(final Collection
alleles) { + this.alleles = new IndexedSet<>(alleles); + } + + @Override + public int alleleCount() { + return alleles.size(); + } + + @Override + public int alleleIndex(final A allele) { + return alleles.indexOf(allele); + } + + @Override + public A alleleAt(final int index) { + return alleles.get(index); + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java new file mode 100644 index 000000000..277404b96 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java @@ -0,0 +1,96 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.genotyping; + +import org.broadinstitute.gatk.utils.collections.IndexedSet; + +import java.util.Collection; + +/** + * Simple implementation of a sample-list using and indexed-set. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IndexedSampleList implements SampleList { + + private final IndexedSet samples; + + /** + * Constructs an empty sample-list. + */ + public IndexedSampleList() { + samples = new IndexedSet<>(0); + } + + /** + * Constructs a sample-list from a collection of samples. + * + *

+ * Repeats in the input collection are ignored (just the first occurrence is kept). + * Sample names will be sorted based on the traversal order + * of the original collection. + *

+ * + * @param samples input sample collection. + * + * @throws IllegalArgumentException if {@code samples} is {@code null} or it contains {@code nulls}. + */ + public IndexedSampleList(final Collection samples) { + this.samples = new IndexedSet<>(samples); + } + + /** + * Constructs a sample-list from an array of samples. + * + *

+ * Repeats in the input array are ignored (just the first occurrence is kept). + * Sample names will be sorted based on the traversal order + * of the original array. + *

+ * + * @param samples input sample array. + * + * @throws IllegalArgumentException if {@code samples} is {@code null} or it contains {@code nulls}. + */ + public IndexedSampleList(final String ... samples) { + this.samples = new IndexedSet<>(samples); + } + + @Override + public int sampleCount() { + return samples.size(); + } + + @Override + public int sampleIndex(final String sample) { + return samples.indexOf(sample); + } + + @Override + public String sampleAt(int sampleIndex) { + return samples.get(sampleIndex); + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java new file mode 100644 index 000000000..3ac8b5ef7 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java @@ -0,0 +1,43 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + + +package org.broadinstitute.gatk.genotyping; + +/** + * A indexed set of samples. + * + *

+ * Implementing classes must guarantee that the sample list will remain constant through the life of the object. + *

+ */ +public interface SampleList { + + public int sampleCount(); + + public int sampleIndex(final String sample); + + public String sampleAt(final int sampleIndex); +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java new file mode 100644 index 000000000..e151d03da --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java @@ -0,0 +1,197 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.genotyping; + +import java.util.*; + +/** + * Some utility operations on sample lists. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class SampleListUtils { + + /** + * Checks whether two sample lists are in fact the same. + * @param first one list to compare. + * @param second another list to compare. + * + * @throws IllegalArgumentException if if either list is {@code null}. + * + * @return {@code true} iff both list are equal. + */ + public static boolean equals(final SampleList first, final SampleList second) { + if (first == null || second == null) + throw new IllegalArgumentException("no null list allowed"); + final int sampleCount = first.sampleCount(); + if (sampleCount != second.sampleCount()) + return false; + + for (int i = 0; i < sampleCount; i++) { + final String firstSample = first.sampleAt(i); + if (firstSample == null) + throw new IllegalStateException("no null samples allowed in sample-lists: first list at " + i); + final String secondSample = second.sampleAt(i); + if (secondSample == null) + throw new IllegalArgumentException("no null samples allowed in sample-list: second list at " + i); + if (!firstSample.equals(secondSample)) + return false; + } + return true; + } + + /** + * Returns a {@link List} unmodifiable view of a sample-list + * @param list the sample-list to wrap. + * + * @throws IllegalArgumentException if {@code list} is {@code null}. + * + * @return never {@code null}. + */ + public static List asList(final SampleList list) { + if (list == null) + throw new IllegalArgumentException("the list cannot be null"); + return new AsList(list); + } + + /** + * Returns a {@link Set} unmodifiable view of the sample-list + * + * @param list the sample-list to wrap. + * + * @throws IllegalArgumentException if {@code list} is {@code null} + */ + public static Set asSet(final SampleList list) { + if (list == null) + throw new IllegalArgumentException("the list cannot be null"); + return new AsSet(list); + } + + /** + * Creates a list with a single sample. + * + * @param sampleName the sample name. + * @return never {@code sampleName} + */ + public static SampleList singletonList(final String sampleName) { + if (sampleName == null) + throw new IllegalArgumentException("the sample name cannot be null"); + return new SampleList() { + + @Override + public int sampleCount() { + return 1; + } + + @Override + public int sampleIndex(final String sample) { + return sampleName.equals(sample) ? 0 : -1; + } + + @Override + public String sampleAt(int sampleIndex) { + if (sampleIndex == 0) + return sampleName; + throw new IllegalArgumentException("index is out of bounds"); + } + }; + } + + /** + * Simple list view of a sample-list. + */ + private static class AsList extends AbstractList { + + private final SampleList list; + + private AsList(final SampleList list) { + this.list = list; + + } + + @Override + public String get(int index) { + return list.sampleAt(index); + } + + @Override + public int size() { + return list.sampleCount(); + } + } + + /** + * Simple set view of a sample-list + */ + private static class AsSet extends AbstractSet { + + private final SampleList list; + + private AsSet(final SampleList list) { + this.list = list; + + } + + @Override + public Iterator iterator() { + return new Iterator() { + private int index = 0; + + @Override + public boolean hasNext() { + return index < list.sampleCount(); + } + + @Override + public String next() { + if (index >= list.sampleCount()) + throw new NoSuchElementException("iterating beyond sample list end"); + return list.sampleAt(index++); + } + + @Override + public void remove() { + throw new UnsupportedOperationException("unsupported operation exception"); + } + }; + } + + @Override + public int size() { + return list.sampleCount(); + } + + @Override + public boolean contains(final Object obj) { + if (obj == null) + return false; + else if (obj instanceof String) + return list.sampleIndex(((String)obj)) >= 0; + else + return false; + } + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java new file mode 100644 index 000000000..53945d949 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java @@ -0,0 +1,342 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.utils.collections; + +import it.unimi.dsi.fastutil.objects.Object2IntMap; +import it.unimi.dsi.fastutil.objects.Object2IntOpenHashMap; + +import java.util.*; + +/** +* Set set where each element can be reference by a unique integer index that runs from +* 0 to the size of the set - 1. +* +* @author Valentin Ruano-Rubio <valentin@broadinstitute.org> +*/ +public class IndexedSet extends AbstractSet implements Set { + + /** + * Elements stored in an array-list by their index. + */ + private final ArrayList elements; + + /** + * A unmodifiable view to the element list. Initially {@code null} it is thread-unsafe lazy instantiated + * when requested first time through {@link #asList}. Therefore typically it is shared by invoking code but + * there could be some extra copies (rare though) in multi-thread runs. + */ + private transient List unmodifiableElementsListView; + + /** + * Quick element to index lookup map. + *

+ * Uses a primitive int value map for efficiency sake. + *

+ */ + private final Object2IntMap indexByElement; + + /** + * Creates an empty indexed set indicating the expected number of elements. + * + * @param initialCapacity the initial number of elements. + */ + public IndexedSet(final int initialCapacity) { + elements = new ArrayList<>(initialCapacity); + indexByElement = new Object2IntOpenHashMap<>(initialCapacity); + } + + /** + * Creates a new sample list from a existing collection of elements. + * + *

+ * Elements will be indexed as they appear in the input array. Repeats will be ignored. + *

+ * + * @param values the original sample list. + * + * @throws IllegalArgumentException + * if {@code values} array is {@code null} itself, or it contains {@code null}. + */ + @SuppressWarnings("unchecked") + public IndexedSet(final Collection values) { + if (values == null) + throw new IllegalArgumentException("input values cannot be null"); + + final int initialCapacity = values.size(); + elements = new ArrayList<>(initialCapacity); + indexByElement = new Object2IntOpenHashMap<>(initialCapacity); + int nextIndex = 0; + for (final E value : values) { + if (value == null) + throw new IllegalArgumentException("null element not allowed: index == " + nextIndex); + if (indexByElement.containsKey(value)) + continue; + indexByElement.put(value, nextIndex++); + elements.add(value); + } + } + + /** + * Creates a new sample list from a existing array of elements. + * + *

+ * Elements will be indexed as they appear in the collection. Repeats will be ignored. + *

+ * + * @param values the original sample list. + * + * @throws IllegalArgumentException + * if {@code values} collection is {@code null} itself, or it contains {@code null}. + */ + @SuppressWarnings("unchecked") + public IndexedSet(final E ... values) { + if (values == null) + throw new IllegalArgumentException("input values cannot be null"); + + final int initialCapacity = values.length; + elements = new ArrayList<>(initialCapacity); + indexByElement = new Object2IntOpenHashMap<>(initialCapacity); + int nextIndex = 0; + for (final E value : values) { + if (value == null) + throw new IllegalArgumentException("null element not allowed: index == " + nextIndex); + if (indexByElement.containsKey(value)) + continue; + indexByElement.put(value, nextIndex++); + elements.add(value); + } + } + + /** + * Returns a list view of the elements in the set. + * + *

+ * Elements are sorted by their index within the set. + *

+ * + *

+ * This view changes as the indexed set changes but it cannot be used to update its contents. + * In such case a {@link UnsupportedOperationException} exception will be thrown if the calling + * code tries to tho just that. + *

+ * + * @return never {@code null}. + */ + public List asList() { + if (unmodifiableElementsListView == null) + unmodifiableElementsListView = Collections.unmodifiableList(elements); + return unmodifiableElementsListView; + } + + /** + * Throws an exception if an index is out of bounds. + * + *

+ * An element index is valid iff is within [0,{@link #size()}). + *

+ * + * @param index the query index. + * + * @throws IllegalArgumentException {@code index} is out of bounds. + */ + protected void checkIndex(final int index) { + if (index < 0) + throw new IllegalArgumentException("the index cannot be negative: " + index); + if (index >= size()) + throw new IllegalArgumentException("the index is equal or larger than the list length: " + index + " >= " + size()); + } + + @Override + public Iterator iterator() { + return asList().iterator(); + } + + /** + * Returns number of elements in the set. + * @return never {@code null}. + */ + @Override + public int size() { + return elements.size(); + } + + /** + * + * @param o + * @return {@code true} iff {@code o} is in + */ + @Override + @SuppressWarnings("all") + public boolean contains(final Object o) { + return o != null && indexByElement.containsKey(o); + } + + /** + * Adds a new element to the set. + * + *

+ * If the element was already in th set nothing will happen and the method will return {@code false}. However, + * if the element is new to this set, it will assigned the next index available (equal to the size before addition). + * The method will return {@code true} in this case. + *

+ * + * @param o the object to add. + * + * @throw IllegalArgumentException if {@code o} is {@code null}. + * + * @return {@code true} iff the set was modified by this operation. + */ + @Override + public boolean add(final E o) { + if (o == null) + throw new IllegalArgumentException("the input argument cannot be null"); + if (contains(o)) + return false; + final int nextIndex = size(); + elements.add(o); + indexByElement.put(o, nextIndex); + return true; + } + + /** + * Removes an element from the set. + * + *

+ * If the element was not present in the set, nothing happens and the method return false. However, + * if the element is new to this set, it will be assigned the next index available (equal to the size + * before addition). + * The method will return {@code true} in this case. + *

+ * + * @param o the object to add. + * + * @throw IllegalArgumentException if {@code o} is {@code null}. + * + * @return {@code true} iff the set was modified by this operation. + */ @Override + public boolean remove(final Object o) { + final int index = indexByElement.removeInt(o); + if (index == -1) + return false; + elements.remove(index); + indexByElement.remove(o); + final ListIterator it = elements.listIterator(index); + int nextIndex = index; + while (it.hasNext()) + indexByElement.put(it.next(),nextIndex++); + return true; + } + + /** + * Removes all elements in the set. + */ + @Override + public void clear() { + elements.clear(); + indexByElement.clear(); + } + + /** + * Compares this with another indexed set. + * @param o the other object to compare to. + * @return {@code false} unless {@code o} is a indexed-set that contains the same elements in the same order. + */ + @Override + public boolean equals(final Object o) { + if (o == this) + return true; + if (o == null) + return false; + if (!(o instanceof IndexedSet)) + return false; + + final IndexedSet other = (IndexedSet)o; + + return equals(other); + } + + /** + * Compare to another indexed set. + * + * @param other the target indexed set. + * + * @throws java.lang.IllegalArgumentException if {@code other} is {@code null}. + * + * @return {@code true} iff {@other} is not {@code null}, and contains exactly the same elements + * (as compared using {@link Object#equals} a this set with matching indices. + */ + public boolean equals(final IndexedSet other) { + if (other == null) + throw new IllegalArgumentException("other cannot be null"); + final ArrayList otherElements = other.elements; + + final int elementCount = elements.size(); + if (otherElements.size() != elementCount) + return false; + for (int i = 0; i < elementCount; i++) + if (!elements.get(i).equals(otherElements.get(i))) + return false; + return true; + } + + @Override + public int hashCode() { + int result = 1; + + for (final E element : elements) + result = 31 * result + (element == null ? 0 : element.hashCode()); + return result; + } + + /** + * Returns the element given its index within the set. + * @param index the target element's index. + * + * @throws IllegalArgumentException if {@code index} is not valid; in [0,{@link #size()}). + * + * @return never {@code null}; as null is not a valid element. + */ + public E get(final int index) { + checkIndex(index); + return elements.get(index); + } + + /** + * Returns the index of an object. + * @param o the object of interest. + * + * @throws IllegalArgumentException if {@code o} is {@code null}. + * + * @return {@code -1} if such an object is not an element of this set, otherwise is index in the set thus a + * values within [0,{@link #size()}). + */ + public int indexOf(final E o) { + if (o == null) + throw new IllegalArgumentException("the query object cannot be null"); + return indexByElement.containsKey(o) ? indexByElement.getInt(o) : -1; + } + +} diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java new file mode 100644 index 000000000..a2477d053 --- /dev/null +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java @@ -0,0 +1,35 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.utils.collections.Permutation; + +/** + * Marks allele list permutation implementation classes. + */ +public interface AlleleListPermutation
extends Permutation, AlleleList { +} diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/collections/Permutation.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/collections/Permutation.java new file mode 100644 index 000000000..35390b91f --- /dev/null +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/collections/Permutation.java @@ -0,0 +1,103 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.gatk.utils.collections; + +import java.util.List; + +/** + * Represent a permutation of a ordered set or list of elements. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public interface Permutation { + + /** + * Checks whether this permutation is a partial one of the original list. + * + *

+ * A partial permutation is one in that no all original elements take part of. + *

+ * + * @return {@code true} iff this is a partial permutation. + */ + public boolean isPartial(); + + /** + * Checks whether this is a trivial permutation where the resulting element list is the same as original. + * + * @return {@code true} iff the resulting element list is the same as the original. + */ + public boolean isNonPermuted(); + + /** + * Given an index on the original list, returns the position of tha element in the resulting list. + * + * @param fromIndex the query original element index. + * + * @throws IllegalArgumentException if {@code fromIndex} is not a valid index within the original list. + * + * @return -1 if that element is not part of the result (partial) permutation, otherwise some number between + * 0 and {@link #toSize()} - 1. + */ + public int toIndex(final int fromIndex); + + /** + * Given an index on the resulting list, it gives you the index of that element on the original list. + * @param toIndex the query resulting list index. + * + * @throws IllegalArgumentException if {@code toIndex} is not a valid index, i.e. in [0,{@link #toSize()}-1). + * + * @return a value between 0 and {@link #fromSize()} - 1. + */ + public int fromIndex(final int toIndex); + + /** + * Length of the original element list. + * + * @return 0 or greater. + */ + public int fromSize(); + + /** + * Length of the resulting element list. + * + * @return 0 or greater. + */ + public int toSize(); + + /** + * Returns an unmodifiable view to the original element list. + * @return never {@code null}. + */ + public List fromList(); + + /** + * Returns an unmodifiable view to the original element list. + * + * @return never {@code null}. + */ + public List toList(); +} From 242cd0e58f4deb40ddc0138a4302f43deb6eb27c Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Wed, 4 Jun 2014 01:36:52 -0400 Subject: [PATCH 2/7] Added genotype allele counts and likelihood calculator utilities for arbitrary ploidy and number of alleles --- .../gatk/genotyping/GenotypeAlleleCounts.java | 707 ++++++++++++++++++ .../GenotypeLikelihoodCalculator.java | 568 ++++++++++++++ .../GenotypeLikelihoodCalculators.java | 410 ++++++++++ .../gatk/utils/collections/IntMaxHeap.java | 230 ++++++ .../broadinstitute/gatk/utils/MathUtils.java | 26 + 5 files changed, 1941 insertions(+) create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IntMaxHeap.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java new file mode 100644 index 000000000..4f55b5785 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java @@ -0,0 +1,707 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import org.broadinstitute.gatk.utils.MathUtils; + +import java.util.Arrays; + +/** + * Collection of allele counts for a genotype. It encompasses what alleles are present in the genotype and in what number.

+ * + *

Alleles are represented herein by their indices running from 0 to N-1 where N is the number of alleles.

+ * + *

Each allele present in a genotype (count != 0) has a rank, that is the 0-based ordinal of + * that allele amongst the ones present in the genotype as sorted by their index.

+ * + *

For example:

+ * + *

0/0/2/2 has two alleles with indices 0 and 2, both with count 2. + * The rank of 0 is 0 whereas the rank of 2 is 1.

+ * + *

2/4/4/7 has three alleles with indices 2, 4 and 7. 2 and 7 have count 1 whereas 4 has count 2. + * The rank of 2 is 0, the rank of 4 is 1. and the rank of 7 is 2.

+ * + *

In contrast, in both examples above both 3 and 10 (and many others) are absent thus they have no rank (represented by -1 whenever applies).

+ * + *

{@link GenotypeAlleleCounts} instances have themselves their own index (returned by {@link #index() index()}, that indicate their 0-based ordinal within the possible genotype combinations with the same ploidy.

+ * + *

For example, for ploidy 3:

+ * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + * + *
IndexGenotype
00/0/0
10/0/1
20/1/1
31/1/1
40/0/2
60/1/2
71/1/2
80/2/2
91/2/2
102/2/2
110/0/3
120/1/3
131/1/3
140/2/3
151/2/3
162/2/3
170/3/3
......
+ * + * The total number of possible genotypes is only bounded by the maximum allele index. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypeAlleleCounts implements Comparable, Cloneable { + + private double log10CombinationCount; + + /** + * The ploidy of the genotype. + */ + private final int ploidy; + + /** + * Sorted array of integer pairs as described in {@link #GenotypeAlleleCounts(int, int, int...)}. + */ + private int[] sortedAlleleCounts; + + /** + * Number of different alleles in the genotype. + */ + private int distinctAlleleCount; + + /** + * Index of this genotype within genotypes of the same ploidy. + */ + private int index; + + /** + * Creates a new unphased genotype. + * + *

This method assumes that the invoker is passing a well formatted and sorted allele frequency array. + * Not checks are done for the sake of performance.

+ * + *

+ * The input argument {@code sortedAlleleCounts} list the index of alleles included in the unphased genotype + * and their frequency in the genotype in a single array using consecutive pairs:
+ * + *

 [allele_1,freq_1,allele_2,freq_2, ... , allele_i, freq_i, ... , allele_n, freq_n]
+ * + *
+ * No entry can have frequency == 0 (these must be omitted) and entries are sorted by allele index without + * any repetitions so that if i < j then allele_i < allele_j. + * + *

+ * + *

+ * The {@code ploidy} provided must be equal to the sum of all frequencies in {@code sortedAlleleCounts} + *

+ * @param ploidy the genotype ploidy. + * @param sortedAlleleCounts sorted allele counts following the restrictions above. + * @param index the genotype index. + */ + private GenotypeAlleleCounts(final int ploidy, final int index, final int... sortedAlleleCounts) { + this.ploidy = ploidy; + this.sortedAlleleCounts = sortedAlleleCounts; + distinctAlleleCount = sortedAlleleCounts.length >> 1; + log10CombinationCount = -1; + this.index = index; + } + + /** + * Returns the log10 of the number of possible allele combinations that would give raise to this allele count. + * @return 0 or less. + */ + public double log10CombinationCount() { + if (log10CombinationCount == -1) + return log10CombinationCount = calculateLog10CombinationCount(); + else + return log10CombinationCount; + } + + /** + * Calculates log10 combination count. + * + * @return 0 or less. + */ + private double calculateLog10CombinationCount() { + if (ploidy <= 1) + return 0; + else { + final int[] counts = new int[distinctAlleleCount]; + for (int i = 0, j = 1; i < distinctAlleleCount; i++, j+=2) + counts[i] = sortedAlleleCounts[j]; + return MathUtils.log10MultinomialCoefficient(ploidy, counts); + } + } + + /** + * Returns the genotype's ploidy. + * @return 0 or greater. + */ + public int ploidy() { + return ploidy; + } + + /** + * Increases the allele counts a number of times. + * + *

+ * This method must not be invoked on cached genotype-allele-counts that are meant to remain constant, + * such as the ones contained in {@link GenotypeLikelihoodCalculators#genotypeTableByPloidy}. + *

+ * + * @param times the number of times to increase. + * + * @throws IllegalArgumentException if {@code times} is negative. + */ + protected void increase(final int times) { + for (int i = 0; i < times; i++) + increase(); + } + + /** + * Updates the genotype counts to match the next genotype. + * + *

+ * This method must not be invoked on cached genotype-allele-counts that are meant to remain constant, + * such as the ones contained in {@link GenotypeLikelihoodCalculators#genotypeTableByPloidy} + *

+ */ + protected void increase() { + // if the ploidy is zero there is only one possible genotype. + if (distinctAlleleCount == 0) + return; + + // Worth make this case faster. + if (distinctAlleleCount == 1) { + if (ploidy == 1) { + sortedAlleleCounts[0]++; + } else { + if (sortedAlleleCounts.length < 4) + sortedAlleleCounts = Arrays.copyOf(sortedAlleleCounts,4); + sortedAlleleCounts[2] = sortedAlleleCounts[0] + 1; + sortedAlleleCounts[3] = 1; + sortedAlleleCounts[0] = 0; + sortedAlleleCounts[1] = ploidy - 1; + distinctAlleleCount = 2; + } + } else { + // Now, all the following ifs are just the way to avoid working with dynamically sizing List + // as the final size of the resulting new sorted-allele-counts array varies depending on the situation. + // this is considerably faster and the logic complexity would not be that different actually so it is worth + // the if indentations. + // + // Notice that at this point distinctAlleleCount >= 2 thus sortedAlleleCounts.length >= 4. + // + // We only need to look at the two lowest allele indices to decide what to do. + + final int allele0 = sortedAlleleCounts[0]; + final int freq0 = sortedAlleleCounts[1]; + final int allele1 = sortedAlleleCounts[2]; + final int allele0Plus1 = allele0 + 1; + final boolean allele0And1AreConsecutive = allele0Plus1 == allele1; + final int[] newSortedAlleleCounts; + // The rest of the sorted allele counts array contains junk + final int sortedAlleleCountsLength = distinctAlleleCount << 1; + + + if (freq0 == 1) { // in this case allele0 wont be present in the result and all is frequency should go to allele0 + 1. + if (allele0And1AreConsecutive) { // need just to remove the first allele and add 1 to the frequency of the second (freq1 += 1). + System.arraycopy(sortedAlleleCounts, 2, sortedAlleleCounts, 0, sortedAlleleCountsLength - 2); // shift left the first component away. + sortedAlleleCounts[1]++; // freq1 has become freq0. + distinctAlleleCount--; + } else // just need to mutate allele0 to allele0 + 1. + sortedAlleleCounts[0] = allele0Plus1; + } else { // && freq0 > 1 as per sortedAlleleCounts format restrictions. In this case allele0 will mutated to '0' with frequency decreased by 1. + if (allele0And1AreConsecutive) { // we don't need to add a component for allele0 + 1 since it already exists. + sortedAlleleCounts[0] = 0; + sortedAlleleCounts[1] = freq0 - 1; + sortedAlleleCounts[3]++; + } else { // we need to insert allele0 + 1 in the sorted-allele-counts array and give it frequency 1. + if (sortedAlleleCounts.length < sortedAlleleCountsLength + 2) // make room for the new component. + sortedAlleleCounts = Arrays.copyOf(sortedAlleleCounts,sortedAlleleCountsLength + 2); + System.arraycopy(sortedAlleleCounts, 2, sortedAlleleCounts, 4, sortedAlleleCountsLength - 2); + sortedAlleleCounts[0] = 0; + sortedAlleleCounts[1] = freq0 - 1; + sortedAlleleCounts[2] = allele0Plus1; + sortedAlleleCounts[3] = 1; + distinctAlleleCount++; + } + } + } + index++; + log10CombinationCount = -1; + } + + /** + * Calculates the next genotype in likelihood indexing order. + * @return never null. + */ + protected GenotypeAlleleCounts next() { + // if the ploidy is zero there is only one possible genotype. + if (distinctAlleleCount == 0) + return this; + + // Worth make this case faster. + if (distinctAlleleCount == 1) { + if (ploidy == 1) // A -> B , D -> E etc... + return new GenotypeAlleleCounts(1, index + 1, sortedAlleleCounts[0] + 1, 1); + else // AAAAA -> AAAAB, DDD -> AAE etc... + return new GenotypeAlleleCounts(ploidy, index + 1, 0, ploidy - 1, sortedAlleleCounts[0] + 1, 1); + } + // Now, all the following ifs are just the way to avoid working with dynamically sizing List + // as the final size of the resulting new sorted-allele-counts array varies depending on the situation. + // this is considerably faster and the logic complexity would not be that different actually so it is worth + // the if indentations. + // + // Notice that at this point distinctAlleleCount >= 2 thus sortedAlleleCounts.length >= 4. + // + // We only need to look at the two lowest allele indices to decide what to do. + + final int allele0 = sortedAlleleCounts[0]; + final int freq0 = sortedAlleleCounts[1]; + final int allele1 = sortedAlleleCounts[2]; + final int allele0Plus1 = allele0 + 1; + final boolean allele0And1AreConsecutive = allele0Plus1 == allele1; + final int[] newSortedAlleleCounts; + // The rest of the sorted allele counts array contains junk + final int sortedAlleleCountsLength = distinctAlleleCount << 1; + + if (freq0 == 1) { // in this case allele0 wont be present in the result and all is frequency should go to allele0 + 1. + if (allele0And1AreConsecutive) { // need just to remove the first allele and 1 to the frequency of the second (freq1 += 1). + newSortedAlleleCounts = Arrays.copyOfRange(sortedAlleleCounts,2,sortedAlleleCountsLength); + newSortedAlleleCounts[1]++; + } else { // just need to mutate allele0 to allele0 + 1. + newSortedAlleleCounts = Arrays.copyOf(sortedAlleleCounts,sortedAlleleCountsLength); + newSortedAlleleCounts[0] = allele0Plus1; + // newSortedAlleleCounts[1] = 1; // :) no need to do it because it is already the case (freq0 == 1). + } + } else { // && freq0 > 1 as per sortedAlleleCounts format restrictions. In this case allele0 will muttated to '0' with frequency decreased by 1. + if (allele0And1AreConsecutive) { // we don't need to add a component for allele0 + 1 since it already exists. + newSortedAlleleCounts = sortedAlleleCounts.clone(); + newSortedAlleleCounts[0] = 0; + newSortedAlleleCounts[1] = freq0 - 1; + newSortedAlleleCounts[3]++; + } else { // we need to insert allele0 + 1 in the sorted-allele-counts array. + newSortedAlleleCounts = new int[sortedAlleleCountsLength + 2]; + newSortedAlleleCounts[0] = 0; + newSortedAlleleCounts[1] = freq0 - 1; + newSortedAlleleCounts[2] = allele0Plus1; + newSortedAlleleCounts[3]++; // = 1 as the array was freshly created with 0s. + System.arraycopy(sortedAlleleCounts,2,newSortedAlleleCounts,4,sortedAlleleCountsLength - 2); + } + } + return new GenotypeAlleleCounts(ploidy, index + 1, newSortedAlleleCounts); + } + + /** + * Returns the number of different alleles that participate in the genotype. + * + * @return 0 or greater. + */ + public int distinctAlleleCount() { + return distinctAlleleCount; + } + + /** + * Returns the index of the allele from its rank in the genotype. + * + * @param rank the query rank. + * + * @throws IllegalArgumentException if the {@code rank} provided is outside the valid range [0,{@link #distinctAlleleCount()}). + * + * @return 0 or greater. + */ + public int alleleIndexAt(final int rank) { + if (rank < 0 || rank >= distinctAlleleCount) + throw new IllegalArgumentException("the requested rank " + rank + " is out of range [0," + distinctAlleleCount + ")"); + return sortedAlleleCounts[rank << 1]; + } + + /** + * Returns the rank of an allele in the genotype by its index. + * + * @param index the target index. + * + * @throws IllegalArgumentException if {@code index} is less that 0. Indices can be arbitrarily large. + * + * @return -1 or less if the allele index is not present in the genotype, 0 to {@link #distinctAlleleCount()} - 1 otherwise. + * If negative, the absolute value can be used to determine where would be that index inserted within {@code [0,{@link #distinctAlleleCount()}]} as + * {@code - result - 1}. + * + */ + public int alleleRankFor(final int index) { + if (index < 0) + throw new IllegalArgumentException("the index must be 0 or greater"); + return alleleIndexToRank(index, 0, distinctAlleleCount); + } + + /** + * Generates a string that would represent the unphased genotype with this allele counts. + * + *

+ * In this string allele calls appear in alleleIndex order with as many repeats as copies of each allele. So + * for example:
+ *

+     *         0         # haploid reference.
+     *         0/0       # typical diploid calls
+     *         0/1
+     *         1/1
+     *         0/0/1/3/3 # pentaploid with to ref, one first alt. and 2 third alt. allele
+     *     
+ * + *

+ * + * @return never {@code null}. + */ + public String toUnphasedGenotypeString() { + if (ploidy == 0) return ""; + final StringBuilder sb = new StringBuilder(distinctAlleleCount * 3); + for (int i = 0; i < distinctAlleleCount; i += 2) { + final int alleleIndex = sortedAlleleCounts[i]; + final int alleleCount = sortedAlleleCounts[i + 1]; + for (int j = 0; j < alleleCount; j++) + sb.append(alleleIndex).append('/'); + + } + sb.setLength(sb.length() - 1); + return sb.toString(); + } + + @Override + public String toString() { + // Perhaps we should change in the future, but the unphased genotype representation seems to be + // a good one. + return toUnphasedGenotypeString(); + } + + /** + * {@inheritDoc} + */ + @Override + public boolean equals(final Object o) { + if (o instanceof GenotypeAlleleCounts) + return equals((GenotypeAlleleCounts)o); + else + return false; + } + + /** + * Compares with another genotype. + * @param o the other genotype. + * @return never {@code null}. + */ + public boolean equals(final GenotypeAlleleCounts o) { + if (o == this) + return true; + if (o == null) + return false; + if (ploidy != o.ploidy) + return false; + return Arrays.equals(sortedAlleleCounts, o.sortedAlleleCounts); + } + + /** + * Returns the index of this genotype allele count within all possible genotypes with the same ploidy. + * + * @return 0 or greater. + */ + public int index() { + return index; + } + + /** + * Compares to genotypes. + * + *

A genotype with larger ploidy is considered greater than one with a lower ploidy. If both genotypes have + * the same ploidy, then the genotype with the largest allele index or largest count if these are the same

. + * + * @param other genotype to compare to. + * + * @throws IllegalArgumentException if {@code other} is {@code null}. + * + * @return 0 if both genotypes are equivalent, < 0 if this genotype is less than {@code other} and > 0 + * if this genotype is greater than {@code other}. + */ + @Override + public int compareTo(final GenotypeAlleleCounts other) { + if (other == this) + return 0; + if (other == null) + throw new IllegalArgumentException("input genotype cannot be null"); + if (other.ploidy == ploidy) + return index - other.index; + else + return ploidy - other.ploidy; + } + + @Override + public int hashCode() { + return ((31 + ploidy) * 31 ) + index; + } + + /** + * Implements binary search across allele indexes. + * @param index the target index. + * @param from first inclusive possible rank. + * @param to last exclusive possible rank. + * @return -1 or less if the allele index is not in the genotype false otherwise. You can obtain + * the potential insertion point (within the interval [from,to]) as {@code -result - 1} + */ + private int alleleIndexToRank(final int index,final int from, final int to) { + if (to <= from) + return - from - 1; + if (from == to - 1) { + final int onlyIndex = sortedAlleleCounts[from << 1]; + return onlyIndex == index ? from : (onlyIndex > index) ? -from - 1 : -to - 1; + } + + final int mid = (to + from) >> 1; + final int midIndex = sortedAlleleCounts[mid << 1]; + if (midIndex == index) + return mid; + else if (midIndex < index) + return alleleIndexToRank(index,mid + 1,to); + else + return alleleIndexToRank(index,0,mid); + } + + /** + * Returns the count of an allele in the genotype given is rank in the genotype (not the allele index itself). + * + * @param rank of the requested allele within the genotype. + * + * @throws IllegalArgumentException if {@code rank} is out the the valid range [0,{@link #distinctAlleleCount}) + * + * @return 1 or greater. + */ + public int alleleCountAt(final int rank) { + if (rank < 0 || rank >= distinctAlleleCount) + throw new IllegalArgumentException("the rank is out of range"); + return sortedAlleleCounts[(rank << 1) + 1]; + } + + /** + * Checks whether this genotype contain at least one call on a particular allele index. + * + * @param index the target allele. + * + * @throws IllegalArgumentException if {@code index} is negative. + * + * @return {@code true} iff the genotype contains that allele index. + */ + public boolean containsAllele(final int index) { + return alleleRankFor(index) >= 0; + } + + /** + * Returns the count of an allele in the genotype given it index. + * + * @return 0 if the allele is not present in the genotype, 1 or more otherwise. + */ + public int alleleCountFor(final int index) { + final int rank = alleleRankFor(index); + return rank < 0 ? 0 : alleleCountAt(rank); + } + + /** + * Returns the allele counts for each allele index to maximum. + * @param maximumAlleleIndex the maximum allele index required. + * @throws IllegalArgumentException if {@code maximumAlleleIndex} is less than 0. + * @return never {@code null}, an array of exactly {@code maximumAlleleIndex + 1} positions with the counts + * of each allele where the position in the array is equal to its index. + */ + public int[] alleleCountsByIndex(final int maximumAlleleIndex) { + if (maximumAlleleIndex < 0) + throw new IllegalArgumentException("the requested allele count cannot be less than 0"); + final int[] result = new int[maximumAlleleIndex + 1]; + copyAlleleCountsByIndex(result, 0, 0, maximumAlleleIndex); + return result; + } + + + private void copyAlleleCountsByIndex(final int[] dest, final int offset, final int minimumAlleleIndex, final int maximumAlleleIndex) { + + // First we determine what section of the sortedAlleleCounts array contains the counts of interest, + // By the present allele rank range of interest. + final int minimumAlleleRank = alleleRankFor(minimumAlleleIndex); + final int maximumAlleleRank = alleleRankFor(maximumAlleleIndex); + + // If the min or max allele index are absent (returned rank < 0) we note where the would be inserted; that + // way we avoid going through the rest of positions in the sortedAlleleCounts array. + // The range of interest is then [startRank,endRank]. + final int startRank = minimumAlleleRank < 0 ? - minimumAlleleRank - 1 : minimumAlleleRank; + final int endRank = maximumAlleleRank < 0 ? - maximumAlleleRank - 2 : maximumAlleleRank; + + // Iteration variables: + int nextIndex = minimumAlleleIndex; // next index that we want to output the count for. + int nextRank = startRank; // next rank to query in sortedAlleleCounts. + int nextSortedAlleleCountsOffset = nextRank << 1; // offset in sortedAlleleCounts where the info is present for the next rank. + int nextDestOffset = offset; // next offset in destination array where to set the count for the nextIndex. + + while (nextRank++ <= endRank) { + final int alleleIndex = sortedAlleleCounts[nextSortedAlleleCountsOffset++]; + // fill non-present allele counts with 0s. + while (alleleIndex > nextIndex) { + dest[nextDestOffset++] = 0; + nextIndex++; + } + // It is guaranteed that at this point alleleIndex == nextIndex + // thanks to the condition of the enclosing while: there must be at least one index of interest that + // it is present in remaning (nextRank,endRank] interval as otherwise endRank would be less than nextRank. + dest[nextDestOffset++] = sortedAlleleCounts[nextSortedAlleleCountsOffset++]; + nextIndex++; + } + // Finally we take care of trailing requested allele indices. + while (nextIndex++ <= maximumAlleleIndex) + dest[nextDestOffset++] = 0; + } + + /** + * Copies the sorted allele counts into an array. + * + *

+ * Sorted allele counts are disposed as an even-sized array where even positions indicate the allele index and + * the following odd positions the number of copies of that allele in this genotype allele count: + *

+ *

+     *     [ allele_0, freq_0, allele_1, freq_1 ... ]
+     * 

+ * + *

+ * With {@code offset} you can indicate an alternative first position in the destination array. + *

+ * + * @param dest where to copy the counts. + * @param offset starting position. + * + * @throws IllegalArgumentException if {@code dest} is {@code null}, {@code offset} is less than 0 + * or {@code dest} is not large enough considering the number of alleles present in this genotype + * allele counts and the {@code offset} provided. A total of + * {@link #distinctAlleleCount()} * 2 positions + * are required for the job. + */ + public void copyAlleleCounts(final int[] dest, final int offset) { + if (dest == null) + throw new IllegalArgumentException("the destination cannot be null"); + if (offset < 0) + throw new IllegalArgumentException("the offset cannot be negative"); + final int sortedAlleleCountsLength = distinctAlleleCount << 1; + if (offset + sortedAlleleCountsLength > dest.length) + throw new IllegalArgumentException("the input array does not have enough capacity"); + System.arraycopy(sortedAlleleCounts,0,dest,offset,sortedAlleleCountsLength); + } + + /** + * Instantiates the first genotype possible provided a total ploidy. + * @param ploidy the ploidy of the genotype. + * + * @throws java.lang.IllegalArgumentException if ploidy is less than 0. + * + * @return never {@code null}. + */ + protected static GenotypeAlleleCounts first(final int ploidy) { + if (ploidy < 0) + throw new IllegalArgumentException("the ploidy must be 0 or greater"); + else if (ploidy == 0) + return new GenotypeAlleleCounts(0,0); + else + return new GenotypeAlleleCounts(ploidy, 0, 0, ploidy); + } + + /** + * Makes the next genotype in likelihood indexing order. + * + * @param g the original genotype. + * + * @throws IllegalArgumentException if {@code g} is {@code null}. + * + * @return never {@code null}. + */ + public static GenotypeAlleleCounts makeNextGenotype(final GenotypeAlleleCounts g) { + if (g == null) + throw new IllegalArgumentException("the next genotype"); + return g.next(); + } + + /** + * Returns the largest allele index present in the genotype. + * + * @return -1 if there is no alleles (ploidy == 0), 0 or greater otherwise. + */ + public int maximumAlleleIndex() { + if (distinctAlleleCount == 0) + return -1; + else + return sortedAlleleCounts[(distinctAlleleCount - 1) << 1]; + } + + /** + * Returns the smallest allele index present in the genotype. + * + * @return -1 if there is no allele (ploidy == 0), 0 or greater otherwise. + */ + public int minimumAlleleIndex() { + if (distinctAlleleCount == 0) + return -1; + else + return sortedAlleleCounts[0]; + } + + /** + * Creates an independent copy of this genotype. + * @return never {@code null}. + */ + @Override + protected GenotypeAlleleCounts clone() { + return new GenotypeAlleleCounts(ploidy,index,Arrays.copyOf(sortedAlleleCounts,distinctAlleleCount << 1)); + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java new file mode 100644 index 000000000..ff824ac26 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java @@ -0,0 +1,568 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; +import org.broadinstitute.gatk.utils.MathUtils; +import org.broadinstitute.gatk.utils.collections.IntMaxHeap; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; + +/** + * Helper to calculate genotype likelihoods given a ploidy and an allele count (number of possible distinct alleles). + * + *

+ * Notice that for performance this class is thread-unsafe an so it cannot be shared between thread in a multi-thread run. + *

+ * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypeLikelihoodCalculator { + + /** + * Maximum number of components (or distinct alleles) for any genotype with this calculator ploidy and allele count. + */ + private int maximumDistinctAllelesInGenotype; + + /** + * Offset table for this calculator. + * + *

+ * This is a shallow copy of {@link GenotypeLikelihoodCalculators#alleleFirstGenotypeOffsetByPloidy} when the calculator was created + * thus it follows the same format as that array. Please refer to its documentation. + *

+ * + *

You can assume that this offset table contain at least (probably more) the numbers corresponding to the allele count and ploidy for this calculator. + * However since it might have more than that and so you must use {@link #alleleCount} and {@link #ploidy} when + * iterating through this array rather that its length or the length of its components.

. + */ + private final int[][] alleleFirstGenotypeOffsetByPloidy; + + /** + * Genotype table for this calculator. + * + *

It is ensure that it contains all the genotypes for this calculator ploidy and allele count, maybe more. For + * that reason you must use {@link #genotypeCount} when iterating through this array and not relay on its length.

+ */ + private final GenotypeAlleleCounts[] genotypeAlleleCounts; + + + /** + * Number of genotypes given this calculator {@link #ploidy} and {@link #alleleCount}. + */ + private final int genotypeCount; + + /** + * Number of genotyping alleles for this calculator. + */ + private final int alleleCount; + + /** + * Ploidy for this calculator. + */ + private final int ploidy; + + /** + * Max-heap for integers used for this calculator internally. + */ + private final IntMaxHeap alleleHeap; + + /** + * Cache of the last genotype-allele-count requested using {@link #genotypeAlleleCountsAt(int)}, when it + * goes beyond the maximum genotype-allele-count static capacity. Check on that method documentation for details. + */ + private transient GenotypeAlleleCounts lastOverheadCounts; + + /** + * Buffer used as a temporary container for likelihood components for genotypes stratified by alleles, allele frequency and reads. + * + *

To improve performance we use a 1-dimensional array to implement a 3-dimensional one as some of those dimension + * have typically very low depths (allele and allele frequency)

+ * + *

+ * The value contained in position [a][f][r] == log10Lk(read[r] | allele[a]) + log10(f) . Exception is + * for f == 0 whose value is undefined (in practice 0.0) and never used. + *

+ * + *

+ * It is indexed by read, then by allele and then by the number of copies of the allele. For the latter + * there are as many entries as the ploidy of the calculator + 1 (to accommodate zero copies although is + * never used in practice). + *

+ */ + private double[] readAlleleLikelihoodByAlleleCount = null; + + /** + * Buffer used as a temporary container for likelihood components for genotypes stratified by reads. + * + *

+ * It is indexed by genotype index and then by read index. The read capacity is increased as needed by calling + * {@link #ensureReadCapacity(int) ensureReadCapacity}. + *

+ */ + private final double[][] readLikelihoodsByGenotypeIndex; + + /** + * Indicates how many reads the calculator supports. + * + *

This figure is increased dynamically as per the + * calculation request calling {@link #ensureReadCapacity(int) ensureReadCapacity}.

+ */ + private int readCapacity = -1; + + /** + * Caches the log10 of the first few integers up to the ploidy supported by the calculator. + *

This is in fact a shallow copy if {@link GenotypeLikelihoodCalculators#ploidyLog10}

and is not meant to be modified by + * this class.

+ */ + private final double[] log10; + + /** + * Buffer field use as a temporal container for sorted allele counts when calculating the likelihood of a + * read in a genotype. + *

+ * This array follows the same format as {@link GenotypeAlleleCounts#sortedAlleleCounts}. Each component in the + * genotype takes up two positions in the array where the first indicate the allele index and the second its frequency in the + * genotype. Only non-zero frequency alleles are represented, taking up the first positions of the array. + *

+ * + *

+ * This array is sized so that it can accommodate the maximum possible number of distinct alleles in any + * genotype supported by the calculator, value stored in {@link #maximumDistinctAllelesInGenotype}. + *

+ */ + private final int[] genotypeAllelesAndCounts; + + /** + * Buffer field use as a temporal container for component likelihoods when calculating the likelihood of a + * read in a genotype. It is stratified by read and the allele component of the genotype likelihood... that is + * the part of the likelihood sum that correspond to a particular allele in the genotype. + * + *

+ * It is implemented in a 1-dimensional array since typically one of the dimensions is rather small. Its size + * is equal to {@link #readCapacity} times {@link #maximumDistinctAllelesInGenotype}. + *

+ * + *

+ * More concretely [r][i] == log10Lk(read[r] | allele[i]) + log(freq[i]) where allele[i] is the ith allele + * in the genotype of interest and freq[i] is the number of times it occurs in that genotype. + *

+ */ + private double[] readGenotypeLikelihoodComponents; + + /** + * Creates a new calculator providing its ploidy and number of genotyping alleles. + */ + protected GenotypeLikelihoodCalculator(final int ploidy, final int alleleCount, + final int[][] alleleFirstGenotypeOffsetByPloidy, + final GenotypeAlleleCounts[][] genotypeTableByPloidy, + final double[] ploidyLog10) { + this.alleleFirstGenotypeOffsetByPloidy = alleleFirstGenotypeOffsetByPloidy; + genotypeAlleleCounts = genotypeTableByPloidy[ploidy]; + this.alleleCount = alleleCount; + this.ploidy = ploidy; + genotypeCount = this.alleleFirstGenotypeOffsetByPloidy[ploidy][alleleCount]; + if (genotypeCount == GenotypeLikelihoodCalculators.GENOTYPE_COUNT_OVERFLOW) + throw new IllegalArgumentException( + String.format("the combination of ploidy (%s) and number of alleles (%s) results in a very large number of genotypes (> %s). You need to limit ploidy or the number of alternative alleles to analyze this locus", + ploidy,alleleCount,Integer.MAX_VALUE)); + alleleHeap = new IntMaxHeap(ploidy); + readLikelihoodsByGenotypeIndex = new double[genotypeCount][]; + log10 = ploidyLog10; + // The number of possible components is limited by distinct allele count and ploidy. + maximumDistinctAllelesInGenotype = Math.min(ploidy, alleleCount); + genotypeAllelesAndCounts = new int[maximumDistinctAllelesInGenotype << 1]; + } + + /** + * Makes sure that temporal arrays and matrices are prepared for a number of reads to process. + * @param requestedCapacity number of read that need to be processed. + */ + public void ensureReadCapacity(final int requestedCapacity) { + if (requestedCapacity < 0) + throw new IllegalArgumentException("illegal capacity value"); + if (readCapacity == -1) { // first time call. + final int minimumCapacity = Math.max(requestedCapacity,10); // Never go too small, 10 is the minimum. + readAlleleLikelihoodByAlleleCount = new double[minimumCapacity * alleleCount * (ploidy+1)]; + for (int i = 0; i < genotypeCount; i++) + readLikelihoodsByGenotypeIndex[i] = new double[minimumCapacity]; + readGenotypeLikelihoodComponents = new double[ploidy * minimumCapacity]; + readCapacity = minimumCapacity; + } else if (readCapacity < requestedCapacity) { + final int doubleCapacity = (requestedCapacity << 1); + readAlleleLikelihoodByAlleleCount = new double[doubleCapacity * alleleCount * (ploidy+1)]; + for (int i = 0; i < genotypeCount; i++) + readLikelihoodsByGenotypeIndex[i] = new double[doubleCapacity]; + readGenotypeLikelihoodComponents = new double[maximumDistinctAllelesInGenotype * doubleCapacity]; + readCapacity = doubleCapacity; + } + } + + /** + * Give a list of alleles, returns the likelihood array index. + * + *

This operation is thread-unsafe.

+ * + * @param alleleIndices the indices of the alleles in the genotype, there should be as many repetition of an + * index as copies of that allele in the genotype. Allele indices do not need to be sorted in + * any particular way. + * + * @return never {@code null}. + */ + public int allelesToIndex(final int... alleleIndices) { + // Special case ploidy == 0. + if (ploidy == 0) return 0; + + alleleHeap.clear(); + alleleHeap.add(alleleIndices); + return alleleHeapToIndex(); + } + + /** + * Returns the number of possible genotypes given ploidy and the maximum allele index. + * @return never {@code null}. + */ + public int genotypeCount() { + return genotypeCount; + } + + /** + * Returns the genotype associated to a particular likelihood index. + * + *

If {@code index} is larger than {@link GenotypeLikelihoodCalculators#MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY}, + * this method will reconstruct that genotype-allele-count iteratively from the largest strongly referenced count available. + * or the last requested index genotype. + *

+ * + *

Therefore if you are iterating through all genotype-allele-counts you should do sequentially and incrementally, to + * avoid a large efficiency drop

. + * + * @param index query likelihood-index. + * @return never {@code null}. + */ + public GenotypeAlleleCounts genotypeAlleleCountsAt(final int index) { + if (index < 0 || index >= genotypeCount) + throw new IllegalArgumentException("invalid likelihood index: " + index + " >= " + genotypeCount + + " (genotype count for nalleles = " + alleleCount + " and ploidy " + ploidy ); + if (index < GenotypeLikelihoodCalculators.MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY) + return genotypeAlleleCounts[index]; + else if (lastOverheadCounts == null || lastOverheadCounts.index() > index) { + final GenotypeAlleleCounts result = genotypeAlleleCounts[GenotypeLikelihoodCalculators.MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY - 1].clone(); + result.increase(index - GenotypeLikelihoodCalculators.MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY + 1); + lastOverheadCounts = result; + return result.clone(); + } else { + lastOverheadCounts.increase(index - lastOverheadCounts.index()); + return lastOverheadCounts.clone(); + } + } + + /** + * Calculate the likelihoods given the list of alleles and the likelihood map. + * + *

This operation is thread-unsafe.

+ * + * @param likelihoods the likelihood matrix all alleles vs all reads. + * + * @throws IllegalArgumentException if {@code alleleList} is {@code null} or {@code likelihoods} is {@code null} + * or the alleleList size does not match the allele-count of this calculator, or there are missing allele vs + * read combinations in {@code likelihoods}. + * + * @return never {@code null}. + */ + public
GenotypeLikelihoods genotypeLikelihoods(final ReadLikelihoods.Matrix likelihoods) { + if (likelihoods == null) + throw new IllegalArgumentException("the likelihood map cannot be null"); + + if (likelihoods.alleleCount() != alleleCount) + throw new IllegalArgumentException("mismatch between allele list and alleleCount"); + + + final int readCount = likelihoods.readCount(); + + + ensureReadCapacity(readCount); + + /// [x][y][z] = z * LnLk(Read_x | Allele_y) + final double[] readLikelihoodComponentsByAlleleCount + = readLikelihoodComponentsByAlleleCount(likelihoods); + final double[][] genotypeLikelihoodByRead = genotypeLikelihoodByRead(readLikelihoodComponentsByAlleleCount,readCount); + final double[] readLikelihoodsByGenotypeIndex = genotypeLikelihoods(genotypeLikelihoodByRead, readCount); + return GenotypeLikelihoods.fromLog10Likelihoods(readLikelihoodsByGenotypeIndex); + } + + /** + * Calculates the final genotype likelihood array out of the likelihoods for each genotype per read. + * + * @param readLikelihoodsByGenotypeIndex [g][r] likelihoods for each genotype g and r. + * @param readCount number of reads in the input likelihood arrays in {@code genotypeLikelihoodByRead}. + * @return never {@code null}, one position per genotype where the i entry is the likelihood of the ith + * genotype (0-based). + */ + private double[] genotypeLikelihoods(final double[][] readLikelihoodsByGenotypeIndex, final int readCount) { + final double[] result = new double[genotypeCount]; + final double denominator = readCount * log10[ploidy]; // instead of dividing each read likelihood by ploidy + // ( so subtract log10(ploidy) ) we multiply them all and the divide by ploidy^readCount (so substract readCount * log10(ploidy) ) + for (int g = 0; g < genotypeCount; g++) { + final double[] likelihoodsByRead = readLikelihoodsByGenotypeIndex[g]; + double s = - denominator; + for (int r = 0; r < readCount; r++) + s += likelihoodsByRead[r]; + result[g] = s; + } + return result; + } + + /** + * Calculates the likelihood component of each read on each genotype. + * + * @param readLikelihoodComponentsByAlleleCount [a][f][r] likelihood stratified by allele a, frequency in genotype f and + * read r. + * @param readCount number of reads in {@code readLikelihoodComponentsByAlleleCount}. + * @return never {@code null}. + */ + private double[][] genotypeLikelihoodByRead(final double[] readLikelihoodComponentsByAlleleCount, final int readCount) { + + // Here we don't use the convenience of {@link #genotypeAlleleCountsAt(int)} within the loop to spare instantiations of + // GenotypeAlleleCounts class when we are dealing with many genotypes. + GenotypeAlleleCounts alleleCounts = genotypeAlleleCounts[0]; + + for (int genotypeIndex = 0; genotypeIndex < genotypeCount; genotypeIndex++) { + final double[] readLikelihoods = this.readLikelihoodsByGenotypeIndex[genotypeIndex]; + final int componentCount = alleleCounts.distinctAlleleCount(); + switch (componentCount) { + case 1: // + singleComponentGenotypeLikelihoodByRead(alleleCounts, readLikelihoods, readLikelihoodComponentsByAlleleCount, readCount); + break; + case 2: + twoComponentGenotypeLikelihoodByRead(alleleCounts,readLikelihoods,readLikelihoodComponentsByAlleleCount, readCount); + break; + default: + manyComponentGenotypeLikelihoodByRead(alleleCounts,readLikelihoods,readLikelihoodComponentsByAlleleCount, readCount); + } + if (genotypeIndex < genotypeCount - 1) + alleleCounts = nextGenotypeAlleleCounts(alleleCounts); + } + return readLikelihoodsByGenotypeIndex; + } + + private GenotypeAlleleCounts nextGenotypeAlleleCounts(final GenotypeAlleleCounts alleleCounts) { + final int index = alleleCounts.index(); + final GenotypeAlleleCounts result; + final int cmp = index - GenotypeLikelihoodCalculators.MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY + 1; + if (cmp < 0) + result = genotypeAlleleCounts[index + 1]; + else if (cmp == 0) { + result = genotypeAlleleCounts[index].clone(); + result.increase(); + } else { + alleleCounts.increase(); + result = alleleCounts; + } + return result; + } + + /** + * General genotype likelihood component by thread calculator. It does not make any assumption in the exact + * number of alleles present in the genotype. + */ + private void manyComponentGenotypeLikelihoodByRead(final GenotypeAlleleCounts genotypeAlleleCounts, + final double[] likelihoodByRead, + final double[]readLikelihoodComponentsByAlleleCount, + final int readCount) { + + // First we collect the allele likelihood component for all reads and place it + // in readGenotypeLikelihoodComponents for the final calculation per read. + genotypeAlleleCounts.copyAlleleCounts(genotypeAllelesAndCounts,0); + final int componentCount = genotypeAlleleCounts.distinctAlleleCount(); + final int alleleDataSize = (ploidy + 1) * readCount; + for (int c = 0,cc = 0; c < componentCount; c++) { + final int alleleIndex = genotypeAllelesAndCounts[cc++]; + final int alleleCount = genotypeAllelesAndCounts[cc++]; + // alleleDataOffset will point to the index of the first read likelihood for that allele and allele count. + int alleleDataOffset = alleleDataSize * alleleIndex + alleleCount * readCount; + for (int r = 0, readDataOffset = c; r < readCount; r++, readDataOffset += maximumDistinctAllelesInGenotype) + readGenotypeLikelihoodComponents[readDataOffset] = readLikelihoodComponentsByAlleleCount[alleleDataOffset++]; + } + + // Calculate the likelihood per read. + for (int r = 0, readDataOffset = 0; r < readCount; r++, readDataOffset += maximumDistinctAllelesInGenotype) + likelihoodByRead[r] = MathUtils.approximateLog10SumLog10(readGenotypeLikelihoodComponents, readDataOffset, readDataOffset + componentCount); + } + + /** + * Calculates the likelihood component by read for a given genotype allele count assuming that there are + * exactly two alleles present in the genotype (with arbitrary non-zero counts each). + */ + private void twoComponentGenotypeLikelihoodByRead(final GenotypeAlleleCounts genotypeAlleleCounts, + final double[] likelihoodByRead, + final double[] readLikelihoodComponentsByAlleleCount, + final int readCount) { + final int allele0 = genotypeAlleleCounts.alleleIndexAt(0); + final int freq0 = genotypeAlleleCounts.alleleCountAt(0); + final int allele1 = genotypeAlleleCounts.alleleIndexAt(1); + final int freq1 = ploidy - freq0; // no need to get it from genotypeAlleleCounts. + int allele0LnLkOffset = readCount * ((ploidy + 1) * allele0 + freq0); + int allele1LnLkOffset = readCount * ((ploidy + 1) * allele1 + freq1); + for (int r = 0; r < readCount; r++) { + final double lnLk0 = readLikelihoodComponentsByAlleleCount[allele0LnLkOffset++]; + final double lnLk1 = readLikelihoodComponentsByAlleleCount[allele1LnLkOffset++]; + likelihoodByRead[r] = MathUtils.approximateLog10SumLog10(lnLk0,lnLk1); + } + } + + /** + * Calculates the likelihood component by read for a given genotype allele count assuming that there are + * exactly one allele present in the genotype. + */ + private void singleComponentGenotypeLikelihoodByRead(final GenotypeAlleleCounts genotypeAlleleCounts, + final double[] likelihoodByRead, final double[] readLikelihoodComponentsByAlleleCount, final int readCount) { + final int allele = genotypeAlleleCounts.alleleIndexAt(0); + // the count of the only component must be = ploidy. + int offset = (allele * (ploidy + 1) + ploidy) * readCount; + for (int r = 0; r < readCount; r++) + likelihoodByRead[r] = + readLikelihoodComponentsByAlleleCount[offset++]; + } + + /** + * Returns a 3rd matrix with the likelihood components. + * + *
+     *     result[y][z][x] :=  z * lnLk ( read_x | allele_y ).
+     * 
+ * + * @return never {@code null}. + */ + private
double[] readLikelihoodComponentsByAlleleCount(final ReadLikelihoods.Matrix likelihoods) { + final int readCount = likelihoods.readCount(); + final int alleleDataSize = readCount * (ploidy + 1); + + // frequency1Offset = readCount to skip the useless frequency == 0. So now we are at the start frequency == 1 + // frequency1Offset += alleleDataSize to skip to the next allele index data location (+ readCount) at each iteration. + for (int a = 0, frequency1Offset = readCount; a < alleleCount; a++, frequency1Offset += alleleDataSize) { + likelihoods.copyAlleleLikelihoods(a, readAlleleLikelihoodByAlleleCount, frequency1Offset); + + // p = 2 because the frequency == 1 we already have it. + for (int frequency = 2, destinationOffset = frequency1Offset + readCount; frequency <= ploidy; frequency++) { + final double log10frequency = log10[frequency]; + for (int r = 0, sourceOffset = frequency1Offset; r < readCount; r++) + readAlleleLikelihoodByAlleleCount[destinationOffset++] = + readAlleleLikelihoodByAlleleCount[sourceOffset++] + log10frequency; + } + } + return readAlleleLikelihoodByAlleleCount; + } + + /** + * Returns the ploidy for this genotype likelihood calculator. + * @return 0 or greater. + */ + public int ploidy() { + return ploidy; + } + + /** + * Returns the total number of alleles for this genotype calculator. + * @return the number of alleles considered by this calculator. + */ + public int alleleCount() { + return alleleCount; + } + + /** + * Returns the likelihood index given the allele counts. + * + * @param alleleCountArray the query allele counts. This must follow the format returned by + * {@link GenotypeAlleleCounts#copyAlleleCounts} with 0 offset. + * + * @throws IllegalArgumentException if {@code alleleCountArray} is not a valid {@code allele count array}: + * + * + * @return 0 or greater but less than {@link #genotypeCount}. + */ + public int alleleCountsToIndex(final int ... alleleCountArray) { + if (alleleCountArray == null) + throw new IllegalArgumentException("the allele counts cannot be null"); + if ((alleleCountArray.length & 1) != 0) + throw new IllegalArgumentException("the allele counts array cannot have odd length"); + alleleHeap.clear(); + for (int i = 0; i < alleleCountArray.length; i += 2) { + final int index = alleleCountArray[i]; + final int count = alleleCountArray[i+1]; + if (count < 0) + throw new IllegalArgumentException("no allele count can be less than 0"); + for (int j = 0; j < count; j++) + alleleHeap.add(index); + } + return alleleHeapToIndex(); + } + + /** + * Transforms the content of the heap into an index. + * @return a valid likelihood index. + */ + private int alleleHeapToIndex() { + if (alleleHeap.size() != ploidy) + throw new IllegalArgumentException("the sum of allele counts must be equal to the ploidy of the calculator"); + if (alleleHeap.peek() >= alleleCount) + throw new IllegalArgumentException("invalid allele " + alleleHeap.peek() + " more than the maximum " + (alleleCount - 1)); + int result = 0; + for (int p = ploidy; p > 0; p--) { + final int allele = alleleHeap.remove(); + if (allele < 0) + throw new IllegalArgumentException("invalid allele " + allele + " must be equal or greater than 0 "); + result += alleleFirstGenotypeOffsetByPloidy[p][allele]; + } + return result; + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java new file mode 100644 index 000000000..4bd5bbaf0 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java @@ -0,0 +1,410 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import java.util.Arrays; + +/** + * Genotype likelihood calculator utility. + * + *

+ * This class provide genotype likelihood calculators with any number of alleles able given an arbitrary ploidy and allele + * count (number of distinct alleles). + *

+ * + *

+ * This class is thread-safe. + *

+ * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypeLikelihoodCalculators { + + /** + * Maximum possible number of genotypes that this calculator can handle. + */ + public static final int MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY = 1000; + + /** + * Mark to indicate genotype-count overflow due to a large number of allele and ploidy; + */ + protected static final int GENOTYPE_COUNT_OVERFLOW = -1; + + /** + * The current maximum allele index supported by the tables. + *

+ * Its initial value indicates the initial capacity of the shared {@link #alleleFirstGenotypeOffsetByPloidy} table. + * Feel free to change it to anything reasonable that is non-negative. + *

+ */ + private static int maximumAllele = 1; // its initial value is the initial capacity of the shared tables. + + /** + * The current maximum ploidy supported by the tables. + *

+ * Its initial value indicates the initial capacity of the shared {@link #genotypeTableByPloidy}. Feel free + * to change it to anything reasonable that is non-negative. + *

+ */ + private static int maximumPloidy = 2; // its initial value is the initial capacity of the shared tables. + + /** + * Shared copy of the offset table as described in {@link #buildGenotypeAlleleCountsTable(int, int, int[][])}. + * + * This reference holds the largest requested so far in terms of maximum-allele and maximum-ploidy. + */ + private volatile static int[][] alleleFirstGenotypeOffsetByPloidy = + buildAlleleFirstGenotypeOffsetTable(maximumPloidy, maximumAllele); + + + /** + * Shared table of genotypes give the ploidy sorted by their index in the likelihood array. + * + *

+ * Its format is described in {@link #buildGenotypeAlleleCountsTable(int, int, int[][])}. + *

+ */ + private volatile static GenotypeAlleleCounts[][] genotypeTableByPloidy = + buildGenotypeAlleleCountsTable(maximumPloidy,maximumAllele,alleleFirstGenotypeOffsetByPloidy); + + + + /** + * Build the table with the genotype offsets based on ploidy and the maximum allele index with representation + * in the genotype. + *

+ * The result is a matrix containing the offset of the first genotype that contain a particular allele + * stratified by ploidy. + *

+ * Row (first dimension) represent the ploidy, whereas + * the second dimension represents the allele. + *

+ * + *

+ * Thus the value a position [p][a] indicates how many genotypes of ploidy p there are before the first + * one that contains allele a.
+ * + * For example, considering ploidy 3 and alleles A, B, C, D, etc ... (indexed 0, 1, 2, ... respectively): + *
+ * [3][A] == [3][0] == 0 as the first genotype AAA contains A. + *
+ * [3][C] == [3][2] == 4 as the first genotype that contains C, AAC follows: AAA AAB ABB BBB + *
+ * [4][D] == [4][3] == 14 as the first genotype that contains D, AAAD follows: AAAA AAAB AABB ABBB BBBB AAAC + * AABC ABBC BBBC AACC ABCC BBCC ACCC BCCC CCCC. + * + *

+ * + *

+ * This value are calculated recursively as follows: + *

+ *
+     *
+     *     Offset[p][a] := Offset[p-1][a] + Offset[p][a-1] when a > 0, p > 0
+     *                     0                               when a == 0
+     *                     1                               otherwise
+     *
+     *
+     *         0 1 1  1  1  1   1 ...
+     *         0 1 2  3  4  5   6 ...
+     *         0 1 3  6 10 15  21 ...
+     *         0 1 4 10 20 35  56 ...
+     *         0 1 5 15 35 70 126 ...
+     *         0 ..................
+     * 
+ * + *

+ * Note: if someone can come with a close form computable 0(1) (respect to ploidy and allele count) + * please let the author know. + *

+ * + *

+ * The matrix is guaranteed to have as many rows as indicated by {@code maximumPloidy} + 1; the first + * row refers to the special case of ploidy == 0, the second row to ploidy 1 and so forth. Thus the ploidy + * matches the index. + *

+ *

+ * The matrix is guaranteed to have as many columns as indicate by {@code maximumAllele} + 1. In this case however + * the first allele index 0 is a sense allele (typically the reference allele). The reason to have at least the total + * genotype count up to allele count {@link @alleleCapacity} that is equal to the offset of the first genotype + * of the following allele; thus we need an extra one. + *

+ * + *

+ * Although it might seem non-sense to have genotypes of ploidy 0. The values in the first row are used when + * filling up values in row 1 and so forth so it is present for programmatic convenience. + * Offsets in this row are 0 for the first column and 1 for any others. + *

+ * + * @param maximumPloidy maximum supported ploidy. + * @param maximumAllele maximum supported allele index. + * + * @throws IllegalArgumentException if {@code maximumPloidy} or {@code maximumAllele} is negative. + * + * @return never {@code null}, the matrix described with enough information to address + * problems concerning up to the requested maximum allele index and ploidy. + */ + private static int[][] buildAlleleFirstGenotypeOffsetTable(final int maximumPloidy, final int maximumAllele) { + checkPloidyAndMaximumAllele(maximumPloidy, maximumAllele); + final int rowCount = maximumPloidy + 1; + final int colCount = maximumAllele + 1; + final int[][] result = new int[rowCount][colCount]; + + // Ploidy 0 array must be { 0, 1, 1, ...., 1} + Arrays.fill(result[0],1,colCount,1); + // Now we take care of the rest of ploidies. + // We leave the first allele offset to it correct value 0 by starting with allele := 1. + for (int ploidy = 1; ploidy < rowCount; ploidy++) + for (int allele = 1; allele < colCount; allele++) { + result[ploidy][allele] = result[ploidy][allele - 1] + result[ploidy - 1][allele]; + if (result[ploidy][allele] < result[ploidy][allele - 1]) + result[ploidy][allele] = GENOTYPE_COUNT_OVERFLOW; + } + return result; + } + + /** + * Composes a table with the lists of all possible genotype allele counts given the the ploidy and maximum allele index. + *

+ * The resulting matrix has at least as many rows as {@code maximumPloidy } + 1 as the first row with index 0 correspond + * to ploidy == 0. Each row array has as many positions as necessary to contain all possible genotype-allele-counts in increasing order. + * This quantity varies with the ploidy. + *

+ * + *

+ * Therefore result[3][4] would contain the 5th genotype with ploidy 3, and result[4].length + * would be equal to the count of possible genotypes for ploidy 4. + *

+ * + * @param maximumPloidy maximum ploidy to use in queries to the resulting table. + * @param maximumAllele maximum allele index to use in queries to the resulting table. + * @param offsetTable an allele first genotype offset table as constructed using {@link #buildAlleleFirstGenotypeOffsetTable(int, int)} + * that supports at least up to {@code maximumAllele} and {@code maximumPloidy}. + * + * @throws IllegalArgumentException if {@code maximumPloidy} or {@code maximumAllele} is negative, or {@code offsetTable} is {@code null}, + * or it does not have the capacity to handle the requested maximum ploidy or allele index. + * + * @return never {@code null}. + */ + private static GenotypeAlleleCounts[][] buildGenotypeAlleleCountsTable(final int maximumPloidy, final int maximumAllele, final int[][] offsetTable) { + checkPloidyAndMaximumAllele(maximumPloidy, maximumAllele); + checkOffsetTableCapacity(offsetTable,maximumPloidy,maximumAllele); + final int rowCount = maximumPloidy + 1; + final GenotypeAlleleCounts[][] result = new GenotypeAlleleCounts[rowCount][]; // each row has a different number of columns. + + for (int ploidy = 0; ploidy <= maximumPloidy; ploidy++) + result[ploidy] = buildGenotypeAlleleCountsArray(ploidy, maximumAllele, offsetTable); + + return result; + } + + /** + * Builds a genotype-allele-counts array given the genotype ploidy and how many genotype you need. + *

+ * The result is guarantee to have exactly {@code length} positions and the elements are sorted + * in agreement with the standard way to display genotypes following the VCF standard. + *

+ * + *

Notice that is possible to request ploidy ==0. In that case the resulting array will have repetitions + * of the empty genotype allele count. + *

+ * + *

+ * For example, + * + *

+     *         ploidy = 1, length = 5 : [ {A}, {B}, {C}, {D}, {E} ]
+     *         ploidy = 2, length = 7 : [ {AA}, {AB}, {BB}, {AC}, {BC}, {CC}, {AD}
+     *         ploidy = 3, length = 10 : [ {AAA}, {AAB}, {ABB}, {BBB}, {AAC}, {ABC}, {BBC}, {BCC}, {CCC}, {AAD} ]
+     *     
+ *

+ * + * @param ploidy requested ploidy. + * @param alleleCount number of different alleles that the genotype table must support. + * @param genotypeOffsetTable table with the offset of the first genotype that contain an allele given + * the ploidy and its index. + * + * @throws IllegalArgumentException if {@code ploidy} or {@code length} is negative. + * + * @return never {@code null}, follows the specification above. + */ + private static GenotypeAlleleCounts[] buildGenotypeAlleleCountsArray(final int ploidy, final int alleleCount, final int[][] genotypeOffsetTable) { + if (ploidy < 0) + throw new IllegalArgumentException("the requested ploidy cannot be negative: " + ploidy); + if (alleleCount < 0) + throw new IllegalArgumentException("the requested maximum allele cannot be negative: " + alleleCount); + final int length = genotypeOffsetTable[ploidy][alleleCount]; + final int strongRefLength = length == GENOTYPE_COUNT_OVERFLOW ? MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY : Math.min(length, MAXIMUM_STRONG_REF_GENOTYPE_PER_PLOIDY); + final GenotypeAlleleCounts[] result = new GenotypeAlleleCounts[strongRefLength]; + result[0] = GenotypeAlleleCounts.first(ploidy); + for (int genotypeIndex = 1; genotypeIndex < strongRefLength; genotypeIndex++) + result[genotypeIndex] = result[genotypeIndex-1].next(); + return result; + } + + /** + * Cached log10 values for the first integer up to the maximum ploidy requested thus far. + */ + private volatile static double[] ploidyLog10; + + // Initialize {@link #ploidyLog10}. + static { + ploidyLog10 = new double[maximumPloidy + 1]; + for (int i = 0; i <= maximumPloidy; i++) + ploidyLog10[i] = Math.log10(i); + } + + /** + * Returns an instance given its ploidy and the number of alleles. + * + * @param alleleCount the required allele-count. + * @param ploidy the required ploidy-count. + * + * @throws IllegalArgumentException if either {@code ploidy} or {@code alleleCount} is {@code null}, or + * the resulting number of genotypes is too large. + * + * @return never {@code null}. + */ + public static GenotypeLikelihoodCalculator getInstance(final int ploidy, + final int alleleCount) { + checkPloidyAndMaximumAllele(ploidy, alleleCount); + if (alleleCount < 0) + throw new IllegalArgumentException("the allele count cannot be negative"); + if (ploidy < 0) + throw new IllegalArgumentException("the ploidy count cannot be negative"); + + // Non-thread safe (fast) check on tables capacities, + // if not enough capacity we expand the tables in a thread-safe manner: + if (alleleCount > maximumAllele || ploidy > maximumPloidy) + ensureCapacity(alleleCount, ploidy); + + // At this point the tables must have at least the requested capacity, likely to be much more. + return new GenotypeLikelihoodCalculator(ploidy,alleleCount,alleleFirstGenotypeOffsetByPloidy,genotypeTableByPloidy,ploidyLog10); + } + + /** + * Thread safe update of shared tables + * + * @param requestedMaximumAllele the new requested maximum allele maximum. + * @param requestedMaximumPloidy the new requested ploidy maximum. + */ + private synchronized static void ensureCapacity(final int requestedMaximumAllele, final int requestedMaximumPloidy) { + + final boolean needsToExpandAlleleCapacity = requestedMaximumAllele > maximumAllele; + final boolean needsToExpandPloidyCapacity = requestedMaximumPloidy > maximumPloidy; + + // Double check with the lock on to avoid double work. + if (!needsToExpandAlleleCapacity && !needsToExpandPloidyCapacity) + return; + + final int newMaximumPloidy = Math.max(maximumPloidy,requestedMaximumPloidy); + final int newMaximumAllele = Math.max(maximumAllele,requestedMaximumAllele); + + // Update tables first. + alleleFirstGenotypeOffsetByPloidy = buildAlleleFirstGenotypeOffsetTable(newMaximumPloidy,newMaximumAllele); + genotypeTableByPloidy = buildGenotypeAlleleCountsTable(newMaximumPloidy,newMaximumAllele,alleleFirstGenotypeOffsetByPloidy); + + if (needsToExpandPloidyCapacity) + ploidyLog10 = ploidyLog10Extension(newMaximumPloidy); + + // Since tables are volatile fields, it is guaranteed that tables changes will be seen before + // than any change on ploidyCapacity and alleleCapacity ensuring that the non-thread safe + // capacity verification test in {@link #getInstance} wont ever allow a thread + // to proceed to use a table without the required capacity. + // Just after updating tables update the capacity fields: + + if (needsToExpandAlleleCapacity) + maximumAllele = requestedMaximumAllele; + if (needsToExpandPloidyCapacity) + maximumPloidy = requestedMaximumPloidy; + } + + /** + * Extends the existing {@link #ploidyLog10} with more log10 as needed by maximum-ploidy expansion. + * @param newMaximumPloidy the new maximum ploidy. + * + * @return never code {@code null}. + */ + private static double[] ploidyLog10Extension(final int newMaximumPloidy) { + final int start = ploidyLog10.length; + final double[] result = Arrays.copyOf(ploidyLog10,newMaximumPloidy + 1); + for (int i = start; i < result.length; i++) + result[i] = Math.log10(i); + return result; + } + + /** + * Perform value checks on maximumPloidy and allele passed to diverse methods in this class. + *

+ * Throws an exception if there is any issues. + *

+ * + * @param ploidy the maximum ploidy value. + * @param maximumAllele the maximum allele value. + * + * @throws IllegalArgumentException if either value is negative. + */ + private static void checkPloidyAndMaximumAllele(final int ploidy, final int maximumAllele) { + if (ploidy < 0) + throw new IllegalArgumentException("the ploidy provided cannot be negative: " + ploidy); + if (maximumAllele < 0) + throw new IllegalArgumentException("the maximum allele index provided cannot be negative: " + maximumAllele); + } + + private static void checkOffsetTableCapacity(final int[][] offsetTable, final int maximumPloidy, final int maximumAllele) { + if (offsetTable == null) + throw new IllegalArgumentException("the allele first genotype offset table provided cannot be null"); + if (offsetTable.length <= maximumPloidy ) + throw new IllegalArgumentException("the allele first genotype offset table provided does not have enough " + + "capacity for requested maximum ploidy: " + maximumPloidy); + if (offsetTable[0].length < maximumAllele) + throw new IllegalArgumentException("the allele first genotype offset table provided does not have enough " + + "capacity for requested maximum allele index: " + maximumAllele); + } + + +} \ No newline at end of file diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IntMaxHeap.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IntMaxHeap.java new file mode 100644 index 000000000..760052b8c --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IntMaxHeap.java @@ -0,0 +1,230 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.utils.collections; + +import java.util.Arrays; + +/** + * Simple integer heap with quick look-up of the minimum value. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IntMaxHeap { + + private int size; + + private int[] values; + + /** + * Creates a new empty heap indicating its initial capacity. + * @param initialCapacity number of elements you expect to have at most in the heap. + * + * @throws IllegalArgumentException if {@code initialCapacity} is negative. + */ + public IntMaxHeap(final int initialCapacity) { + if (initialCapacity < 0) + throw new IllegalArgumentException(); + // We force it to have at least length 1 so that the capacity expansion works when adding; + // it doubles current length and twice 0 = 0. + values = new int[initialCapacity == 0 ? 1 : initialCapacity]; + } + + /** + * Adds a new element to the heap. + * + *

The heap with grow if it runs out of capacity to hold the new element

+ * + * @param v the new element. + */ + public void add(final int v) { + // Double capacity if overflow: + ensureCapacity(size + 1); + addWithoutCheckingCapacity(v); + } + + /** + * Implements the heap addition floating up the value. + * @param v the value to add. + */ + private void addWithoutCheckingCapacity(final int v) { + int p; + values[p = size++] = v; + + // Float up the recently added element: + while (p > 0) { + final int q = (p - 1) >> 1; // parent index. + final int u = values[q]; // parent value. + + //Finish check and update: + if (u >= v) + break; + values[p] = u; + values[q] = v; + p = q; + } + } + + /** + * Add several integers into the heap. + * @param v values to add. + */ + public void add(final int ... v) { + if (v == null) + throw new IllegalArgumentException("the input array cannot be null"); + ensureCapacity(v.length + size); + for (int i : v) + addWithoutCheckingCapacity(i); + } + + private void ensureCapacity(final int newSize) { + if (newSize > values.length) + values = Arrays.copyOf(values,Math.max(newSize,10 + values.length << 1)); + } + + /** + * Returns the current minimum element. + * + * @throws IllegalStateException if the heap is empty. + * + * @return the minimum element in the heap. + */ + public int peek() { + if (size == 0) + throw new IllegalStateException("the heap is empty"); + return values[0]; + } + + /** + * Returns the minimum element of the heap and removes it. + * + * @throws IllegalStateException if the heap is empty. + * + * @return the minimum element in the heap before removing it. + */ + public int remove() { + if (size == 0) + throw new IllegalArgumentException("the heap is empty"); + final int result = values[0]; + removeUpdate(); + return result; + } + + /** + * Updates the heap after a removal, sinking the last element from the top-down. + */ + private void removeUpdate() { + // if the remove make the heap to be empty there is nothing to do. + if (--size == 0) + return; + + final int v = values[size]; // the last value. + + int p; + values[p = 0] = v; + + // limit := first index in the heap that does not have any descendants within the heap. + final int limit = (size >> 1); + + // Sorry! for the big loop but doesn't seem to be any other *practical* option that would reduce its size. + while (p < limit) { + + // Initialize variables: + final int r = (p + 1) << 1; // left descendant index. + final int l = r - 1; // right descendant index (no guarantee to be in the heap). + int u = v; // will contain min(v,values[l],values[r]). + int q = p; // wilL contain argmin_x(values[x], x in {p,l,r}). + + // Check left descendant: + int lv = values[l]; // left descendant value. + if (lv > u) { // is the left descendant'v value more than v. + u = lv; + q = l; + } + + // Check right descendant: + if (r < size) { // make sure that r is within the heap. + int rv = values[r]; + if (rv > u) { // is the right descendant's value less than v or left's + u = rv; + q = r; + } + } + + // Finish check and update: + if (p == q) // q == p if neither left or right descendants are less than v. + break; + + values[p] = u; + values[q] = v; + p = q; + } + } + + /** + * Checks whether the heap is empty. + * + * @return {@code true} iff the heap is empty. + */ + public boolean isEmpty() { + return size == 0; + } + + /** + * Returns the current size of the heap. + * + * @return 0 or greater. + */ + public int size() { + return size; + } + + /** + * Removes all elements from the heap. + */ + public void clear() { + size = 0; + } +} diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/MathUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/MathUtils.java index 56d19c64a..4e47da387 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/MathUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/MathUtils.java @@ -151,6 +151,32 @@ public class MathUtils { return approximateLog10SumLog10(vals, vals.length); } + /** + * Calculate the approximate log10 sum of an array range. + * @param vals the input values. + * @param fromIndex the first inclusive index in the input array. + * @param toIndex index following the last element to sum in the input array (exclusive). + * @return the approximate sum. + * @throws IllegalArgumentException if {@code vals} is {@code null} or {@code fromIndex} is out of bounds + * or if {@code toIndex} is larger than + * the length of the input array or {@code fromIndex} is larger than {@code toIndex}. + */ + public static double approximateLog10SumLog10(final double[] vals, final int fromIndex, final int toIndex) { + if (fromIndex == toIndex) return Double.NEGATIVE_INFINITY; + final int maxElementIndex = MathUtils.maxElementIndex(vals,fromIndex,toIndex); + double approxSum = vals[maxElementIndex]; + + for (int i = fromIndex; i < toIndex; i++) { + final double val; + if (i == maxElementIndex || (val = vals[i]) == Double.NEGATIVE_INFINITY) + continue; + final double diff = approxSum - val; + if (diff < JacobianLogTable.MAX_TOLERANCE) + approxSum += JacobianLogTable.get(diff); + } + return approxSum; + } + public static double approximateLog10SumLog10(final double[] vals, final int endIndex) { final int maxElementIndex = MathUtils.maxElementIndex(vals, endIndex); From 4f993e8dbef64036269a05d0de3a8199d4b50c79 Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Tue, 12 Aug 2014 18:04:43 -0400 Subject: [PATCH 3/7] Added read-likelihoods array base structure to substitute existing Map-of-Map-of-Maps. --- .../gatk/genotyping/AlleleList.java | 0 .../gatk/genotyping/AlleleListUtils.java | 0 .../gatk/genotyping/IndexedAlleleList.java | 0 .../gatk/genotyping/IndexedSampleList.java | 0 .../gatk/genotyping/SampleList.java | 0 .../gatk/genotyping/SampleListUtils.java | 0 .../gatk/utils/collections/IndexedSet.java | 0 .../gatk/utils/genotyper/ReadLikelihoods.java | 633 +++++++++--------- 8 files changed, 331 insertions(+), 302 deletions(-) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java (100%) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java (100%) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java (100%) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java (100%) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java (100%) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java (100%) rename {protected/gatk-tools-protected => public/gatk-tools-public}/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java (100%) diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java similarity index 100% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/collections/IndexedSet.java diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java index bf12d3a33..8deb30f49 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java @@ -1,6 +1,6 @@ /* * Copyright (c) 2012 The Broad Institute -* +* * Permission is hereby granted, free of charge, to any person * obtaining a copy of this software and associated documentation * files (the "Software"), to deal in the Software without @@ -9,10 +9,10 @@ * copies of the Software, and to permit persons to whom the * Software is furnished to do so, subject to the following * conditions: -* +* * The above copyright notice and this permission notice shall be * included in all copies or substantial portions of the Software. -* +* * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND @@ -30,6 +30,7 @@ import it.unimi.dsi.fastutil.ints.IntArrayList; import it.unimi.dsi.fastutil.objects.Object2IntMap; import it.unimi.dsi.fastutil.objects.Object2IntOpenHashMap; import org.broadinstitute.gatk.engine.downsampling.AlleleBiasedDownsamplingUtils; +import org.broadinstitute.gatk.genotyping.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.Utils; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; @@ -42,7 +43,7 @@ import java.util.*; * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ -public class ReadLikelihoods
implements Cloneable { +public class ReadLikelihoods implements SampleList, AlleleList, Cloneable { /** * Reads by sample index. Each sub array contains reference to the reads of the ith sample. @@ -58,44 +59,37 @@ public class ReadLikelihoods implements Cloneable { private double[][][] valuesBySampleIndex; /** - * Sorted list samples. + * Sample list */ - private final String[] samples; + private final SampleList samples; /** - * Unmodifiable list version of the samples + * Allele list */ - private List sampleList; + private AlleleList alleles; /** - * Unmodifiable list version of the alleles + * Cached allele list. */ private List alleleList; /** - * Sorted array of alleles. + * Cached sample list. */ - private A[] alleles; - - /** - * Maps from sample name to its index. - */ - private final Object2IntMap sampleIndex; - - /** - * Maps from allele to its index. - */ - private final Object2IntMap alleleIndex; + private List sampleList; /** * Maps from each read to its index within the sample. + * + *

In order to save CPU time the indices contained in this array (not the array itself) is + * lazily initialized by invoking {@link #readIndexBySampleIndex(int)}.

*/ private final Object2IntMap[] readIndexBySampleIndex; /** - * Index of the reference allele if any, otherwise -1. + * Index of the reference allele if any, otherwise -1 */ - private int referenceAlleleIndex; + private int referenceAlleleIndex = -1; /** * Caches the read-list per sample list returned by {@link #sampleReads} @@ -103,7 +97,7 @@ public class ReadLikelihoods
implements Cloneable { private final List[] readListBySampleIndex; /** - * Sample matrices. + * Sample matrices lazily initialized (the elements not the array) by invoking {@link #sampleMatrix(int)}. */ private final Matrix[] sampleMatrices; @@ -124,7 +118,7 @@ public class ReadLikelihoods implements Cloneable { * or if they contain null values. */ @SuppressWarnings("unchecked") - public ReadLikelihoods(final List samples, final List alleles, + public ReadLikelihoods(final SampleList samples, final AlleleList alleles, final Map> reads) { if (alleles == null) throw new IllegalArgumentException("allele list cannot be null"); @@ -133,17 +127,17 @@ public class ReadLikelihoods implements Cloneable { if (reads == null) throw new IllegalArgumentException("read map cannot be null"); - final int sampleCount = samples.size(); - final int alleleCount = alleles.size(); - this.alleles = alleles.toArray((A[]) new Allele[alleleCount]); - this.samples = samples.toArray(new String[sampleCount]); + this.samples = samples; + this.alleles = alleles; + + final int sampleCount = samples.sampleCount(); + final int alleleCount = alleles.alleleCount(); + readsBySampleIndex = new GATKSAMRecord[sampleCount][]; readListBySampleIndex = new List[sampleCount]; valuesBySampleIndex = new double[sampleCount][][]; - referenceAlleleIndex = findReferenceAllele(this.alleles); + referenceAlleleIndex = findReferenceAllele(alleles); - sampleIndex = new Object2IntOpenHashMap<>(sampleCount); - alleleIndex = new Object2IntOpenHashMap<>(alleleCount); readIndexBySampleIndex = new Object2IntMap[sampleCount]; setupIndexes(reads, sampleCount, alleleCount); @@ -153,48 +147,21 @@ public class ReadLikelihoods implements Cloneable { // Add all the indices to alleles, sample and reads in the look-up maps. private void setupIndexes(final Map> reads, final int sampleCount, final int alleleCount) { - alleleIndex.clear(); - for (int i = 0; i < alleleCount; i++) { - final A allele = alleles[i]; - if (allele == null) - throw new IllegalArgumentException("no allele can be null"); - alleleIndex.put(allele, i); - } - if (alleleIndex.size() != alleleCount) - throw new IllegalArgumentException("repeated alleles"); - - sampleIndex.clear(); - for (int i = 0; i < sampleCount; i++) { + for (int i = 0; i < sampleCount; i++) setupSampleData(i, reads, alleleCount); - } - - if (sampleIndex.size() != sampleCount) - throw new IllegalArgumentException("repeated sample names"); } // Assumes that {@link #samples} has been initialized with the sample names. private void setupSampleData(final int sampleIndex, final Map> readsBySample, final int alleleCount) { - final String sample = this.samples[sampleIndex]; - if (sample == null) - throw new IllegalArgumentException("no sample can be null"); - this.sampleIndex.put(sample, sampleIndex); + final String sample = samples.sampleAt(sampleIndex); + final List reads = readsBySample.get(sample); readsBySampleIndex[sampleIndex] = reads == null ? new GATKSAMRecord[0] : reads.toArray(new GATKSAMRecord[reads.size()]); final int sampleReadCount = readsBySampleIndex[sampleIndex].length; - readIndexBySampleIndex[sampleIndex] = new Object2IntOpenHashMap<>(sampleReadCount); - for (int r = 0; r < sampleReadCount; r++) { - final GATKSAMRecord read = readsBySampleIndex[sampleIndex][r]; - if (read == null) - throw new IllegalArgumentException("read cannot be null"); - if (readIndexBySampleIndex[sampleIndex].containsKey(read)) - throw new IllegalArgumentException("repeated read " + read); - readIndexBySampleIndex[sampleIndex].put(readsBySampleIndex[sampleIndex][r], r); - } - final double[][] sampleValues = new double[alleleCount][sampleReadCount]; valuesBySampleIndex[sampleIndex] = sampleValues; } @@ -204,8 +171,8 @@ public class ReadLikelihoods implements Cloneable { */ public ReadLikelihoods clone() { - final int sampleCount = samples.length; - final int alleleCount = alleles.length; + final int sampleCount = samples.sampleCount(); + final int alleleCount = alleles.alleleCount(); final double[][][] newLikelihoodValues = new double[sampleCount][alleleCount][]; @@ -214,21 +181,20 @@ public class ReadLikelihoods implements Cloneable { final GATKSAMRecord[][] newReadsBySampleIndex = new GATKSAMRecord[sampleCount][]; for (int s = 0; s < sampleCount; s++) { - newReadIndexBySampleIndex[s] = new Object2IntOpenHashMap<>(readIndexBySampleIndex[s]); newReadsBySampleIndex[s] = readsBySampleIndex[s].clone(); for (int a = 0; a < alleleCount; a++) newLikelihoodValues[s][a] = valuesBySampleIndex[s][a].clone(); } // Finally we create the new read-likelihood - return new ReadLikelihoods<>(alleles.clone(), samples, sampleIndex, + return new ReadLikelihoods<>(alleles, samples, newReadsBySampleIndex, newReadIndexBySampleIndex, newLikelihoodValues); } // Internally used constructor. @SuppressWarnings("unchecked") - private ReadLikelihoods(final A[] alleles, final String[] samples, final Object2IntMap sampleIndex, + private ReadLikelihoods(final AlleleList alleles, final SampleList samples, final GATKSAMRecord[][] readsBySampleIndex, final Object2IntMap[] readIndex, final double[][][] values) { this.samples = samples; @@ -236,43 +202,22 @@ public class ReadLikelihoods implements Cloneable { this.readsBySampleIndex = readsBySampleIndex; this.valuesBySampleIndex = values; this.readIndexBySampleIndex = readIndex; - this.readListBySampleIndex = new List[samples.length]; - - this.sampleIndex = sampleIndex; - - this.alleleIndex = new Object2IntOpenHashMap<>(alleles.length); - for (int i = 0; i < alleles.length; i++) - alleleIndex.put(alleles[i],i); - - if (alleleIndex.size() != alleles.length) - throw new IllegalArgumentException("the allele index is null"); + final int sampleCount = samples.sampleCount(); + this.readListBySampleIndex = new List[sampleCount]; referenceAlleleIndex = findReferenceAllele(alleles); - sampleMatrices = (Matrix[]) new Matrix[samples.length]; + sampleMatrices = (Matrix[]) new Matrix[sampleCount]; } - // Search for the reference allele, if not found the index is -1. - private int findReferenceAllele(final A[] alleles) { - for (int i = 0; i < alleles.length; i++) - if (alleles[i].isReference()) + private int findReferenceAllele(final AlleleList alleles) { + final int alleleCount = alleles.alleleCount(); + for (int i = 0; i < alleleCount; i++) + if (alleles.alleleAt(i).isReference()) return i; return -1; } - /** - * Checks whether a sample is included likelihood collection. - * - * @param sample the query sample. - * - * @throws IllegalArgumentException if {@code sample} is {@code null}. - * @return {@code true} iff the sample is in the likelihood collection. - */ - @SuppressWarnings("unused") - public boolean containsSample(final String sample) { - return sampleIndex.containsKey(sample); - } - /** * Returns the index of a sample within the likelihood collection. * @@ -282,12 +227,7 @@ public class ReadLikelihoods implements Cloneable { * @return -1 if the allele is not included, 0 or greater otherwise. */ public int sampleIndex(final String sample) { - if (sample == null) - throw new IllegalArgumentException("the input allele cannot be null"); - if (sampleIndex.containsKey(sample)) - return sampleIndex.getInt(sample); - else - return -1; + return samples.sampleIndex(sample); } /** @@ -295,7 +235,7 @@ public class ReadLikelihoods implements Cloneable { * @return 0 or greater. */ public int sampleCount() { - return samples.length; + return samples.sampleCount(); } /** @@ -307,22 +247,8 @@ public class ReadLikelihoods implements Cloneable { * * @return never {@code null}. */ - public String sample(final int sampleIndex) { - checkSampleIndex(sampleIndex); - return samples[sampleIndex]; - } - - /** - * Checks whether the allele is within the likelihood collection. - * - * @param allele the query allele. - * - * @throws IllegalArgumentException if {@code allele} is {@code null}. - * @return {@code true} iff the allele is in the likelihood collection. - */ - @SuppressWarnings("unused") - public boolean containsAllele(final A allele) { - return alleleIndex.containsKey(allele); + public String sampleAt(final int sampleIndex) { + return samples.sampleAt(sampleIndex); } /** @@ -335,12 +261,7 @@ public class ReadLikelihoods implements Cloneable { * @return -1 if the allele is not included, 0 or greater otherwise. */ public int alleleIndex(final A allele) { - if (allele == null) - throw new IllegalArgumentException("the input allele cannot be null"); - if (alleleIndex.containsKey(allele)) - return alleleIndex.getInt(allele); - else - return -1; + return alleles.alleleIndex(allele); } /** @@ -349,7 +270,7 @@ public class ReadLikelihoods implements Cloneable { */ @SuppressWarnings("unused") public int alleleCount() { - return alleles.length; + return alleles.alleleCount(); } /** @@ -361,9 +282,8 @@ public class ReadLikelihoods implements Cloneable { * * @return never {@code null}. */ - public A allele(final int alleleIndex) { - checkAlleleIndex(alleleIndex); - return alleles[alleleIndex]; + public A alleleAt(final int alleleIndex) { + return alleles.alleleAt(alleleIndex); } /** @@ -382,30 +302,6 @@ public class ReadLikelihoods implements Cloneable { return extantList; } - /** - * Returns the likelihood matrix for a sample. - *

- * The matrix is indexed by allele and the by read index. - * - *

-     *          result[a][r] == lnLk(Read_r | Allele_a)
-     *     
- *

- * - *

- * The matrix is live and changes to it update the likelihood in the collection, please use with care. - *

- * - * @param sampleIndex the sample index. - * - * @return never {@code null}. - */ - /* package */ double[][] sampleValues(final int sampleIndex) { - checkSampleIndex(sampleIndex); - return valuesBySampleIndex[sampleIndex]; - } - - /** * Returns a read vs allele likelihood matrix corresponding to a sample. * @@ -441,7 +337,7 @@ public class ReadLikelihoods
implements Cloneable { if (maximumLikelihoodDifferenceCap == Double.NEGATIVE_INFINITY && !bestToZero) return; - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); if (alleleCount == 0) // trivial case there is no alleles. return; else if (alleleCount == 1 && !bestToZero) @@ -469,19 +365,20 @@ public class ReadLikelihoods implements Cloneable { final double bestAbsoluteLikelihood = Math.max(bestAlternativeAllele.likelihood,referenceLikelihood); + final int alleleCount = alleles.alleleCount(); if (bestToZero) { if (bestAbsoluteLikelihood == Double.NEGATIVE_INFINITY) - for (int a = 0; a < alleles.length; a++) + for (int a = 0; a < alleleCount; a++) sampleValues[a][readIndex] = 0; else if (worstLikelihoodCap != Double.NEGATIVE_INFINITY) - for (int a = 0; a < alleles.length; a++) + for (int a = 0; a < alleleCount; a++) sampleValues[a][readIndex] = (sampleValues[a][readIndex] < worstLikelihoodCap ? worstLikelihoodCap : sampleValues[a][readIndex]) - bestAbsoluteLikelihood; else - for (int a = 0; a < alleles.length; a++) + for (int a = 0; a < alleleCount; a++) sampleValues[a][readIndex] -= bestAbsoluteLikelihood; } else // else if (maximumReferenceLikelihoodFall != Double.NEGATIVE_INFINITY ) { // - // Guarantee to be the case by enclosing code. - for (int a = 0; a < alleles.length; a++) + // Guarantee to be the case by enclosing code. + for (int a = 0; a < alleleCount; a++) if (sampleValues[a][readIndex] < worstLikelihoodCap) sampleValues[a][readIndex] = worstLikelihoodCap; } @@ -499,9 +396,8 @@ public class ReadLikelihoods implements Cloneable { * @return never {@code null}. */ public List samples() { - if (sampleList == null) - sampleList = Collections.unmodifiableList(Arrays.asList(samples)); - return sampleList; + return sampleList == null ? sampleList = SampleListUtils.asList(samples) : sampleList; + } /** @@ -518,11 +414,10 @@ public class ReadLikelihoods implements Cloneable { * @return never {@code null}. */ public List alleles() { - if (alleleList == null) - alleleList = Collections.unmodifiableList(Arrays.asList(alleles)); - return alleleList; + return alleleList == null ? alleleList = AlleleListUtils.asList(alleles) : alleleList; } + /** * Search the best allele for a read. * @@ -533,7 +428,7 @@ public class ReadLikelihoods implements Cloneable { * if non-could be found. */ private BestAllele searchBestAllele(final int sampleIndex, final int readIndex, final boolean canBeReference) { - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); if (alleleCount == 0 || (alleleCount == 1 && referenceAlleleIndex == 0 && !canBeReference)) return new BestAllele(sampleIndex,readIndex,-1,Double.NEGATIVE_INFINITY,Double.NEGATIVE_INFINITY); @@ -558,7 +453,7 @@ public class ReadLikelihoods implements Cloneable { } public void changeReads(final Map readRealignments) { - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); for (int s = 0; s < sampleCount; s++) { final GATKSAMRecord[] sampleReads = readsBySampleIndex[s]; final Object2IntMap readIndex = readIndexBySampleIndex[s]; @@ -568,8 +463,11 @@ public class ReadLikelihoods implements Cloneable { final GATKSAMRecord replacement = readRealignments.get(read); if (replacement == null) continue; - readIndex.remove(read); - readIndex.put(sampleReads[r] = replacement,r); + sampleReads[r] = replacement; + if (readIndex != null) { + readIndex.remove(read); + readIndex.put(replacement, r); + } } } } @@ -577,45 +475,51 @@ public class ReadLikelihoods implements Cloneable { /** * Add alleles that are missing in the read-likelihoods collection giving all reads a default * likelihood value. - * @param alleles the potentially missing alleles. + * @param candidateAlleles the potentially missing alleles. * @param defaultLikelihood the default read likelihood value for that allele. * - * @throws IllegalArgumentException if {@code alleles} is {@code null} or there is more than + * @throws IllegalArgumentException if {@code candidateAlleles} is {@code null} or there is more than * one missing allele that is a reference or there is one but the collection already has * a reference allele. */ - public void addMissingAlleles(final Collection alleles, final double defaultLikelihood) { - if (alleles == null) - throw new IllegalArgumentException("the alleles list cannot be null"); - if (alleles.isEmpty()) + public void addMissingAlleles(final Collection candidateAlleles, final double defaultLikelihood) { + if (candidateAlleles == null) + throw new IllegalArgumentException("the candidateAlleles list cannot be null"); + if (candidateAlleles.isEmpty()) return; - final List allelesToAdd = new ArrayList(alleles.size()); - for (final A allele : alleles) - if (!alleleIndex.containsKey(allele)) + final List allelesToAdd = new ArrayList<>(candidateAlleles.size()); + for (final A allele : candidateAlleles) + if (alleles.alleleIndex(allele) == -1) allelesToAdd.add(allele); + if (allelesToAdd.isEmpty()) return; - final int oldAlleleCount = this.alleles.length; - final int newAlleleCount = this.alleles.length + allelesToAdd.size(); + final int oldAlleleCount = alleles.alleleCount(); + final int newAlleleCount = alleles.alleleCount() + allelesToAdd.size(); alleleList = null; int referenceIndex = this.referenceAlleleIndex; - this.alleles = Arrays.copyOf(this.alleles,newAlleleCount); - int nextIndex = oldAlleleCount; + @SuppressWarnings("unchecked") + final A[] newAlleles = (A[]) new Allele[newAlleleCount]; + for (int a = 0; a < oldAlleleCount; a++) + newAlleles[a] = this.alleleAt(a); + int newIndex = oldAlleleCount; for (final A allele : allelesToAdd) { if (allele.isReference()) { if (referenceIndex != -1) throw new IllegalArgumentException("there cannot be more than one reference allele"); - referenceIndex = nextIndex; + referenceIndex = newIndex; } - alleleIndex.put(this.alleles[nextIndex] = allele, nextIndex++); + newAlleles[newIndex++] = allele; } + alleles = new IndexedAlleleList<>(newAlleles); + if (referenceIndex != -1) referenceAlleleIndex = referenceIndex; - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); for (int s = 0; s < sampleCount; s++) { final int sampleReadCount = readsBySampleIndex[s].length; final double[][] newValuesBySampleIndex = Arrays.copyOf(valuesBySampleIndex[s],newAlleleCount); @@ -632,7 +536,7 @@ public class ReadLikelihoods implements Cloneable { * Likelihood matrix between a set of alleles and reads. * @param the allele-type. */ - public interface Matrix { + public interface Matrix extends AlleleList { /** * List of reads in the matrix sorted by their index therein. @@ -716,7 +620,7 @@ public class ReadLikelihoods implements Cloneable { * @throws IllegalArgumentException if {@code alleleIndex} is not a valid allele index. * @return never {@code null}. */ - public A allele(final int alleleIndex); + public A alleleAt(final int alleleIndex); /** * Returns the allele given its index. @@ -726,7 +630,16 @@ public class ReadLikelihoods implements Cloneable { * @throws IllegalArgumentException if {@code readIndex} is not a valid read index. * @return never {@code null}. */ - public GATKSAMRecord read(final int readIndex); + public GATKSAMRecord readAt(final int readIndex); + + + /** + * Copies the likelihood of all the reads for a given allele into an array from a particular offset. + * @param alleleIndex the targeted allele + * @param dest the destination array. + * @param offset the copy offset within the destination allele + */ + public void copyAlleleLikelihoods(final int alleleIndex, final double[] dest, final int offset); } /** @@ -749,7 +662,7 @@ public class ReadLikelihoods implements Cloneable { @SuppressWarnings("unchecked") final B[] newAlleles = newToOldAlleleMap.keySet().toArray((B[]) new Allele[newToOldAlleleMap.size()]); - final int oldAlleleCount = alleles.length; + final int oldAlleleCount = alleles.alleleCount(); final int newAlleleCount = newAlleles.length; // we get the index correspondence between new old -> new allele, -1 entries mean that the old @@ -760,19 +673,18 @@ public class ReadLikelihoods implements Cloneable { final double[][][] newLikelihoodValues = marginalLikelihoods(oldAlleleCount, newAlleleCount, oldToNewAlleleIndexMap, null); - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); @SuppressWarnings("unchecked") final Object2IntMap[] newReadIndexBySampleIndex = new Object2IntMap[sampleCount]; final GATKSAMRecord[][] newReadsBySampleIndex = new GATKSAMRecord[sampleCount][]; for (int s = 0; s < sampleCount; s++) { - newReadIndexBySampleIndex[s] = new Object2IntOpenHashMap<>(readIndexBySampleIndex[s]); newReadsBySampleIndex[s] = readsBySampleIndex[s].clone(); } // Finally we create the new read-likelihood - return new ReadLikelihoods<>(newAlleles, samples, sampleIndex, + return new ReadLikelihoods<>(new IndexedAlleleList(newAlleles), samples, newReadsBySampleIndex, newReadIndexBySampleIndex, newLikelihoodValues); } @@ -804,7 +716,7 @@ public class ReadLikelihoods implements Cloneable { @SuppressWarnings("unchecked") final B[] newAlleles = newToOldAlleleMap.keySet().toArray((B[]) new Allele[newToOldAlleleMap.size()]); - final int oldAlleleCount = alleles.length; + final int oldAlleleCount = alleles.alleleCount(); final int newAlleleCount = newAlleles.length; // we get the index correspondence between new old -> new allele, -1 entries mean that the old @@ -816,7 +728,7 @@ public class ReadLikelihoods implements Cloneable { final double[][][] newLikelihoodValues = marginalLikelihoods(oldAlleleCount, newAlleleCount, oldToNewAlleleIndexMap, readsToKeep); - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); @SuppressWarnings("unchecked") final Object2IntMap[] newReadIndexBySampleIndex = new Object2IntMap[sampleCount]; @@ -828,18 +740,16 @@ public class ReadLikelihoods implements Cloneable { final int oldSampleReadCount = oldSampleReads.length; final int newSampleReadCount = sampleReadsToKeep.length; if (newSampleReadCount == oldSampleReadCount) { - newReadIndexBySampleIndex[s] = new Object2IntOpenHashMap<>(readIndexBySampleIndex[s]); newReadsBySampleIndex[s] = oldSampleReads.clone(); } else { - final Object2IntMap newSampleReadIndex = newReadIndexBySampleIndex[s] = new Object2IntOpenHashMap<>(newSampleReadCount); - final GATKSAMRecord[] newSampleReads = newReadsBySampleIndex[s] = new GATKSAMRecord[newSampleReadCount]; - for (int r = 0; r < newSampleReadCount; r++) - newSampleReadIndex.put(newSampleReads[r] = oldSampleReads[sampleReadsToKeep[r]],r); + newReadsBySampleIndex[s] = new GATKSAMRecord[newSampleReadCount]; + for (int i = 0; i < newSampleReadCount; i++) + newReadsBySampleIndex[s][i] = oldSampleReads[sampleReadsToKeep[i]]; } } // Finally we create the new read-likelihood - return new ReadLikelihoods<>(newAlleles, samples, sampleIndex, + return new ReadLikelihoods<>(new IndexedAlleleList(newAlleles), samples, newReadsBySampleIndex, newReadIndexBySampleIndex, newLikelihoodValues); } @@ -847,7 +757,7 @@ public class ReadLikelihoods implements Cloneable { private int[][] overlappingReadIndicesBySampleIndex(final GenomeLoc overlap) { if (overlap == null) return null; - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); final int[][] result = new int[sampleCount][]; final IntArrayList buffer = new IntArrayList(200); final int referenceIndex = overlap.getContigIndex(); @@ -884,12 +794,10 @@ public class ReadLikelihoods implements Cloneable { return readEnd >= start; } - - // Calculate the marginal likelihoods considering the old -> new allele index mapping. private double[][][] marginalLikelihoods(final int oldAlleleCount, final int newAlleleCount, final int[] oldToNewAlleleIndexMap, final int[][] readsToKeep) { - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); final double[][][] result = new double[sampleCount][][]; for (int s = 0; s < sampleCount; s++) { @@ -917,6 +825,46 @@ public class ReadLikelihoods implements Cloneable { return result; } + /** + * Given a collection of likelihood in the old map format, it creates the corresponding read-likelihoods collection. + * + * @param map the likelihoods to transform. + * + * @throws IllegalArgumentException if {@code map} is {@code null}. + * + * @return never {@code null}. + */ + public static ReadLikelihoods fromPerAlleleReadLikelihoodsMap(final Map map) { + + // First we need to create the read-likelihood collection with all required alleles, samples and reads. + final SampleList sampleList = new IndexedSampleList(map.keySet()); + final Set alleles = new LinkedHashSet<>(10); + final Map> sampleToReads = new HashMap<>(sampleList.sampleCount()); + for (final Map.Entry entry : map.entrySet()) { + final String sample = entry.getKey(); + final PerReadAlleleLikelihoodMap sampleLikelihoods = entry.getValue(); + alleles.addAll(sampleLikelihoods.getAllelesSet()); + sampleToReads.put(sample,new ArrayList<>(sampleLikelihoods.getLikelihoodReadMap().keySet())); + } + + final AlleleList alleleList = new IndexedAlleleList<>(alleles); + final ReadLikelihoods result = new ReadLikelihoods<>(sampleList,alleleList,sampleToReads); + + // Now set the likelihoods. + for (final Map.Entry sampleEntry : map.entrySet()) { + final ReadLikelihoods.Matrix sampleMatrix = result.sampleMatrix(result.sampleIndex(sampleEntry.getKey())); + for (final Map.Entry> readEntry : sampleEntry.getValue().getLikelihoodReadMap().entrySet()) { + final GATKSAMRecord read = readEntry.getKey(); + final int readIndex = sampleMatrix.readIndex(read); + for (final Map.Entry alleleEntry : readEntry.getValue().entrySet()) { + final int alleleIndex = result.alleleIndex(alleleEntry.getKey()); + sampleMatrix.set(alleleIndex,readIndex,alleleEntry.getValue()); + } + } + } + return result; + } + // calculates an old to new allele index map array. private int[] oldToNewAlleleIndexMap(final Map> newToOldAlleleMap, final B[] newAlleles, final int oldAlleleCount, final int newAlleleCount) { @@ -963,18 +911,24 @@ public class ReadLikelihoods implements Cloneable { if (location.isUnmapped()) throw new IllegalArgumentException("the location cannot be unmapped"); - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); final int locContig = location.getContigIndex(); final int locStart = location.getStart(); final int locEnd = location.getStop(); - final Set readsToRemove = new HashSet<>(100); // can we improve this estimate? - for (int s = 0; s < sampleCount; s++) - for (final GATKSAMRecord read : readsBySampleIndex[s]) - if (!unclippedReadOverlapsRegion(read, locContig, locStart, locEnd)) - readsToRemove.add(read); - removeReads(readsToRemove); + final int alleleCount = alleles.alleleCount(); + final IntArrayList removeIndices = new IntArrayList(10); + for (int s = 0; s < sampleCount; s++) { + int readRemoveCount = 0; + final GATKSAMRecord[] sampleReads = readsBySampleIndex[s]; + final int sampleReadCount = sampleReads.length; + for (int r = 0; r < sampleReadCount; r++) + if (!unclippedReadOverlapsRegion(sampleReads[r], locContig, locStart, locEnd)) + removeIndices.add(r); + removeSampleReads(s,removeIndices,alleleCount); + removeIndices.clear(); + } } // Compare the read coordinates to the location of interest. @@ -1014,23 +968,25 @@ public class ReadLikelihoods implements Cloneable { * @throws IllegalArgumentException if {@code maximumErrorPerBase} is negative. */ public void filterPoorlyModeledReads(final double maximumErrorPerBase) { - if (alleles.length == 0) + if (alleles.alleleCount() == 0) throw new IllegalStateException("unsupported for read-likelihood collections with no alleles"); if (Double.isNaN(maximumErrorPerBase) || maximumErrorPerBase <= 0.0) throw new IllegalArgumentException("the maximum error per base must be a positive number"); - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); - final Set readsToRemove = new HashSet<>(100); // rough estimate, can be improved? + final int alleleCount = alleles.alleleCount(); + final IntArrayList removeIndices = new IntArrayList(10); for (int s = 0; s < sampleCount; s++) { final GATKSAMRecord[] sampleReads = readsBySampleIndex[s]; final int sampleReadCount = sampleReads.length; for (int r = 0; r < sampleReadCount; r++) { final GATKSAMRecord read = sampleReads[r]; if (readIsPoorlyModelled(s,r,read, maximumErrorPerBase)) - readsToRemove.add(read); + removeIndices.add(r); } + removeSampleReads(s, removeIndices, alleleCount); + removeIndices.clear(); } - removeReads(readsToRemove); } // Check whether the read is poorly modelled. @@ -1039,7 +995,7 @@ public class ReadLikelihoods implements Cloneable { final double log10QualPerBase = -4.0; final double log10MaxLikelihoodForTrueAllele = maxErrorsForRead * log10QualPerBase; - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); final double[][] sampleValues = valuesBySampleIndex[sampleIndex]; for (int a = 0; a < alleleCount; a++) if (sampleValues[a][readIndex] >= log10MaxLikelihoodForTrueAllele) @@ -1064,7 +1020,7 @@ public class ReadLikelihoods implements Cloneable { final String sample = entry.getKey(); final List newSampleReads = entry.getValue(); - final int sampleIndex = this.sampleIndex.getInt(sample); + final int sampleIndex = samples.sampleIndex(sample); if (sampleIndex == -1) throw new IllegalArgumentException("input sample " + sample + @@ -1084,7 +1040,7 @@ public class ReadLikelihoods implements Cloneable { // Extends the likelihood arrays-matrices. private void extendsLikelihoodArrays(double initialLikelihood, int sampleIndex, int sampleReadCount, int newSampleReadCount) { final double[][] sampleValues = valuesBySampleIndex[sampleIndex]; - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); for (int a = 0; a < alleleCount; a++) sampleValues[a] = Arrays.copyOf(sampleValues[a], newSampleReadCount); if (initialLikelihood != 0.0) // the default array new value. @@ -1101,10 +1057,10 @@ public class ReadLikelihoods implements Cloneable { int nextReadIndex = sampleReadCount; final Object2IntMap sampleReadIndex = readIndexBySampleIndex[sampleIndex]; for (final GATKSAMRecord newRead : newSampleReads) { - if (sampleReadIndex.containsKey(newRead)) // might be worth handle this without exception (ignore the read?) but in practice should never be the case. - throw new IllegalArgumentException("you cannot add reads that are already in read-likelihood collection"); - sampleReads[nextReadIndex] = newRead; - sampleReadIndex.put(newRead,nextReadIndex++); + // if (sampleReadIndex.containsKey(newRead)) // might be worth handle this without exception (ignore the read?) but in practice should never be the case. + // throw new IllegalArgumentException("you cannot add reads that are already in read-likelihood collection"); + if (sampleReadIndex != null ) sampleReadIndex.put(newRead,nextReadIndex); + sampleReads[nextReadIndex++] = newRead; } } @@ -1133,19 +1089,22 @@ public class ReadLikelihoods implements Cloneable { if (!nonRefAllele.equals(GATKVariantContextUtils.NON_REF_SYMBOLIC_ALLELE)) throw new IllegalArgumentException("the non-ref allele is not valid"); // Already present? - if (alleleIndex.containsKey(nonRefAllele)) + if (alleles.alleleIndex(nonRefAllele) != -1) return; - final int alleleCount = alleles.length; - final int newAlleleCount = alleleCount + 1; - alleles = Arrays.copyOf(alleles,newAlleleCount); - alleles[alleleCount] = nonRefAllele; - alleleIndex.put(nonRefAllele,alleleCount); + final int oldAlleleCount = alleles.alleleCount(); + final int newAlleleCount = oldAlleleCount + 1; + @SuppressWarnings("unchecked") + final A[] newAlleles = (A[]) new Allele[newAlleleCount]; + for (int a = 0; a < oldAlleleCount; a++) + newAlleles[a] = alleles.alleleAt(a); + newAlleles[oldAlleleCount] = nonRefAllele; + alleles = new IndexedAlleleList<>(newAlleles); alleleList = null; // remove the cached alleleList. - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); for (int s = 0; s < sampleCount; s++) - addNonReferenceAlleleLikelihoodsPerSample(alleleCount, newAlleleCount, s); + addNonReferenceAlleleLikelihoodsPerSample(oldAlleleCount, newAlleleCount, s); } // Updates per-sample structures according to the addition of the NON_REF allele. @@ -1173,24 +1132,75 @@ public class ReadLikelihoods implements Cloneable { */ public void contaminationDownsampling(final Map perSampleDownsamplingFraction) { - final int sampleCount = samples.length; - final Set readsToRemove = new HashSet<>(100); // blind estimate, can be improved? + final int sampleCount = samples.sampleCount(); + final IntArrayList readsToRemove = new IntArrayList(10); // blind estimate, can be improved? + final int alleleCount = alleles.alleleCount(); for (int s = 0; s < sampleCount; s++) { - final String sample = samples[s]; + final String sample = samples.sampleAt(s); final Double fractionDouble = perSampleDownsamplingFraction.get(sample); if (fractionDouble == null) continue; final double fraction = fractionDouble; if (Double.isNaN(fraction) || fraction <= 0.0) continue; - if (fraction >= 1.0) - readsToRemove.addAll(Arrays.asList(readsBySampleIndex[s])); + if (fraction >= 1.0) { + final int sampleReadCount = readsBySampleIndex[s].length; + readsToRemove.ensureCapacity(sampleReadCount); + for (int r = 0; r < sampleReadCount; r++) + readsToRemove.add(r); + removeSampleReads(s,readsToRemove,alleleCount); + readsToRemove.clear(); + } else { final Map> readsByBestAllelesMap = readsByBestAlleleMap(s); - readsToRemove.addAll(AlleleBiasedDownsamplingUtils.selectAlleleBiasedReads(readsByBestAllelesMap, fraction)); + removeSampleReads(s,AlleleBiasedDownsamplingUtils.selectAlleleBiasedReads(readsByBestAllelesMap, fraction),alleleCount); } } - removeReads(readsToRemove); + } + + /** + * Given a collection of likelihood in the old map format, it creates the corresponding read-likelihoods collection. + * + * @param alleleList the target list of alleles. + * @param map the likelihoods to transform. + * + * + * @throws IllegalArgumentException if {@code map} is {@code null}, or {@code map} does not contain likelihoods for all read vs allele combinations. + * + * @return never {@code null}. + */ + public static ReadLikelihoods fromPerAlleleReadLikelihoodsMap(final AlleleList alleleList, final Map map) { + + //TODO add test code for this method. + // First we need to create the read-likelihood collection with all required alleles, samples and reads. + final SampleList sampleList = new IndexedSampleList(map.keySet()); + final int alleleCount = alleleList.alleleCount(); + final Map> sampleToReads = new HashMap<>(sampleList.sampleCount()); + for (final Map.Entry entry : map.entrySet()) { + final String sample = entry.getKey(); + final PerReadAlleleLikelihoodMap sampleLikelihoods = entry.getValue(); + sampleToReads.put(sample,new ArrayList<>(sampleLikelihoods.getLikelihoodReadMap().keySet())); + } + + final ReadLikelihoods result = new ReadLikelihoods<>(sampleList,alleleList,sampleToReads); + + // Now set the likelihoods. + for (final Map.Entry sampleEntry : map.entrySet()) { + final ReadLikelihoods.Matrix sampleMatrix = result.sampleMatrix(result.sampleIndex(sampleEntry.getKey())); + for (final Map.Entry> readEntry : sampleEntry.getValue().getLikelihoodReadMap().entrySet()) { + final GATKSAMRecord read = readEntry.getKey(); + final int readIndex = sampleMatrix.readIndex(read); + final Map alleleToLikelihoodMap = readEntry.getValue(); + for (int a = 0; a < alleleCount; a++) { + final Allele allele = alleleList.alleleAt(a); + final Double likelihood = alleleToLikelihoodMap.get(allele); + if (likelihood == null) + throw new IllegalArgumentException("there is no likelihood for allele " + allele + " and read " + read); + sampleMatrix.set(a,readIndex,likelihood); + } + } + } + return result; } /** @@ -1202,7 +1212,7 @@ public class ReadLikelihoods implements Cloneable { */ public Collection bestAlleles() { final List result = new ArrayList<>(100); // blind estimate. - final int sampleCount = samples.length; + final int sampleCount = samples.sampleCount(); for (int s = 0; s < sampleCount; s++) { final GATKSAMRecord[] sampleReads = readsBySampleIndex[s]; final int readCount = sampleReads.length; @@ -1219,11 +1229,11 @@ public class ReadLikelihoods implements Cloneable { */ public Map> readsByBestAlleleMap(final int sampleIndex) { checkSampleIndex(sampleIndex); - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); final int sampleReadCount = readsBySampleIndex[sampleIndex].length; final Map> result = new HashMap<>(alleleCount); - for (final A allele : alleles) - result.put(allele,new ArrayList(sampleReadCount)); + for (int a = 0; a < alleleCount; a++) + result.put(alleles.alleleAt(a),new ArrayList(sampleReadCount)); readsByBestAlleleMap(sampleIndex,result); return result; } @@ -1234,12 +1244,12 @@ public class ReadLikelihoods implements Cloneable { */ @SuppressWarnings("unused") public Map> readsByBestAlleleMap() { - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); final Map> result = new HashMap<>(alleleCount); final int totalReadCount = readCount(); - for (final A allele : alleles) - result.put(allele,new ArrayList(totalReadCount)); - final int sampleCount = samples.length; + for (int a = 0; a < alleleCount; a++) + result.put(alleles.alleleAt(a),new ArrayList(totalReadCount)); + final int sampleCount = samples.sampleCount(); for (int s = 0; s < sampleCount; s++) readsByBestAlleleMap(s,result); return result; @@ -1265,9 +1275,9 @@ public class ReadLikelihoods implements Cloneable { */ @SuppressWarnings("unused") public int readIndex(final int sampleIndex, final GATKSAMRecord read) { - final Object2IntMap readIndex = readIndexBySampleIndex[sampleIndex]; + final Object2IntMap readIndex = readIndexBySampleIndex(sampleIndex); if (readIndex.containsKey(read)) - return readIndexBySampleIndex[sampleIndex].getInt(read); + return readIndexBySampleIndex(sampleIndex).getInt(read); else return -1; } @@ -1279,7 +1289,8 @@ public class ReadLikelihoods implements Cloneable { */ public int readCount() { int sum = 0; - for (int i = 0; i < samples.length; i++) + final int sampleCount = samples.sampleCount(); + for (int i = 0; i < sampleCount; i++) sum += readsBySampleIndex[i].length; return sum; } @@ -1330,9 +1341,9 @@ public class ReadLikelihoods implements Cloneable { private BestAllele(final int sampleIndex, final int readIndex, final int bestAlleleIndex, final double likelihood, final double secondBestLikelihood) { - allele = bestAlleleIndex == -1 ? null : alleles[bestAlleleIndex]; + allele = bestAlleleIndex == -1 ? null : alleles.alleleAt(bestAlleleIndex); this.likelihood = likelihood; - sample = samples[sampleIndex]; + sample = samples.sampleAt(sampleIndex); read = readsBySampleIndex[sampleIndex][readIndex]; confidence = likelihood == secondBestLikelihood ? 0 : likelihood - secondBestLikelihood; } @@ -1342,38 +1353,51 @@ public class ReadLikelihoods implements Cloneable { } } - - /** - * Remove a set of reads from the read-likelihoods - * @param readsToRemove collection of reads to remove. - */ - @SuppressWarnings("unused") - public void removeReads(final Collection readsToRemove) { - if (readsToRemove == null) - throw new IllegalArgumentException("remove read collection cannot be null"); - if (readsToRemove.isEmpty()) + private void removeSampleReads(final int sampleIndex, final IntArrayList indexToRemove, final int alleleCount) { + final int removeCount = indexToRemove.size(); + if (removeCount == 0) return; - removeReads(new HashSet<>(readsToRemove)); - } - // Requires that the collection passed iterator can remove elements, and it can be modified. - private void removeReads(final Set readsToRemove) { - if (readsToRemove.isEmpty()) - return; - final int sampleCount = samples.length; - final int alleleCount = alleles.length; - for (int s = 0; s < sampleCount; s++) { - removeSampleReads(s, readsToRemove, alleleCount); - if (readsToRemove.isEmpty()) break; // each iteration may exhaust the reads to remove. - } - } - - // Requires that the collection passed iterator can remove elements, and it can be modified. - private void removeSampleReads(final int sampleIndex, final Set readsToRemove, final int alleleCount) { final GATKSAMRecord[] sampleReads = readsBySampleIndex[sampleIndex]; final int sampleReadCount = sampleReads.length; final Object2IntMap indexByRead = readIndexBySampleIndex[sampleIndex]; + if (indexByRead != null) + for (int i = 0; i < removeCount; i++) + indexByRead.remove(sampleReads[indexToRemove.getInt(i)]); + final boolean[] removeIndex = new boolean[sampleReadCount]; + int firstDeleted = indexToRemove.get(0); + for (int i = 0; i < removeCount; i++) + removeIndex[indexToRemove.get(i)] = true; + + final int newSampleReadCount = sampleReadCount - removeCount; + + // Now we skim out the removed reads from the read array. + final GATKSAMRecord[] oldSampleReads = readsBySampleIndex[sampleIndex]; + final GATKSAMRecord[] newSampleReads = new GATKSAMRecord[newSampleReadCount]; + + System.arraycopy(oldSampleReads,0,newSampleReads,0,firstDeleted); + Utils.skimArray(oldSampleReads,firstDeleted, newSampleReads, firstDeleted, removeIndex, firstDeleted); + + // Then we skim out the likelihoods of the removed reads. + final double[][] oldSampleValues = valuesBySampleIndex[sampleIndex]; + final double[][] newSampleValues = new double[alleleCount][newSampleReadCount]; + for (int a = 0; a < alleleCount; a++) { + System.arraycopy(oldSampleValues[a],0,newSampleValues[a],0,firstDeleted); + Utils.skimArray(oldSampleValues[a], firstDeleted, newSampleValues[a], firstDeleted, removeIndex, firstDeleted); + } + valuesBySampleIndex[sampleIndex] = newSampleValues; + readsBySampleIndex[sampleIndex] = newSampleReads; + readListBySampleIndex[sampleIndex] = null; // reset the unmodifiable list. + } + + + // Requires that the collection passed iterator can remove elements, and it can be modified. + private void removeSampleReads(final int sampleIndex, final Collection readsToRemove, final int alleleCount) { + final GATKSAMRecord[] sampleReads = readsBySampleIndex[sampleIndex]; + final int sampleReadCount = sampleReads.length; + + final Object2IntMap indexByRead = readIndexBySampleIndex(sampleIndex); // Count how many we are going to remove, which ones (indexes) and remove entry from the read-index map. final boolean[] removeIndex = new boolean[sampleReadCount]; int removeCount = 0; // captures the number of deletions. @@ -1423,18 +1447,32 @@ public class ReadLikelihoods implements Cloneable { readListBySampleIndex[sampleIndex] = null; // reset the unmodifiable list. } + private Object2IntMap readIndexBySampleIndex(final int sampleIndex) { + if (readIndexBySampleIndex[sampleIndex] == null) { + final GATKSAMRecord[] sampleReads = readsBySampleIndex[sampleIndex]; + final int sampleReadCount = sampleReads.length; + readIndexBySampleIndex[sampleIndex] = new Object2IntOpenHashMap<>(sampleReadCount); + for (int r = 0; r < sampleReadCount; r++) + readIndexBySampleIndex[sampleIndex].put(sampleReads[r],r); + } + return readIndexBySampleIndex[sampleIndex]; + } + /** * Transform into a multi-sample HashMap backed {@link PerReadAlleleLikelihoodMap} type. * @return never {@code null}. * + * @deprecated + * + * This method should eventually disappear once we have removed PerReadAlleleLikelihoodMap class completelly. */ @Deprecated @SuppressWarnings("all") - public Map toPerReadAlleleLikelihoodMap () { - final int sampleCount = samples.length; - final Map result = new HashMap<>(sampleCount); + public Map toPerReadAlleleLikelihoodMap() { + final int sampleCount = samples.sampleCount(); + final Map result = new HashMap<>(sampleCount); for (int s = 0; s < sampleCount; s++) - result.put(samples[s],toPerReadAlleleLikelihoodMap(s)); + result.put(samples.sampleAt(s),toPerReadAlleleLikelihoodMap(s)); return result; } @@ -1447,11 +1485,11 @@ public class ReadLikelihoods implements Cloneable { public PerReadAlleleLikelihoodMap toPerReadAlleleLikelihoodMap(final int sampleIndex) { checkSampleIndex(sampleIndex); final PerReadAlleleLikelihoodMap result = new PerReadAlleleLikelihoodMap(); - final int alleleCount = alleles.length; + final int alleleCount = alleles.alleleCount(); final GATKSAMRecord[] sampleReads = readsBySampleIndex[sampleIndex]; final int sampleReadCount = sampleReads.length; for (int a = 0; a < alleleCount; a++) { - final A allele = alleles[a]; + final A allele = alleles.alleleAt(a); final double[] readLikelihoods = valuesBySampleIndex[sampleIndex][a]; for (int r = 0; r < sampleReadCount; r++) result.add(sampleReads[r], allele, readLikelihoods[r]); @@ -1497,12 +1535,12 @@ public class ReadLikelihoods implements Cloneable { @Override public int readIndex(final GATKSAMRecord read) { - return ReadLikelihoods.this.readIndex(sampleIndex,read); + return ReadLikelihoods.this.readIndex(sampleIndex, read); } @Override public int alleleCount() { - return alleles.length; + return alleles.alleleCount(); } @Override @@ -1511,12 +1549,12 @@ public class ReadLikelihoods implements Cloneable { } @Override - public A allele(int alleleIndex) { - return ReadLikelihoods.this.allele(alleleIndex); + public A alleleAt(int alleleIndex) { + return ReadLikelihoods.this.alleleAt(alleleIndex); } @Override - public GATKSAMRecord read(final int readIndex) { + public GATKSAMRecord readAt(final int readIndex) { if (readIndex < 0) throw new IllegalArgumentException("the read-index cannot be negative"); final GATKSAMRecord[] sampleReads = readsBySampleIndex[sampleIndex]; @@ -1524,6 +1562,11 @@ public class ReadLikelihoods implements Cloneable { throw new IllegalArgumentException("the read-index is beyond the read count of the sample"); return sampleReads[readIndex]; } + + @Override + public void copyAlleleLikelihoods(final int alleleIndex, final double[] dest, final int offset) { + System.arraycopy(valuesBySampleIndex[sampleIndex][alleleIndex],0,dest,offset,readCount()); + } } /** @@ -1536,21 +1579,7 @@ public class ReadLikelihoods implements Cloneable { * @throws IllegalArgumentException if {@code sampleIndex} is invalid, i.e. outside the range [0,{@link #sampleCount}). */ private void checkSampleIndex(final int sampleIndex) { - if (sampleIndex < 0 || sampleIndex >= samples.length) + if (sampleIndex < 0 || sampleIndex >= samples.sampleCount()) throw new IllegalArgumentException("invalid sample index: " + sampleIndex); } - - /** - * Checks whether the provide allele index is valid. - *

- * If not, it throws an exception. - *

- * @param alleleIndex the target sample index. - * - * @throws IllegalArgumentException if {@code alleleIndex} is invalid, i.e. outside the range [0,{@link #sampleCount}). - */ - private void checkAlleleIndex(final int alleleIndex) { - if (alleleIndex < 0 || alleleIndex >= alleles.length) - throw new IllegalArgumentException("invalid allele index: " + alleleIndex); - } } \ No newline at end of file From f08dcbc160abcccd9acec7df748ac38868949757 Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Mon, 18 Aug 2014 15:28:27 -0400 Subject: [PATCH 4/7] Added the genotype likelihoods model interface and implementation for the random speciment sample from an infinite population with homogeneous ploidy accross samples. --- .../AlleleLikelihoodMatrixMapper.java | 171 ++++++++++++++++++ .../gatk/genotyping/GenotypingData.java | 130 +++++++++++++ .../genotyping/GenotypingLikelihoods.java | 159 ++++++++++++++++ .../gatk/genotyping/GenotypingModel.java | 75 ++++++++ .../genotyping/HomogeneousPloidyModel.java | 116 ++++++++++++ .../InfiniteRandomMatingPopulationModel.java | 147 +++++++++++++++ .../gatk/genotyping/PloidyModel.java | 80 ++++++++ 7 files changed, 878 insertions(+) create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java create mode 100644 protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java new file mode 100644 index 000000000..557dfd0ad --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java @@ -0,0 +1,171 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; +import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; + +import java.util.List; + +/** + * Creates {@link org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods.Matrix} mappers to be used when working with a subset of the original alleles. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public abstract class AlleleLikelihoodMatrixMapper
{ + + public abstract ReadLikelihoods.Matrix map(final ReadLikelihoods.Matrix original); + + /** + * Instantiates a new mapper given an allele-list permutation. + * @param permutation the requested permutation. + * @param the allele type. + * + * @throws IllegalArgumentException if {@code permutation} is {@code null}. + * + * @return never {@code null}. + */ + public static AlleleLikelihoodMatrixMapper newInstance(final AlleleListPermutation permutation) { + if (permutation == null) + throw new IllegalArgumentException("the permutation must not be null"); + if (permutation.isNonPermuted()) + return asIs(); + else + return general(permutation); + } + + /** + * Returns trivial mapper that just maps to the original matrix without changes. + * + * @param the allele type. + * @return never {@code null}. + */ + @SuppressWarnings("unchecked") + private static AlleleLikelihoodMatrixMapper asIs() { + return AS_IS; + } + + @SuppressWarnings("unchecked") + private static final AlleleLikelihoodMatrixMapper AS_IS = new AlleleLikelihoodMatrixMapper() { + @Override + public ReadLikelihoods.Matrix map(final ReadLikelihoods.Matrix original) { + return original; + } + }; + + /** + * Constructs a new mapper instance that work with general permutation without making any assumption. + * @param permutation the permutation to apply to requested matrices wrappers. + * @param allele type. + * @return never {@code null}. + */ + private static AlleleLikelihoodMatrixMapper general(final AlleleListPermutation permutation) { + return new AlleleLikelihoodMatrixMapper() { + @Override + public ReadLikelihoods.Matrix map(final ReadLikelihoods.Matrix original) { + return new ReadLikelihoods.Matrix() { + + @Override + public List reads() { + return original.reads(); + } + + @Override + public List alleles() { + return permutation.toList(); + } + + @Override + public void set(final int alleleIndex, final int readIndex, final double value) { + original.set(permutation.fromIndex(alleleIndex),readIndex,value); + } + + @Override + public double get(final int alleleIndex, final int readIndex) { + return original.get(permutation.fromIndex(alleleIndex),readIndex); + } + + @Override + public int alleleIndex(final A allele) { + return permutation.alleleIndex(allele); + } + + @Override + public int readIndex(GATKSAMRecord read) { + return original.readIndex(read); + } + + @Override + public int alleleCount() { + return permutation.toSize(); + } + + @Override + public int readCount() { + return original.readCount(); + } + + @Override + public A alleleAt(final int alleleIndex) { + return original.alleleAt(permutation.fromIndex(alleleIndex)); + } + + @Override + public GATKSAMRecord readAt(final int readIndex) { + return original.readAt(readIndex); + } + + @Override + public void copyAlleleLikelihoods(final int alleleIndex, final double[] dest, final int offset) { + original.copyAlleleLikelihoods(permutation.fromIndex(alleleIndex),dest,offset); + } + }; + } + }; + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java new file mode 100644 index 000000000..12214d67e --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java @@ -0,0 +1,130 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; + +/** + * Encapsulates the data use to make the genotype calls. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypingData implements SampleList, AlleleList { + + private final PloidyModel ploidyModel; + + private final ReadLikelihoods likelihoods; + + /** + * Constructs a new genotyping-data collection providing the ploidy model to apply to the input model + * and the read-likelihoods collection. + * + * + * @param ploidyModel the ploidy model. + * @param likelihoods the read-likelihoods collection. + * + * @throws IllegalArgumentException if either {@code ploidyModel} or {@code likelihoods} is {@code null}, + * or they are not compatible in terms of the samples they contain; their lists must match. + */ + public GenotypingData(final PloidyModel ploidyModel, final ReadLikelihoods likelihoods) { + if (ploidyModel == null) + throw new IllegalArgumentException("the ploidy model cannot be null"); + if (likelihoods == null) + throw new IllegalArgumentException("the likelihood object cannot be null"); + this.ploidyModel = ploidyModel; + this.likelihoods = likelihoods; + if (!SampleListUtils.equals(ploidyModel,likelihoods)) + throw new IllegalArgumentException("sample list are different between ploidy-model and read-likelihood collection, perhaps just the order"); + } + + /** + * Returns the ploidy model that corresponds to the data provided. + * @return never {@code null}. + */ + public PloidyModel ploidyModel() { + return ploidyModel; + } + + @Override + public int sampleCount() { + return ploidyModel.sampleCount(); + } + + @Override + public int sampleIndex(final String sample) { + return ploidyModel.sampleIndex(sample); + } + + @Override + public String sampleAt(int sampleIndex) { + return ploidyModel.sampleAt(sampleIndex); + } + + /** + * Returns read-likelihoods to use for genotyping. + * @return never {@code null}. + */ + public ReadLikelihoods readLikelihoods() { + return likelihoods; + } + + @Override + public int alleleCount() { + return likelihoods.alleleCount(); + } + + @Override + public int alleleIndex(final A allele) { + return likelihoods.alleleIndex(allele); + } + + @Override + public A alleleAt(final int index) { + return likelihoods.alleleAt(index); + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java new file mode 100644 index 000000000..35787107f --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java @@ -0,0 +1,159 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; + +import java.util.List; + +/** + * Genotyping Likelihoods collection. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypingLikelihoods implements SampleList, AlleleList { + + private final GenotypeLikelihoods[] likelihoods; + + private final PloidyModel ploidyModel; + + private final AlleleList alleles; + + /** + * Creates a new genotyping-likelihoods collection given the genotype alleles, the sample ploidy model and the + * likelihoods themselves. + *

+ * Notice that this constructor does not check whether the likelihood array lengths corresponds to the sample plodies and + * number of alleles. + *

+ * + * @param alleles the genotyping alleles. + * @param ploidyModel the ploidy model. + * @param likelihoods the actual genotype likelihoods, one element per sample. + * + * @throws IllegalArgumentException if any argument is {@code null}, or the number of samples in {@code ploidyModel} + * does not correspond with the number of likelihoods arrays in {@code likelihoods} + */ + GenotypingLikelihoods(final AlleleList
alleles, final PloidyModel ploidyModel, + final List likelihoods) { + if (alleles == null) + throw new IllegalArgumentException("allele list cannot be null"); + if (ploidyModel == null) + throw new IllegalArgumentException("the ploidy model cannot be null"); + if (likelihoods == null) + throw new IllegalArgumentException("the likelihood collection cannot be null"); + if (ploidyModel.sampleCount() != likelihoods.size()) + throw new IllegalArgumentException("there must be exactly one likelihood set for each sample"); + + this.likelihoods = likelihoods.toArray(new GenotypeLikelihoods[likelihoods.size()]); + for (final GenotypeLikelihoods likelihood : this.likelihoods) + if (likelihood == null) + throw new IllegalArgumentException("no genotype likelihood is allowed to be null"); + + this.alleles = alleles; + this.ploidyModel = ploidyModel; + } + + @Override + public int sampleCount() { + return ploidyModel.sampleCount(); + } + + @Override + public int sampleIndex(final String sample) { + return ploidyModel.sampleIndex(sample); + } + + @Override + public String sampleAt(final int sampleIndex) { + return ploidyModel.sampleAt(sampleIndex); + } + + /** + * Returns the ploidy of the sample given its index in the collection. + * + * @param sampleIndex the query sample index. + * + * @throws IllegalArgumentException if {@code sampleIndex} is not a valid index for this collection: + * [0,{@link #sampleCount()). + * + * @return 0 or greater. + */ + public int samplePloidy(final int sampleIndex) { + return ploidyModel.samplePloidy(sampleIndex); + } + + /** + * Returns the genotype-likelihoods of the sample given its index in the collection. + * + * @param sampleIndex the query sample index. + * + * @throws IllegalArgumentException if {@code sampleIndex} is not a valid index for this collection: + * [0,{@link #sampleCount()). + * + * @return never {@code null}. + */ + public GenotypeLikelihoods sampleLikelihoods(final int sampleIndex) { + return likelihoods[sampleIndex]; + } + + @Override + public int alleleCount() { + return alleles.alleleCount(); + } + + @Override + public int alleleIndex(final A allele) { + return alleles.alleleIndex(allele); + } + + @Override + public A alleleAt(final int index) { + return alleles.alleleAt(index); + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java new file mode 100644 index 000000000..9c84c8962 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java @@ -0,0 +1,75 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; + +/** + * Common interface for genotyping models. + * + * Given a plo + * + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public interface GenotypingModel { + + /** + * Calculate genotype likelihoods given the genotype data and the set of + * alleles to genotype upon. + * + * @param genotypingAlleles the target alleles. + * @param data the data (read-likelihoods and ploidy) to genotype + * @param the allele type. + * + * @throws IllegalArgumentException if {@code genotypingData} or {@code genotypingAlleles} is {@code null}, + * or {@code genotypingData} does not cover the requested alleles. + * + * @return never {@code null}. + */ + public GenotypingLikelihoods calculateLikelihoods(final AlleleList genotypingAlleles, final GenotypingData data); +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java new file mode 100644 index 000000000..ed8d59a94 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java @@ -0,0 +1,116 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +/** +* {@link PloidyModel} implementation tailored to work with a homogeneous constant ploidy +* across samples and positions. +* +* @author Valentin Ruano-Rubio <valentin@broadinstitute.org> +*/ +public class HomogeneousPloidyModel implements PloidyModel, SampleList { + + private SampleList sampleList; + + private final int ploidy; + + /** + * Constructs a homogeneous ploidy model given the sample list and ploidy. + * + * @param samples the sample list. + * @param ploidy the common ploidy for all samples in {@code samples}. + * + * @throws IllegalArgumentException if {@code samples} is {@code null}, + * or ploidy is 0 or less. + */ + public HomogeneousPloidyModel(final SampleList samples, final int ploidy) { + if (ploidy <= 0) + throw new IllegalArgumentException("does not support negative ploidy"); + this.ploidy = ploidy; + + sampleList = samples; + } + + @Override + public int sampleCount() { + return sampleList.sampleCount(); + } + + @Override + public String sampleAt(final int index) { + return sampleList.sampleAt(index); + } + + @Override + public int sampleIndex(final String sample) { + return sampleList.sampleIndex(sample); + } + + @Override + public int samplePloidy(final int sampleIndex) { + checkSampleIndex(sampleIndex); + return ploidy; + } + + private void checkSampleIndex(final int sampleIndex) { + if (sampleIndex < 0) + throw new IllegalArgumentException("the sample index cannot be negative: " + sampleIndex); + if (sampleIndex >= sampleList.sampleCount()) + throw new IllegalArgumentException("the sample index is equal or larger than the sample count: " + sampleIndex + " >= " + sampleList.sampleCount()); + } + + @Override + public boolean isHomogeneous() { + return true; + } + + @Override + public int totalPloidy() { + return ploidy * sampleList.sampleCount(); + } + +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java new file mode 100644 index 000000000..6b0594ee0 --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java @@ -0,0 +1,147 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; + +import java.util.ArrayList; +import java.util.Collections; +import java.util.List; + +/** + * The infinite-population-genotyping assumes that samples belong to individuals taken at random + * from a very large population that mate at random. + *

+ * Consequently genotypes calls between samples are totally independent conditional to the frequencies in + * the population they coming from. And genotypes should exhibit the ratios expected under HWE. + *

+ * Therefore each sample genotype likelihoods can be considered to + * be independent from all other samples. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class InfiniteRandomMatingPopulationModel implements GenotypingModel { + + @Override + public
GenotypingLikelihoods calculateLikelihoods(final AlleleList genotypingAlleles, final GenotypingData data) { + if (genotypingAlleles == null) + throw new IllegalArgumentException("the allele cannot be null"); + if (data == null) + throw new IllegalArgumentException("the genotyping data cannot be null"); + + final AlleleListPermutation permutation = AlleleListUtils.permutation(data,genotypingAlleles); + final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper = AlleleLikelihoodMatrixMapper.newInstance(permutation); + + final int sampleCount = data.sampleCount(); + + switch (sampleCount) { + case 0: return noSampleLikelihoods(permutation,data); + case 1: return singleSampleLikelihoods(genotypingAlleles,data,alleleLikelihoodMatrixMapper); + default: + final PloidyModel ploidyModel = data.ploidyModel(); + return ploidyModel.isHomogeneous() ? multiSampleHomogeneousPloidyModelLikelihoods(genotypingAlleles, data, alleleLikelihoodMatrixMapper, sampleCount, ploidyModel) + : multiSampleHeterogeneousPloidyModelLikelihoods(genotypingAlleles, data, alleleLikelihoodMatrixMapper, sampleCount, ploidyModel); + } + } + + private GenotypingLikelihoods noSampleLikelihoods(final AlleleList genotypingAlleles, + final GenotypingData data) { + @SuppressWarnings("unchecked") + final List likelihoods = Collections.EMPTY_LIST; + return new GenotypingLikelihoods<>(genotypingAlleles,data.ploidyModel(), likelihoods); + + } + + private GenotypingLikelihoods singleSampleLikelihoods(final AlleleList genotypingAlleles, + final GenotypingData data, + final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper) { + final PloidyModel ploidyModel = data.ploidyModel(); + final int samplePloidy = ploidyModel.samplePloidy(0); + final int alleleCount = genotypingAlleles.alleleCount(); + final GenotypeLikelihoodCalculator likelihoodsCalculator = + GenotypeLikelihoodCalculator.getInstance(samplePloidy,alleleCount); + final ReadLikelihoods.Matrix sampleLikelihoods = alleleLikelihoodMatrixMapper.map(data.readLikelihoods().sampleMatrix(0)); + final List genotypeLikelihoods = Collections.singletonList(likelihoodsCalculator.genotypeLikelihoods(sampleLikelihoods)); + return new GenotypingLikelihoods<>(genotypingAlleles,ploidyModel,genotypeLikelihoods); + } + + private GenotypingLikelihoods multiSampleHeterogeneousPloidyModelLikelihoods(final AlleleList genotypingAlleles, + final GenotypingData data, + final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper, + final int sampleCount, + final PloidyModel ploidyModel) { + final List genotypeLikelihoods = new ArrayList<>(sampleCount); + final int alleleCount = genotypingAlleles.alleleCount(); + for (int i = 0; i < sampleCount; i++) { + final int samplePloidy = ploidyModel.samplePloidy(i); + final GenotypeLikelihoodCalculator likelihoodsCalculator = + GenotypeLikelihoodCalculator.getInstance(samplePloidy,alleleCount); + final ReadLikelihoods.Matrix sampleLikelihoods = alleleLikelihoodMatrixMapper.map(data.readLikelihoods().sampleMatrix(i)); + genotypeLikelihoods.add(likelihoodsCalculator.genotypeLikelihoods(sampleLikelihoods)); + } + return new GenotypingLikelihoods<>(genotypingAlleles,ploidyModel,genotypeLikelihoods); + } + + private GenotypingLikelihoods multiSampleHomogeneousPloidyModelLikelihoods(final AlleleList genotypingAlleles, + final GenotypingData data, + final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper, + final int sampleCount, + final PloidyModel ploidyModel) { + final int samplePloidy = ploidyModel.samplePloidy(0); + final List genotypeLikelihoods = new ArrayList<>(sampleCount); + final int alleleCount = genotypingAlleles.alleleCount(); + final GenotypeLikelihoodCalculator likelihoodsCalculator = + GenotypeLikelihoodCalculator.getInstance(samplePloidy,alleleCount); + for (int i = 0; i < sampleCount; i++) { + final ReadLikelihoods.Matrix sampleLikelihoods = alleleLikelihoodMatrixMapper.map(data.readLikelihoods().sampleMatrix(i)); + genotypeLikelihoods.add(likelihoodsCalculator.genotypeLikelihoods(sampleLikelihoods)); + } + return new GenotypingLikelihoods<>(genotypingAlleles,ploidyModel,genotypeLikelihoods); + } +} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java new file mode 100644 index 000000000..8ca00611e --- /dev/null +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java @@ -0,0 +1,80 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.genotyping; + +/** + * Information about the number of chromosome per sample at a given location. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public interface PloidyModel extends SampleList { + + /** + * Return the assumed ploidy for a sample given its index. + * + * @param sampleIndex target sample index. + * @return 0 or greater. + */ + public int samplePloidy(final int sampleIndex); + + /** + * Checks whether the ploidy is homogeneous across all samples. + * + * @return {@code true} if all samples has the same ploidy. + */ + public boolean isHomogeneous(); + + /** + * Sum of all ploidy across all samples. + *

+ * It must match the sum of all ploidies across samples. + *

+ * + * @return 0 or greater. + */ + public int totalPloidy(); +} From 9ee9da36bb206d57b07987bdc10c9bbda69f3516 Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Mon, 18 Aug 2014 15:29:28 -0400 Subject: [PATCH 5/7] Generalize the calculation of the genotype likelihoods in HC to cope with haploid and multiploidy Changes in several walker to use new sample, allele closed lists and new GenotypingEngine constructors signatures Rebase adoption of new calculation system in walkers --- .../StandardCallerArgumentCollection.java | 2 +- .../InfiniteRandomMatingPopulationModel.java | 45 +++++- .../GeneralPloidyGenotypeLikelihoods.java | 24 ++- .../walkers/genotyper/GenotypingEngine.java | 64 +++----- .../walkers/genotyper/UnifiedGenotyper.java | 35 +++-- .../genotyper/UnifiedGenotypingEngine.java | 55 ++++--- .../genotyper/afcalc/AFCalcFactory.java | 41 ++--- .../afcalc/GeneralPloidyExactAFCalc.java | 2 +- ...GraphBasedLikelihoodCalculationEngine.java | 3 +- ...edLikelihoodCalculationEngineInstance.java | 12 +- .../haplotypecaller/HaplotypeCaller.java | 88 ++++++----- .../HaplotypeCallerArgumentCollection.java | 2 +- .../HaplotypeCallerGenotypingEngine.java | 105 ++++++++----- .../PairHMMLikelihoodCalculationEngine.java | 12 +- .../RandomLikelihoodCalculationEngine.java | 19 +-- .../ReadLikelihoodCalculationEngine.java | 4 +- .../haplotypecaller/RefVsAnyResult.java | 32 +++- .../ReferenceConfidenceModel.java | 146 +++++++++++++++--- .../indels/PairHMMIndelErrorModel.java | 7 +- .../validation/GenotypeAndValidate.java | 6 +- .../walkers/variantutils/GenotypeGVCFs.java | 17 +- .../variantutils/RegenotypeVariants.java | 14 +- .../gatk/utils/gvcf/GVCFWriter.java | 60 +++---- .../gatk/utils/gvcf/HomRefBlock.java | 38 +++-- .../haplotype/HaplotypeLDCalculator.java | 7 +- .../UnifiedGenotyperEngineUnitTest.java | 14 +- ...LikelihoodCalculationEnginesBenchmark.java | 5 +- ...ngLikelihoodCalculationEngineUnitTest.java | 5 +- .../ReferenceConfidenceModelUnitTest.java | 37 +++-- .../genotyper/ReadLikelihoodsUnitTest.java | 50 +++--- .../gatk/utils/gvcf/GVCFWriterUnitTest.java | 40 ++--- .../gatk/utils/gvcf/HomRefBlockUnitTest.java | 13 +- .../gatk/engine/GenomeAnalysisEngine.java | 30 +++- .../gatk/genotyping/AlleleListUtils.java | 28 ++++ .../gatk/genotyping/SampleListUtils.java | 27 ++++ .../gatk/utils/SampleUtils.java | 4 +- .../variant/GATKVariantContextUtils.java | 18 +++ 37 files changed, 712 insertions(+), 399 deletions(-) diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/engine/arguments/StandardCallerArgumentCollection.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/engine/arguments/StandardCallerArgumentCollection.java index 7c69ab014..3f7794b24 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/engine/arguments/StandardCallerArgumentCollection.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/engine/arguments/StandardCallerArgumentCollection.java @@ -145,7 +145,7 @@ public class StandardCallerArgumentCollection implements Cloneable { */ @Hidden @Argument(fullName = "p_nonref_model", shortName = "pnrm", doc = "Non-reference probability calculation model to employ", required = false) - public AFCalcFactory.Calculation AFmodel = AFCalcFactory.Calculation.getDefaultModel(); + public AFCalcFactory.Calculation requestedAlleleFrequencyCalculationModel; @Hidden @Argument(shortName = "logExactCalls", doc="x", required=false) diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java index 6b0594ee0..f476d940c 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java @@ -68,6 +68,28 @@ import java.util.List; */ public class InfiniteRandomMatingPopulationModel implements GenotypingModel { + private final int cachePloidyCapacity; + private final int cacheAlleleCountCapacity; + private ThreadLocal likelihoodCalculators; + + /** + * Create a new infinite model instance. + */ + public InfiniteRandomMatingPopulationModel() { + this(10,50); + } + + public InfiniteRandomMatingPopulationModel(final int calculatorCachePloidyCapacity, final int calculatorCacheAlleleCapacity) { + cachePloidyCapacity = calculatorCachePloidyCapacity; + cacheAlleleCountCapacity = calculatorCachePloidyCapacity; + likelihoodCalculators = new ThreadLocal( ) { + @Override + public GenotypeLikelihoodCalculator[][] initialValue() { + return new GenotypeLikelihoodCalculator[calculatorCachePloidyCapacity][calculatorCacheAlleleCapacity]; + } + }; + } + @Override public
GenotypingLikelihoods calculateLikelihoods(final AlleleList genotypingAlleles, final GenotypingData data) { if (genotypingAlleles == null) @@ -99,18 +121,27 @@ public class InfiniteRandomMatingPopulationModel implements GenotypingModel { } private GenotypingLikelihoods singleSampleLikelihoods(final AlleleList genotypingAlleles, - final GenotypingData data, - final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper) { + final GenotypingData data, + final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper) { final PloidyModel ploidyModel = data.ploidyModel(); final int samplePloidy = ploidyModel.samplePloidy(0); final int alleleCount = genotypingAlleles.alleleCount(); - final GenotypeLikelihoodCalculator likelihoodsCalculator = - GenotypeLikelihoodCalculator.getInstance(samplePloidy,alleleCount); + final GenotypeLikelihoodCalculator likelihoodsCalculator = getLikelihoodsCalculator(samplePloidy,alleleCount); final ReadLikelihoods.Matrix sampleLikelihoods = alleleLikelihoodMatrixMapper.map(data.readLikelihoods().sampleMatrix(0)); final List genotypeLikelihoods = Collections.singletonList(likelihoodsCalculator.genotypeLikelihoods(sampleLikelihoods)); return new GenotypingLikelihoods<>(genotypingAlleles,ploidyModel,genotypeLikelihoods); } + private GenotypeLikelihoodCalculator getLikelihoodsCalculator(final int samplePloidy, final int alleleCount) { + if (samplePloidy >= cacheAlleleCountCapacity) + return GenotypeLikelihoodCalculators.getInstance(samplePloidy, alleleCount); + else if (alleleCount >= cacheAlleleCountCapacity) + return GenotypeLikelihoodCalculators.getInstance(samplePloidy, alleleCount); + final GenotypeLikelihoodCalculator[][] cache = likelihoodCalculators.get(); + final GenotypeLikelihoodCalculator result = cache[samplePloidy][alleleCount]; + return result != null ? result : (cache[samplePloidy][alleleCount] = GenotypeLikelihoodCalculators.getInstance(samplePloidy, alleleCount)); + } + private GenotypingLikelihoods multiSampleHeterogeneousPloidyModelLikelihoods(final AlleleList genotypingAlleles, final GenotypingData data, final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper, @@ -120,8 +151,7 @@ public class InfiniteRandomMatingPopulationModel implements GenotypingModel { final int alleleCount = genotypingAlleles.alleleCount(); for (int i = 0; i < sampleCount; i++) { final int samplePloidy = ploidyModel.samplePloidy(i); - final GenotypeLikelihoodCalculator likelihoodsCalculator = - GenotypeLikelihoodCalculator.getInstance(samplePloidy,alleleCount); + final GenotypeLikelihoodCalculator likelihoodsCalculator = getLikelihoodsCalculator(samplePloidy,alleleCount); final ReadLikelihoods.Matrix sampleLikelihoods = alleleLikelihoodMatrixMapper.map(data.readLikelihoods().sampleMatrix(i)); genotypeLikelihoods.add(likelihoodsCalculator.genotypeLikelihoods(sampleLikelihoods)); } @@ -136,8 +166,7 @@ public class InfiniteRandomMatingPopulationModel implements GenotypingModel { final int samplePloidy = ploidyModel.samplePloidy(0); final List genotypeLikelihoods = new ArrayList<>(sampleCount); final int alleleCount = genotypingAlleles.alleleCount(); - final GenotypeLikelihoodCalculator likelihoodsCalculator = - GenotypeLikelihoodCalculator.getInstance(samplePloidy,alleleCount); + final GenotypeLikelihoodCalculator likelihoodsCalculator = getLikelihoodsCalculator(samplePloidy,alleleCount); for (int i = 0; i < sampleCount; i++) { final ReadLikelihoods.Matrix sampleLikelihoods = alleleLikelihoodMatrixMapper.map(data.readLikelihoods().sampleMatrix(i)); genotypeLikelihoods.add(likelihoodsCalculator.genotypeLikelihoods(sampleLikelihoods)); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java index 0495db541..5abb1cd85 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java @@ -47,16 +47,19 @@ package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.samtools.SAMUtils; +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; +import htsjdk.variant.vcf.VCFConstants; +import org.broadinstitute.gatk.genotyping.GenotypeAlleleCounts; +import org.broadinstitute.gatk.genotyping.GenotypeLikelihoodCalculator; +import org.broadinstitute.gatk.genotyping.GenotypeLikelihoodCalculators; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.ExactACcounts; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.ExactACset; import org.broadinstitute.gatk.utils.MathUtils; -import htsjdk.variant.vcf.VCFConstants; import org.broadinstitute.gatk.utils.collections.Pair; import org.broadinstitute.gatk.utils.exceptions.ReviewedGATKException; import org.broadinstitute.gatk.utils.exceptions.UserException; import org.broadinstitute.gatk.utils.pileup.ReadBackedPileup; -import htsjdk.variant.variantcontext.Allele; -import htsjdk.variant.variantcontext.GenotypeLikelihoods; import java.util.*; @@ -424,18 +427,9 @@ public abstract class GeneralPloidyGenotypeLikelihoods { */ public static int[] getAlleleCountFromPLIndex(final int nAlleles, final int numChromosomes, final int PLindex) { - // todo - another brain-dead inefficient implementation, can do much better by computing in closed form - final SumIterator iterator = new SumIterator(nAlleles,numChromosomes); - while (iterator.hasNext()) { - final int[] plVec = iterator.getCurrentVector(); - if (iterator.getLinearIndex() == PLindex) - return plVec; - - iterator.next(); - } - - return null; - + final GenotypeLikelihoodCalculator calculator = GenotypeLikelihoodCalculators.getInstance(numChromosomes, nAlleles); + final GenotypeAlleleCounts alleleCounts = calculator.genotypeAlleleCountsAt(PLindex); + return alleleCounts.alleleCountsByIndex(nAlleles - 1); } /* diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java index 97a98e704..8225ba9a5 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java @@ -48,15 +48,17 @@ package org.broadinstitute.gatk.tools.walkers.genotyper; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; +import htsjdk.variant.variantcontext.*; +import htsjdk.variant.vcf.VCFConstants; import htsjdk.variant.vcf.VCFHeaderLineType; import htsjdk.variant.vcf.VCFInfoHeaderLine; import org.apache.log4j.Logger; -import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.arguments.StandardCallerArgumentCollection; import org.broadinstitute.gatk.engine.contexts.AlignmentContext; import org.broadinstitute.gatk.engine.contexts.AlignmentContextUtils; import org.broadinstitute.gatk.engine.contexts.ReferenceContext; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.tools.walkers.annotator.VariantAnnotatorEngine; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalc; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalcFactory; @@ -69,8 +71,6 @@ import org.broadinstitute.gatk.utils.exceptions.UserException; import org.broadinstitute.gatk.utils.gga.GenotypingGivenAllelesUtils; import org.broadinstitute.gatk.utils.pileup.ReadBackedPileup; import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; -import htsjdk.variant.variantcontext.*; -import htsjdk.variant.vcf.VCFConstants; import java.util.*; @@ -86,22 +86,20 @@ public abstract class GenotypingEngine sampleNames; + protected final SampleList samples; private final double[] log10AlleleFrequencyPriorsSNPs; private final double[] log10AlleleFrequencyPriorsIndels; - private final GenomeLocParser genomeLocParser; + protected final GenomeLocParser genomeLocParser; // the model used for calculating p(non-ref) protected ThreadLocal afcm = new ThreadLocal() { @@ -111,59 +109,32 @@ public abstract class GenotypingEngine resolveSampleNamesFromToolkit(final GenomeAnalysisEngine toolkit) { - if (toolkit == null) - throw new IllegalArgumentException("the toolkit cannot be null"); - return new LinkedHashSet<>(toolkit.getSampleDB().getSampleNames()); - } /** * Construct a new genotyper engine, on a specific subset of samples. * - * @param toolkit reference to the genome-analysis toolkit. * @param configuration engine configuration object. - * @param sampleNames subset of sample to work on identified by their names. If {@code null}, the full toolkit + * @param samples subset of sample to work on identified by their names. If {@code null}, the full toolkit * sample set will be used instead. + * @param genomeLocParser the genome-loc-parser * - * @throws IllegalArgumentException if either {@code toolkit} or {@code configuration} is {@code null}. + * @throws IllegalArgumentException if any of {@code samples}, {@code configuration} or {@code genomeLocParser} is {@code null}. */ - protected GenotypingEngine(final GenomeAnalysisEngine toolkit, final Config configuration,final Set sampleNames) { - if (toolkit == null) - throw new IllegalArgumentException("the toolkit cannot be null"); + protected GenotypingEngine(final Config configuration,final SampleList samples, final GenomeLocParser genomeLocParser) { + if (configuration == null) throw new IllegalArgumentException("the configuration cannot be null"); this.configuration = configuration; logger = Logger.getLogger(getClass()); - this.toolkit = toolkit; - this.sampleNames = sampleNames != null ? sampleNames : toolkit.getSampleDB().getSampleNames(); - numberOfGenomes = this.sampleNames.size() * configuration.genotypeArgs.samplePloidy; + this.samples = samples; + numberOfGenomes = this.samples.sampleCount() * configuration.genotypeArgs.samplePloidy; MathUtils.Log10Cache.ensureCacheContains(numberOfGenomes * 2); log10AlleleFrequencyPriorsSNPs = computeAlleleFrequencyPriors(numberOfGenomes, configuration.genotypeArgs.snpHeterozygosity,configuration.genotypeArgs.inputPrior); log10AlleleFrequencyPriorsIndels = computeAlleleFrequencyPriors(numberOfGenomes, configuration.genotypeArgs.indelHeterozygosity,configuration.genotypeArgs.inputPrior); - genomeLocParser = toolkit.getGenomeLocParser(); + this.genomeLocParser = genomeLocParser; } /** @@ -257,7 +228,7 @@ public abstract class GenotypingEngine outputAlleles = outputAlternativeAlleles.outputAlleles(vc.getReference()); final VariantContextBuilder builder = new VariantContextBuilder(callSourceString(), loc.getContig(), loc.getStart(), loc.getStop(), outputAlleles); @@ -506,7 +480,9 @@ public abstract class GenotypingEngine, Unif * Which annotations to add to the output VCF file. See the VariantAnnotator -list argument to view available annotations. */ @Argument(fullName="annotation", shortName="A", doc="One or more specific annotations to apply to variant calls", required=false) - protected List annotationsToUse = new ArrayList(); + protected List annotationsToUse = new ArrayList<>(); /** * Which annotations to exclude from output in the VCF file. Note that this argument has higher priority than the -A or -G arguments, * so annotations will be excluded even if they are explicitly included with the other options. */ @Argument(fullName="excludeAnnotation", shortName="XA", doc="One or more specific annotations to exclude", required=false) - protected List annotationsToExclude = new ArrayList(); + protected List annotationsToExclude = new ArrayList<>(); /** * If specified, all available annotations in the group will be applied. See the VariantAnnotator -list argument to view available groups. @@ -218,11 +221,6 @@ public class UnifiedGenotyper extends LocusWalker, Unif // the calculation arguments private UnifiedGenotypingEngine genotypingEngine = null; - // the annotation engine - private VariantAnnotatorEngine annotationEngine; - - private Set samples; - // enable deletions in the pileup @Override public boolean includeReadsWithDeletionAtLoci() { return true; } @@ -256,17 +254,22 @@ public class UnifiedGenotyper extends LocusWalker, Unif * **/ public void initialize() { + super.initialize(); + final GenomeAnalysisEngine toolkit = getToolkit(); + final Set sampleNameSet; if ( UAC.TREAT_ALL_READS_AS_SINGLE_POOL ) { - samples.add(GenotypeLikelihoodsCalculationModel.DUMMY_SAMPLE_NAME); + sampleNameSet = Collections.singleton(GenotypeLikelihoodsCalculationModel.DUMMY_SAMPLE_NAME); } else { // get all of the unique sample names - samples = SampleUtils.getSAMFileSamples(getToolkit().getSAMFileHeader()); + sampleNameSet = SampleUtils.getSAMFileSamples(toolkit.getSAMFileHeader()); if ( UAC.referenceSampleName != null ) - samples.remove(UAC.referenceSampleName); + sampleNameSet.remove(UAC.referenceSampleName); } + final SampleList samples = new IndexedSampleList(sampleNameSet); + if ( UAC.CONTAMINATION_FRACTION_FILE != null ) - UAC.setSampleContamination(AlleleBiasedDownsamplingUtils.loadContaminationFile(UAC.CONTAMINATION_FRACTION_FILE, UAC.CONTAMINATION_FRACTION, samples, logger)); + UAC.setSampleContamination(AlleleBiasedDownsamplingUtils.loadContaminationFile(UAC.CONTAMINATION_FRACTION_FILE, UAC.CONTAMINATION_FRACTION, sampleNameSet, logger)); // check for a bad max alleles value if ( UAC.genotypeArgs.MAX_ALTERNATE_ALLELES > GenotypeLikelihoods.MAX_ALT_ALLELES_THAT_CAN_BE_GENOTYPED) @@ -282,8 +285,8 @@ public class UnifiedGenotyper extends LocusWalker, Unif if ( verboseWriter != null ) verboseWriter.println("AFINFO\tLOC\tREF\tALT\tMAF\tF\tAFprior\tMLE\tMAP"); - annotationEngine = new VariantAnnotatorEngine(Arrays.asList(annotationClassesToUse), annotationsToUse, annotationsToExclude, this, getToolkit()); - genotypingEngine = new UnifiedGenotypingEngine(getToolkit(), UAC, samples); + final VariantAnnotatorEngine annotationEngine = new VariantAnnotatorEngine(Arrays.asList(annotationClassesToUse), annotationsToUse, annotationsToExclude, this, getToolkit()); + genotypingEngine = new UnifiedGenotypingEngine(UAC, samples, toolkit.getGenomeLocParser(), toolkit.getArguments().BAQMode); genotypingEngine.setVerboseWriter(verboseWriter); genotypingEngine.setAnnotationEngine(annotationEngine); @@ -298,11 +301,11 @@ public class UnifiedGenotyper extends LocusWalker, Unif final Set samplesForHeader; if ( ! onlyEmitSamples.isEmpty() ) { // make sure that onlyEmitSamples is a subset of samples - if ( ! samples.containsAll(onlyEmitSamples) ) + if ( ! sampleNameSet.containsAll(onlyEmitSamples) ) throw new UserException.BadArgumentValue("onlyEmitSamples", "must be a strict subset of the samples in the BAM files but is wasn't"); samplesForHeader = onlyEmitSamples; } else { - samplesForHeader = samples; + samplesForHeader = sampleNameSet; } writer.writeHeader(new VCFHeader(headerInfo, samplesForHeader)); } @@ -310,7 +313,7 @@ public class UnifiedGenotyper extends LocusWalker, Unif public static Set getHeaderInfo(final UnifiedArgumentCollection UAC, final VariantAnnotatorEngine annotationEngine, final DbsnpArgumentCollection dbsnp) { - Set headerInfo = new HashSet(); + final Set headerInfo = new HashSet<>(); // all annotation fields from VariantAnnotatorEngine if ( annotationEngine != null ) diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java index 36ac2e5bf..22bc09e98 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java @@ -45,12 +45,16 @@ */ package org.broadinstitute.gatk.tools.walkers.genotyper; +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypesContext; +import htsjdk.variant.variantcontext.VariantContext; import org.apache.log4j.Logger; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.contexts.AlignmentContext; import org.broadinstitute.gatk.engine.contexts.AlignmentContextUtils; import org.broadinstitute.gatk.engine.contexts.ReferenceContext; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalcResult; import org.broadinstitute.gatk.utils.BaseUtils; import org.broadinstitute.gatk.utils.GenomeLocParser; @@ -62,9 +66,6 @@ import org.broadinstitute.gatk.utils.gga.GenotypingGivenAllelesUtils; import org.broadinstitute.gatk.utils.pileup.PileupElement; import org.broadinstitute.gatk.utils.pileup.ReadBackedPileup; import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; -import htsjdk.variant.variantcontext.Allele; -import htsjdk.variant.variantcontext.GenotypesContext; -import htsjdk.variant.variantcontext.VariantContext; import java.io.PrintStream; import java.lang.reflect.Constructor; @@ -88,7 +89,6 @@ public class UnifiedGenotypingEngine extends GenotypingEngineThe new engine won't emmit annotations, will use the full sample set and will not produce additional verbose - * output

+ * Creates a new unified genotyping given the UG configuration parameters and the GA engine. + * @param configuration the UG configuration. + * @param toolkit the GA engine. * - * @param toolkit reference to the enclosing genome analysis engine. - * @param configuration configuration object. - * - * @throws IllegalArgumentException if either {@code toolkit} or {@code UAC} is {@code null}. + * @throws NullPointerException if either {@code configuration} or {@code toolkit} is {@code null}. */ - public UnifiedGenotypingEngine(final GenomeAnalysisEngine toolkit, final UnifiedArgumentCollection configuration) { - this(toolkit, configuration, null); + public UnifiedGenotypingEngine(final UnifiedArgumentCollection configuration, + final GenomeAnalysisEngine toolkit) { + this(configuration,toolkit.getSampleList(),toolkit.getGenomeLocParser(),toolkit.getArguments().BAQMode); } + /** - * Constructs a new Unified-Genotyper engine. + * Creates a new unified genotyping given the UG configuration parameters, the targeted set of samples and + * a genome location parser. * - * @param toolkit reference to the enclosing genome analysis engine. - * @param configuration configuration object. - * @param sampleNames subset of sample names to work on. If {@code null}, all it will use the {@code toolkit} full sample set. + * @param configuration the UG configuration. + * @param samples {@inheritDoc} + * @param baqCalculationMode the BAQ calculation mode. * - * @throws IllegalArgumentException if either {@code toolkit} or {@code UAC} is {@code null}. + * @throws NullPointerException if any of {@code configuration}, {@code samples} or {@code genomeLocParser} is {@code null}. + * + * @throws IllegalArgumentException if {@code baqCalculationMode} is {@code null}. */ - public UnifiedGenotypingEngine(final GenomeAnalysisEngine toolkit, final UnifiedArgumentCollection configuration, - final Set sampleNames) { + public UnifiedGenotypingEngine(final UnifiedArgumentCollection configuration, + final SampleList samples, final GenomeLocParser genomeLocParser, + final BAQ.CalculationMode baqCalculationMode) { - super(toolkit,configuration,sampleNames); + super(configuration,samples,genomeLocParser); - this.BAQEnabledOnCMDLine = toolkit.getArguments().BAQMode != BAQ.CalculationMode.OFF; - genomeLocParser = toolkit.getGenomeLocParser(); + if (baqCalculationMode == null) + throw new IllegalArgumentException("the BAQ calculation mode cannot be null"); + + this.BAQEnabledOnCMDLine = baqCalculationMode != BAQ.CalculationMode.OFF; determineGLModelsToUse(); @@ -302,7 +308,8 @@ public class UnifiedGenotypingEngine extends GenotypingEngine perReadAlleleLikelihoodMap) { - return glcm.get().get(model.name()).getLikelihoods(tracker, refContext, stratifiedContexts, type, alternateAllelesToUse, useBAQedPileup && BAQEnabledOnCMDLine, genomeLocParser, perReadAlleleLikelihoodMap); + return glcm.get().get(model.name()).getLikelihoods(tracker, refContext, stratifiedContexts, type, alternateAllelesToUse, useBAQedPileup && BAQEnabledOnCMDLine, + genomeLocParser != null || refContext == null ? genomeLocParser : refContext.getGenomeLocParser(), perReadAlleleLikelihoodMap); } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/AFCalcFactory.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/AFCalcFactory.java index e4cbf0b5d..ad4ce979a 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/AFCalcFactory.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/AFCalcFactory.java @@ -48,10 +48,8 @@ package org.broadinstitute.gatk.tools.walkers.genotyper.afcalc; import org.apache.log4j.Logger; import org.broadinstitute.gatk.engine.arguments.StandardCallerArgumentCollection; -import org.broadinstitute.gatk.utils.Utils; import org.broadinstitute.gatk.utils.classloader.PluginManager; import org.broadinstitute.gatk.utils.exceptions.ReviewedGATKException; -import org.broadinstitute.gatk.utils.exceptions.UserException; import java.lang.reflect.Constructor; import java.util.LinkedList; @@ -105,6 +103,24 @@ public class AFCalcFactory { } public static Calculation getDefaultModel() { return EXACT_INDEPENDENT; } + + /** + * Returns the best (fastest) model give the required ploidy and alternative allele count. + * @param requiredPloidy required ploidy + * @param requiredAlternativeAlleleCount required alternative allele count. + * @param preferredModel a preferred mode if any. A {@code null} indicate that we should be try to use the default instead. + * @return never {@code null} + */ + public static Calculation getBestModel(final int requiredPloidy, final int requiredAlternativeAlleleCount, final Calculation preferredModel) { + final Calculation preferred = preferredModel == null ? getDefaultModel() : preferredModel; + if (preferred.usableForParams(requiredPloidy,requiredAlternativeAlleleCount)) + return preferred; + if (EXACT_INDEPENDENT.usableForParams(requiredPloidy,requiredAlternativeAlleleCount)) + return EXACT_INDEPENDENT; + if (EXACT_REFERENCE.usableForParams(requiredPloidy,requiredAlternativeAlleleCount)) + return EXACT_REFERENCE; + return EXACT_GENERAL_PLOIDY; + } } private static final Map> afClasses; @@ -137,25 +153,10 @@ public class AFCalcFactory { public static AFCalc createAFCalc(final StandardCallerArgumentCollection UAC, final int nSamples, final Logger logger) { - final int maxAltAlleles = UAC.genotypeArgs.MAX_ALTERNATE_ALLELES; - if ( ! UAC.AFmodel.usableForParams(UAC.genotypeArgs.samplePloidy, maxAltAlleles) ) { - logger.info("Requested ploidy " + UAC.genotypeArgs.samplePloidy + " maxAltAlleles " + maxAltAlleles + " not supported by requested model " + UAC.AFmodel + " looking for an option"); - final List supportingCalculations = new LinkedList(); - for ( final Calculation calc : Calculation.values() ) { - if ( calc.usableForParams(UAC.genotypeArgs.samplePloidy, maxAltAlleles) ) - supportingCalculations.add(calc); - } + final Calculation afCalculationModel = Calculation.getBestModel(UAC.genotypeArgs.samplePloidy,UAC.genotypeArgs.MAX_ALTERNATE_ALLELES, + UAC.requestedAlleleFrequencyCalculationModel); - if ( supportingCalculations.isEmpty() ) - throw new UserException("no AFCalculation model found that supports ploidy of " + UAC.genotypeArgs.samplePloidy + " and max alt alleles " + maxAltAlleles); - else if ( supportingCalculations.size() > 1 ) - logger.debug("Warning, multiple supporting AFCalcs found " + Utils.join(",", supportingCalculations) + " choosing first arbitrarily"); - else - UAC.AFmodel = supportingCalculations.get(0); - logger.info("Selecting model " + UAC.AFmodel); - } - - final AFCalc calc = createAFCalc(UAC.AFmodel, nSamples, maxAltAlleles, UAC.genotypeArgs.samplePloidy); + final AFCalc calc = createAFCalc(afCalculationModel, nSamples, UAC.genotypeArgs.MAX_ALTERNATE_ALLELES, UAC.genotypeArgs.samplePloidy); if ( logger != null ) calc.setLogger(logger); if ( UAC.exactCallsLog != null ) calc.enableProcessLog(UAC.exactCallsLog); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java index 500cdf4ce..98df248aa 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java @@ -56,7 +56,7 @@ import htsjdk.variant.variantcontext.*; import java.util.*; public class GeneralPloidyExactAFCalc extends ExactAFCalc { - static final int MAX_LENGTH_FOR_POOL_PL_LOGGING = 10; // if PL vectors longer than this # of elements, don't log them + static final int MAX_LENGTH_FOR_POOL_PL_LOGGING = 100; // if PL vectors longer than this # of elements, don't log them private final int ploidy; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java index ace4f22d2..0008f5b28 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java @@ -47,6 +47,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import org.apache.log4j.Logger; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.SeqGraph; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; @@ -113,7 +114,7 @@ public class GraphBasedLikelihoodCalculationEngine implements ReadLikelihoodCalc } @Override - public ReadLikelihoods computeReadLikelihoods(final AssemblyResultSet assemblyResultSet, final List samples, final Map> perSampleReadList) { + public ReadLikelihoods computeReadLikelihoods(final AssemblyResultSet assemblyResultSet, final SampleList samples, final Map> perSampleReadList) { final GraphBasedLikelihoodCalculationEngineInstance graphLikelihoodEngine = new GraphBasedLikelihoodCalculationEngineInstance(assemblyResultSet, hmm,log10GlobalReadMismappingRate,heterogeneousKmerSizeResolution); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java index 7d4b3db1a..e2229cd50 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java @@ -46,7 +46,11 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; +import htsjdk.variant.variantcontext.Allele; import org.apache.log4j.Logger; +import org.broadinstitute.gatk.genotyping.AlleleList; +import org.broadinstitute.gatk.genotyping.IndexedAlleleList; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.MultiSampleEdge; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.Path; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.Route; @@ -61,7 +65,6 @@ import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.pairhmm.FlexibleHMM; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; -import htsjdk.variant.variantcontext.Allele; import java.util.*; @@ -233,12 +236,13 @@ public class GraphBasedLikelihoodCalculationEngineInstance { * @return never {@code null}, and with at least one entry for input sample (keys in {@code perSampleReadList}. * The value maps can be potentially empty though. */ - public ReadLikelihoods computeReadLikelihoods(final List haplotypes, final List samples, + public ReadLikelihoods computeReadLikelihoods(final List haplotypes, final SampleList samples, final Map> perSampleReadList) { // General preparation on the input haplotypes: - final ReadLikelihoods result = new ReadLikelihoods<>(samples, haplotypes, perSampleReadList); final List sortedHaplotypes = new ArrayList<>(haplotypes); Collections.sort(sortedHaplotypes, Haplotype.ALPHANUMERICAL_COMPARATOR); + final AlleleList alleles = new IndexedAlleleList<>(sortedHaplotypes); + final ReadLikelihoods result = new ReadLikelihoods<>(samples, alleles, perSampleReadList); // The actual work: final int sampleCount = result.sampleCount(); @@ -315,7 +319,7 @@ public class GraphBasedLikelihoodCalculationEngineInstance { private void calculatePerReadAlleleLikelihoodMapHaplotypeProcessing(final int haplotypeIndex, final ReadLikelihoods.Matrix likelihoods, final Map> costsEndingByVertex) { - final Haplotype haplotype = likelihoods.allele(haplotypeIndex); + final Haplotype haplotype = likelihoods.alleleAt(haplotypeIndex); final HaplotypeRoute haplotypeRoute = haplotypeGraph.getHaplotypeRoute(haplotype); final Set haplotypeVertices = haplotypeRoute.vertexSet(); final Map readCostByRead = new HashMap<>(); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java index 2ee5752f0..5e6a519ea 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java @@ -52,6 +52,7 @@ import htsjdk.variant.variantcontext.*; import htsjdk.variant.variantcontext.writer.VariantContextWriter; import htsjdk.variant.vcf.*; import org.broadinstitute.gatk.engine.CommandLineGATK; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.arguments.DbsnpArgumentCollection; import org.broadinstitute.gatk.engine.contexts.AlignmentContext; import org.broadinstitute.gatk.engine.contexts.AlignmentContextUtils; @@ -64,15 +65,12 @@ import org.broadinstitute.gatk.engine.io.GATKSAMFileWriter; import org.broadinstitute.gatk.engine.iterators.ReadTransformer; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; import org.broadinstitute.gatk.engine.walkers.*; +import org.broadinstitute.gatk.genotyping.*; import org.broadinstitute.gatk.tools.walkers.annotator.VariantAnnotatorEngine; import org.broadinstitute.gatk.tools.walkers.annotator.interfaces.AnnotatorCompatible; import org.broadinstitute.gatk.tools.walkers.genotyper.*; -import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalcFactory; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.readthreading.ReadThreadingAssembler; -import org.broadinstitute.gatk.utils.GenomeLoc; -import org.broadinstitute.gatk.utils.MathUtils; -import org.broadinstitute.gatk.utils.QualityUtils; -import org.broadinstitute.gatk.utils.SampleUtils; +import org.broadinstitute.gatk.utils.*; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; import org.broadinstitute.gatk.utils.activeregion.ActiveRegionReadState; import org.broadinstitute.gatk.utils.activeregion.ActivityProfileState; @@ -606,7 +604,7 @@ public class HaplotypeCaller extends ActiveRegionWalker, In // the minimum length of a read we'd consider using for genotyping private final static int MIN_READ_LENGTH = 10; - private List samplesList; + private SampleList samplesList; private final static Allele FAKE_REF_ALLELE = Allele.create("N", true); // used in isActive function to call into UG Engine. Should never appear anywhere in a VCF file private final static Allele FAKE_ALT_ALLELE = Allele.create("", false); // used in isActive function to call into UG Engine. Should never appear anywhere in a VCF file @@ -626,9 +624,6 @@ public class HaplotypeCaller extends ActiveRegionWalker, In public void initialize() { super.initialize(); - if (SCAC.genotypeArgs.samplePloidy != HomoSapiensConstants.DEFAULT_PLOIDY) - throw new UserException.BadArgumentValue("-ploidy", "" + SCAC.genotypeArgs.samplePloidy + "; currently HaplotypeCaller only supports diploid sample analysis (-ploidy 2)"); - if (dontGenotype && emitReferenceConfidence()) throw new UserException("You cannot request gVCF output and do not genotype at the same time"); @@ -656,12 +651,9 @@ public class HaplotypeCaller extends ActiveRegionWalker, In logger.info("Disabling physical phasing, which is supported only for reference-model confidence output"); } - if ( SCAC.AFmodel == AFCalcFactory.Calculation.EXACT_GENERAL_PLOIDY ) - throw new UserException.BadArgumentValue("pnrm", "HaplotypeCaller doesn't currently support " + SCAC.AFmodel); - - - samplesList = new ArrayList<>(SampleUtils.getSAMFileSamples(getToolkit().getSAMFileHeader())); - Set samplesSet = new LinkedHashSet<>(samplesList); + final GenomeAnalysisEngine toolkit = getToolkit(); + samplesList = toolkit.getReadSampleList(); + final Set sampleSet = SampleListUtils.asSet(samplesList); // create a UAC but with the exactCallsLog = null, so we only output the log for the HC caller itself, if requested final UnifiedArgumentCollection simpleUAC = SCAC.cloneTo(UnifiedArgumentCollection.class); @@ -672,20 +664,24 @@ public class HaplotypeCaller extends ActiveRegionWalker, In simpleUAC.CONTAMINATION_FRACTION = 0.0; simpleUAC.CONTAMINATION_FRACTION_FILE = null; simpleUAC.exactCallsLog = null; - activeRegionEvaluationGenotyperEngine = new UnifiedGenotypingEngine(getToolkit(), simpleUAC, samplesSet); + // Seems that at least with some test data we can lose genuine haploid variation if we use + // UGs engine with ploidy == 1 + simpleUAC.genotypeArgs.samplePloidy = Math.max(2,SCAC.genotypeArgs.samplePloidy); + activeRegionEvaluationGenotyperEngine = new UnifiedGenotypingEngine(simpleUAC, toolkit); activeRegionEvaluationGenotyperEngine.setLogger(logger); if( SCAC.CONTAMINATION_FRACTION_FILE != null ) - SCAC.setSampleContamination(AlleleBiasedDownsamplingUtils.loadContaminationFile(SCAC.CONTAMINATION_FRACTION_FILE, SCAC.CONTAMINATION_FRACTION, samplesSet, logger)); + SCAC.setSampleContamination(AlleleBiasedDownsamplingUtils.loadContaminationFile(SCAC.CONTAMINATION_FRACTION_FILE, SCAC.CONTAMINATION_FRACTION, sampleSet, logger)); if( SCAC.genotypingOutputMode == GenotypingOutputMode.GENOTYPE_GIVEN_ALLELES && consensusMode ) throw new UserException("HaplotypeCaller cannot be run in both GENOTYPE_GIVEN_ALLELES mode and in consensus mode. Please choose one or the other."); - genotypingEngine = new HaplotypeCallerGenotypingEngine( getToolkit(), SCAC, !doNotRunPhysicalPhasing); + final GenomeLocParser genomeLocParser = toolkit.getGenomeLocParser(); + genotypingEngine = new HaplotypeCallerGenotypingEngine( SCAC, samplesList, genomeLocParser, !doNotRunPhysicalPhasing); // initialize the output VCF header final VariantAnnotatorEngine annotationEngine = new VariantAnnotatorEngine(Arrays.asList(annotationClassesToUse), annotationsToUse, annotationsToExclude, this, getToolkit()); - Set headerInfo = new HashSet<>(); + final Set headerInfo = new HashSet<>(); headerInfo.addAll(genotypingEngine.getAppropriateVCFInfoHeaders()); // all annotation fields from VariantAnnotatorEngine @@ -707,13 +703,20 @@ public class HaplotypeCaller extends ActiveRegionWalker, In headerInfo.add(new VCFFormatHeaderLine(HAPLOTYPE_CALLER_PHASING_GT_KEY, 1, VCFHeaderLineType.String, "Physical phasing haplotype information, describing how the alternate alleles are phased in relation to one another")); } + if (SCAC.genotypeArgs.samplePloidy != HomoSapiensConstants.DEFAULT_PLOIDY) { + if (SCAC.emitReferenceConfidence != ReferenceConfidenceMode.NONE) + throw new UserException.BadArgumentValue("ERC", "For now ploidies different that 2 are not allow for GVCF or BP_RESOLUTION outputs"); + headerInfo.add(new VCFFormatHeaderLine(VCFConstants.MLE_PER_SAMPLE_ALLELE_COUNT_KEY, VCFHeaderLineCount.A, VCFHeaderLineType.Integer, "Maximum likelihood expectation (MLE) for the alternate allele count, in the same order as listed, for each individual sample")); + headerInfo.add(new VCFFormatHeaderLine(VCFConstants.MLE_PER_SAMPLE_ALLELE_FRACTION_KEY, VCFHeaderLineCount.A, VCFHeaderLineType.Float, "Maximum likelihood expectation (MLE) for the alternate allele fraction, in the same order as listed, for each individual sample")); + } + // FILTER fields are added unconditionally as it's not always 100% certain the circumstances // where the filters are used. For example, in emitting all sites the lowQual field is used headerInfo.add(new VCFFilterHeaderLine(UnifiedGenotypingEngine.LOW_QUAL_FILTER_NAME, "Low quality")); - initializeReferenceConfidenceModel(samplesSet, headerInfo); + initializeReferenceConfidenceModel(samplesList, headerInfo); - vcfWriter.writeHeader(new VCFHeader(headerInfo, samplesSet)); + vcfWriter.writeHeader(new VCFHeader(headerInfo, sampleSet)); try { // fasta reference reader to supplement the edges of the reference sequence @@ -771,10 +774,11 @@ public class HaplotypeCaller extends ActiveRegionWalker, In SCAC.genotypingOutputMode == GenotypingOutputMode.GENOTYPE_GIVEN_ALLELES,emitReferenceConfidence()); } - private void initializeReferenceConfidenceModel(final Set samples, final Set headerInfo) { + private void initializeReferenceConfidenceModel(final SampleList samples, final Set headerInfo) { referenceConfidenceModel = new ReferenceConfidenceModel(getToolkit().getGenomeLocParser(), samples, getToolkit().getSAMFileHeader(), indelSizeToEliminateInRefModel); if ( emitReferenceConfidence() ) { - if ( samples.size() != 1 ) throw new UserException.BadArgumentValue("emitRefConfidence", "Can only be used in single sample mode currently"); + if ( samples.sampleCount() != 1 ) + throw new UserException.BadArgumentValue("emitRefConfidence", "Can only be used in single sample mode currently"); headerInfo.addAll(referenceConfidenceModel.getVCFHeaderLines()); if ( SCAC.emitReferenceConfidence == ReferenceConfidenceMode.GVCF ) { // a kluge to enforce the use of this indexing strategy @@ -784,7 +788,7 @@ public class HaplotypeCaller extends ActiveRegionWalker, In } try { - vcfWriter = new GVCFWriter(vcfWriter, GVCFGQBands); + vcfWriter = new GVCFWriter(vcfWriter, GVCFGQBands,SCAC.genotypeArgs.samplePloidy); } catch ( IllegalArgumentException e ) { throw new UserException.BadArgumentValue("GQBands", "are malformed: " + e.getMessage()); } @@ -857,8 +861,12 @@ public class HaplotypeCaller extends ActiveRegionWalker, In final Map splitContexts = AlignmentContextUtils.splitContextBySampleName(context); final GenotypesContext genotypes = GenotypesContext.create(splitContexts.keySet().size()); final MathUtils.RunningAverage averageHQSoftClips = new MathUtils.RunningAverage(); + final GenotypingModel genotypingModel = genotypingEngine.getGenotypingModel(); for( final Map.Entry sample : splitContexts.entrySet() ) { - final double[] genotypeLikelihoods = referenceConfidenceModel.calcGenotypeLikelihoodsOfRefVsAny(sample.getValue().getBasePileup(), ref.getBase(), MIN_BASE_QUALTY_SCORE, averageHQSoftClips).genotypeLikelihoods; + final String sampleName = sample.getKey(); + // The ploidy here is not dictated by the sample but by the simple genotyping-engine used to determine whether regions are active or not. + final int activeRegionDetectionHackishSamplePloidy = activeRegionEvaluationGenotyperEngine.getConfiguration().genotypeArgs.samplePloidy; + final double[] genotypeLikelihoods = referenceConfidenceModel.calcGenotypeLikelihoodsOfRefVsAny(sampleName,activeRegionDetectionHackishSamplePloidy,genotypingModel,sample.getValue().getBasePileup(), ref.getBase(), MIN_BASE_QUALTY_SCORE, averageHQSoftClips).genotypeLikelihoods; genotypes.add( new GenotypeBuilder(sample.getKey()).alleles(noCall).PL(genotypeLikelihoods).make() ); } @@ -969,8 +977,8 @@ public class HaplotypeCaller extends ActiveRegionWalker, In regionForGenotyping.getLocation(), getToolkit().getGenomeLocParser(), metaDataTracker, - ( consensusMode ? Collections.emptyList() : givenAlleles ), - emitReferenceConfidence() ); + (consensusMode ? Collections.emptyList() : givenAlleles), + emitReferenceConfidence()); // TODO -- must disable if we are doing NCT, or set the output type of ! presorted if ( bamWriter != null ) { @@ -997,7 +1005,7 @@ public class HaplotypeCaller extends ActiveRegionWalker, In // output variant containing region. result.addAll(referenceConfidenceModel.calculateRefConfidence(assemblyResult.getReferenceHaplotype(), calledHaplotypes.getCalledHaplotypes(), assemblyResult.getPaddedReferenceLoc(), regionForGenotyping, - readLikelihoods, calledHaplotypes.getCalls())); + readLikelihoods, genotypingEngine.getPloidyModel(), genotypingEngine.getGenotypingModel(), calledHaplotypes.getCalls())); // output right-flanking non-variant section: if (trimmingResult.hasRightFlankingRegion()) result.addAll(referenceModelForNoVariation(trimmingResult.nonVariantRightFlankRegion(),false)); @@ -1110,7 +1118,7 @@ public class HaplotypeCaller extends ActiveRegionWalker, In final List haplotypes = Collections.singletonList(refHaplotype); return referenceConfidenceModel.calculateRefConfidence(refHaplotype, haplotypes, paddedLoc, region, createDummyStratifiedReadMap(refHaplotype, samplesList, region), - Collections.emptyList()); + genotypingEngine.getPloidyModel(), genotypingEngine.getGenotypingModel(), Collections.emptyList()); } else return NO_CALLS; } @@ -1123,11 +1131,10 @@ public class HaplotypeCaller extends ActiveRegionWalker, In * @return a map from sample -> PerReadAlleleLikelihoodMap that maps each read to ref */ public static ReadLikelihoods createDummyStratifiedReadMap(final Haplotype refHaplotype, - final List samples, + final SampleList samples, final ActiveRegion region) { - return new ReadLikelihoods<>(samples, Collections.singletonList(refHaplotype), + return new ReadLikelihoods<>(samples, new IndexedAlleleList<>(refHaplotype), splitReadsBySample(samples, region.getReads())); - } @@ -1235,18 +1242,15 @@ public class HaplotypeCaller extends ActiveRegionWalker, In return splitReadsBySample(samplesList, reads); } - public static Map> splitReadsBySample( final List samplesList, final Collection reads ) { + private static Map> splitReadsBySample( final SampleList samplesList, final Collection reads ) { final Map> returnMap = new HashMap<>(); - for( final String sample : samplesList) { - List readList = returnMap.get( sample ); - if( readList == null ) { - readList = new ArrayList<>(); - returnMap.put(sample, readList); - } - } - for( final GATKSAMRecord read : reads ) { + final int sampleCount = samplesList.sampleCount(); + for (int i = 0; i < sampleCount; i++) + returnMap.put(samplesList.sampleAt(i), new ArrayList()); + + for( final GATKSAMRecord read : reads ) returnMap.get(read.getReadGroup().getSample()).add(read); - } + return returnMap; } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerArgumentCollection.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerArgumentCollection.java index 321c48166..97bb9efa8 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerArgumentCollection.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerArgumentCollection.java @@ -45,9 +45,9 @@ */ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; +import org.broadinstitute.gatk.engine.arguments.StandardCallerArgumentCollection; import org.broadinstitute.gatk.utils.commandline.Advanced; import org.broadinstitute.gatk.utils.commandline.Argument; -import org.broadinstitute.gatk.engine.arguments.StandardCallerArgumentCollection; /** * Set of arguments for the {@link HaplotypeCaller} diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java index 77c308cfc..76c8dc772 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java @@ -48,8 +48,9 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import htsjdk.variant.variantcontext.*; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; +import org.broadinstitute.gatk.genotyping.*; import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypeLikelihoodsCalculationModel; import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypingEngine; import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypingOutputMode; @@ -64,7 +65,6 @@ import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.haplotype.MergeVariantsAcrossHaplotypes; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; -import htsjdk.variant.variantcontext.*; import java.util.*; @@ -80,28 +80,33 @@ public class HaplotypeCallerGenotypingEngine extends GenotypingEngine sampleNames) { - super(toolkit,configuration,sampleNames); - doPhysicalPhasing = true; + public HaplotypeCallerGenotypingEngine(final HaplotypeCallerArgumentCollection configuration, final SampleList samples, final GenomeLocParser genomeLocParser) { + this(configuration,samples,genomeLocParser,false); } - /** * Change the merge variant across haplotypes for this engine. * @@ -198,9 +203,9 @@ public class HaplotypeCallerGenotypingEngine extends GenotypingEngine alleleList = new ArrayList<>(); - alleleList.addAll(mergedVC.getAlleles()); - alleleList.add(GATKVariantContextUtils.NON_REF_SYMBOLIC_ALLELE); - vcb.alleles(alleleList); - mergedVC = vcb.make(); - } + if (emitReferenceConfidence) + mergedVC = addNonRefSymbolicAllele(mergedVC); final Map mergeMap = new LinkedHashMap<>(); mergeMap.put(null, mergedVC.getReference()); // the reference event (null) --> the reference allele @@ -264,7 +265,7 @@ public class HaplotypeCallerGenotypingEngine extends GenotypingEngine originalList = mergedVC.getAlleles(); + final List alleleList = new ArrayList<>(originalList.size() + 1); + alleleList.addAll(mergedVC.getAlleles()); + alleleList.add(GATKVariantContextUtils.NON_REF_SYMBOLIC_ALLELE); + vcb.alleles(alleleList); + return vcb.make(); + } + // Builds the read-likelihoods collection to use for annotation considering user arguments and the collection // used for genotyping. private ReadLikelihoods prepareReadAlleleLikelihoodsForAnnotation( @@ -653,22 +664,14 @@ public class HaplotypeCallerGenotypingEngine extends GenotypingEngine readLikelihoods, final VariantContext mergedVC ) { - final GenotypesContext genotypes = GenotypesContext.create(readLikelihoods.sampleCount()); - // Grab the genotype likelihoods from the appropriate places in the haplotype likelihood matrix -- calculation performed independently per sample - for (final String sample : readLikelihoods.samples() ) { - final int numHaplotypes = mergedVC.getAlleles().size(); - final double[] genotypeLikelihoods = new double[numHaplotypes * (numHaplotypes+1) / 2]; - final double[][] haplotypeLikelihoodMatrix = PairHMMLikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(sample, readLikelihoods, mergedVC.getAlleles(), true); - int glIndex = 0; - for( int iii = 0; iii < numHaplotypes; iii++ ) { - for( int jjj = 0; jjj <= iii; jjj++ ) { - genotypeLikelihoods[glIndex++] = haplotypeLikelihoodMatrix[iii][jjj]; // for example: AA,AB,BB,AC,BC,CC - } - } - logger.debug(" Likelihoods for sample " + sample + " : " + Arrays.toString(genotypeLikelihoods)); - genotypes.add(new GenotypeBuilder(sample).alleles(NO_CALL).PL(genotypeLikelihoods).make()); - } - return genotypes; + final List vcAlleles = mergedVC.getAlleles(); + final AlleleList alleleList = readLikelihoods.alleleCount() == vcAlleles.size() ? readLikelihoods : new IndexedAlleleList<>(vcAlleles); + final GenotypingLikelihoods likelihoods = genotypingModel.calculateLikelihoods(alleleList,new GenotypingData<>(ploidyModel,readLikelihoods)); + final int sampleCount = samples.sampleCount(); + final GenotypesContext result = GenotypesContext.create(sampleCount); + for (int s = 0; s < sampleCount; s++) + result.add(new GenotypeBuilder(samples.sampleAt(s)).alleles(NO_CALL).PL(likelihoods.sampleLikelihoods(s).getAsPLs()).make()); + return result; } /** @@ -779,4 +782,22 @@ public class HaplotypeCallerGenotypingEngine extends GenotypingEngine computeReadLikelihoods( final AssemblyResultSet assemblyResultSet, final List samples, final Map> perSampleReadList ) { + public ReadLikelihoods computeReadLikelihoods( final AssemblyResultSet assemblyResultSet, final SampleList samples, final Map> perSampleReadList ) { - final List haplotypes = assemblyResultSet.getHaplotypeList(); + final List haplotypeList = assemblyResultSet.getHaplotypeList(); + final AlleleList haplotypes = new IndexedAlleleList<>(haplotypeList); // configure the HMM - initializePairHMM(haplotypes, perSampleReadList); + initializePairHMM(haplotypeList, perSampleReadList); // Add likelihoods for each sample's reads to our result final ReadLikelihoods result = new ReadLikelihoods<>(samples, haplotypes, perSampleReadList); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java index bd72a764d..aa7305bcf 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java @@ -46,11 +46,14 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; +import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.broadinstitute.gatk.genotyping.AlleleList; +import org.broadinstitute.gatk.genotyping.IndexedAlleleList; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; -import htsjdk.variant.variantcontext.Allele; import java.util.HashMap; import java.util.List; @@ -63,17 +66,15 @@ import java.util.Random; public class RandomLikelihoodCalculationEngine implements ReadLikelihoodCalculationEngine { @Override - public ReadLikelihoods computeReadLikelihoods(final AssemblyResultSet assemblyResultSet, - final List samples, + public ReadLikelihoods computeReadLikelihoods(final AssemblyResultSet assemblyResultSet, + final SampleList samples, final Map> reads) { - final List haplotypes = assemblyResultSet.getHaplotypeList(); + final AlleleList haplotypes = new IndexedAlleleList<>(assemblyResultSet.getHaplotypeList()); final ReadLikelihoods result = new ReadLikelihoods(samples, haplotypes, reads); - final Map alleles = new HashMap<>(haplotypes.size()); - for (final Haplotype haplotype : haplotypes) - alleles.put(haplotype,Allele.create(haplotype,false)); + final Map alleles = new HashMap<>(haplotypes.alleleCount()); final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); - final int sampleCount = samples.size(); - final int alleleCount = alleles.size(); + final int sampleCount = samples.sampleCount(); + final int alleleCount = haplotypes.alleleCount(); for (int i = 0; i < sampleCount; i++) { final List sampleReads = result.sampleReads(i); final int readCount = sampleReads.size(); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java index 6119cba1c..ccc0c18b8 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java @@ -46,6 +46,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; @@ -81,6 +82,7 @@ public interface ReadLikelihoodCalculationEngine { * active region assembly process. * * @param assemblyResultSet the input assembly results. + * @param samples the list of targeted samples. * @param perSampleReadList the input read sets stratified per sample. * * @throws NullPointerException if either parameter is {@code null}. @@ -88,7 +90,7 @@ public interface ReadLikelihoodCalculationEngine { * @return never {@code null}, and with at least one entry for input sample (keys in {@code perSampleReadList}. * The value maps can be potentially empty though. */ - public ReadLikelihoods computeReadLikelihoods(AssemblyResultSet assemblyResultSet, List samples, + public ReadLikelihoods computeReadLikelihoods(AssemblyResultSet assemblyResultSet, SampleList samples, Map> perSampleReadList); public void close(); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RefVsAnyResult.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RefVsAnyResult.java index 8726c9365..bb3b64f93 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RefVsAnyResult.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RefVsAnyResult.java @@ -46,6 +46,8 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; +import org.broadinstitute.gatk.utils.variant.HomoSapiensConstants; + /** * Holds information about a genotype call of a single sample reference vs. any non-ref event * @@ -58,7 +60,7 @@ final class RefVsAnyResult { /** * The genotype likelihoods for ref/ref ref/non-ref non-ref/non-ref */ - final double[] genotypeLikelihoods = new double[3]; + final double[] genotypeLikelihoods; /** * AD field value for ref / non-ref @@ -74,7 +76,31 @@ final class RefVsAnyResult { * Cap the het and hom var likelihood values by the hom ref likelihood. */ protected void capByHomRefLikelihood() { - genotypeLikelihoods[1] = Math.min(genotypeLikelihoods[0], genotypeLikelihoods[1]); - genotypeLikelihoods[2] = Math.min(genotypeLikelihoods[0], genotypeLikelihoods[2]); + final int likelihoodCount = genotypeLikelihoods.length; + for (int i = 1; i < likelihoodCount; i++) + genotypeLikelihoods[i] = Math.min(genotypeLikelihoods[0],genotypeLikelihoods[i]); } + + /** + * Creates a new ref-vs-alt result assuming 3 as the number of genotype likelihoods (human ploidy. + */ + @Deprecated + public RefVsAnyResult() { + genotypeLikelihoods = + new double[(HomoSapiensConstants.DEFAULT_PLOIDY * (HomoSapiensConstants.DEFAULT_PLOIDY + 1)) >> 1]; + } + + /** + * Creates a new ref-vs-alt result indicating the genotype likelihood vector capacity. + * @param likelihoodCapacity the required capacity of the likelihood array, should match the possible number of + * genotypes given the number of alleles (always 2), ploidy (arbitrary) less the genotyping + * model non-sense genotype count if applies. + * @throws IllegalArgumentException if {@code likelihoodCapacity} is negative. + */ + public RefVsAnyResult(final int likelihoodCapacity) { + if (likelihoodCapacity < 0) + throw new IllegalArgumentException("likelihood capacity is negative"); + genotypeLikelihoods = new double[likelihoodCapacity]; + } + } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java index dc9512eee..116b27009 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java @@ -51,11 +51,13 @@ import htsjdk.variant.variantcontext.*; import htsjdk.variant.vcf.VCFHeaderLine; import htsjdk.variant.vcf.VCFSimpleHeaderLine; import org.broadinstitute.gatk.engine.contexts.AlignmentContext; +import org.broadinstitute.gatk.genotyping.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.GenomeLocParser; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.QualityUtils; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; +import org.broadinstitute.gatk.utils.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.locusiterator.LocusIteratorByState; @@ -85,8 +87,8 @@ public class ReferenceConfidenceModel { public final static String ALTERNATE_ALLELE_STRING = "ALT"; // arbitrary alternate allele private final GenomeLocParser genomeLocParser; - private final Set samples; - private final SAMFileHeader header; // TODO -- really shouldn't depend on this + + private final SampleList samples; private final int indelInformativeDepthIndelSize; private final static boolean WRITE_DEBUGGING_BAM = false; @@ -103,18 +105,17 @@ public class ReferenceConfidenceModel { * @param indelInformativeDepthIndelSize the max size of indels to consider when calculating indel informative depths */ public ReferenceConfidenceModel(final GenomeLocParser genomeLocParser, - final Set samples, + final SampleList samples, final SAMFileHeader header, final int indelInformativeDepthIndelSize) { if ( genomeLocParser == null ) throw new IllegalArgumentException("genomeLocParser cannot be null"); if ( samples == null ) throw new IllegalArgumentException("samples cannot be null"); - if ( samples.isEmpty() ) throw new IllegalArgumentException("samples cannot be empty"); + if ( samples.sampleCount() == 0) throw new IllegalArgumentException("samples cannot be empty"); if ( header == null ) throw new IllegalArgumentException("header cannot be empty"); if ( indelInformativeDepthIndelSize < 0) throw new IllegalArgumentException("indelInformativeDepthIndelSize must be >= 1 but got " + indelInformativeDepthIndelSize); this.genomeLocParser = genomeLocParser; this.samples = samples; - this.header = header; this.indelInformativeDepthIndelSize = indelInformativeDepthIndelSize; if ( WRITE_DEBUGGING_BAM ) { @@ -124,8 +125,6 @@ public class ReferenceConfidenceModel { } else { debuggingWriter = null; } - - initializeIndelPLCache(); } /** @@ -151,7 +150,7 @@ public class ReferenceConfidenceModel { /** * Calculate the reference confidence for a single sample given the its read data * - * Returns a list of variant contexts, one for each position in the activeregion.getLoc(), each containing + * Returns a list of variant contexts, one for each position in the {@code activeRegion.getLoc()}, each containing * detailed information about the certainty that the sample is hom-ref for each base in the region. * * @@ -162,6 +161,8 @@ public class ReferenceConfidenceModel { * @param paddedReferenceLoc the location of refHaplotype (which might be larger than activeRegion.getLoc()) * @param activeRegion the active region we want to get the reference confidence over * @param readLikelihoods a map from a single sample to its PerReadAlleleLikelihoodMap for each haplotype in calledHaplotypes + * @param ploidyModel indicate the ploidy of each sample in {@code stratifiedReadMap}. + * @param model genotyping model. * @param variantCalls calls made in this region. The return result will contain any variant call in this list in the * correct order by genomic position, and any variant in this list will stop us emitting a ref confidence * under any position it covers (for snps and insertions that is 1 bp, but for deletions its the entire ref span) @@ -173,6 +174,8 @@ public class ReferenceConfidenceModel { final GenomeLoc paddedReferenceLoc, final ActiveRegion activeRegion, final ReadLikelihoods readLikelihoods, + final PloidyModel ploidyModel, + final GenotypingModel model, final List variantCalls) { if ( refHaplotype == null ) throw new IllegalArgumentException("refHaplotype cannot be null"); if ( calledHaplotypes == null ) throw new IllegalArgumentException("calledHaplotypes cannot be null"); @@ -182,12 +185,15 @@ public class ReferenceConfidenceModel { if ( readLikelihoods == null ) throw new IllegalArgumentException("readLikelihoods cannot be null"); if ( readLikelihoods.sampleCount() != 1 ) throw new IllegalArgumentException("readLikelihoods must contain exactly one sample but it contained " + readLikelihoods.sampleCount()); if ( refHaplotype.length() != activeRegion.getExtendedLoc().size() ) throw new IllegalArgumentException("refHaplotype " + refHaplotype.length() + " and activeRegion location size " + activeRegion.getLocation().size() + " are different"); + if ( ploidyModel == null) throw new IllegalArgumentException("the ploidy model cannot be null"); + if ( model == null) throw new IllegalArgumentException("the genotyping model cannot be null"); + final int ploidy = ploidyModel.samplePloidy(0); // the first sample = the only sample in reference-confidence mode. final GenomeLoc refSpan = activeRegion.getLocation(); final List refPileups = getPileupsOverReference(refHaplotype, calledHaplotypes, paddedReferenceLoc, activeRegion, refSpan, readLikelihoods); final byte[] ref = refHaplotype.getBases(); final List results = new ArrayList<>(refSpan.size()); - final String sampleName = readLikelihoods.sample(0); + final String sampleName = readLikelihoods.sampleAt(0); final int globalRefOffset = refSpan.getStart() - activeRegion.getExtendedLoc().getStart(); for ( final ReadBackedPileup pileup : refPileups ) { @@ -201,20 +207,20 @@ public class ReferenceConfidenceModel { // otherwise emit a reference confidence variant context final int refOffset = offset + globalRefOffset; final byte refBase = ref[refOffset]; - final RefVsAnyResult homRefCalc = calcGenotypeLikelihoodsOfRefVsAny(pileup, refBase, (byte)6, null); + final RefVsAnyResult homRefCalc = calcGenotypeLikelihoodsOfRefVsAny(sampleName,ploidy,model,pileup, refBase, (byte)6, null); homRefCalc.capByHomRefLikelihood(); final Allele refAllele = Allele.create(refBase, true); final List refSiteAlleles = Arrays.asList(refAllele, GATKVariantContextUtils.NON_REF_SYMBOLIC_ALLELE); final VariantContextBuilder vcb = new VariantContextBuilder("HC", curPos.getContig(), curPos.getStart(), curPos.getStart(), refSiteAlleles); - final GenotypeBuilder gb = new GenotypeBuilder(sampleName, Arrays.asList(refAllele, refAllele)); + final GenotypeBuilder gb = new GenotypeBuilder(sampleName, GATKVariantContextUtils.homozygousAlleleList(refAllele, ploidy)); gb.AD(homRefCalc.AD_Ref_Any); gb.DP(homRefCalc.getDP()); // genotype likelihood calculation final GenotypeLikelihoods snpGLs = GenotypeLikelihoods.fromLog10Likelihoods(homRefCalc.genotypeLikelihoods); final int nIndelInformativeReads = calcNIndelInformativeReads(pileup, refOffset, ref, indelInformativeDepthIndelSize); - final GenotypeLikelihoods indelGLs = getIndelPLs(nIndelInformativeReads); + final GenotypeLikelihoods indelGLs = getIndelPLs(ploidy,nIndelInformativeReads); // now that we have the SNP and indel GLs, we take the one with the least confidence, // as this is the most conservative estimate of our certainty that we are hom-ref. @@ -251,23 +257,51 @@ public class ReferenceConfidenceModel { * Get indel PLs corresponding to seeing N nIndelInformativeReads at this site * * @param nInformativeReads the number of reads that inform us about being ref without an indel at this site + * @param ploidy the requested ploidy. * @return non-null GenotypeLikelihoods given N */ - protected final GenotypeLikelihoods getIndelPLs(final int nInformativeReads) { - return indelPLCache[nInformativeReads > MAX_N_INDEL_INFORMATIVE_READS ? MAX_N_INDEL_INFORMATIVE_READS : nInformativeReads]; + protected final GenotypeLikelihoods getIndelPLs(final int ploidy, final int nInformativeReads) { + if (ploidy > MAX_N_INDEL_PLOIDY) + throw new IllegalArgumentException("you have hit a current limitation of the GVCF output model that cannot handle ploidies larger than " + MAX_N_INDEL_PLOIDY + " , please let the GATK team about it: " + ploidy); + return indelPLCache(ploidy, nInformativeReads > MAX_N_INDEL_INFORMATIVE_READS ? MAX_N_INDEL_INFORMATIVE_READS : nInformativeReads); } protected static final int MAX_N_INDEL_INFORMATIVE_READS = 40; // more than this is overkill because GQs are capped at 99 anyway - private static final GenotypeLikelihoods[] indelPLCache = new GenotypeLikelihoods[MAX_N_INDEL_INFORMATIVE_READS + 1]; + private static final int MAX_N_INDEL_PLOIDY = 20; + private static final GenotypeLikelihoods[][] indelPLCache = new GenotypeLikelihoods[MAX_N_INDEL_PLOIDY][]; private static final double INDEL_ERROR_RATE = -4.5; // 10^-4.5 indel errors per bp - private void initializeIndelPLCache() { - for( int nInformativeReads = 0; nInformativeReads <= MAX_N_INDEL_INFORMATIVE_READS; nInformativeReads++ ) { - final double homRef = 0.0; - final double het = MathUtils.LOG_ONE_HALF * nInformativeReads; - final double homVar = INDEL_ERROR_RATE * nInformativeReads; - indelPLCache[nInformativeReads] = GenotypeLikelihoods.fromLog10Likelihoods(new double[]{homRef, het, homVar}); + private final GenotypeLikelihoods indelPLCache(final int ploidy, final int nInformativeReads) { + GenotypeLikelihoods[] indelPLCacheByPloidy = indelPLCache[ploidy]; + if (indelPLCacheByPloidy == null) + return initializeIndelPLCache(ploidy)[nInformativeReads]; + else + return indelPLCacheByPloidy[nInformativeReads]; + } + + private synchronized GenotypeLikelihoods[] initializeIndelPLCache(final int ploidy) { + // Double-check whether another thread has done the initialization. + if (indelPLCache[ploidy] != null) + return indelPLCache[ploidy]; + + final double denominator = - MathUtils.Log10Cache.get(ploidy); + final GenotypeLikelihoods[] result = new GenotypeLikelihoods[MAX_N_INDEL_INFORMATIVE_READS + 1]; + result[0] = GenotypeLikelihoods.fromLog10Likelihoods(new double[ploidy + 1]); + for( int nInformativeReads = 1; nInformativeReads <= MAX_N_INDEL_INFORMATIVE_READS; nInformativeReads++ ) { + final byte indelQual = (byte) Math.round((INDEL_ERROR_RATE * -10)); + final double refLikelihood = QualityUtils.qualToProbLog10(indelQual); + final double altLikelihood = QualityUtils.qualToErrorProbLog10(indelQual); + double[] PLs = new double[ploidy + 1]; + PLs[0] = nInformativeReads * refLikelihood; + for (int altCount = 1; altCount <= ploidy; altCount++) { + final double refLikelihoodAccum = refLikelihood + MathUtils.Log10Cache.get(ploidy - altCount); + final double altLikelihoodAccum = altLikelihood + MathUtils.Log10Cache.get(altCount); + PLs[altCount] = nInformativeReads * (MathUtils.approximateLog10SumLog10(refLikelihoodAccum ,altLikelihoodAccum) + denominator); + } + result[nInformativeReads] = GenotypeLikelihoods.fromLog10Likelihoods(PLs); } + indelPLCache[ploidy] = result; + return result; } /** @@ -279,6 +313,7 @@ public class ReferenceConfidenceModel { * @param hqSoftClips running average data structure (can be null) to collect information about the number of high quality soft clips * @return a RefVsAnyResult genotype call */ + @Deprecated public RefVsAnyResult calcGenotypeLikelihoodsOfRefVsAny(final ReadBackedPileup pileup, final byte refBase, final byte minBaseQual, final MathUtils.RunningAverage hqSoftClips) { final RefVsAnyResult result = new RefVsAnyResult(); @@ -305,6 +340,73 @@ public class ReferenceConfidenceModel { return result; } + /** + * Calculate the genotype likelihoods for the sample in pileup for being hom-ref contrasted with being ref vs. alt + * + * @param sampleName target sample name. + * @param ploidy target sample ploidy. + * @param genotypingModel model to calculate likelihoods and genotypes. + * @param pileup the read backed pileup containing the data we want to evaluate + * @param refBase the reference base at this pileup position + * @param minBaseQual the min base quality for a read in the pileup at the pileup position to be included in the calculation + * @param hqSoftClips running average data structure (can be null) to collect information about the number of high quality soft clips + * @return a RefVsAnyResult genotype call. + */ + public RefVsAnyResult calcGenotypeLikelihoodsOfRefVsAny(final String sampleName, final int ploidy, + final GenotypingModel genotypingModel, + final ReadBackedPileup pileup, final byte refBase, final byte minBaseQual, final MathUtils.RunningAverage hqSoftClips) { + final AlleleList alleleList = new IndexedAlleleList<>(Allele.create(refBase,true),GATKVariantContextUtils.NON_REF_SYMBOLIC_ALLELE); + // Notice that the sample name is rather irrelevant as this information is never used, just need to be the same in both lines bellow. + + final int maximumReadCount = pileup.getReads().size(); + + final List reads = new ArrayList<>(maximumReadCount); + final double[][] likelihoods = new double[2][maximumReadCount]; + final int[] adCounts = new int[2]; + int nextIndex = 0; + for (final PileupElement p : pileup) { + final byte qual = p.isDeletion() ? REF_MODEL_DELETION_QUAL : p.getQual(); + if (!p.isDeletion() && qual <= minBaseQual) + continue; + final GATKSAMRecord read = p.getRead(); + reads.add(read); + final boolean isAlt = p.getBase() != refBase || p.isDeletion() || p.isBeforeDeletionStart() + || p.isAfterDeletionEnd() || p.isBeforeInsertion() || p.isAfterInsertion() || p.isNextToSoftClip(); + final int bestAllele; + final int worstAllele; + if (isAlt) { + bestAllele = 1; + worstAllele = 0; + } else { + bestAllele = 0; + worstAllele = 1; + } + + likelihoods[bestAllele][nextIndex] = QualityUtils.qualToProbLog10(qual); + likelihoods[worstAllele][nextIndex++] = QualityUtils.qualToErrorProbLog10(qual) + MathUtils.LOG_ONE_THIRD; + adCounts[bestAllele]++; + if (isAlt && hqSoftClips != null && p.isNextToSoftClip()) + hqSoftClips.add(AlignmentUtils.calcNumHighQualitySoftClips(read, (byte) 28)); + } + + final Map> sampleToReads = Collections.singletonMap(sampleName,reads); + final ReadLikelihoods readLikelihoods = new ReadLikelihoods<>(new IndexedSampleList(sampleName),alleleList,sampleToReads); + final ReadLikelihoods.Matrix sampleLikelihoods = readLikelihoods.sampleMatrix(0); + final int readCount = sampleLikelihoods.readCount(); + for (int i = 0; i < readCount; i++) { + sampleLikelihoods.set(0,i,likelihoods[0][i]); + sampleLikelihoods.set(1,i,likelihoods[1][i]); + } + + final PloidyModel ploidyModel = new HomogeneousPloidyModel(new IndexedSampleList(sampleName),ploidy); + final GenotypingLikelihoods genotypingLikelihoods = genotypingModel.calculateLikelihoods(alleleList, new GenotypingData<>(ploidyModel, readLikelihoods)); + final double[] genotypeLikelihoodArray = genotypingLikelihoods.sampleLikelihoods(0).getAsVector(); + final RefVsAnyResult result = new RefVsAnyResult(genotypeLikelihoodArray.length); + System.arraycopy(genotypeLikelihoodArray,0,result.genotypeLikelihoods,0,genotypeLikelihoodArray.length); + System.arraycopy(adCounts,0,result.AD_Ref_Any,0,2); + return result; + } + /** * Get a list of pileups that span the entire active region span, in order, one for each position */ @@ -330,7 +432,7 @@ public class ReferenceConfidenceModel { debuggingWriter.addAlignment(read); final LocusIteratorByState libs = new LocusIteratorByState(reads.iterator(), LocusIteratorByState.NO_DOWNSAMPLING, - true, genomeLocParser, samples, false); + true, genomeLocParser, SampleListUtils.asSet(samples), false); final List pileups = new LinkedList<>(); final int startPos = activeRegionSpan.getStart(); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java index 6f71868bb..a798c760f 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java @@ -49,6 +49,9 @@ package org.broadinstitute.gatk.tools.walkers.indels; import com.google.java.contract.Ensures; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.contexts.ReferenceContext; +import org.broadinstitute.gatk.genotyping.AlleleList; +import org.broadinstitute.gatk.genotyping.IndexedAlleleList; +import org.broadinstitute.gatk.genotyping.IndexedSampleList; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.clipping.ReadClipper; import org.broadinstitute.gatk.utils.exceptions.UserException; @@ -444,10 +447,10 @@ public class PairHMMIndelErrorModel { // Apparently more than one allele can map to the same haplotype after trimming final Set distinctHaplotypesSet = new LinkedHashSet<>(trimmedHaplotypeMap.values()); - final List distinctHaplotypesList = Arrays.asList(distinctHaplotypesSet.toArray(new Haplotype[distinctHaplotypesSet.size()])); + final AlleleList distinctHaplotypesList = new IndexedAlleleList<>(distinctHaplotypesSet.toArray(new Haplotype[distinctHaplotypesSet.size()])); // Get the likelihoods for our clipped read against each of our trimmed haplotypes. final ReadLikelihoods rl = new ReadLikelihoods<>( - Collections.singletonList("DUMMY_SAMPLE"),distinctHaplotypesList,Collections.singletonMap("DUMMY_SAMPLE",Collections.singletonList(processedRead))); + new IndexedSampleList(Collections.singletonList("DUMMY_SAMPLE")),distinctHaplotypesList,Collections.singletonMap("DUMMY_SAMPLE",Collections.singletonList(processedRead))); final ReadLikelihoods.Matrix dummySampleLikelihoods = rl.sampleMatrix(0); pairHMM.computeLikelihoods(rl.sampleMatrix(0), Collections.singletonList(processedRead), readGCPArrayMap); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/validation/GenotypeAndValidate.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/validation/GenotypeAndValidate.java index 432bfc770..f78519f3f 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/validation/GenotypeAndValidate.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/validation/GenotypeAndValidate.java @@ -46,6 +46,7 @@ package org.broadinstitute.gatk.tools.walkers.validation; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.walkers.*; import org.broadinstitute.gatk.utils.commandline.*; import org.broadinstitute.gatk.engine.CommandLineGATK; @@ -349,13 +350,14 @@ public class GenotypeAndValidate extends RodWalker= 0) uac.genotypeArgs.STANDARD_CONFIDENCE_FOR_EMITTING = emitConf; if (callConf >= 0) uac.genotypeArgs.STANDARD_CONFIDENCE_FOR_CALLING = callConf; + final GenomeAnalysisEngine toolkit = getToolkit(); uac.GLmodel = GenotypeLikelihoodsCalculationModel.Model.SNP; - snpEngine = new UnifiedGenotypingEngine(getToolkit(), uac); + snpEngine = new UnifiedGenotypingEngine(uac,toolkit); // Adding the INDEL calling arguments for UG UnifiedArgumentCollection uac_indel = uac.clone(); uac_indel.GLmodel = GenotypeLikelihoodsCalculationModel.Model.INDEL; - indelEngine = new UnifiedGenotypingEngine(getToolkit(), uac_indel); + indelEngine = new UnifiedGenotypingEngine(uac_indel,toolkit); // make sure we have callConf set to the threshold set by the UAC so we can use it later. callConf = uac.genotypeArgs.STANDARD_CONFIDENCE_FOR_CALLING; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java index ebcb82444..9d18e9981 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java @@ -46,8 +46,12 @@ package org.broadinstitute.gatk.tools.walkers.variantutils; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.arguments.GenotypeCalculationArgumentCollection; import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypingEngine; +import org.broadinstitute.gatk.genotyping.IndexedSampleList; +import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.genotyping.SampleListUtils; import org.broadinstitute.gatk.utils.commandline.*; import org.broadinstitute.gatk.engine.CommandLineGATK; import org.broadinstitute.gatk.engine.arguments.DbsnpArgumentCollection; @@ -111,6 +115,7 @@ import java.util.*; */ @DocumentedGATKFeature( groupName = HelpConstants.DOCS_CAT_VARDISC, extraDocs = {CommandLineGATK.class} ) @Reference(window=@Window(start=-10,stop=10)) +@SuppressWarnings("unused") public class GenotypeGVCFs extends RodWalker implements AnnotatorCompatible, TreeReducible { /** @@ -159,12 +164,13 @@ public class GenotypeGVCFs extends RodWalker variantCollection : variantCollections ) variants.addAll(variantCollection.getRodBindings()); - final Map vcfRods = GATKVCFUtils.getVCFHeadersFromRods(getToolkit(), variants); - final Set samples = SampleUtils.getSampleList(vcfRods, GATKVariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE); + final GenomeAnalysisEngine toolkit = getToolkit(); + final Map vcfRods = GATKVCFUtils.getVCFHeadersFromRods(toolkit, variants); + final SampleList samples = new IndexedSampleList(SampleUtils.getSampleList(vcfRods, GATKVariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE)); // create the genotyping engine - genotypingEngine = new UnifiedGenotypingEngine(getToolkit(), createUAC(), samples); + genotypingEngine = new UnifiedGenotypingEngine(createUAC(), samples, toolkit.getGenomeLocParser(), toolkit.getArguments().BAQMode); // create the annotation engine - annotationEngine = new VariantAnnotatorEngine(Arrays.asList("none"), annotationsToUse, Collections.emptyList(), this, getToolkit()); + annotationEngine = new VariantAnnotatorEngine(Arrays.asList("none"), annotationsToUse, Collections.emptyList(), this, toolkit); // take care of the VCF headers final Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), true); @@ -179,7 +185,8 @@ public class GenotypeGVCFs extends RodWalker sampleNameSet = SampleListUtils.asSet(samples); + final VCFHeader vcfHeader = new VCFHeader(headerLines, sampleNameSet); vcfWriter.writeHeader(vcfHeader); } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java index 50e8bd416..e6cc614e6 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java @@ -46,6 +46,10 @@ package org.broadinstitute.gatk.tools.walkers.variantutils; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.broadinstitute.gatk.genotyping.IndexedSampleList; +import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.genotyping.SampleListUtils; import org.broadinstitute.gatk.utils.commandline.ArgumentCollection; import org.broadinstitute.gatk.utils.commandline.Output; import org.broadinstitute.gatk.engine.CommandLineGATK; @@ -120,14 +124,18 @@ public class RegenotypeVariants extends RodWalker implements T UAC.genotypingOutputMode = GenotypingOutputMode.GENOTYPE_GIVEN_ALLELES; String trackName = variantCollection.variants.getName(); - Set samples = SampleUtils.getSampleListWithVCFHeader(getToolkit(), Arrays.asList(trackName)); - UG_engine = new UnifiedGenotypingEngine(getToolkit(), UAC, samples); + + final GenomeAnalysisEngine toolkit = getToolkit(); + final SampleList samples = + new IndexedSampleList(SampleUtils.getSampleListWithVCFHeader(getToolkit(), Arrays.asList(trackName))); + final Set sampleNameSet = SampleListUtils.asSet(samples); + UG_engine = new UnifiedGenotypingEngine(UAC, samples,toolkit.getGenomeLocParser(),toolkit.getArguments().BAQMode); final Set hInfo = new HashSet(); hInfo.addAll(GATKVCFUtils.getHeaderFields(getToolkit(), Arrays.asList(trackName))); hInfo.addAll(UnifiedGenotyper.getHeaderInfo(UAC, null, null)); - vcfWriter.writeHeader(new VCFHeader(hInfo, samples)); + vcfWriter.writeHeader(new VCFHeader(hInfo, sampleNameSet)); } /** diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriter.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriter.java index e55bf4fa0..5659e76a0 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriter.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriter.java @@ -46,15 +46,14 @@ package org.broadinstitute.gatk.utils.gvcf; -import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; import htsjdk.variant.variantcontext.Genotype; import htsjdk.variant.variantcontext.GenotypeBuilder; import htsjdk.variant.variantcontext.VariantContext; import htsjdk.variant.variantcontext.VariantContextBuilder; import htsjdk.variant.variantcontext.writer.VariantContextWriter; import htsjdk.variant.vcf.*; +import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; -import java.util.Collections; import java.util.HashMap; import java.util.LinkedList; import java.util.List; @@ -70,9 +69,7 @@ public class GVCFWriter implements VariantContextWriter { // // static VCF field names // - protected final static String BLOCK_SIZE_INFO_FIELD = "BLOCK_SIZE"; protected final static String MIN_DP_FORMAT_FIELD = "MIN_DP"; - protected final static String MIN_GQ_FORMAT_FIELD = "MIN_GQ"; // // Final fields initialized in constructor @@ -87,6 +84,7 @@ public class GVCFWriter implements VariantContextWriter { String contigOfNextAvailableStart = null; private String sampleName = null; private HomRefBlock currentBlock = null; + private final int defaultPloidy; /** * Is the proposed GQ partitions well-formed? @@ -94,7 +92,7 @@ public class GVCFWriter implements VariantContextWriter { * @param GQPartitions proposed GQ partitions * @return a non-null string if something is wrong (string explains issue) */ - protected static List parsePartitions(final List GQPartitions) { + protected static List parsePartitions(final List GQPartitions, final int defaultPloidy) { if ( GQPartitions == null ) throw new IllegalArgumentException("GQpartitions cannot be null"); if ( GQPartitions.isEmpty() ) throw new IllegalArgumentException("GQpartitions cannot be empty"); @@ -104,10 +102,10 @@ public class GVCFWriter implements VariantContextWriter { if ( value == null ) throw new IllegalArgumentException("GQPartitions contains a null integer"); if ( value < lastThreshold ) throw new IllegalArgumentException("GQPartitions is out of order. Last is " + lastThreshold + " but next is " + value); if ( value == lastThreshold ) throw new IllegalArgumentException("GQPartitions is equal elements: Last is " + lastThreshold + " but next is " + value); - result.add(new HomRefBlock(lastThreshold, value)); + result.add(new HomRefBlock(lastThreshold, value,defaultPloidy)); lastThreshold = value; } - result.add(new HomRefBlock(lastThreshold, Integer.MAX_VALUE)); + result.add(new HomRefBlock(lastThreshold, Integer.MAX_VALUE,defaultPloidy)); return result; } @@ -128,11 +126,13 @@ public class GVCFWriter implements VariantContextWriter { * * @param underlyingWriter the ultimate destination of the GVCF records * @param GQPartitions a well-formed list of GQ partitions + * @param defaultPloidy the assumed ploidy for input variant context without one. */ - public GVCFWriter(final VariantContextWriter underlyingWriter, final List GQPartitions) { + public GVCFWriter(final VariantContextWriter underlyingWriter, final List GQPartitions, final int defaultPloidy) { if ( underlyingWriter == null ) throw new IllegalArgumentException("underlyingWriter cannot be null"); this.underlyingWriter = underlyingWriter; - this.GQPartitions = parsePartitions(GQPartitions); + this.GQPartitions = parsePartitions(GQPartitions,defaultPloidy); + this.defaultPloidy = defaultPloidy; } /** @@ -148,10 +148,6 @@ public class GVCFWriter implements VariantContextWriter { header.addMetaDataLine(VCFStandardHeaderLines.getInfoLine(VCFConstants.END_KEY)); header.addMetaDataLine(new VCFFormatHeaderLine(MIN_DP_FORMAT_FIELD, 1, VCFHeaderLineType.Integer, "Minimum DP observed within the GVCF block")); - // These annotations are no longer standard - //header.addMetaDataLine(new VCFInfoHeaderLine(BLOCK_SIZE_INFO_FIELD, 1, VCFHeaderLineType.Integer, "Size of the homozygous reference GVCF block")); - //header.addMetaDataLine(new VCFFormatHeaderLine(MIN_GQ_FORMAT_FIELD, 1, VCFHeaderLineType.Integer, "Minimum GQ observed within the GVCF block")); - for ( final HomRefBlock partition : GQPartitions ) { header.addMetaDataLine(partition.toVCFHeaderLine()); } @@ -188,27 +184,30 @@ public class GVCFWriter implements VariantContextWriter { * @return a VariantContext to be emitted, or null if non is appropriate */ protected VariantContext addHomRefSite(final VariantContext vc, final Genotype g) { + if ( nextAvailableStart != -1 ) { // don't create blocks while the hom-ref site falls before nextAvailableStart (for deletions) - if ( vc.getStart() <= nextAvailableStart && vc.getChr().equals(contigOfNextAvailableStart) ) { + if ( vc.getStart() <= nextAvailableStart && vc.getChr().equals(contigOfNextAvailableStart) ) return null; - } // otherwise, reset to non-relevant nextAvailableStart = -1; contigOfNextAvailableStart = null; } - if ( currentBlock == null ) { - currentBlock = createNewBlock(vc, g); - return null; - } else if ( currentBlock.withinBounds(g.getGQ()) ) { + final VariantContext result; + if (genotypeCanBeMergedInCurrentBlock(g)) { currentBlock.add(vc.getStart(), g); - return null; + result = null; } else { - final VariantContext result = blockToVCF(currentBlock); + result = blockToVCF(currentBlock); currentBlock = createNewBlock(vc, g); - return result; } + return result; + } + + private boolean genotypeCanBeMergedInCurrentBlock(final Genotype g) { + return currentBlock != null && currentBlock.withinBounds(g.getGQ()) && currentBlock.getPloidy() == g.getPloidy() + && (currentBlock.getMinPLs() == null || !g.hasPL() || (currentBlock.getMinPLs().length == g.getPL().length)); } /** @@ -226,21 +225,20 @@ public class GVCFWriter implements VariantContextWriter { * Convert a HomRefBlock into a VariantContext * * @param block the block to convert - * @return a VariantContext representing the gVCF encoding for this block + * @return a VariantContext representing the gVCF encoding for this block. + * It will return {@code null} if input {@code block} is {@code null}, indicating that there + * is no variant-context to be output into the VCF. */ private VariantContext blockToVCF(final HomRefBlock block) { - if ( block == null ) throw new IllegalArgumentException("block cannot be null"); + if ( block == null ) return null; final VariantContextBuilder vcb = new VariantContextBuilder(block.getStartingVC()); vcb.attributes(new HashMap(2)); // clear the attributes vcb.stop(block.getStop()); vcb.attribute(VCFConstants.END_KEY, block.getStop()); - // This annotation is no longer standard - //vcb.attribute(BLOCK_SIZE_INFO_FIELD, block.getSize()); - // create the single Genotype with GQ and DP annotations - final GenotypeBuilder gb = new GenotypeBuilder(sampleName, Collections.nCopies(2, block.getRef())); + final GenotypeBuilder gb = new GenotypeBuilder(sampleName, GATKVariantContextUtils.homozygousAlleleList(block.getRef(),block.getPloidy())); gb.noAD().noPL().noAttributes(); // clear all attributes gb.GQ(block.getMedianGQ()); gb.DP(block.getMedianDP()); @@ -269,10 +267,12 @@ public class GVCFWriter implements VariantContextWriter { break; } } - if ( partition == null ) throw new IllegalStateException("GQ " + g + " from " + vc + " didn't fit into any partition " + partition); + + if ( partition == null ) + throw new IllegalStateException("GQ " + g + " from " + vc + " didn't fit into any partition"); // create the block, add g to it, and return it for use - final HomRefBlock block = new HomRefBlock(vc, partition.getGQLowerBound(), partition.getGQUpperBound()); + final HomRefBlock block = new HomRefBlock(vc, partition.getGQLowerBound(), partition.getGQUpperBound(), defaultPloidy); block.add(vc.getStart(), g); return block; } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlock.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlock.java index 179217b91..200eb1366 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlock.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlock.java @@ -46,11 +46,11 @@ package org.broadinstitute.gatk.utils.gvcf; -import org.broadinstitute.gatk.utils.MathUtils; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.Genotype; import htsjdk.variant.variantcontext.VariantContext; import htsjdk.variant.vcf.VCFHeaderLine; +import org.broadinstitute.gatk.utils.MathUtils; import java.util.ArrayList; import java.util.List; @@ -75,6 +75,7 @@ final class HomRefBlock { final private List GQs = new ArrayList<>(100); final private List DPs = new ArrayList<>(100); private final Allele ref; + private final int ploidy; /** * Create a new HomRefBlock @@ -83,7 +84,7 @@ final class HomRefBlock { * @param minGQ the minGQ (inclusive) to use in this band * @param maxGQ the maxGQ (exclusive) to use in this band */ - public HomRefBlock(final VariantContext startingVC, int minGQ, int maxGQ) { + public HomRefBlock(final VariantContext startingVC, final int minGQ, final int maxGQ, final int defaultPloidy) { if ( startingVC == null ) throw new IllegalArgumentException("startingVC cannot be null"); if ( minGQ > maxGQ ) throw new IllegalArgumentException("bad minGQ " + minGQ + " as its > maxGQ " + maxGQ); @@ -92,6 +93,7 @@ final class HomRefBlock { this.ref = startingVC.getReference(); this.minGQ = minGQ; this.maxGQ = maxGQ; + this.ploidy = startingVC.getMaxPloidy(defaultPloidy); } /** @@ -100,7 +102,7 @@ final class HomRefBlock { * @param minGQ the minGQ (inclusive) to use in this band * @param maxGQ the maxGQ (exclusive) to use in this band */ - public HomRefBlock(int minGQ, int maxGQ) { + public HomRefBlock(final int minGQ, final int maxGQ, final int ploidy) { if ( minGQ > maxGQ ) throw new IllegalArgumentException("bad minGQ " + minGQ + " as its > maxGQ " + maxGQ); this.startingVC = null; @@ -108,6 +110,7 @@ final class HomRefBlock { this.ref = null; this.minGQ = minGQ; this.maxGQ = maxGQ; + this.ploidy = ploidy; } /** @@ -119,19 +122,18 @@ final class HomRefBlock { if ( ! g.hasGQ() ) throw new IllegalArgumentException("g must have GQ field"); if ( ! g.hasPL() ) throw new IllegalArgumentException("g must have PL field"); if ( pos != stop + 1 ) throw new IllegalArgumentException("adding genotype at pos " + pos + " isn't contiguous with previous stop " + stop); + if ( g.getPloidy() != ploidy) + throw new IllegalArgumentException("cannot add a genotype with a different ploidy: " + g.getPloidy() + " != " + ploidy); - if( minPLs == null ) { // if the minPLs vector has not been set yet, create it here by copying the provided genotype's PLs + if( minPLs == null ) + minPLs = g.getPL(); + else { // otherwise take the min with the provided genotype's PLs final int[] PL = g.getPL(); - if( PL.length == 3 ) { - minPLs = PL.clone(); - } - } else { // otherwise take the min with the provided genotype's PLs - final int[] PL = g.getPL(); - if( PL.length == 3 ) { - minPLs[0] = Math.min(minPLs[0], PL[0]); - minPLs[1] = Math.min(minPLs[1], PL[1]); - minPLs[2] = Math.min(minPLs[2], PL[2]); - } + if (PL.length != minPLs.length) + throw new IllegalStateException("trying to merge different PL array sizes: " + PL.length + " != " + minPLs.length); + for (int i = 0; i < PL.length; i++) + if (minPLs[i] > PL[i]) + minPLs[i] = PL[i]; } stop = pos; GQs.add(Math.min(g.getGQ(), 99)); // cap the GQs by the max. of 99 emission @@ -182,4 +184,12 @@ final class HomRefBlock { public VCFHeaderLine toVCFHeaderLine() { return new VCFHeaderLine("GVCFBlock", "minGQ=" + getGQLowerBound() + "(inclusive),maxGQ=" + getGQUpperBound() + "(exclusive)"); } + + /** + * Get the ploidy of this hom-ref block. + * @return + */ + public int getPloidy() { + return ploidy; + } } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java index 2c17d4d5c..af93892a7 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java @@ -48,6 +48,9 @@ package org.broadinstitute.gatk.utils.haplotype; import com.google.java.contract.Requires; import htsjdk.variant.variantcontext.VariantContext; +import org.broadinstitute.gatk.genotyping.AlleleList; +import org.broadinstitute.gatk.genotyping.AlleleListUtils; +import org.broadinstitute.gatk.genotyping.SampleListUtils; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.PairHMMLikelihoodCalculationEngine; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; @@ -77,7 +80,9 @@ public class HaplotypeLDCalculator { @SuppressWarnings("unchecked") protected HaplotypeLDCalculator() { haplotypes = Collections.emptyList(); - readLikelihoods = new ReadLikelihoods<>((List)Collections.EMPTY_LIST, (List)Collections.EMPTY_LIST, Collections.EMPTY_MAP); + final AlleleList alleleList = AlleleListUtils.emptyList(); + readLikelihoods = new ReadLikelihoods<>(SampleListUtils.emptyList(), + alleleList, Collections.EMPTY_MAP); } public HaplotypeLDCalculator(final List haplotypes, final ReadLikelihoods haplotypeReadMap) { diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java index d17c12b30..51f1e04a2 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java @@ -50,15 +50,17 @@ package org.broadinstitute.gatk.tools.walkers.genotyper; // the imports for unit testing. -import org.broadinstitute.gatk.utils.BaseTest; -import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; -import org.broadinstitute.gatk.engine.arguments.GATKArgumentCollection; -import org.broadinstitute.gatk.utils.MathUtils; -import org.broadinstitute.gatk.utils.Utils; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; import htsjdk.variant.variantcontext.VariantContext; import htsjdk.variant.variantcontext.VariantContextBuilder; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.broadinstitute.gatk.engine.arguments.GATKArgumentCollection; +import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.genotyping.SampleListUtils; +import org.broadinstitute.gatk.utils.BaseTest; +import org.broadinstitute.gatk.utils.MathUtils; +import org.broadinstitute.gatk.utils.Utils; import org.testng.Assert; import org.testng.annotations.BeforeClass; import org.testng.annotations.DataProvider; @@ -76,7 +78,7 @@ public class UnifiedGenotyperEngineUnitTest extends BaseTest { engine.setArguments(new GATKArgumentCollection()); final UnifiedArgumentCollection args = new UnifiedArgumentCollection(); - final Set fakeSamples = Collections.singleton("fake"); + final SampleList fakeSamples = SampleListUtils.singletonList("fake"); ugEngine = new UnifiedGenotypingEngine(engine, args,fakeSamples); } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java index 66af674e9..d36b1af16 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java @@ -47,6 +47,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import com.google.caliper.Param; import com.google.caliper.SimpleBenchmark; +import org.broadinstitute.gatk.genotyping.SampleListUtils; import org.broadinstitute.gatk.utils.pairhmm.ActiveRegionTestDataSet; import org.broadinstitute.gatk.utils.pairhmm.FastLoglessPairHMM; import org.broadinstitute.gatk.utils.pairhmm.PairHMM; @@ -112,7 +113,7 @@ public class HCLikelihoodCalculationEnginesBenchmark extends SimpleBenchmark { public void timeGraphBasedLikelihoods(final int reps) { for (int i = 0; i < reps; i++) { final GraphBasedLikelihoodCalculationEngineInstance rtlce = new GraphBasedLikelihoodCalculationEngineInstance(dataSet.assemblyResultSet(), new FastLoglessPairHMM((byte)10),Double.NEGATIVE_INFINITY,HeterogeneousKmerSizeResolution.COMBO_MAX); - rtlce.computeReadLikelihoods(dataSet.haplotypeList(), Collections.singletonList("anonymous"), Collections.singletonMap("anonymous", dataSet.readList())); + rtlce.computeReadLikelihoods(dataSet.haplotypeList(), SampleListUtils.singletonList("anonymous"), Collections.singletonMap("anonymous", dataSet.readList())); } } @@ -121,7 +122,7 @@ public class HCLikelihoodCalculationEnginesBenchmark extends SimpleBenchmark { for (int i = 0; i < reps; i++) { final PairHMMLikelihoodCalculationEngine engine = new PairHMMLikelihoodCalculationEngine((byte) 10, PairHMM.HMM_IMPLEMENTATION.LOGLESS_CACHING, -3, true, PairHMMLikelihoodCalculationEngine.PCR_ERROR_MODEL.NONE); - engine.computeReadLikelihoods(dataSet.assemblyResultSet(), Collections.singletonList("anonymous"), Collections.singletonMap("anonymous", dataSet.readList())); + engine.computeReadLikelihoods(dataSet.assemblyResultSet(), SampleListUtils.singletonList("anonymous"), Collections.singletonMap("anonymous", dataSet.readList())); } } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java index db6923feb..cb946aafe 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java @@ -47,6 +47,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.genotyping.SampleListUtils; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.readthreading.HaplotypeGraph; import org.broadinstitute.gatk.utils.collections.Pair; import org.broadinstitute.gatk.utils.genotyper.PerReadAlleleLikelihoodMap; @@ -262,7 +263,7 @@ public class ReadThreadingLikelihoodCalculationEngineUnitTest extends ActiveRegi dataSet = (ActiveRegionTestDataSet) params[0]; if (INTRODUCE_READ_ERRORS) dataSet.introduceErrors(new Random(13)); graphEngine = new GraphBasedLikelihoodCalculationEngineInstance(dataSet.assemblyResultSet(),hmm,Double.NEGATIVE_INFINITY, HeterogeneousKmerSizeResolution.COMBO_MAX); - graphLks = graphEngine.computeReadLikelihoods(dataSet.haplotypeList(),Collections.singletonList("anonymous"),Collections.singletonMap("anonymous",dataSet.readList())).toPerReadAlleleLikelihoodMap(0); + graphLks = graphEngine.computeReadLikelihoods(dataSet.haplotypeList(), SampleListUtils.singletonList("anonymous"),Collections.singletonMap("anonymous",dataSet.readList())).toPerReadAlleleLikelihoodMap(0); // clip reads at the anchors. final Map clippedReads = anchorClippedReads(graphEngine.getHaplotypeGraph(),dataSet.readList()); @@ -272,7 +273,7 @@ public class ReadThreadingLikelihoodCalculationEngineUnitTest extends ActiveRegi clippedReadList.add(clippedReads.containsKey(r) ? clippedReads.get(r) : r); } - loglessLks = fullPairHMM.computeReadLikelihoods(dataSet.assemblyResultSet(),Collections.singletonList("anonymous"),Collections.singletonMap("anonymous",clippedReadList)).toPerReadAlleleLikelihoodMap(0); + loglessLks = fullPairHMM.computeReadLikelihoods(dataSet.assemblyResultSet(),SampleListUtils.singletonList("anonymous"),Collections.singletonMap("anonymous",clippedReadList)).toPerReadAlleleLikelihoodMap(0); // Change clipped by unclipped in the resulting likelihood map. for (final GATKSAMRecord r : clippedReads.keySet()) { diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java index 08edeee98..7c2cd8727 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java @@ -47,11 +47,12 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import htsjdk.samtools.SAMFileHeader; -import org.broadinstitute.gatk.utils.BaseTest; -import org.broadinstitute.gatk.utils.GenomeLoc; -import org.broadinstitute.gatk.utils.GenomeLocParser; -import org.broadinstitute.gatk.utils.UnvalidatingGenomeLoc; -import org.broadinstitute.gatk.utils.Utils; +import htsjdk.variant.variantcontext.Genotype; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; +import htsjdk.variant.variantcontext.GenotypeType; +import htsjdk.variant.variantcontext.VariantContext; +import org.broadinstitute.gatk.genotyping.*; +import org.broadinstitute.gatk.utils.*; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; @@ -61,7 +62,7 @@ import org.broadinstitute.gatk.utils.sam.ArtificialSAMUtils; import org.broadinstitute.gatk.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; -import htsjdk.variant.variantcontext.*; +import org.broadinstitute.gatk.utils.variant.HomoSapiensConstants; import org.testng.Assert; import org.testng.annotations.BeforeClass; import org.testng.annotations.BeforeMethod; @@ -75,7 +76,7 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { final String RGID = "ID1"; GATKSAMReadGroupRecord rg; final String sample = "NA12878"; - final Set samples = Collections.singleton(sample); + final SampleList samples = SampleListUtils.singletonList(sample); SAMFileHeader header; ReferenceConfidenceModel model; @@ -179,12 +180,12 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { @Test public void testIndelLikelihoods() { - GenotypeLikelihoods prev = model.getIndelPLs(0); + GenotypeLikelihoods prev = model.getIndelPLs(HomoSapiensConstants.DEFAULT_PLOIDY,0); Assert.assertEquals(prev.getAsPLs(), new int[]{0, 0, 0}); Assert.assertEquals(-10 * prev.getLog10GQ(GenotypeType.HOM_REF), 0.0); for ( int i = 1; i <= ReferenceConfidenceModel.MAX_N_INDEL_INFORMATIVE_READS; i++ ) { - final GenotypeLikelihoods current = model.getIndelPLs(i); + final GenotypeLikelihoods current = model.getIndelPLs(HomoSapiensConstants.DEFAULT_PLOIDY,i); final double prevGQ = -10 * prev.getLog10GQ(GenotypeType.HOM_REF); final double currGQ = -10 * current.getLog10GQ(GenotypeType.HOM_REF); Assert.assertTrue(prevGQ < currGQ, "GQ Failed with prev " + prev + " curr " + current + " at " + i); @@ -288,10 +289,12 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { data.getActiveRegion().add(data.makeRead(0, data.getRefLength())); } - final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), new ArrayList<>(samples), data.getActiveRegion()); + final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), samples, data.getActiveRegion()); + final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,2); + final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); final List expectedDPs = Collections.nCopies(data.getActiveRegion().getLocation().size(), nReads); - final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, calls); + final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, ploidyModel, genotypingModel, calls); checkReferenceModelResult(data, contexts, expectedDPs, calls); } @@ -304,12 +307,14 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { final List haplotypes = Arrays.asList(data.getRefHap()); final List calls = Collections.emptyList(); + final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,2); + final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); data.getActiveRegion().add(data.makeRead(start, readLen)); - final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), new ArrayList<>(samples), data.getActiveRegion()); + final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), samples, data.getActiveRegion()); final List expectedDPs = new ArrayList<>(Collections.nCopies(data.getActiveRegion().getLocation().size(), 0)); for ( int i = start; i < readLen + start; i++ ) expectedDPs.set(i, 1); - final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, calls); + final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, ploidyModel, genotypingModel, calls); checkReferenceModelResult(data, contexts, expectedDPs, calls); } } @@ -340,10 +345,12 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { data.getActiveRegion().add(data.makeRead(0, data.getRefLength())); } - final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), new ArrayList<>(samples), data.getActiveRegion()); + final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), samples, data.getActiveRegion()); + final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,HomoSapiensConstants.DEFAULT_PLOIDY); + final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); final List expectedDPs = Collections.nCopies(data.getActiveRegion().getLocation().size(), nReads); - final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, calls); + final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, ploidyModel, genotypingModel, calls); checkReferenceModelResult(data, contexts, expectedDPs, calls); } } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java index 61a6860fd..33e1a4758 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java @@ -48,6 +48,8 @@ package org.broadinstitute.gatk.utils.genotyper; import htsjdk.samtools.SAMFileHeader; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.broadinstitute.gatk.genotyping.IndexedAlleleList; +import org.broadinstitute.gatk.genotyping.IndexedSampleList; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.GenomeLocParser; import org.broadinstitute.gatk.utils.sam.ArtificialSAMUtils; @@ -72,7 +74,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testInstantiationAndQuery(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods result = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods result = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); Assert.assertEquals(result.sampleCount(), samples.length); Assert.assertEquals(result.alleleCount(), alleles.length); @@ -85,7 +87,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testLikelihoodFillingAndQuery(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods result = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods result = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final double[][][] likelihoods = fillWithRandomLikelihoods(samples, alleles, result); testLikelihoodMatrixQueries(samples, result, likelihoods); } @@ -106,7 +108,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testBestAlleles(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); fillWithRandomLikelihoods(samples,alleles,original); final int alleleCount = alleles.length; for (int s = 0; s < samples.length; s++) { @@ -146,7 +148,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testBestAlleleMap(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); fillWithRandomLikelihoods(samples,alleles,original); final Map> expected = new HashMap<>(alleles.length); for (final Allele allele : alleles) @@ -171,7 +173,7 @@ public class ReadLikelihoodsUnitTest } } if ((bestAlleleLk - secondBestAlleleLk) > ReadLikelihoods.BestAllele.INFORMATIVE_THRESHOLD) - expected.get(alleles[bestAlleleIndex]).add(sampleMatrix.read(r)); + expected.get(alleles[bestAlleleIndex]).add(sampleMatrix.readAt(r)); } } @@ -189,7 +191,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testFilterPoorlyModeledReads(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); for (int s = 0; s < samples.length; s++) { final int sampleReadCount = original.sampleReadCount(s); @@ -220,7 +222,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testFilterReadsToOverlap(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final GenomeLoc evenReadOverlap = locParser.createGenomeLoc(SAM_HEADER.getSequenceDictionary().getSequences().get(0).getSequenceName(),EVEN_READ_START ,EVEN_READ_START ); fillWithRandomLikelihoods(samples,alleles,original); final ReadLikelihoods result = original.clone(); @@ -231,7 +233,7 @@ public class ReadLikelihoodsUnitTest newLikelihoods[s][a] = new double[(original.sampleReadCount(s) + 1) / 2]; final ReadLikelihoods.Matrix sampleMatrix = original.sampleMatrix(s); for (int r = 0; r < newLikelihoods[s][a].length; r++) { - Assert.assertEquals(result.readIndex(s,sampleMatrix.read(r << 1)),r); + Assert.assertEquals(result.readIndex(s,sampleMatrix.readAt(r << 1)),r); newLikelihoods[s][a][r] = sampleMatrix.get(a, r << 1); } } @@ -240,14 +242,14 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "marginalizationDataSets") public void testMarginalizationWithOverlap(final String[] samples, final Allele[] alleles, final Map> reads, final Map> newToOldAlleleMapping) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final GenomeLoc evenReadOverlap = locParser.createGenomeLoc(SAM_HEADER.getSequenceDictionary().getSequences().get(0).getSequenceName(),EVEN_READ_START ,EVEN_READ_START ); fillWithRandomLikelihoods(samples, alleles, original); final ReadLikelihoods marginalized = original.marginalize(newToOldAlleleMapping,evenReadOverlap); Assert.assertNotNull(marginalized); Assert.assertEquals(newToOldAlleleMapping.size(),marginalized.alleleCount()); for (int a = 0; a < marginalized.alleleCount(); a++) { - final List oldAlleles = newToOldAlleleMapping.get(marginalized.allele(a)); + final List oldAlleles = newToOldAlleleMapping.get(marginalized.alleleAt(a)); Assert.assertNotNull(oldAlleles); for (int s = 0; s < samples.length; s++) { final ReadLikelihoods.Matrix oldSmapleLikelihoods = original.sampleMatrix(s); @@ -268,13 +270,13 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "marginalizationDataSets") public void testMarginalization(final String[] samples, final Allele[] alleles, final Map> reads, final Map> newToOldAlleleMapping) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); fillWithRandomLikelihoods(samples, alleles, original); final ReadLikelihoods marginalized = original.marginalize(newToOldAlleleMapping); Assert.assertNotNull(marginalized); Assert.assertEquals(newToOldAlleleMapping.size(),marginalized.alleleCount()); for (int a = 0; a < marginalized.alleleCount(); a++) { - final List oldAlleles = newToOldAlleleMapping.get(marginalized.allele(a)); + final List oldAlleles = newToOldAlleleMapping.get(marginalized.alleleAt(a)); Assert.assertNotNull(oldAlleles); for (int s = 0; s < samples.length; s++) { final ReadLikelihoods.Matrix oldSmapleLikelihoods = original.sampleMatrix(s); @@ -295,7 +297,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testNormalizeBestToZero(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final double[][][] originalLikelihoods = fillWithRandomLikelihoods(samples,alleles,original); final ReadLikelihoods result= original.clone(); result.normalizeLikelihoods(true, Double.NEGATIVE_INFINITY); @@ -321,7 +323,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testNormalizeCapWorstLK(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final double[][][] originalLikelihoods = fillWithRandomLikelihoods(samples,alleles,original); final ReadLikelihoods result= original.clone(); result.normalizeLikelihoods(false, - 0.001); @@ -354,7 +356,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testNormalizeCapWorstLKAndBestToZero(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final double[][][] originalLikelihoods = fillWithRandomLikelihoods(samples,alleles,original); final ReadLikelihoods result= original.clone(); result.normalizeLikelihoods(true, - 0.001); @@ -390,7 +392,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testAddMissingAlleles(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final double[][][] originalLikelihoods = fillWithRandomLikelihoods(samples,alleles,original); final ReadLikelihoods result = original.clone(); @@ -411,8 +413,8 @@ public class ReadLikelihoodsUnitTest Assert.assertEquals(original.alleleCount() + 1, result.alleleCount()); // We add too more amongst exisisting alleles: - result.addMissingAlleles(Arrays.asList(newTwo = Allele.create("ATATATTATATTAATATT".getBytes(), false),result.allele(1), - result.allele(0),newThree = Allele.create("TGTGTGTATTG".getBytes(),false),Allele.create("ACCCCCAAAATTTAAAGGG".getBytes(),false)),-6.54321); + result.addMissingAlleles(Arrays.asList(newTwo = Allele.create("ATATATTATATTAATATT".getBytes(), false),result.alleleAt(1), + result.alleleAt(0),newThree = Allele.create("TGTGTGTATTG".getBytes(),false),Allele.create("ACCCCCAAAATTTAAAGGG".getBytes(),false)),-6.54321); Assert.assertEquals(original.alleleCount()+3,result.alleleCount()); @@ -439,7 +441,7 @@ public class ReadLikelihoodsUnitTest @Test(dataProvider = "dataSets") public void testAddNonRefAllele(final String[] samples, final Allele[] alleles, final Map> reads) { - final ReadLikelihoods original = new ReadLikelihoods<>(Arrays.asList(samples), Arrays.asList(alleles), reads); + final ReadLikelihoods original = new ReadLikelihoods<>(new IndexedSampleList(samples), new IndexedAlleleList<>(alleles), reads); final double[][][] originalLikelihoods = fillWithRandomLikelihoods(samples,alleles,original); final ReadLikelihoods result = original.clone(); result.addNonReferenceAllele(GATKVariantContextUtils.NON_REF_SYMBOLIC_ALLELE); @@ -473,13 +475,13 @@ public class ReadLikelihoodsUnitTest private void testLikelihoodMatrixQueries(String[] samples, ReadLikelihoods result, final double[][][] likelihoods) { for (final String sample : samples) { final int sampleIndex = result.sampleIndex(sample); - final double[][] likelihoodMatrix = result.sampleValues(sampleIndex); final int sampleReadCount = result.sampleReadCount(sampleIndex); - Assert.assertEquals(result.alleleCount(), likelihoodMatrix.length); - for (int a = 0; a < likelihoodMatrix.length; a++) { - Assert.assertEquals(likelihoodMatrix[a].length,sampleReadCount); + final int alleleCount = result.alleleCount(); + Assert.assertEquals(result.alleleCount(), alleleCount); + for (int a = 0; a < alleleCount; a++) { + Assert.assertEquals(result.sampleReadCount(0),sampleReadCount); for (int r = 0; r < sampleReadCount; r++) - Assert.assertEquals(likelihoodMatrix[a][r], + Assert.assertEquals(result.sampleMatrix(0).get(a,r), likelihoods == null ? 0.0 : likelihoods[sampleIndex][a][r], EPSILON); } } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java index 3228e87d6..1f0280c82 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java @@ -46,14 +46,14 @@ package org.broadinstitute.gatk.utils.gvcf; -import org.broadinstitute.gatk.utils.BaseTest; -import org.broadinstitute.gatk.tools.walkers.haplotypecaller.ReferenceConfidenceModel; -import org.broadinstitute.gatk.utils.Utils; -import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; import htsjdk.variant.variantcontext.*; import htsjdk.variant.variantcontext.writer.VariantContextWriter; import htsjdk.variant.vcf.VCFConstants; import htsjdk.variant.vcf.VCFHeader; +import org.broadinstitute.gatk.utils.BaseTest; +import org.broadinstitute.gatk.utils.Utils; +import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.gatk.utils.variant.HomoSapiensConstants; import org.testng.Assert; import org.testng.annotations.BeforeMethod; import org.testng.annotations.DataProvider; @@ -100,21 +100,21 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testHeaderWriting() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.writeHeader(new VCFHeader()); Assert.assertTrue(mockWriter.headerWritten); } @Test public void testClose() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.close(); Assert.assertTrue(mockWriter.closed); } @Test public void testCloseWithoutClosingUnderlyingWriter() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.close(false); Assert.assertFalse(mockWriter.closed); } @@ -164,7 +164,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCloseEmitsLastVariant() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 30)); Assert.assertEquals(mockWriter.emitted.size(), 0); @@ -176,7 +176,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCloseDoesntEmitsLastVariantWhenNonRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeNonRef("20", 1, 30)); Assert.assertEquals(mockWriter.emitted.size(), 1); @@ -188,7 +188,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCrossingContigBoundaryRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 30)); writer.add(makeHomRef("20", 2, 30)); @@ -204,7 +204,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCrossingContigBoundaryToLowerPositionsRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 30, 30)); writer.add(makeHomRef("20", 31, 30)); @@ -220,7 +220,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCrossingContigBoundaryFromNonRefToLowerPositionsRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeNonRef("20", 20, 30)); Assert.assertEquals(mockWriter.emitted.size(), 1); @@ -235,7 +235,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCrossingContigBoundaryNonRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 30)); writer.add(makeHomRef("20", 2, 30)); @@ -248,7 +248,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testCrossingContigBoundaryNonRefThenNonRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeNonRef("20", 1, 30)); Assert.assertEquals(mockWriter.emitted.size(), 1); @@ -283,7 +283,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testVariantForcesNonRef() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 30)); writer.add(makeHomRef("20", 2, 30)); @@ -300,7 +300,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testEmittingTwoBands() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 0)); writer.add(makeHomRef("20", 2, 0)); @@ -315,7 +315,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testNonContiguousBlocks() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 0)); writer.add(makeHomRef("20", 2, 0)); @@ -329,7 +329,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testDeletion() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 0)); writer.add(makeHomRef("20", 2, 0)); @@ -347,7 +347,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testHomRefAlt() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, 2); writer.add(makeHomRef("20", 1, 0)); writer.add(makeHomRef("20", 2, 0)); @@ -383,7 +383,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test(dataProvider = "BandPartitionData") public void testMyData(final List partitions, final boolean expectedGood) { try { - GVCFWriter.parsePartitions(partitions); + GVCFWriter.parsePartitions(partitions,2); Assert.assertTrue(expectedGood, "Expected to fail but didn't"); } catch ( Exception e ) { Assert.assertTrue(! expectedGood, "Expected to succeed but failed with message " + e.getMessage()); diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java index 36d3aa09e..00d5d6984 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java @@ -46,11 +46,11 @@ package org.broadinstitute.gatk.utils.gvcf; -import org.broadinstitute.gatk.utils.BaseTest; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeBuilder; import htsjdk.variant.variantcontext.VariantContext; import htsjdk.variant.variantcontext.VariantContextBuilder; +import org.broadinstitute.gatk.utils.BaseTest; import org.testng.Assert; import org.testng.annotations.BeforeMethod; import org.testng.annotations.DataProvider; @@ -58,7 +58,6 @@ import org.testng.annotations.Test; import java.util.ArrayList; import java.util.Arrays; -import java.util.Collections; import java.util.List; public class HomRefBlockUnitTest extends BaseTest { @@ -71,7 +70,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test public void testBasicConstruction() { - final HomRefBlock band = new HomRefBlock(vc, 10, 20); + final HomRefBlock band = new HomRefBlock(vc, 10, 20, 2); Assert.assertSame(band.getStartingVC(), vc); Assert.assertEquals(band.getRef(), vc.getReference()); Assert.assertEquals(band.getGQLowerBound(), 10); @@ -86,7 +85,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test public void testMinMedian() { //TODO - might be better to make this test use a data provider? - final HomRefBlock band = new HomRefBlock(vc, 10, 20); + final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); final GenotypeBuilder gb = new GenotypeBuilder("NA12878"); int pos = vc.getStart(); @@ -117,7 +116,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test public void testBigGQIsCapped() { - final HomRefBlock band = new HomRefBlock(vc, 10, 20); + final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); final GenotypeBuilder gb = new GenotypeBuilder("NA12878"); band.add(vc.getStart(), gb.DP(1000).GQ(1000).PL(new int[]{0,10,100}).make()); @@ -126,7 +125,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test(expectedExceptions = IllegalArgumentException.class) public void testBadAdd() { - final HomRefBlock band = new HomRefBlock(vc, 10, 20); + final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); final GenotypeBuilder gb = new GenotypeBuilder("NA12878"); band.add(vc.getStart() + 10, gb.DP(10).GQ(11).PL(new int[]{0,10,100}).make()); @@ -156,7 +155,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test(dataProvider = "ContiguousData") public void testIsContiguous(final String contig, final int pos, final boolean expected) { - final HomRefBlock band = new HomRefBlock(vc, 10, 20); + final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); final VariantContext testVC = new VariantContextBuilder(vc).chr(contig).start(pos).stop(pos).make(); Assert.assertEquals(band.isContiguous(testVC), expected); } diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java index 8e5ae61fb..feb41712b 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java @@ -26,14 +26,13 @@ package org.broadinstitute.gatk.engine; import com.google.java.contract.Ensures; -import htsjdk.samtools.reference.IndexedFastaSequenceFile; -import htsjdk.samtools.reference.ReferenceSequenceFile; import htsjdk.samtools.SAMFileHeader; import htsjdk.samtools.SAMRecord; import htsjdk.samtools.SAMSequenceDictionary; +import htsjdk.samtools.reference.IndexedFastaSequenceFile; +import htsjdk.samtools.reference.ReferenceSequenceFile; +import htsjdk.variant.vcf.VCFConstants; import org.apache.log4j.Logger; -import org.broadinstitute.gatk.engine.walkers.*; -import org.broadinstitute.gatk.utils.commandline.*; import org.broadinstitute.gatk.engine.arguments.GATKArgumentCollection; import org.broadinstitute.gatk.engine.arguments.ValidationExclusion; import org.broadinstitute.gatk.engine.datasources.reads.*; @@ -55,8 +54,12 @@ import org.broadinstitute.gatk.engine.refdata.utils.RMDTriplet; import org.broadinstitute.gatk.engine.resourcemanagement.ThreadAllocation; import org.broadinstitute.gatk.engine.samples.SampleDB; import org.broadinstitute.gatk.engine.samples.SampleDBBuilder; +import org.broadinstitute.gatk.engine.walkers.*; +import org.broadinstitute.gatk.genotyping.IndexedSampleList; +import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.utils.*; import org.broadinstitute.gatk.utils.classloader.PluginManager; +import org.broadinstitute.gatk.utils.commandline.*; import org.broadinstitute.gatk.utils.exceptions.ReviewedGATKException; import org.broadinstitute.gatk.utils.exceptions.UserException; import org.broadinstitute.gatk.utils.interval.IntervalUtils; @@ -64,7 +67,6 @@ import org.broadinstitute.gatk.utils.progressmeter.ProgressMeter; import org.broadinstitute.gatk.utils.recalibration.BQSRArgumentSet; import org.broadinstitute.gatk.utils.text.XReadLines; import org.broadinstitute.gatk.utils.threading.ThreadEfficiencyMonitor; -import htsjdk.variant.vcf.VCFConstants; import java.io.File; import java.io.FileNotFoundException; @@ -1138,7 +1140,7 @@ public class GenomeAnalysisEngine { * Returns data source objects encapsulating all rod data; * individual rods can be accessed through the returned data source objects. * - * @return the rods data sources + * @return the rods data sources, never {@code null}. */ public List getRodDataSources() { return this.rodDataSources; @@ -1254,4 +1256,20 @@ public class GenomeAnalysisEngine { runtimeLimitInNanoseconds = TimeUnit.NANOSECONDS.convert(args.maxRuntime, args.maxRuntimeUnits); } } + + /** + * Returns the sample list including all samples. + * @return never {@code null}. + */ + public SampleList getSampleList() { + return new IndexedSampleList(getSampleDB().getSampleNames()); + } + + /** + * Returns the sample list including samples in read inputs. + * @return never {@code null}. + */ + public SampleList getReadSampleList() { + return new IndexedSampleList(SampleUtils.getSAMFileSamples(getSAMFileHeader())); + } } diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java index 380a20379..dfdfe0945 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java @@ -37,6 +37,24 @@ import java.util.List; */ public class AlleleListUtils { + @SuppressWarnings("unchecked") + private static final AlleleList EMPTY_LIST = new AlleleList() { + @Override + public int alleleCount() { + return 0; + } + + @Override + public int alleleIndex(final Allele allele) { + return -1; + } + + @Override + public Allele alleleAt(final int index) { + throw new IllegalArgumentException("allele index is out of range"); + } + }; + /** * Checks whether two allele lists are in fact the same. * @param first one list to compare. @@ -107,6 +125,16 @@ public class AlleleListUtils { return new AsList(list); } + /** + * Returns an unmodifiable empty allele-list. + * @param
the allele class. + * @return never {@code null}. + */ + @SuppressWarnings("unchecked") + public static final AlleleList emptyList() { + return EMPTY_LIST; + } + /** * Simple list view of a sample-list. */ diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java index e151d03da..f3787568a 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java @@ -34,6 +34,33 @@ import java.util.*; */ public class SampleListUtils { + private static final SampleList EMPTY_LIST = new SampleList() { + + @Override + public int sampleCount() { + return 0; + } + + @Override + public int sampleIndex(String sample) { + return -1; + } + + @Override + public String sampleAt(final int sampleIndex) { + throw new IllegalArgumentException("index is out of valid range"); + } + }; + + /** + * Empty list. + * + * @return never {@code null} + */ + public static SampleList emptyList() { + return EMPTY_LIST; + } + /** * Checks whether two sample lists are in fact the same. * @param first one list to compare. diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/SampleUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/SampleUtils.java index ccb573414..77fc17083 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/SampleUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/SampleUtils.java @@ -60,9 +60,9 @@ public class SampleUtils { * @param header the sam file header * @return list of strings representing the sample names */ - public static Set getSAMFileSamples(SAMFileHeader header) { + public static Set getSAMFileSamples(final SAMFileHeader header) { // get all of the unique sample names - Set samples = new TreeSet(); + final Set samples = new TreeSet(); List readGroups = header.getReadGroups(); for ( SAMReadGroupRecord readGroup : readGroups ) samples.add(readGroup.getSample()); diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/variant/GATKVariantContextUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/variant/GATKVariantContextUtils.java index 97cbebd09..2fdf657cc 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/variant/GATKVariantContextUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/variant/GATKVariantContextUtils.java @@ -85,6 +85,24 @@ public class GATKVariantContextUtils { return true; } + /** + * Returns a homozygous call allele list given the only allele and the ploidy. + * + * @param allele the only allele in the allele list. + * @param ploidy the ploidy of the resulting allele list. + * + * @throws IllegalArgumentException if {@code allele} is {@code null} or ploidy is negative. + * + * @return never {@code null}. + */ + public static List homozygousAlleleList(final Allele allele, final int ploidy) { + if (allele == null || ploidy < 0) + throw new IllegalArgumentException(); + + // Use a tailored inner class to implement the list: + return Collections.nCopies(ploidy,allele); + } + public enum GenotypeMergeType { /** * Make all sample genotypes unique by file. Each sample shared across RODs gets named sample.ROD. From 611b7f25ea847671440bc36c2ffdba14f8679676 Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Wed, 13 Aug 2014 14:06:52 -0400 Subject: [PATCH 6/7] Adds unit-test and integration test for new omniploidy likelihood calculation components Added md5 to HaplotypeCallerIntegrationTest.testHaplotypeCallerSingleSampleWithDbsnp --- .../GenotypeLikelihoodCalculator.java | 1 - .../gatk/genotyping/AlleleListUnitTester.java | 171 +++++++++ .../genotyping/AlleleListUtilsUnitTest.java | 226 ++++++++++++ .../GenotypeAlleleCountsUnitTest.java | 328 ++++++++++++++++++ .../GenotypeLikelihoodCalculatorUnitTest.java | 172 +++++++++ .../genotyping/GenotypingDataUnitTest.java | 103 ++++++ .../genotyping/HeterogeneousPloidyModel.java | 119 +++++++ .../HomogeneousPloidyModelUnitTest.java | 92 +++++ .../genotyping/IndexedAlleleListUnitTest.java | 102 ++++++ .../genotyping/IndexedSampleListUnitTest.java | 133 +++++++ ...teRandomMatingPopulationModelUnitTest.java | 145 ++++++++ .../genotyping/ReadLikelihoodsUnitTester.java | 124 +++++++ .../gatk/genotyping/SampleListUnitTester.java | 120 +++++++ .../genotyping/SampleListUtilsUnitTest.java | 126 +++++++ .../UnifiedGenotyperEngineUnitTest.java | 6 +- ...perGeneralPloidySuite1IntegrationTest.java | 4 +- ...perGeneralPloidySuite2IntegrationTest.java | 2 +- .../HaplotypeCallerGVCFIntegrationTest.java | 90 ++++- .../HaplotypeCallerIntegrationTest.java | 50 ++- .../ReferenceConfidenceModelUnitTest.java | 10 +- .../broadinstitute/gatk/utils/RandomDNA.java | 16 +- .../utils/collections/IndexedSetUnitTest.java | 281 +++++++++++++++ .../utils/collections/IntMaxHeapUnitTest.java | 171 +++++++++ .../genotyper/ReadLikelihoodsUnitTest.java | 258 +++++++++++++- .../gatk/utils/gvcf/GVCFWriterUnitTest.java | 2 +- .../gatk/utils/gvcf/HomRefBlockUnitTest.java | 13 +- .../genotyper/PerReadAlleleLikelihoodMap.java | 18 +- .../broadinstitute/gatk/utils/BaseTest.java | 25 +- 28 files changed, 2855 insertions(+), 53 deletions(-) create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IndexedSetUnitTest.java create mode 100644 protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IntMaxHeapUnitTest.java diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java index ff824ac26..b07334f04 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java @@ -89,7 +89,6 @@ public class GenotypeLikelihoodCalculator { */ private final GenotypeAlleleCounts[] genotypeAlleleCounts; - /** * Number of genotypes given this calculator {@link #ploidy} and {@link #alleleCount}. */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java new file mode 100644 index 000000000..2eefe64aa --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java @@ -0,0 +1,171 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.broadinstitute.gatk.utils.RandomDNA; +import org.testng.Assert; +import org.testng.SkipException; + +import java.util.HashSet; +import java.util.List; +import java.util.Random; +import java.util.Set; + +/** + * Helper class for those unit-test classes that test on implementations of SampleList. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class AlleleListUnitTester { + + private static final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + private static final RandomDNA rndDNA = new RandomDNA(rnd); + + /** + * Test that the contents of an allele-list are the ones expected. + *

+ *

+ * This method perform various consistency check involving all the {@link org.broadinstitute.gatk.genotyping.AlleleList} interface methods. + * Therefore calling this method is equivalent to a thorough check of the {@link org.broadinstitute.gatk.genotyping.AlleleList} aspect of + * the {@code actual} argument. + *

+ * + * @param actual the sample-list to assess. + * @param expected the expected sample-list. + * @throws IllegalArgumentException if {@code expected} is {@code null} or contains + * {@code null}s which is an indication of an bug in the testing code. + * @throws RuntimeException if there is some testing assertion exception which + * is an indication of an actual bug the code that is been tested. + */ + public static
void assertAlleleList(final AlleleList actual, final List expected) { + if (expected == null) + throw new IllegalArgumentException("the expected list cannot be null"); + final Set expectedAlleleSet = new HashSet<>(expected.size()); + Assert.assertNotNull(actual); + Assert.assertEquals(actual.alleleCount(), expected.size()); + for (int i = 0; i < expected.size(); i++) { + final A expectedAllele = expected.get(i); + if (expectedAllele == null) + throw new IllegalArgumentException("the expected sample cannot be null"); + if (expectedAllele.equals(NEVER_USE_ALLELE)) + throw new IllegalArgumentException("you cannot use the forbidden sample name"); + if (expectedAlleleSet.contains(expected.get(i))) + throw new IllegalArgumentException("repeated allele in the expected list, this is a test bug"); + final A actualAllele = actual.alleleAt(i); + Assert.assertNotNull(actualAllele, "allele cannot be null"); + Assert.assertFalse(expectedAlleleSet.contains(actualAllele), "repeated allele: " + actualAllele); + Assert.assertEquals(actualAllele, expectedAllele, "wrong allele order; index = " + i); + Assert.assertEquals(actual.alleleIndex(actualAllele), i, "allele index mismatch"); + expectedAlleleSet.add(actualAllele); + } + + Assert.assertEquals(actual.alleleIndex((A) NEVER_USE_ALLELE), -1); + } + + /** + * Save to assume that this allele will never be used. + */ + private static final Allele NEVER_USE_ALLELE = Allele.create(new String("ACTGACTGACTGACTGACTGACTGACTGACTGGTCAGTCAGTCAGTCAGTCAGTCA").getBytes(), false); + + /** + * Generate testing alleles. + * + *

+ * Basically all are random alleles given the maximum allele length. + *

+ * + *

+ * So with a low max-allele-length and high allele-count you can force repeats. + *

+ * + * @param alleleCount number of alleles to generate. + * @param maxAlleleLength the maximum length of the allele in bases. + * + * @throws RuntimeException if {@code alleleCount} is negative or {@code maxAlleleLength} is less than 1. + * @return never {@code null}. + */ + public static Allele[] generateRandomAlleles(final int alleleCount, final int maxAlleleLength) { + if (maxAlleleLength < 1) + throw new IllegalArgumentException("the max allele length cannot be less than 1"); + final Allele[] result = new Allele[alleleCount]; + for (int i = 0; i < alleleCount; i++) { + final int alleleLength = rnd.nextInt(maxAlleleLength) + 1; + result[i] = Allele.create(rndDNA.nextBases(alleleLength)); + } + return result; + } + + /** + * Generate testing alleles. + * + *

+ * Basically all are random alleles given the maximum allele length. + *

+ * + *

+ * So with a low max-allele-length and high allele-count you can force repeats. + *

+ * + * @param alleleCount number of alleles to generate. + * @param maxAlleleLength the maximum length of the allele in bases. + * @param skipIfRepeats throw an test-skip exception {@link SkipException} if the resulting allele-list + * has repeats, thus is size is less than {@code alleleCount} + * + * @throws RuntimeException if {@code alleleCount} is negative or {@code maxAlleleLength} is less than 1. + * @return never {@code null}. + */ + static AlleleList alleleList(final int alleleCount, final int maxAlleleLength, final boolean skipIfRepeats) { + final Allele[] alleles = AlleleListUnitTester.generateRandomAlleles(alleleCount,maxAlleleLength); + if (alleleCount > 0) + alleles[0] = Allele.create(alleles[0].getBases(),true); + final AlleleList alleleList = new IndexedAlleleList<>(alleles); + if (skipIfRepeats && alleleList.alleleCount() != alleles.length) + throw new SkipException("repeated alleles, should be infrequent"); + return alleleList; + } +} \ No newline at end of file diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java new file mode 100644 index 000000000..a7e2dce88 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java @@ -0,0 +1,226 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.testng.Assert; +import org.testng.SkipException; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Test {@link org.broadinstitute.gatk.genotyping.AlleleListUtils}. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class AlleleListUtilsUnitTest { + + @Test(dataProvider = "singleAlleleListData") + public void testAsList(final List alleles1) { + final Allele[] uniqueAlleles = new LinkedHashSet<>(alleles1).toArray(new Allele[0]); + final AlleleList alleleList = new IndexedAlleleList<>(alleles1); + final List asList = AlleleListUtils.asList(alleleList); + final Allele[] asListArray = asList.toArray(new Allele[asList.size()]); + Assert.assertTrue(Arrays.equals(uniqueAlleles,asListArray)); + } + + @Test(dataProvider = "singleAlleleListData") + public void testIndexOfReference(final List alleles1) { + final Allele[] uniqueAlleles = new LinkedHashSet<>(alleles1).toArray(new Allele[0]); + for (int i = 0; i < uniqueAlleles.length; i++) { + final Allele[] actualAlleles = uniqueAlleles.clone(); + actualAlleles[i] = Allele.create(actualAlleles[i].getBases(),true); + final AlleleList alleleList = new IndexedAlleleList<>(actualAlleles); + Assert.assertEquals(AlleleListUtils.indexOfReference(alleleList),i); + } + final AlleleList alleleList = new IndexedAlleleList<>(uniqueAlleles); + Assert.assertEquals(AlleleListUtils.indexOfReference(alleleList),-1); + } + + @Test(dataProvider = "twoAlleleListData", dependsOnMethods={"testAsList"}) + public void testEquals(final List alleles1, final List alleles2) { + final AlleleList alleleList1 = new IndexedAlleleList(alleles1); + final AlleleList alleleList2 = new IndexedAlleleList(alleles2); + Assert.assertTrue(AlleleListUtils.equals(alleleList1,alleleList1)); + Assert.assertTrue(AlleleListUtils.equals(alleleList2,alleleList2)); + Assert.assertEquals(AlleleListUtils.equals(alleleList1, alleleList2), + Arrays.equals(AlleleListUtils.asList(alleleList1).toArray(new Allele[alleleList1.alleleCount()]), + AlleleListUtils.asList(alleleList2).toArray(new Allele[alleleList2.alleleCount()])) + ); + Assert.assertEquals(AlleleListUtils.equals(alleleList1,alleleList2), + AlleleListUtils.equals(alleleList2,alleleList1)); + } + + @Test(dataProvider = "singleAlleleListData", dependsOnMethods= "testEquals" ) + public void testSelfPermutation(final List alleles1) { + final AlleleList originalAlleleList = new IndexedAlleleList<>(alleles1); + final AlleleListPermutation selfPermutation = AlleleListUtils.permutation(originalAlleleList,originalAlleleList); + Assert.assertEquals(selfPermutation.fromSize(),originalAlleleList.alleleCount()); + Assert.assertEquals(selfPermutation.toSize(),originalAlleleList.alleleCount()); + Assert.assertTrue(selfPermutation.isNonPermuted()); + Assert.assertFalse(selfPermutation.isPartial()); + for (int i = 0; i < originalAlleleList.alleleCount(); i++) { + Assert.assertEquals(selfPermutation.fromIndex(i), i); + Assert.assertEquals(selfPermutation.toIndex(i),i); + Assert.assertEquals(selfPermutation.fromList(),selfPermutation.toList()); + AlleleListUnitTester.assertAlleleList(originalAlleleList, selfPermutation.fromList()); + } + Assert.assertTrue(AlleleListUtils.equals(selfPermutation,originalAlleleList)); + } + + private final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + @Test(dataProvider = "singleAlleleListData", dependsOnMethods = "testEquals") + public void testSubsetPermutation(final List alleles1) { + final List subsetAlleles = new ArrayList<>(alleles1.size()); + for (final Allele allele : alleles1) + if (rnd.nextBoolean()) subsetAlleles.add(allele); + final AlleleList originalAlleleList = new IndexedAlleleList<>(alleles1); + final AlleleList targetAlleleList = new IndexedAlleleList<>(subsetAlleles); + final AlleleListPermutation subset = AlleleListUtils.permutation(originalAlleleList,targetAlleleList); + if (originalAlleleList.alleleCount() == targetAlleleList.alleleCount()) + throw new SkipException("no real subset"); + Assert.assertTrue(subset.isPartial()); + Assert.assertFalse(subset.isNonPermuted()); + Assert.assertEquals(subset.fromSize(),originalAlleleList.alleleCount()); + Assert.assertEquals(subset.toSize(),targetAlleleList.alleleCount()); + AlleleListUnitTester.assertAlleleList(originalAlleleList,subset.fromList()); + AlleleListUnitTester.assertAlleleList(targetAlleleList,subset.toList()); + + for (int i = 0; i < targetAlleleList.alleleCount(); i++) + Assert.assertEquals(subset.fromIndex(i), originalAlleleList.alleleIndex(targetAlleleList.alleleAt(i))); + + for (int j = 0; j < originalAlleleList.alleleCount(); j++) { + final Allele allele = originalAlleleList.alleleAt(j); + Assert.assertEquals(subset.toIndex(j),targetAlleleList.alleleIndex(allele)); + } + + Assert.assertTrue(AlleleListUtils.equals(subset,targetAlleleList)); + } + + @Test(dataProvider = "singleAlleleListData", dependsOnMethods = {"testAsList","testEquals"}) + public void testShufflePermutation(final List alleles1) { + final AlleleList originalAlleleList = new IndexedAlleleList<>(alleles1); + if (originalAlleleList.alleleCount() <= 1) + throw new SkipException("non-shuffle allele-list"); + + final Allele[] targetAlleleArray = AlleleListUtils.asList(originalAlleleList).toArray(new Allele[originalAlleleList.alleleCount()]); + final int[] fromIndex = new int[targetAlleleArray.length]; + for (int i = 0; i < fromIndex.length; i++) + fromIndex[i] = i; + + for (int i = 0; i < targetAlleleArray.length - 1; i++) { + final int swapIndex = rnd.nextInt(targetAlleleArray.length - i - 1); + final int otherIndex = fromIndex[swapIndex + i + 1]; + final Allele other = targetAlleleArray[swapIndex + i + 1]; + fromIndex[swapIndex + i + 1] = fromIndex[i]; + fromIndex[i] = otherIndex; + targetAlleleArray[swapIndex + i + 1] = targetAlleleArray[i]; + targetAlleleArray[i] = other; + } + final AlleleList targetAlleleList = new IndexedAlleleList<>(targetAlleleArray); + + final AlleleListPermutation permutation = AlleleListUtils.permutation(originalAlleleList,targetAlleleList); + Assert.assertFalse(permutation.isNonPermuted()); + AlleleListUnitTester.assertAlleleList(originalAlleleList,permutation.fromList()); + AlleleListUnitTester.assertAlleleList(targetAlleleList,permutation.toList()); + Assert.assertFalse(permutation.isPartial()); + Assert.assertEquals(permutation.fromSize(),originalAlleleList.alleleCount()); + Assert.assertEquals(permutation.toSize(),targetAlleleList.alleleCount()); + for (int i = 0; i < permutation.fromSize(); i++) { + Assert.assertEquals(permutation.toIndex(i),targetAlleleList.alleleIndex(originalAlleleList.alleleAt(i))); + Assert.assertEquals(permutation.fromIndex(i),originalAlleleList.alleleIndex(targetAlleleList.alleleAt(i))); + Assert.assertEquals(permutation.fromIndex(i),fromIndex[i]); + } + Assert.assertTrue(AlleleListUtils.equals(permutation,targetAlleleList)); + + } + + + private List[] alleleLists; + + @BeforeClass + public void setUp() { + alleleLists = new List[ALLELE_COUNT.length * MAX_ALLELE_LENGTH.length]; + int nextIndex = 0; + for (int i = 0; i < ALLELE_COUNT.length; i++) + for (int j = 0; j < MAX_ALLELE_LENGTH.length; j++) + alleleLists[nextIndex++] = Arrays.asList(AlleleListUnitTester.generateRandomAlleles(ALLELE_COUNT[i], MAX_ALLELE_LENGTH[j])); + } + + private static final int[] ALLELE_COUNT = { 0, 1, 5, 10, 20}; + + private static final int[] MAX_ALLELE_LENGTH = { 1, 2, 3, 10 }; + + @DataProvider(name="singleAlleleListData") + public Object[][] singleAlleleListData() { + final Object[][] result = new Object[alleleLists.length][]; + for (int i = 0; i < alleleLists.length; i++) + result[i] = new Object[] { alleleLists[i]}; + return result; + } + + @DataProvider(name="twoAlleleListData") + public Object[][] twoAlleleListData() { + final Object[][] result = new Object[alleleLists.length * alleleLists.length][]; + int index = 0; + for (int i = 0; i < alleleLists.length; i++) + for (int j = 0; j < alleleLists.length; j++) + result[index++] = new Object[] { alleleLists[i], alleleLists[j]}; + return result; + } + + + + + + + +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java new file mode 100644 index 000000000..8506b96e9 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java @@ -0,0 +1,328 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.Arrays; + +/** + * Test {@link GenotypeAlleleCounts} + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypeAlleleCountsUnitTest { + + @Test(dataProvider="ploidyData") + public void testFirst(final int ploidy) { + final GenotypeAlleleCounts subject = GenotypeAlleleCounts.first(ploidy); + Assert.assertNotNull(subject); + Assert.assertEquals(subject.ploidy(), ploidy); + Assert.assertEquals(subject.distinctAlleleCount(),1); + Assert.assertEquals(subject.alleleCountAt(0),ploidy); + Assert.assertEquals(subject.alleleCountFor(0),ploidy); + Assert.assertEquals(subject.alleleRankFor(0),0); + Assert.assertEquals(subject.alleleRankFor(1),-2); + Assert.assertTrue(subject.containsAllele(0)); + Assert.assertFalse(subject.containsAllele(1)); + Assert.assertEquals(subject.alleleIndexAt(0),0); + Assert.assertEquals(subject.maximumAlleleIndex(),0); + Assert.assertEquals(subject.minimumAlleleIndex(),0); + Assert.assertTrue(subject.compareTo(subject) == 0); + Assert.assertTrue(subject.equals(subject)); + Assert.assertEquals(subject.index(),0); + for (int maximumAlleleIndex = 0; maximumAlleleIndex <= MAXIMUM_ALLELE_INDEX; maximumAlleleIndex++) { + final int[] expected = new int[maximumAlleleIndex + 1]; + expected[0] = ploidy; + Assert.assertEquals(subject.alleleCountsByIndex(maximumAlleleIndex),expected); + } + } + + @Test(dataProvider = "ploidyData",dependsOnMethods = "testFirst") + public void testNext(final int ploidy) { + if (ploidy == 0) + testNextZeroPloidy(); + else if (ploidy == 1) + testNextOnePloidy(); + else + testPloidyTwoOrMore(ploidy); + } + + @Test(dataProvider = "ploidyData",dependsOnMethods = "testNext") + public void testIncrease(final int ploidy) { + if (ploidy == 0) + testNextZeroPloidyIncrease(); + else if (ploidy == 1) + testNextOnePloidyIncrease(); + else + testPloidyTwoOrMoreIncrease(ploidy); + } + + private void testNextZeroPloidy() { + final GenotypeAlleleCounts first = GenotypeAlleleCounts.first(0); + final GenotypeAlleleCounts next = first.next(); + Assert.assertEquals(first,next); + Assert.assertEquals(first.compareTo(next),0); + Assert.assertEquals(next.compareTo(first), 0); + Assert.assertEquals(next.distinctAlleleCount(),0); + Assert.assertEquals(next.ploidy(),0); + Assert.assertEquals(next.index(),0); + for (int maximumAlleleIndex = 0; maximumAlleleIndex <= 10; maximumAlleleIndex++) { + final int[] expected = new int[maximumAlleleIndex + 1]; + Assert.assertEquals(next.alleleCountsByIndex(maximumAlleleIndex),expected); + } + } + + private void testNextOnePloidy() { + final GenotypeAlleleCounts first = GenotypeAlleleCounts.first(1); + GenotypeAlleleCounts current = first; + + while (!current.containsAllele(MAXIMUM_ALLELE_INDEX + 1)) { + final GenotypeAlleleCounts next = current.next(); + Assert.assertEquals(next.minimumAlleleIndex(),next.maximumAlleleIndex()); + Assert.assertEquals(next.minimumAlleleIndex(),current.minimumAlleleIndex() + 1); + Assert.assertEquals(next.alleleCountAt(0),1); + Assert.assertEquals(next.alleleIndexAt(0),next.minimumAlleleIndex()); + Assert.assertEquals(next.alleleRankFor(next.minimumAlleleIndex()),0); + Assert.assertEquals(next.alleleRankFor(next.minimumAlleleIndex() + 1),-2); + Assert.assertEquals(next.alleleCountFor(next.minimumAlleleIndex()),1); + Assert.assertEquals(next.alleleCountFor(next.minimumAlleleIndex()+1),0); + Assert.assertEquals(next.ploidy(),1); + + Assert.assertTrue(next.compareTo(current) > 0); + Assert.assertTrue(current.compareTo(next) < 0); + Assert.assertTrue(next.compareTo(next) == 0); + Assert.assertTrue(next.equals(next)); + Assert.assertFalse(next.equals(current)); + Assert.assertFalse(current.equals(next)); + + Assert.assertEquals(next.index(), current.index() + 1); + Assert.assertEquals(next.ploidy(),current.ploidy()); + + for (int maximumAlleleIndex = 0; maximumAlleleIndex <= MAXIMUM_ALLELE_INDEX; maximumAlleleIndex++) { + final int[] expected = new int[maximumAlleleIndex + 1]; + if (maximumAlleleIndex >= current.minimumAlleleIndex() + 1) expected[current.minimumAlleleIndex() + 1] = 1; + Assert.assertEquals(next.alleleCountsByIndex(maximumAlleleIndex),expected); + } + current = next; + } + } + + private void testPloidyTwoOrMore(final int ploidy) { + if (ploidy < 2) + throw new IllegalArgumentException(); + + GenotypeAlleleCounts current = GenotypeAlleleCounts.first(ploidy); + + while (!current.containsAllele(MAXIMUM_ALLELE_INDEX + 1)) { + final GenotypeAlleleCounts next = current.next(); + if (current.distinctAlleleCount() == 1) { + Assert.assertEquals(next.maximumAlleleIndex(),current.maximumAlleleIndex() + 1); + Assert.assertEquals(next.distinctAlleleCount(), 2 ); + Assert.assertEquals(next.minimumAlleleIndex(), 0 ); + } else { + Assert.assertEquals(next.maximumAlleleIndex(),current.maximumAlleleIndex()); + Assert.assertEquals(next.minimumAlleleIndex(),current.alleleCountAt(0) > 1 ? 0 + : current.alleleCountAt(0) == 1 ? current.minimumAlleleIndex() + 1 : current.minimumAlleleIndex()); + } + + // Checking on 0's new count and current.minAllele + 1 alleles. + Assert.assertEquals(next.alleleCountFor(0),current.alleleCountFor(current.minimumAlleleIndex()) - 1); + Assert.assertEquals(next.alleleCountFor(current.minimumAlleleIndex() + 1), + current.alleleCountFor(current.minimumAlleleIndex() + 1) + 1); + + // Checks current.minAllele count + Assert.assertEquals(next.alleleCountFor(current.minimumAlleleIndex()), + current.minimumAlleleIndex() == 0 ? current.alleleCountAt(0) - 1 : 0); + + int totalCountSum = 0; + final int[] expectedAlleleCountsByIndex = new int[Math.max(MAXIMUM_ALLELE_INDEX,next.maximumAlleleIndex()) + 1]; + for (int i = 0; i < next.distinctAlleleCount(); i++) { + final int count = next.alleleCountAt(i); + final int index = next.alleleIndexAt(i); + expectedAlleleCountsByIndex[index] = count; + // Check consistency of alleleCountAt(x) and alleleCountFor(alleleIndexAt(x)) + Assert.assertEquals(next.alleleCountFor(index),count); + totalCountSum += count; + // Check on counts of, in theory, unaffected allele counts. + if (index > current.minimumAlleleIndex() + 1) + Assert.assertEquals(next.alleleCountFor(index),current.alleleCountFor(index)); + } + Assert.assertTrue(Arrays.equals(next.alleleCountsByIndex(Math.max(MAXIMUM_ALLELE_INDEX,next.maximumAlleleIndex())),expectedAlleleCountsByIndex)); + Assert.assertEquals(totalCountSum,ploidy); + + Assert.assertTrue(next.compareTo(current) > 0); + Assert.assertTrue(current.compareTo(next) < 0); + Assert.assertTrue(next.compareTo(next) == 0); + Assert.assertTrue(next.equals(next)); + Assert.assertFalse(next.equals(current)); + Assert.assertFalse(current.equals(next)); + Assert.assertEquals(next.index(),current.index() + 1); + Assert.assertEquals(next.ploidy(),ploidy); + current = next; + } + } + + private void testNextZeroPloidyIncrease() { + final GenotypeAlleleCounts first = GenotypeAlleleCounts.first(0); + final GenotypeAlleleCounts next = first.clone(); + next.increase(); + Assert.assertEquals(first,next); + Assert.assertEquals(first.compareTo(next),0); + Assert.assertEquals(next.compareTo(first), 0); + Assert.assertEquals(next.distinctAlleleCount(),0); + Assert.assertEquals(next.ploidy(),0); + Assert.assertEquals(next.index(),0); + for (int maximumAlleleIndex = 0; maximumAlleleIndex <= 10; maximumAlleleIndex++) { + final int[] expected = new int[maximumAlleleIndex + 1]; + Assert.assertEquals(next.alleleCountsByIndex(maximumAlleleIndex),expected); + } + } + + private void testNextOnePloidyIncrease() { + final GenotypeAlleleCounts first = GenotypeAlleleCounts.first(1); + GenotypeAlleleCounts next = first; + + while (!next.containsAllele(MAXIMUM_ALLELE_INDEX + 1)) { + final GenotypeAlleleCounts current = next.clone(); + next.increase(); + Assert.assertEquals(next.minimumAlleleIndex(),next.maximumAlleleIndex()); + Assert.assertEquals(next.minimumAlleleIndex(),current.minimumAlleleIndex() + 1); + Assert.assertEquals(next.alleleCountAt(0),1); + Assert.assertEquals(next.alleleIndexAt(0),next.minimumAlleleIndex()); + Assert.assertEquals(next.alleleRankFor(next.minimumAlleleIndex()),0); + Assert.assertEquals(next.alleleRankFor(next.minimumAlleleIndex() + 1),-2); + Assert.assertEquals(next.alleleCountFor(next.minimumAlleleIndex()),1); + Assert.assertEquals(next.alleleCountFor(next.minimumAlleleIndex()+1),0); + Assert.assertEquals(next.ploidy(),1); + + Assert.assertTrue(next.compareTo(current) > 0); + Assert.assertTrue(current.compareTo(next) < 0); + Assert.assertTrue(next.compareTo(next) == 0); + Assert.assertTrue(next.equals(next)); + Assert.assertFalse(next.equals(current)); + Assert.assertFalse(current.equals(next)); + + Assert.assertEquals(next.index(), current.index() + 1); + Assert.assertEquals(next.ploidy(),current.ploidy()); + + for (int maximumAlleleIndex = 0; maximumAlleleIndex <= MAXIMUM_ALLELE_INDEX; maximumAlleleIndex++) { + final int[] expected = new int[maximumAlleleIndex + 1]; + if (maximumAlleleIndex >= current.minimumAlleleIndex() + 1) expected[current.minimumAlleleIndex() + 1] = 1; + Assert.assertEquals(next.alleleCountsByIndex(maximumAlleleIndex),expected); + } + } + } + + private void testPloidyTwoOrMoreIncrease(final int ploidy) { + if (ploidy < 2) + throw new IllegalArgumentException(); + + GenotypeAlleleCounts next = GenotypeAlleleCounts.first(ploidy); + + while (!next.containsAllele(MAXIMUM_ALLELE_INDEX + 1)) { + final GenotypeAlleleCounts current = next.clone(); + next.increase(); + if (current.distinctAlleleCount() == 1) { + Assert.assertEquals(next.maximumAlleleIndex(),current.maximumAlleleIndex() + 1); + Assert.assertEquals(next.distinctAlleleCount(), 2 ); + Assert.assertEquals(next.minimumAlleleIndex(), 0 ); + } else { + Assert.assertEquals(next.maximumAlleleIndex(),current.maximumAlleleIndex()); + Assert.assertEquals(next.minimumAlleleIndex(),current.alleleCountAt(0) > 1 ? 0 + : current.alleleCountAt(0) == 1 ? current.minimumAlleleIndex() + 1 : current.minimumAlleleIndex()); + } + + // Checking on 0's new count and current.minAllele + 1 alleles. + Assert.assertEquals(next.alleleCountFor(0),current.alleleCountFor(current.minimumAlleleIndex()) - 1); + Assert.assertEquals(next.alleleCountFor(current.minimumAlleleIndex() + 1), + current.alleleCountFor(current.minimumAlleleIndex() + 1) + 1); + + // Checks current.minAllele count + Assert.assertEquals(next.alleleCountFor(current.minimumAlleleIndex()), + current.minimumAlleleIndex() == 0 ? current.alleleCountAt(0) - 1 : 0); + + int totalCountSum = 0; + final int[] expectedAlleleCountsByIndex = new int[Math.max(MAXIMUM_ALLELE_INDEX,next.maximumAlleleIndex()) + 1]; + for (int i = 0; i < next.distinctAlleleCount(); i++) { + final int count = next.alleleCountAt(i); + final int index = next.alleleIndexAt(i); + expectedAlleleCountsByIndex[index] = count; + // Check consistency of alleleCountAt(x) and alleleCountFor(alleleIndexAt(x)) + Assert.assertEquals(next.alleleCountFor(index),count); + totalCountSum += count; + // Check on counts of, in theory, unaffected allele counts. + if (index > current.minimumAlleleIndex() + 1) + Assert.assertEquals(next.alleleCountFor(index),current.alleleCountFor(index)); + } + Assert.assertTrue(Arrays.equals(next.alleleCountsByIndex(Math.max(MAXIMUM_ALLELE_INDEX,next.maximumAlleleIndex())),expectedAlleleCountsByIndex)); + Assert.assertEquals(totalCountSum,ploidy); + + Assert.assertTrue(next.compareTo(current) > 0); + Assert.assertTrue(current.compareTo(next) < 0); + Assert.assertTrue(next.compareTo(next) == 0); + Assert.assertTrue(next.equals(next)); + Assert.assertFalse(next.equals(current)); + Assert.assertFalse(current.equals(next)); + Assert.assertEquals(next.index(),current.index() + 1); + Assert.assertEquals(next.ploidy(),ploidy); + } + } + + private static final int MAXIMUM_ALLELE_INDEX = 10; + + private static final int[] PLOIDY = new int[] { 1, 2, 3, 7, 10}; + + @DataProvider(name="ploidyData") + public Object[][] ploidyData() { + final Object[][] result = new Object[PLOIDY.length][]; + for (int i = 0; i < PLOIDY.length; i++) + result[i] = new Object[] { PLOIDY[i ]}; + return result; + } +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java new file mode 100644 index 000000000..99f4c0422 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java @@ -0,0 +1,172 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; +import org.broadinstitute.gatk.utils.MathUtils; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.Arrays; + +/** + * Tests {@link GenotypeLikelihoodCalculators} and {@link GenotypeLikelihoodCalculator}. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class GenotypeLikelihoodCalculatorUnitTest { + + @Test(dataProvider = "ploidyAndMaximumAlleleData") + public void testPloidyAndMaximumAllele(final int ploidy, final int alleleCount) { + final GenotypeLikelihoodCalculator calculator = GenotypeLikelihoodCalculators.getInstance(ploidy, alleleCount); + Assert.assertNotNull(calculator); + Assert.assertEquals(calculator.ploidy(),ploidy); + Assert.assertEquals(calculator.alleleCount(), alleleCount); + Assert.assertEquals(calculator.genotypeCount(),calculateGenotypeCount(ploidy, alleleCount)," ploidy = " + ploidy + " alleleCount = " + alleleCount); + final int genotypeCount = calculator.genotypeCount(); + final int testGenotypeCount = Math.min(30000,genotypeCount); + for (int i = 0; i < testGenotypeCount; i++) { + final GenotypeAlleleCounts alleleCounts = calculator.genotypeAlleleCountsAt(i); + Assert.assertNotNull(alleleCounts); + if (i > 0) + Assert.assertTrue(calculator.genotypeAlleleCountsAt(i - 1).compareTo(alleleCounts) < 0); + final int[] alleleArray = new int[ploidy]; + int index = 0; + for (int j = 0; j < alleleCounts.distinctAlleleCount(); j++) + Arrays.fill(alleleArray, index, index += alleleCounts.alleleCountAt(j), alleleCounts.alleleIndexAt(j)); + final int[] alleleCountArray = new int[alleleCounts.distinctAlleleCount() << 1]; + alleleCounts.copyAlleleCounts(alleleCountArray,0); + Assert.assertEquals(index,ploidy); + Assert.assertEquals(calculator.allelesToIndex(alleleArray),i); + Assert.assertEquals(calculator.alleleCountsToIndex(alleleCountArray),i); + } + } + + @Test(dataProvider = "ploidyAndMaximumAlleleAndReadCountsData", dependsOnMethods = "testPloidyAndMaximumAllele") + public void testLikelihoodCalculation(final int ploidy, final int alleleCount, final int[] readCount) { + final ReadLikelihoods readLikelihoods = ReadLikelihoodsUnitTester.readLikelihoods(alleleCount,readCount); + final GenotypeLikelihoodCalculator calculator = GenotypeLikelihoodCalculators.getInstance(ploidy, alleleCount); + final int genotypeCount = calculator.genotypeCount(); + final int testGenotypeCount = Math.min(30000,genotypeCount); + final int sampleCount = readCount.length; + for (int s = 0; s < sampleCount ; s++) { + final ReadLikelihoods.Matrix sampleLikelihoods = readLikelihoods.sampleMatrix(s); + final GenotypeLikelihoods genotypeLikelihoods = calculator.genotypeLikelihoods(sampleLikelihoods); + final double[] genotypeLikelihoodsDoubles = genotypeLikelihoods.getAsVector(); + Assert.assertEquals(genotypeLikelihoodsDoubles.length,genotypeCount); + for (int i = 0; i < testGenotypeCount; i++) { + final GenotypeAlleleCounts genotypeAlleleCounts = calculator.genotypeAlleleCountsAt(i); + Assert.assertNotNull(genotypeLikelihoods); + final double[] readGenotypeLikelihoods = new double[sampleLikelihoods.readCount()]; + for (int r = 0; r < sampleLikelihoods.readCount(); r++) { + final double[] compoments = new double[genotypeAlleleCounts.distinctAlleleCount()]; + for (int ar = 0; ar < genotypeAlleleCounts.distinctAlleleCount(); ar++) { + final int a = genotypeAlleleCounts.alleleIndexAt(ar); + final int aCount = genotypeAlleleCounts.alleleCountAt(ar); + final double readLk = sampleLikelihoods.get(a, r); + compoments[ar] = readLk + Math.log10(aCount); + } + readGenotypeLikelihoods[r] = MathUtils.approximateLog10SumLog10(compoments) - Math.log10(ploidy); + } + final double genotypeLikelihood = MathUtils.sum(readGenotypeLikelihoods); + Assert.assertEquals(genotypeLikelihoodsDoubles[i], genotypeLikelihood, 0.0001); + } + } + + } + + + // Simple inefficient calculation of the genotype count given the ploidy. + private int calculateGenotypeCount(final int ploidy, final int alleleCount) { + if (ploidy == 0) + return 0; + else if (ploidy == 1) + return alleleCount; + else if (ploidy == 2) + return ((alleleCount) * (alleleCount + 1)) >> 1; + else if (alleleCount == 0) + return 0; + else { + return calculateGenotypeCount(ploidy - 1, alleleCount) + + calculateGenotypeCount(ploidy, alleleCount - 1); + } + } + + private static final int[] MAXIMUM_ALLELE = new int[] { 1, 2, 5, 6 }; + + private static final int[] PLOIDY = new int[] { 1, 2, 3, 20 }; + + private static final int[][] READ_COUNTS = new int[][] { + { 10 , 100, 50 }, + { 0, 100, 10, 1 , 50 }, + { 1, 2, 3, 4, 20 }, + { 10, 0 }, + }; + + @DataProvider(name="ploidyAndMaximumAlleleAndReadCountsData") + public Object[][] ploidyAndMaximumAlleleAndReadCountsData() { + final Object[][] result = new Object[PLOIDY.length * MAXIMUM_ALLELE.length * READ_COUNTS.length][]; + int index = 0; + for (final int i : PLOIDY) + for (final int j : MAXIMUM_ALLELE) + for (final int[] k : READ_COUNTS) + result[index++] = new Object[] { i, j, k }; + return result; + } + + @DataProvider(name="ploidyAndMaximumAlleleData") + public Object[][] ploidyAndMaximumAlleleData() { + final Object[][] result = new Object[PLOIDY.length * MAXIMUM_ALLELE.length][]; + int index = 0; + for (final int i : PLOIDY) + for (final int j : MAXIMUM_ALLELE) + result[index++] = new Object[] { i, j }; + return result; + } +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java new file mode 100644 index 000000000..59e14e14c --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java @@ -0,0 +1,103 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.List; + +/** + * Test {@link org.broadinstitute.gatk.genotyping.InfiniteRandomMatingPopulationModel} + */ +public class GenotypingDataUnitTest { + + @Test(dataProvider="ploidyAndMaximumAlleleAndReadCountsData") + public void testInstantiation(final int[] ploidies, final int[] readCounts) { + final ReadLikelihoods likelihoods = ReadLikelihoodsUnitTester.readLikelihoods(2,readCounts); + final SampleList sampleList = likelihoods; + final PloidyModel ploidyModel = new HeterogeneousPloidyModel(sampleList,ploidies); + final GenotypingData data = new GenotypingData<>(ploidyModel,likelihoods); + Assert.assertTrue(AlleleListUtils.equals(data,likelihoods)); + Assert.assertTrue(SampleListUtils.equals(data,likelihoods)); + Assert.assertEquals(data.readLikelihoods(),likelihoods); + Assert.assertEquals(data.ploidyModel(),ploidyModel); + } + + private static final int[][] PLOIDIES = new int[][]{ + {1, 1, 1, 1}, + {1, 2, 3, 4}, + {2, 2, 2, 2}, + {2, 1, 2, 1}, + {1}, + {2}, + {}, + }; + + + private static final int[][] READ_COUNTS = new int[][] { + { 10 , 100, 50, 20 }, + { 0, 100, 10, 1 }, + { 1, 2, 3, 4 }, + { 10, 20, 50, 40 }, + { 10 }, + { 20 }, + { } + }; + + @DataProvider(name="ploidyAndMaximumAlleleAndReadCountsData") + public Object[][] ploidyAndMaximumAlleleAndReadCountsData() { + final List result = new ArrayList<>(PLOIDIES.length * 2); + for (int i = 0; i < PLOIDIES.length; i++) + result.add(new Object[] {PLOIDIES[i], READ_COUNTS[i]}); + return result.toArray(new Object[0][]); + } + +} \ No newline at end of file diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java new file mode 100644 index 000000000..865668093 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java @@ -0,0 +1,119 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + + +/** + * General heterogeneous ploidy model. + * + *

+ * Currenly only avaialable for testing but will be promoted at some point and have its own unit test. + *

+ */ +public class HeterogeneousPloidyModel implements PloidyModel { + + private final SampleList sampleList; + + private final int[] ploidies; + + private final int ploidySum; + + private final boolean isHomogeneous; + + public HeterogeneousPloidyModel(final SampleList sampleList, final int[] ploidies) { + if (sampleList == null) + throw new IllegalArgumentException("the sample list cannot be null"); + if (ploidies == null) + throw new IllegalArgumentException("the ploidies cannot be null"); + if (sampleList.sampleCount() != ploidies.length) + throw new IllegalArgumentException("sample-list and ploidy array length must match"); + + this.ploidies = ploidies.clone(); + + int ploidySum = 0; + for (int i = 0; i < ploidies.length; i++) { + final int p = this.ploidies[i]; + if (p < 0) + throw new IllegalArgumentException("no ploidy can be less than 0"); + ploidySum += p; + } + this.ploidySum = ploidySum; + isHomogeneous = ploidies.length == 0 || ploidies.length * this.ploidies[0] == ploidySum; + this.sampleList = sampleList; + } + + @Override + public int samplePloidy(final int sampleIndex) { + if (sampleIndex < 0 || sampleIndex > ploidies.length) + throw new IllegalArgumentException("invalid sample index: " + sampleIndex); + return ploidies[sampleIndex]; + } + + @Override + public boolean isHomogeneous() { + return isHomogeneous; + } + + @Override + public int totalPloidy() { + return ploidySum; + } + + @Override + public int sampleCount() { + return ploidies.length; + } + + @Override + public int sampleIndex(final String sample) { + return sampleList.sampleIndex(sample); + } + + @Override + public String sampleAt(int sampleIndex) { + return sampleList.sampleAt(sampleIndex); + } +} \ No newline at end of file diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java new file mode 100644 index 000000000..030ebf21b --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java @@ -0,0 +1,92 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.List; + +/** + * Tests {@link HomogeneousPloidyModel} + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class HomogeneousPloidyModelUnitTest { + private static final int[] PLOIDY = new int[] { 1, 2, 3, 7, 10}; + + private static final int[] SAMPLE_COUNT = new int[] { 0, 1, 3, 4, 5, 6, 10, 101}; + + + @Test(dataProvider = "ploidyAndSampleListData") + public void testPloidyAndSampleList(final int ploidy, final int sampleCount) { + final List sampleNames = new ArrayList<>(sampleCount); + for (int i = 0; i < sampleCount; i++) + sampleNames.add("SAMPLE_" + i); + final IndexedSampleList sampleList = new IndexedSampleList(sampleNames); + + final HomogeneousPloidyModel ploidyModel = new HomogeneousPloidyModel(sampleList,ploidy); + Assert.assertTrue(ploidyModel.isHomogeneous()); + Assert.assertEquals(ploidyModel.totalPloidy(),sampleCount * ploidy); + + for (int i = 0; i < sampleCount; i++) + Assert.assertEquals(ploidyModel.samplePloidy(i),ploidy); + + SampleListUnitTester.assertSampleList(ploidyModel,sampleNames); + } + + @DataProvider(name="ploidyAndSampleListData") + public Object[][] ploidyAndSampleListData() { + final Object[][] result = new Object[PLOIDY.length * SAMPLE_COUNT.length][]; + int index = 0; + for (int i = 0; i < PLOIDY.length; i++) + for (int j = 0; j < SAMPLE_COUNT.length; j++ ) + result[index++] = new Object[] { PLOIDY[i], SAMPLE_COUNT[j]}; + return result; + } +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java new file mode 100644 index 000000000..61bd9f8a7 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java @@ -0,0 +1,102 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + + +import htsjdk.variant.variantcontext.Allele; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +import static org.broadinstitute.gatk.genotyping.AlleleListUnitTester.assertAlleleList; + +/** + * Tests {@link org.broadinstitute.gatk.genotyping.IndexedSampleList}. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IndexedAlleleListUnitTest { + + @Test + public void testEmptyConstructor() { + final IndexedAlleleList subject = new IndexedAlleleList<>(); + assertAlleleList(subject, Collections.EMPTY_LIST); + } + + @Test(dataProvider= "alleleCountMaxAlleleLengthData") + public void testArrayConstructor(final int alleleCount, final int maxAlleleLength) { + final Allele[] alleles = AlleleListUnitTester.generateRandomAlleles(alleleCount, maxAlleleLength); + + final LinkedHashSet nonRepeatedAlleles = new LinkedHashSet<>(Arrays.asList(alleles)); + final IndexedAlleleList subject = new IndexedAlleleList<>(alleles); + assertAlleleList(subject, Arrays.asList(nonRepeatedAlleles.toArray(new Allele[nonRepeatedAlleles.size()]))); + } + + @Test(dataProvider= "alleleCountMaxAlleleLengthData") + public void testCollectionConstructor(final int alleleCount, final int maxAlleleLength) { + final Allele[] alleles = AlleleListUnitTester.generateRandomAlleles(alleleCount, maxAlleleLength); + + final List alleleList = Arrays.asList(alleles); + final LinkedHashSet nonRepeatedAlleles = new LinkedHashSet<>(Arrays.asList(alleles)); + final IndexedAlleleList subject = new IndexedAlleleList<>(alleleList); + assertAlleleList(subject, Arrays.asList(nonRepeatedAlleles.toArray(new Allele[nonRepeatedAlleles.size()]))); + } + + private static final int[] SAMPLE_COUNT = { 0, 1, 5, 10, 20}; + + private static final int[] MAX_ALLELE_LENGTH = { 1, 2, 3, 10 }; + + @DataProvider(name="alleleCountMaxAlleleLengthData") + public Object[][] alleleCountMaxAlleleLengthData() { + final Object[][] result = new Object[SAMPLE_COUNT.length * MAX_ALLELE_LENGTH.length][]; + int nextIndex = 0; + for (int i = 0; i < SAMPLE_COUNT.length; i++) + for (int j = 0; j < MAX_ALLELE_LENGTH.length; j++) + result[nextIndex++] = new Object[] { SAMPLE_COUNT[i], MAX_ALLELE_LENGTH[j]}; + return result; + } +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java new file mode 100644 index 000000000..138ec0e31 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java @@ -0,0 +1,133 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + + +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +import static org.broadinstitute.gatk.genotyping.SampleListUnitTester.assertSampleList; + +/** + * Tests {@link IndexedSampleList}. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IndexedSampleListUnitTest { + + @Test + public void testEmptyConstructor() { + final IndexedSampleList subject = new IndexedSampleList(); + assertSampleList(subject, Collections.EMPTY_LIST); + } + + @Test(dataProvider="sampleCountMaxSampleIndexData") + public void testArrayConstructor(final int sampleCount, final int maxSampleIndex) { + final String[] sampleNames = generateSampleNames(sampleCount,maxSampleIndex); + + final LinkedHashSet nonRepeatedNames = new LinkedHashSet<>(Arrays.asList(sampleNames)); + final IndexedSampleList subject = new IndexedSampleList(sampleNames); + assertSampleList(subject, Arrays.asList(nonRepeatedNames.toArray(new String[nonRepeatedNames.size()]))); + } + + @Test(dataProvider="sampleCountMaxSampleIndexData") + public void testCollectionConstructor(final int sampleCount, final int maxSampleIndex) { + final String[] sampleNames = generateSampleNames(sampleCount,maxSampleIndex); + + final List sampleNameList = Arrays.asList(sampleNames); + final LinkedHashSet nonRepeatedNames = new LinkedHashSet<>(Arrays.asList(sampleNames)); + final IndexedSampleList subject = new IndexedSampleList(sampleNameList); + assertSampleList(subject, Arrays.asList(nonRepeatedNames.toArray(new String[nonRepeatedNames.size()]))); + } + + /** + * Generate testing sample names. + * + *

+ * Basically all have a common prefix "SAMPLE_" followed by a numeric index. + *

+ * + *

+ * With {@code maxSampleIndex} you can force to have some repeated sample names; + * (if {@code sampleCount < maxSampleIndex}. + *

+ * + * @param sampleCount number of sample names to generate. + * @param maxSampleIndex the maximum sample numeric index. + * + * @throws RuntimeException if {@code sampleCount} or {@code maxSampleIndex} are negative. + * @return never {@code null}. + */ + private String[] generateSampleNames(final int sampleCount, final int maxSampleIndex) { + final String[] result = new String[sampleCount]; + for (int i = 0; i < sampleCount; i++) + result[i] = "SAMPLE_" + rnd.nextInt(maxSampleIndex + 1); + return result; + } + + private static final int[] SAMPLE_COUNT = { 0, 1, 5, 10, 20}; + + private static final int[] MAX_SAMPLE_INDEX = { 0, 1, 4, 9, 10000}; + + private static final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + + @DataProvider(name="sampleCountMaxSampleIndexData") + public Object[][] sampleCountMaxSampleIndexData() { + final Object[][] result = new Object[SAMPLE_COUNT.length * MAX_SAMPLE_INDEX.length][]; + int nextIndex = 0; + for (int i = 0; i < SAMPLE_COUNT.length; i++) + for (int j = 0; j < MAX_SAMPLE_INDEX.length; j++) + result[nextIndex++] = new Object[] { SAMPLE_COUNT[i], MAX_SAMPLE_INDEX[j]}; + return result; + } + + + +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java new file mode 100644 index 000000000..af4b37b18 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java @@ -0,0 +1,145 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import htsjdk.variant.variantcontext.GenotypeLikelihoods; +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.List; +import java.util.Random; + +/** + * Test {@link InfiniteRandomMatingPopulationModel} + */ +public class InfiniteRandomMatingPopulationModelUnitTest { + + @Test(dataProvider="ploidyAndMaximumAlleleAndReadCountsData") + public void testCalculateLikelihoods(final int[] ploidies, final int alleleCount, final int discardAlleleCount, final int[] readCounts) { + final ReadLikelihoods likelihoods = ReadLikelihoodsUnitTester.readLikelihoods(alleleCount,readCounts); + final AlleleList genotypingAlleleList = discardAlleleCount == 0 ? likelihoods : discardAllelesAtRandom(likelihoods,discardAlleleCount); + final SampleList sampleList = SampleListUnitTester.sampleList(ploidies.length); + final PloidyModel ploidyModel = new HeterogeneousPloidyModel(sampleList,ploidies); + final GenotypingData data = new GenotypingData<>(ploidyModel,likelihoods); + final InfiniteRandomMatingPopulationModel model = new InfiniteRandomMatingPopulationModel(); + final GenotypingLikelihoods gLikelihoods = model.calculateLikelihoods(genotypingAlleleList,data); + Assert.assertNotNull(gLikelihoods); + AlleleListUnitTester.assertAlleleList(gLikelihoods, AlleleListUtils.asList(genotypingAlleleList)); + SampleListUnitTester.assertSampleList(gLikelihoods,SampleListUtils.asList(sampleList)); + final int sampleCount = gLikelihoods.sampleCount(); + for (int i = 0; i < sampleCount; i++) { + final GenotypeLikelihoods sampleLikelihoods = gLikelihoods.sampleLikelihoods(i); + Assert.assertNotNull(sampleLikelihoods); + final double[] values = sampleLikelihoods.getAsVector(); + Assert.assertNotNull(values); + Assert.assertEquals(values.length, GenotypeLikelihoodCalculators.getInstance(ploidies[i], genotypingAlleleList.alleleCount()).genotypeCount()); + for (int j = 0; j < values.length; j++) + Assert.assertTrue(values[j] <= 0); + } + } + + private AlleleList discardAllelesAtRandom(final AlleleList likelihoods, final int discardAlleleCount) { + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + final ArrayList subset = new ArrayList<>(AlleleListUtils.asList(likelihoods)); + for (int i = 0; i < discardAlleleCount; i++) { + subset.remove(rnd.nextInt(subset.size())); + } + return new IndexedAlleleList<>(subset); + } + + /** + * Each entry contains to value, where the first is the total number of alleles and the second + * The number to discard some arbitrary number of alleles for genotyping for the {@link #testCalculateLikelihoods}. + */ + private static final int[][] ALLELE_COUNTS = new int[][] { + {1, 0}, + {2, 1}, + {5, 2}, + {10, 4}, + {1, 0}, + {2, 1}, + {10, 7} + }; + + private static final int[][] PLOIDIES = new int[][]{ + {1, 1, 1, 1}, + {1, 2, 3, 4}, + {2, 2, 2, 2}, + {2, 1, 2, 1}, + {1}, + {2}, + {}, + }; + + + private static final int[][] READ_COUNTS = new int[][] { + { 10 , 100, 50, 20 }, + { 0, 100, 10, 1 }, + { 1, 2, 3, 4 }, + { 10, 20, 50, 40 }, + { 10 }, + { 20 }, + { } + }; + + @DataProvider(name="ploidyAndMaximumAlleleAndReadCountsData") + public Object[][] ploidyAndMaximumAlleleAndReadCountsData() { + final List result = new ArrayList<>(PLOIDIES.length * 2); + for (int i = 0; i < PLOIDIES.length; i++) { + result.add(new Object[] {PLOIDIES[i], ALLELE_COUNTS[i][0], 0, READ_COUNTS[i]}); + final int discardAlleleCount = ALLELE_COUNTS[i][1]; + if (discardAlleleCount == 0) continue; + result.add(new Object[] { PLOIDIES[i], ALLELE_COUNTS[i][0], ALLELE_COUNTS[i][1], READ_COUNTS[i]}); + } + return result.toArray(new Object[0][]); + } + +} \ No newline at end of file diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java new file mode 100644 index 000000000..08bfd9f60 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java @@ -0,0 +1,124 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + + +import htsjdk.samtools.SAMFileHeader; +import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; +import org.broadinstitute.gatk.utils.sam.ArtificialSAMUtils; +import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; + +import java.util.ArrayList; +import java.util.HashMap; +import java.util.List; +import java.util.Map; + +/** + * Constains utilities for tests that need to create read-likelihoods. + */ +public class ReadLikelihoodsUnitTester { + + + static ReadLikelihoods readLikelihoods(final int alleleCount, final int[] readCount) { + final int sampleCount = readCount.length; + final AlleleList alleleList = AlleleListUnitTester.alleleList(alleleCount,100,true); + final SampleList sampleList = SampleListUnitTester.sampleList(sampleCount); + final Map> sampleToReads = new HashMap<>(sampleCount); + for (int i = 0; i < sampleCount; i++) { + sampleToReads.put(sampleList.sampleAt(i),readList(i,readCount[i])); + } + final ReadLikelihoods likelihoods = new ReadLikelihoods<>(sampleList,alleleList, sampleToReads); + for (int s = 0; s < sampleCount; s++) { + final ReadLikelihoods.Matrix sampleLikelihoods = likelihoods.sampleMatrix(s); + for (int a = 0; a < alleleCount; a++) + for (int r = 0; r < readCount[s]; r++) + sampleLikelihoods.set(a, r, testLikelihood(s, a, r)); + } + return likelihoods; + } + + /** + * produces a test likelihood depending on the sample, read and allele index. + */ + private static double testLikelihood(final int sampleIndex, final int alleleIndex, final int readIndex) { + return - Math.abs(3 * (sampleIndex + 1) + 7 * (alleleIndex + 1) + 11 * (readIndex + 1)); + } + + + private static SAMFileHeader SAM_HEADER = ArtificialSAMUtils.createArtificialSamHeader(10, 0, 1000); + + + static List readList(final int sampleIndex, final int readCount) { + final List reads = new ArrayList<>(readCount); + int readIndex = 0; + for (int j = 0; j < readCount; j++) + reads.add(ArtificialSAMUtils.createArtificialRead(SAM_HEADER, "READ_" + sampleIndex + "_" + (readIndex++), 1, 1, 100)); + return reads; + } + + + /** + * Creates a sampleToReads map given the sample list and the required read counts. + * @param sampleList the target sample-list. + * @param readCounts the target read-counts. + * @return never {@code null}. + */ + public static Map> sampleToReads(final SampleList sampleList, final int[] readCounts) { + final Map> result = new HashMap<>(sampleList.sampleCount()); + int readIndex = 0; + for (int i = 0; i < sampleList.sampleCount(); i++) { + final int readCount = readCounts[i]; + final String sample = sampleList.sampleAt(i); + final List records = new ArrayList<>(readCount); + for (int j = 0; j < readCount; j++) + records.add(ArtificialSAMUtils.createArtificialRead(SAM_HEADER,"READ_" + (readIndex++),1,1,100)); + result.put(sample,records); + } + return result; + } + +} \ No newline at end of file diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java new file mode 100644 index 000000000..9bca352d2 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java @@ -0,0 +1,120 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import org.testng.Assert; + +import java.util.*; + +/** + * Helper class for those unit-test classes that test on implementations of SampleList. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class SampleListUnitTester { + + /** + * Test that the contents of a sample-list are the ones expected. + * + *

+ * This method perform various consistency check involving all the {@link SampleList} interface methods. + * Therefore calling this method is equivalent to a thorough check of the {@link SampleList} aspect of + * the {@code actual} argument. + *

+ * + * @param actual the sample-list to assess. + * @param expected the expected sample-list. + * + * @throws IllegalArgumentException if {@code expected} is {@code null} or contains + * {@code null}s which is an indication of an bug in the testing code. + * + * @throws java.lang.RuntimeException if there is some testing assertion exception which + * is an indication of an actual bug the code that is been tested. + */ + public static void assertSampleList(final SampleList actual, final List expected) { + if (expected == null) + throw new IllegalArgumentException("the expected list cannot be null"); + final Set expectedNames = new HashSet<>(expected.size()); + Assert.assertNotNull(actual); + Assert.assertEquals(actual.sampleCount(),expected.size()); + for (int i = 0; i < expected.size(); i++) { + final String expectedSample = expected.get(i); + if (expectedSample == null) + throw new IllegalArgumentException("the expected sample cannot be null"); + if (expectedSample.equals(NEVER_USE_SAMPLE_NAME)) + throw new IllegalArgumentException("you cannot use the forbidden sample name"); + if (expectedNames.contains(expected.get(i))) + throw new IllegalArgumentException("repeated names in the expected list, this is a test bug"); + final String actualSample = actual.sampleAt(i); + Assert.assertNotNull(actualSample,"sample name cannot be null"); + Assert.assertFalse(expectedNames.contains(actualSample),"repeated sample name: " + actualSample); + Assert.assertEquals(actualSample,expectedSample,"wrong sample name order; index = " + i); + Assert.assertEquals(actual.sampleIndex(actualSample),i,"sample index mismatch"); + expectedNames.add(actualSample); + } + + Assert.assertEquals(actual.sampleIndex(NEVER_USE_SAMPLE_NAME),-1); + } + + /** + * Creates a sample list for testing given the number of samples in it. + * @param sampleCount the required sample count. + * @return never {@code null}. + */ + static SampleList sampleList(final int sampleCount) { + if (sampleCount < 0) + throw new IllegalArgumentException("the number of sample cannot be negative"); + final List result = new ArrayList<>(sampleCount); + for (int i =0; i < sampleCount; i++) + result.add("SAMPLE_" + i); + return new IndexedSampleList(result); + } + + /** + * Save to assume that this sample name will never be used. + */ + private static final String NEVER_USE_SAMPLE_NAME = "WHY_WOULD_YOU_CALL_A_SAMPLE_LIKE_THIS? ArE yOu Crazzzzy? " + new Date().toString(); +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java new file mode 100644 index 000000000..71da45838 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java @@ -0,0 +1,126 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.genotyping; + +import htsjdk.variant.variantcontext.Allele; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Arrays; +import java.util.List; + +/** + * Test {@link AlleleListUtils}. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class SampleListUtilsUnitTest { + + @Test(dataProvider = "singleSampleListData") + public void testAsList(final List samples) { + final SampleList sampleList = new IndexedSampleList(samples); + final List asList = SampleListUtils.asList(sampleList); + Assert.assertEquals(samples, asList); + } + + @Test(dataProvider = "twoSampleListData", dependsOnMethods={"testAsList"}) + public void testEquals(final List sample2, final List samples2) { + final SampleList sampleList1 = new IndexedSampleList(sample2); + final SampleList sampleList2 = new IndexedSampleList(samples2); + Assert.assertTrue(SampleListUtils.equals(sampleList1, sampleList1)); + Assert.assertTrue(SampleListUtils.equals(sampleList2,sampleList2)); + Assert.assertEquals(SampleListUtils.equals(sampleList1, sampleList2), + Arrays.equals(SampleListUtils.asList(sampleList1).toArray(new String[sampleList1.sampleCount()]), + SampleListUtils.asList(sampleList2).toArray(new String[sampleList2.sampleCount()])) + ); + Assert.assertEquals(SampleListUtils.equals(sampleList1,sampleList2), + SampleListUtils.equals(sampleList2,sampleList1)); + } + + private List[] sampleLists; + + @BeforeClass + public void setUp() { + sampleLists = new List[SAMPLE_COUNT.length]; + int nextIndex = 0; + for (int i = 0; i < SAMPLE_COUNT.length; i++) { + final List sampleList = new ArrayList<>(SAMPLE_COUNT[i]); + sampleList.add("SAMPLE_" + i); + sampleLists[nextIndex++] = sampleList; + } + } + + private static final int[] SAMPLE_COUNT = { 0, 1, 5, 10, 20}; + + + @DataProvider(name="singleSampleListData") + public Object[][] singleSampleListData() { + final Object[][] result = new Object[sampleLists.length][]; + for (int i = 0; i < sampleLists.length; i++) + result[i] = new Object[] { sampleLists[i]}; + return result; + } + + @DataProvider(name="twoSampleListData") + public Object[][] twoAlleleListData() { + final Object[][] result = new Object[sampleLists.length * sampleLists.length][]; + int index = 0; + for (int i = 0; i < sampleLists.length; i++) + for (int j = 0; j < sampleLists.length; j++) + result[index++] = new Object[] { sampleLists[i], sampleLists[j]}; + return result; + } + + + + + + + +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java index 51f1e04a2..335c355d2 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java @@ -80,7 +80,7 @@ public class UnifiedGenotyperEngineUnitTest extends BaseTest { final UnifiedArgumentCollection args = new UnifiedArgumentCollection(); final SampleList fakeSamples = SampleListUtils.singletonList("fake"); - ugEngine = new UnifiedGenotypingEngine(engine, args,fakeSamples); + ugEngine = new UnifiedGenotypingEngine(args,fakeSamples,engine.getGenomeLocParser(),engine.getArguments().BAQMode); } private UnifiedGenotypingEngine getEngine() { @@ -89,7 +89,7 @@ public class UnifiedGenotyperEngineUnitTest extends BaseTest { @DataProvider(name = "ReferenceQualityCalculation") public Object[][] makeReferenceQualityCalculation() { - List tests = new ArrayList(); + final List tests = new ArrayList<>(); // this functionality can be adapted to provide input data for whatever you might want in your data final double p = Math.log10(0.5); @@ -116,7 +116,7 @@ public class UnifiedGenotyperEngineUnitTest extends BaseTest { for ( Integer numAltAlleles = 0; numAltAlleles < 100; numAltAlleles++ ) { - Set alleles = new HashSet(); + final Set alleles = new HashSet<>(); alleles.add(Allele.create("A", true)); // ref allele for (int len = 1; len <=numAltAlleles; len++) { diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java index 7ac0c86df..0437eb375 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite1IntegrationTest.java @@ -69,12 +69,12 @@ public class UnifiedGenotyperGeneralPloidySuite1IntegrationTest extends WalkerTe @Test(enabled = true) public void testBOTH_GGA_Pools() { - executor.PC_LSV_Test(String.format(" -maxAltAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s", LSV_ALLELES), "LSV_BOTH_GGA", "BOTH", "05b8af0db7b009721df209eea96bdf1a"); + executor.PC_LSV_Test(String.format(" -maxAltAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s", LSV_ALLELES), "LSV_BOTH_GGA", "BOTH", "4b646b6fc9c5c2ef88433a5b350310fe"); } @Test(enabled = true) public void testINDEL_GGA_Pools() { - executor.PC_LSV_Test(String.format(" -maxAltAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s", LSV_ALLELES), "LSV_INDEL_GGA", "INDEL", "1ac510860b295d66e1da7b27ba7cafb8"); + executor.PC_LSV_Test(String.format(" -maxAltAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s", LSV_ALLELES), "LSV_INDEL_GGA", "INDEL", "171355e4d0648fdd50d7d56de950d338"); } @Test(enabled = true) diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java index 6d95098fe..bd1daa714 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperGeneralPloidySuite2IntegrationTest.java @@ -68,6 +68,6 @@ public class UnifiedGenotyperGeneralPloidySuite2IntegrationTest extends WalkerTe @Test(enabled = true) public void testMT_SNP_GGA_sp10() { - executor.PC_MT_Test(CEUTRIO_BAM, String.format(" -maxAltAlleles 1 -ploidy 20 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",NA12891_CALLS), "MT_SNP_GGA_sp10", "654059dda19cb2cf546097e44753ea14"); + executor.PC_MT_Test(CEUTRIO_BAM, String.format(" -maxAltAlleles 1 -ploidy 20 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",NA12891_CALLS), "MT_SNP_GGA_sp10", "0f6fdf60d7f93b2db8c8cb92c1fd3e00"); } } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGVCFIntegrationTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGVCFIntegrationTest.java index 14924bdc3..b0c157d82 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGVCFIntegrationTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGVCFIntegrationTest.java @@ -47,18 +47,36 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import org.broadinstitute.gatk.engine.walkers.WalkerTest; -import org.broadinstitute.gatk.utils.collections.Pair; import org.broadinstitute.gatk.utils.exceptions.UserException; import org.broadinstitute.gatk.utils.variant.GATKVCFIndexType; import org.testng.annotations.DataProvider; import org.testng.annotations.Test; -import java.io.File; import java.util.ArrayList; import java.util.Arrays; import java.util.List; public class HaplotypeCallerGVCFIntegrationTest extends WalkerTest { + + @DataProvider(name = "MyDataProviderHaploid") + public Object[][] makeMyDataProviderHaploid() { + List tests = new ArrayList<>(); + + final String PCRFreeIntervals = "-L 20:10,000,000-10,010,000"; + final String WExIntervals = "-L 20:10,000,000-10,100,000 -isr INTERSECTION -L " + hg19Chr20Intervals; + + // this functionality can be adapted to provide input data for whatever you might want in your data + tests.add(new Object[]{NA12878_PCRFREE, ReferenceConfidenceMode.NONE, PCRFreeIntervals, "5cc1858896aca6683282f53054bb7a61"}); + tests.add(new Object[]{NA12878_PCRFREE, ReferenceConfidenceMode.BP_RESOLUTION, PCRFreeIntervals, "010a747f5c41ddb7889168e499eb40bb"}); + tests.add(new Object[]{NA12878_PCRFREE, ReferenceConfidenceMode.GVCF, PCRFreeIntervals, "d7dbc1c8e11a277e9db857eb766fd2c6"}); + tests.add(new Object[]{NA12878_WEx, ReferenceConfidenceMode.NONE, WExIntervals, "799752d88c4e15e19a953add764d2239"}); + tests.add(new Object[]{NA12878_WEx, ReferenceConfidenceMode.BP_RESOLUTION, WExIntervals, "fa057b35d6fe9588c2653b6560d6e3c2"}); + tests.add(new Object[]{NA12878_WEx, ReferenceConfidenceMode.GVCF, WExIntervals, "d10e8907594414890cbf80d282426812"}); + + return tests.toArray(new Object[][]{}); + } + + @DataProvider(name = "MyDataProvider") public Object[][] makeMyDataProvider() { List tests = new ArrayList<>(); @@ -77,6 +95,24 @@ public class HaplotypeCallerGVCFIntegrationTest extends WalkerTest { return tests.toArray(new Object[][]{}); } + @DataProvider(name = "MyDataProviderTetraploid") + public Object[][] makeMyDataProviderTetraploid() { + List tests = new ArrayList<>(); + + final String PCRFreeIntervals = "-L 20:10,000,000-10,010,000"; + final String WExIntervals = "-L 20:10,000,000-10,100,000 -isr INTERSECTION -L " + hg19Chr20Intervals; + + // this functionality can be adapted to provide input data for whatever you might want in your data + tests.add(new Object[]{NA12878_PCRFREE, ReferenceConfidenceMode.NONE, PCRFreeIntervals, "6e157b6fdf4071fcb7da74f40146a611"}); + tests.add(new Object[]{NA12878_PCRFREE, ReferenceConfidenceMode.BP_RESOLUTION, PCRFreeIntervals, "354b84dbfaf55947aea40865e74ce66b"}); + tests.add(new Object[]{NA12878_PCRFREE, ReferenceConfidenceMode.GVCF, PCRFreeIntervals, "fc4b7e6528747cb20e0c92699a0787cb"}); + tests.add(new Object[]{NA12878_WEx, ReferenceConfidenceMode.NONE, WExIntervals, "6e0f5d82b77ea79a639d43b2db70e751"}); + tests.add(new Object[]{NA12878_WEx, ReferenceConfidenceMode.BP_RESOLUTION, WExIntervals, "a3daf472f7ab16667e5f6dab1af392ff"}); + tests.add(new Object[]{NA12878_WEx, ReferenceConfidenceMode.GVCF, WExIntervals, "af9230fa56752b732572ce956101a2be"}); + + return tests.toArray(new Object[][]{}); + } + /** * Example testng test using MyDataProvider */ @@ -86,7 +122,31 @@ public class HaplotypeCallerGVCFIntegrationTest extends WalkerTest { b37KGReference, bam, intervals, mode, HaplotypeCaller.OPTIMAL_GVCF_INDEX_TYPE, HaplotypeCaller.OPTIMAL_GVCF_INDEX_PARAMETER); final String name = "testHCWithGVCF bam=" + bam + " intervals= " + intervals + " gvcf= " + mode; final WalkerTestSpec spec = new WalkerTestSpec(commandLine + " -o %s", Arrays.asList(md5)); - final Pair,List> executionOutput = executeTest(name, spec); + executeTest(name, spec); + } + + /** + * Example testng test using MyDataProvider + */ + @Test(dataProvider = "MyDataProviderHaploid", enabled=false) + public void testHCWithGVCFHaploid(final String bam, final ReferenceConfidenceMode mode, final String intervals, final String md5) { + final String commandLine = String.format("-T HaplotypeCaller -ploidy 1 --disableDithering --pcr_indel_model NONE -R %s -I %s %s -ERC %s --no_cmdline_in_header -variant_index_type %s -variant_index_parameter %d", + b37KGReference, bam, intervals, mode, HaplotypeCaller.OPTIMAL_GVCF_INDEX_TYPE, HaplotypeCaller.OPTIMAL_GVCF_INDEX_PARAMETER); + final String name = "testHCWithGVCFHaploid bam=" + bam + " intervals= " + intervals + " gvcf= " + mode; + final WalkerTestSpec spec = new WalkerTestSpec(commandLine + " -o %s", Arrays.asList(md5)); + executeTest(name, spec); + } + + /** + * Example testng test using MyDataProvider + */ + @Test(dataProvider = "MyDataProviderTetraploid", enabled=false) + public void testHCWithGVCFTetraploid(final String bam, final ReferenceConfidenceMode mode, final String intervals, final String md5) { + final String commandLine = String.format("-T HaplotypeCaller -ploidy 4 --disableDithering --pcr_indel_model NONE -R %s -I %s %s -ERC %s --no_cmdline_in_header -variant_index_type %s -variant_index_parameter %d", + b37KGReference, bam, intervals, mode, HaplotypeCaller.OPTIMAL_GVCF_INDEX_TYPE, HaplotypeCaller.OPTIMAL_GVCF_INDEX_PARAMETER); + final String name = "testHCWithGVCFTetraploid bam=" + bam + " intervals= " + intervals + " gvcf= " + mode; + final WalkerTestSpec spec = new WalkerTestSpec(commandLine + " -o %s", Arrays.asList(md5)); + executeTest(name, spec); } @Test @@ -144,6 +204,11 @@ public class HaplotypeCallerGVCFIntegrationTest extends WalkerTest { private static final String NOCALL_GVCF_BUGFIX_INTERVALS = privateTestDir + "gvcf_nocall_bug.interval_list"; private static final String NOCALL_GVCF_BUGFIX_BAM = privateTestDir + "gvcf_nocall_bug.bam"; + private static final String GENERAL_PLOIDY_BUGFIX1_BAM = privateTestDir + "general-ploidy-arrayindex-bug-1.bam"; + private static final String GENERAL_PLOIDY_BUGFIX1_INTERVALS = privateTestDir + "general-ploidy-arrayindex-bug-1.intervals"; + private static final String GENERAL_PLOIDY_BUGFIX2_BAM = privateTestDir + "general-ploidy-arrayindex-bug-2.bam"; + private static final String GENERAL_PLOIDY_BUGFIX2_INTERVALS = privateTestDir + "general-ploidy-arrayindex-bug-2.intervals"; + @Test public void testNoCallGVCFMissingPLsBugFix() { @@ -153,4 +218,23 @@ public class HaplotypeCallerGVCFIntegrationTest extends WalkerTest { spec.disableShadowBCF(); executeTest("testNoCallGVCFMissingPLsBugFix", spec); } + + @Test(enabled=false) + public void testGeneralPloidyArrayIndexBug1Fix() { + final String commandLine = String.format("-T HaplotypeCaller --pcr_indel_model NONE -R %s -I %s -L %s -ERC GVCF --no_cmdline_in_header -variant_index_type %s -variant_index_parameter %d -ploidy 1 -maxAltAlleles 2 -isr INTERSECTION -L 1:23696115-23696189", + b37KGReference, GENERAL_PLOIDY_BUGFIX1_BAM, GENERAL_PLOIDY_BUGFIX1_INTERVALS, HaplotypeCaller.OPTIMAL_GVCF_INDEX_TYPE, HaplotypeCaller.OPTIMAL_GVCF_INDEX_PARAMETER); + final WalkerTestSpec spec = new WalkerTestSpec(commandLine + " -o %s", Arrays.asList("7c263d77bf831551366c6e36233b46ce")); + spec.disableShadowBCF(); + executeTest(" testGeneralPloidyArrayIndexBug1Fix", spec); + } + + @Test(enabled=false) + public void testGeneralPloidyArrayIndexBug2Fix() { + final String commandLine = String.format("-T HaplotypeCaller --pcr_indel_model NONE -R %s -I %s -L %s -ERC GVCF --no_cmdline_in_header -variant_index_type %s -variant_index_parameter %d -ploidy 2 -maxAltAlleles 2 -A DepthPerSampleHC -A StrandBiasBySample -L 1:38052860-38052937", + b37KGReference, GENERAL_PLOIDY_BUGFIX2_BAM, GENERAL_PLOIDY_BUGFIX2_INTERVALS, HaplotypeCaller.OPTIMAL_GVCF_INDEX_TYPE, HaplotypeCaller.OPTIMAL_GVCF_INDEX_PARAMETER); + final WalkerTestSpec spec = new WalkerTestSpec(commandLine + " -o %s", Arrays.asList("7c263d77bf831551366c6e36233b46ce")); + spec.disableShadowBCF(); + executeTest(" testGeneralPloidyArrayIndexBug2Fix", spec); + } + } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java index 84c67130c..37c9cbe02 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerIntegrationTest.java @@ -93,24 +93,55 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { HCTest(NA12878_BAM, "", "42de756c08b028be70287ada1022526e"); } + @Test + public void testHaplotypeCallerMultiSampleHaploid() { + HCTest(CEUTRIO_BAM, + "-ploidy 1", "b9e43506af628768fc9fd1ced49822b1"); + } + + @Test + public void testHaplotypeCallerSingleSampleHaploid() { + HCTest(NA12878_BAM, "-ploidy 1", "fb584b8c3f371ee2e438a3fc2335b26f"); + } + + @Test + public void testHaplotypeCallerSingleSampleTetraploid() { + HCTest(NA12878_BAM, "-ploidy 4", "d450b486c76520f9c803c603f25563e4"); + } + @Test public void testHaplotypeCallerMinBaseQuality() { HCTest(NA12878_BAM, "-mbq 15", "d063c0e5af1fd413be0500609ae36d46"); } + @Test + public void testHaplotypeCallerMinBaseQualityHaploid() { + HCTest(NA12878_BAM, "-mbq 15 -ploidy 1", "40259040f6febd8ea5931132cf5d8958"); + } + + @Test + public void testHaplotypeCallerMinBaseQualityTetraploid() { + HCTest(NA12878_BAM, "-mbq 15 -ploidy 4", "ca11eae5def67ca9717d129348e4cda7"); + } + @Test public void testHaplotypeCallerGraphBasedSingleSample() { HCTest(NA12878_BAM, "-likelihoodEngine GraphBased", "6cf15ddbfa4a3738e891fd9a09da8d07"); } + @Test + public void testHaplotypeCallerGraphBasedMultiSampleHaploid() { + HCTest(CEUTRIO_BAM, "-likelihoodEngine GraphBased -ploidy 1", "f0677e5a2882f947f437e8d2049172cb"); + } + @Test public void testHaplotypeCallerGraphBasedMultiSample() { HCTest(CEUTRIO_BAM, "-likelihoodEngine GraphBased", "4c2a2dad6379b13fee4c7faca17441f5"); } - @Test(enabled = false) // can't annotate the rsID's yet + @Test public void testHaplotypeCallerSingleSampleWithDbsnp() { - HCTest(NA12878_BAM, "-D " + b37dbSNP132, ""); + HCTest(NA12878_BAM, "-D " + b37dbSNP132, "9d7067648561aa35b04d355184a5dea2"); } @Test @@ -120,6 +151,18 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { "669aac2aa9c22881eda86ee53b13351a"); } + @Test + public void testHaplotypeCallerMultiSampleGGAHaploid() { + HCTest(CEUTRIO_BAM, "--max_alternate_alleles 3 -gt_mode GENOTYPE_GIVEN_ALLELES -ploidy 1 -alleles " + validationDataLocation + "combined.phase1.chr20.raw.indels.sites.vcf", + "e50c55c65db3fa55c75ba03b4dd2f1a8"); + } + + @Test + public void testHaplotypeCallerMultiSampleGGATetraploid() { + HCTest(CEUTRIO_BAM, "--max_alternate_alleles 3 -gt_mode GENOTYPE_GIVEN_ALLELES -ploidy 4 -alleles " + validationDataLocation + "combined.phase1.chr20.raw.indels.sites.vcf", + "374d6db6e5f3f4fdb5ede26a529caa8b"); + } + @Test public void testHaplotypeCallerInsertionOnEdgeOfContig() { HCTest(CEUTRIO_MT_TEST_BAM, "-L MT:1-10", "7f1fb8f9587f64643f6612ef1dd6d4ae"); @@ -265,7 +308,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { "-T HaplotypeCaller -likelihoodEngine GraphBased --disableDithering --pcr_indel_model NONE -R " + hg19Reference + " --no_cmdline_in_header -I " + NA12878_PCRFREE250_ADAPTER_TRIMMED + " -o %s -L 20:10,024,000-10,024,500 " , 1, Arrays.asList("")); - executeTest("HC calling with dbSNP ID annotation on WEx intervals", spec); + executeTest("HCTestGraphBasedPCRFreePositiveLogLkFix", spec); } // -------------------------------------------------------------------------------------------------------------- @@ -346,5 +389,4 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest { executeTest("testDifferentIndelLocationsDueToSWExactDoubleComparisonsFix::longInterval",longSpec); } - } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java index 7c2cd8727..f268ce535 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java @@ -300,6 +300,9 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { @Test public void testRefConfidencePartialReads() { + + final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,2); + final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); final String ref = "ACGTAACCGGTT"; for ( int readLen = 3; readLen < ref.length(); readLen++ ) { for ( int start = 0; start < ref.length() - readLen; start++ ) { @@ -307,8 +310,6 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { final List haplotypes = Arrays.asList(data.getRefHap()); final List calls = Collections.emptyList(); - final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,2); - final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); data.getActiveRegion().add(data.makeRead(start, readLen)); final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), samples, data.getActiveRegion()); @@ -326,6 +327,9 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { final int start = xxxdata.getStart(); final int stop = xxxdata.getEnd(); + final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,2); + final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); + for ( int nReads = 0; nReads < 2; nReads++ ) { final VariantContext vcStart = GATKVariantContextUtils.makeFromAlleles("test", "chr1", start, Arrays.asList("A", "C")); @@ -347,8 +351,6 @@ public class ReferenceConfidenceModelUnitTest extends BaseTest { final ReadLikelihoods likelihoods = HaplotypeCaller.createDummyStratifiedReadMap(data.getRefHap(), samples, data.getActiveRegion()); - final PloidyModel ploidyModel = new HomogeneousPloidyModel(samples,HomoSapiensConstants.DEFAULT_PLOIDY); - final GenotypingModel genotypingModel = new InfiniteRandomMatingPopulationModel(); final List expectedDPs = Collections.nCopies(data.getActiveRegion().getLocation().size(), nReads); final List contexts = model.calculateRefConfidence(data.getRefHap(), haplotypes, data.getPaddedRefLoc(), data.getActiveRegion(), likelihoods, ploidyModel, genotypingModel, calls); checkReferenceModelResult(data, contexts, expectedDPs, calls); diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/RandomDNA.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/RandomDNA.java index cdcd63427..5b58fbcbe 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/RandomDNA.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/RandomDNA.java @@ -56,7 +56,8 @@ import java.util.Random; * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ -public class RandomDNA { +public class + RandomDNA { private Random random; @@ -73,6 +74,19 @@ public class RandomDNA { random = new Random(); } + + /** + * Creates a new random DNA generator given a random number generator. + * @param rnd the underlying random number generator. + * + * @throws IllegalArgumentException if {@code rnd} is {@code null}. + */ + public RandomDNA(final Random rnd) { + if (rnd == null) + throw new IllegalArgumentException("the random number generator cannot be null"); + random = rnd; + } + /** * Constructs a new random DNA generator providing a seed. * diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IndexedSetUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IndexedSetUnitTest.java new file mode 100644 index 000000000..99d4855d0 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IndexedSetUnitTest.java @@ -0,0 +1,281 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.gatk.utils.collections; + +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Tests the working of {@link IndexedSet} + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IndexedSetUnitTest { + + @Test(dataProvider = "initialCapacityElementCountMaxElementData") + public void testCompositionBySingleElementAddition(final int initialCapacity, + final int elementCount, final int maxElement) { + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + final IndexedSet subject = new IndexedSet<>(initialCapacity); + + final Set elementSet = new LinkedHashSet<>(); + + for (int i = 0; i < elementCount; i++) { + final int nextElement = rnd.nextInt(maxElement + 1); + final boolean isNewElement = ! elementSet.contains(nextElement); + Assert.assertEquals(subject.add(nextElement), elementSet.add(nextElement)); + Assert.assertEquals(subject.size(),elementSet.size()); + if (isNewElement) + Assert.assertEquals(subject.indexOf(nextElement),elementSet.size() - 1); + } + assertEquals(subject, elementSet); + } + + @Test(dataProvider = "initialCapacityElementCountMaxElementData") + public void testCompositionByCollectionAddition(final int initialCapacity, + final int elementCount, final int maxElement) { + final IndexedSet subject = new IndexedSet<>(initialCapacity); + final List elementList = generateElementCollection(elementCount,maxElement); + + + Assert.assertEquals(subject.addAll(elementList), !elementList.isEmpty()); + + final Set elementSet = new LinkedHashSet<>(elementCount); + elementSet.addAll(elementList); + + assertEquals(subject,elementSet); + } + + @Test(dataProvider = "elementCountMaxElementData") + public void testCompositionByCollectionConstructor(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + + final IndexedSet subject = new IndexedSet<>(elementList); + + final Set elementSet = new LinkedHashSet<>(elementList); + assertEquals(subject,elementSet); + Assert.assertFalse(subject.addAll(elementList)); + } + + private List generateElementCollection(final int elementCount, final int maxElement) { + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + final List elementList = new ArrayList<>(elementCount); + for (int i = 0; i < elementCount; i++) + elementList.add(rnd.nextInt(maxElement + 1)); + return elementList; + } + + @Test(dataProvider = "elementCountMaxElementData", + dependsOnMethods = {"testCompositionByCollectionConstructor"}) + public void testLookupByIndex(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + final IndexedSet subject = new IndexedSet<>(elementList); + final Set elementSet = new LinkedHashSet<>(elementList); + final Integer[] elementArray = elementSet.toArray(new Integer[elementSet.size()]); + + final List subjectList = subject.asList(); + for (int i = 0; i < subject.size(); i++) { + final int element = elementArray[i]; + final int subjectElement = subject.get(i); + final int subjectListElement = subjectList.get(i); + Assert.assertEquals(subjectElement,element); + Assert.assertEquals(subjectListElement,element); + } + } + + @Test(dataProvider = "elementCountMaxElementData", + dependsOnMethods = {"testCompositionByCollectionConstructor"}) + public void testIndexOf(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + final IndexedSet subject = new IndexedSet<>(elementList); + final Set elementSet = new LinkedHashSet<>(elementList); + final Integer[] elementArray = elementSet.toArray(new Integer[elementSet.size()]); + + final List subjectList = subject.asList(); + for (int i = 0; i < subject.size(); i++) { + final int element = elementArray[i]; + final int listElement = subjectList.get(i); + final int subjectIndex = subject.indexOf(element); + Assert.assertEquals(listElement,element); + Assert.assertEquals(subjectIndex,i); + Assert.assertEquals(subject.indexOf(-element - 1),-1); + } + } + + @Test(dataProvider = "elementCountMaxElementData", + dependsOnMethods = {"testCompositionByCollectionConstructor","testIndexOf"}) + public void testRemoveHalf(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + final IndexedSet subject = new IndexedSet<>(elementList); + final Set elementSet = new LinkedHashSet<>(elementList); + final int removeCount = (subject.size() + 1) / 2; + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + for (int i = 0; i < removeCount; i++) { + final int removeIndex = rnd.nextInt(subject.size()); + final int removeElement = subject.get(removeIndex); + subject.remove(removeElement); + elementSet.remove(removeElement); + } + + assertEquals(subject,elementSet); + } + + @Test(dataProvider = "elementCountMaxElementData", + dependsOnMethods = {"testCompositionByCollectionConstructor","testIndexOf"}) + public void testRemoveAll(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + final IndexedSet subject = new IndexedSet<>(elementList); + final Set elementSet = new LinkedHashSet<>(elementList); + final int removeCount = subject.size(); + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + for (int i = 0; i < removeCount; i++) { + final int removeIndex = rnd.nextInt(subject.size()); + final int removeElement = subject.get(removeIndex); + subject.remove(removeElement); + elementSet.remove(removeElement); + } + + assertEquals(subject,elementSet); + } + + @Test(dataProvider = "elementCountMaxElementData", + dependsOnMethods = {"testCompositionByCollectionConstructor"}) + public void testClear(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + final IndexedSet subject = new IndexedSet<>(elementList); + final Set elementSet = new LinkedHashSet<>(elementList); + subject.clear(); + elementSet.clear(); + + assertEquals(subject, elementSet); + } + + @Test(dataProvider = "elementCountMaxElementData", + dependsOnMethods = {"testCompositionByCollectionConstructor","testIndexOf"}) + public void testRemoveAndAdd(final int elementCount, final int maxElement) { + final List elementList = generateElementCollection(elementCount, maxElement); + final IndexedSet subject = new IndexedSet<>(elementList); + final Set elementSet = new LinkedHashSet<>(elementList); + final int removeCount = subject.size(); + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + for (int i = 0; i < removeCount; i++) { + final int removeIndex = rnd.nextInt(subject.size()); + final int removeElement = subject.get(removeIndex); + subject.remove(removeElement); + elementSet.remove(removeElement); + } + subject.addAll(elementList); + elementSet.addAll(elementList); + + assertEquals(subject, elementSet); + } + + private final int[] INITIAL_CAPACITY = { 0, 10, 100 }; + + private final int[] ELEMENT_COUNT = { 0, 1, 10, 100 , 1000 }; + + private final int[] MAX_ELEMENT = { 0, 1, 5, 10, 50, 100, 500 }; + + @DataProvider(name="initialCapacityElementCountMaxElementData") + public Object[][] initialCapacityElementCountMaxElementData() { + final Object[][] result = new Object[INITIAL_CAPACITY.length * ELEMENT_COUNT.length * MAX_ELEMENT.length][]; + + int nextIndex = 0; + + for (int i = 0; i < INITIAL_CAPACITY.length; i++) + for (int j = 0; j < ELEMENT_COUNT.length; j++) + for (int k = 0; k < MAX_ELEMENT.length; k++) + result[nextIndex++] = new Object[] { INITIAL_CAPACITY[i], ELEMENT_COUNT[j], MAX_ELEMENT[k]}; + + return result; + } + + @DataProvider(name="elementCountMaxElementData") + public Object[][] elementCountMaxElementData() { + final Object[][] result = new Object[ELEMENT_COUNT.length * MAX_ELEMENT.length][]; + + int nextIndex = 0; + + for (int j = 0; j < ELEMENT_COUNT.length; j++) + for (int k = 0; k < MAX_ELEMENT.length; k++) + result[nextIndex++] = new Object[] { ELEMENT_COUNT[j], MAX_ELEMENT[k]}; + + return result; + } + + /** + * Asserts that an indexed-set is equivalent to a insertion-sorted set provided. + * @param subject the indexed-set to test. + * @param elementSet the insertion-sorted set. + */ + private void assertEquals(final IndexedSet subject, final Set elementSet) { + Assert.assertEquals(subject.size(), elementSet.size()); + final List subjectList = subject.asList(); + Assert.assertEquals(subjectList.size(),elementSet.size()); + final Iterator subjectIterator = subject.iterator(); + final Iterator elementSetIterator = subject.iterator(); + + final ListIterator subjectListIterator = subjectList.listIterator(); + + while (subjectIterator.hasNext()) { + Assert.assertTrue(elementSetIterator.hasNext(),"less elements in indexed-set than in the equivalent hash-set"); + Assert.assertTrue(subjectListIterator.hasNext()); + + final Integer nextElement; + Assert.assertEquals(nextElement = subjectIterator.next(),elementSetIterator.next(),"elements in indexed-set do not follow the same order as equivalent linked hash-set's"); + Assert.assertEquals(subjectListIterator.next(),nextElement); + Assert.assertEquals(subject.indexOf(nextElement),subjectListIterator.previousIndex()); + } + Assert.assertFalse(elementSetIterator.hasNext()); + Assert.assertFalse(subjectListIterator.hasNext()); + } +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IntMaxHeapUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IntMaxHeapUnitTest.java new file mode 100644 index 000000000..986df35e0 --- /dev/null +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/collections/IntMaxHeapUnitTest.java @@ -0,0 +1,171 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ +package org.broadinstitute.gatk.utils.collections; + +import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Collections; +import java.util.List; +import java.util.Random; + +/** + * Tests {@link IntMaxHeap}. + * + * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> + */ +public class IntMaxHeapUnitTest { + + @Test(dataProvider = "capacityData") + public void testCapacity(final int initialCapacity, final int elementCount) { + + final IntMaxHeap heap = new IntMaxHeap(initialCapacity); + + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + for (int i = 0; i < elementCount; i++) { + final int v = rnd.nextInt(); + heap.add(v); + } + } + + @Test(dataProvider = "capacityData",dependsOnMethods = {"testCapacity"}) + public void testEmptynessAndSize(final int initialCapacity, final int elementCount) { + final IntMaxHeap heap = new IntMaxHeap(initialCapacity); + + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + Assert.assertEquals(heap.size(),0); + Assert.assertTrue(heap.isEmpty()); + for (int i = 0; i < elementCount; i++) { + final int v = rnd.nextInt(); + heap.add(v); + Assert.assertEquals(heap.size(),i+1); + Assert.assertFalse(heap.isEmpty()); + } + } + + @Test(dataProvider = "capacityData", dependsOnMethods = {"testEmptynessAndSize"}) + public void testClear(final int initialCapacity, final int elementCount) { + final IntMaxHeap heap = new IntMaxHeap(initialCapacity); + + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + for (int i = 0; i < elementCount; i++) { + final int v = rnd.nextInt(); + heap.add(v); + } + heap.clear(); + Assert.assertEquals(heap.size(),0); + Assert.assertTrue(heap.isEmpty()); + } + + @Test(dataProvider = "capacityData", dependsOnMethods = {"testCapacity"}) + public void testAddArray(final int initialCapacity, final int elementCount) { + + final IntMaxHeap addHeap = new IntMaxHeap(initialCapacity); + final IntMaxHeap arrayAddHeap = new IntMaxHeap(initialCapacity); + + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + final int[] values = new int[elementCount]; + for (int i = 0; i < elementCount; i++) { + final int v = rnd.nextInt(); + values[i] = v; + addHeap.add(v); + } + arrayAddHeap.add(values); + Assert.assertEquals(arrayAddHeap.size(),addHeap.size()); + while (!arrayAddHeap.isEmpty()) + Assert.assertEquals(arrayAddHeap.remove(),addHeap.remove()); + } + + @Test(dataProvider = "capacityData", dependsOnMethods = {"testEmptynessAndSize"}) + public void testRemove(final int initialCapacity, final int elementCount) { + final IntMaxHeap heap = new IntMaxHeap(initialCapacity); + + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + final List values = new ArrayList<>(elementCount); + for (int i = 0; i < elementCount; i++) { + final int v = rnd.nextInt(); + values.add(v); + heap.add(v); + } + + Collections.sort(values, Collections.reverseOrder()); + for (int i = 0; i < elementCount; i++) { + Assert.assertEquals(heap.remove(),(int)values.get(i), "element-count = " + elementCount + ", initial-capacity = " + initialCapacity); + Assert.assertEquals(heap.size(),elementCount - i - 1); + } + } + + @Test(dataProvider = "capacityData", dependsOnMethods = {"testCapacity"}) + public void testPeek(final int initialCapacity, final int elementCount) { + final IntMaxHeap heap = new IntMaxHeap(initialCapacity); + + final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + int top = rnd.nextInt(); + heap.add(top); + Assert.assertEquals(heap.peek(),top); + for (int i = 1; i < elementCount; i++) { + final int v = rnd.nextInt(); + if (v > top) top = v; + heap.add(v); + Assert.assertEquals(heap.peek(),top); + } + } + + @DataProvider(name="capacityData") + public Object[][] capacityData() { + return new Object[][] { + {0,100}, {1,113}, {20,301} + }; + } + +} diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java index 33e1a4758..65fc43579 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java @@ -48,14 +48,15 @@ package org.broadinstitute.gatk.utils.genotyper; import htsjdk.samtools.SAMFileHeader; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; -import org.broadinstitute.gatk.genotyping.IndexedAlleleList; -import org.broadinstitute.gatk.genotyping.IndexedSampleList; +import org.broadinstitute.gatk.genotyping.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.GenomeLocParser; +import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.sam.ArtificialSAMUtils; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; import org.broadinstitute.gatk.utils.variant.GATKVariantContextUtils; import org.testng.Assert; +import org.testng.SkipException; import org.testng.annotations.DataProvider; import org.testng.annotations.Test; @@ -410,7 +411,7 @@ public class ReadLikelihoodsUnitTest // We add a single missing. result.addMissingAlleles(Arrays.asList(newOne = Allele.create("ACCCCCAAAATTTAAAGGG".getBytes(),false)),-12345.6); - Assert.assertEquals(original.alleleCount() + 1, result.alleleCount()); + Assert.assertEquals(result.alleleCount(), original.alleleCount() + 1); // We add too more amongst exisisting alleles: result.addMissingAlleles(Arrays.asList(newTwo = Allele.create("ATATATTATATTAATATT".getBytes(), false),result.alleleAt(1), @@ -479,9 +480,9 @@ public class ReadLikelihoodsUnitTest final int alleleCount = result.alleleCount(); Assert.assertEquals(result.alleleCount(), alleleCount); for (int a = 0; a < alleleCount; a++) { - Assert.assertEquals(result.sampleReadCount(0),sampleReadCount); + Assert.assertEquals(result.sampleReadCount(sampleIndex),sampleReadCount); for (int r = 0; r < sampleReadCount; r++) - Assert.assertEquals(result.sampleMatrix(0).get(a,r), + Assert.assertEquals(result.sampleMatrix(sampleIndex).get(a,r), likelihoods == null ? 0.0 : likelihoods[sampleIndex][a][r], EPSILON); } } @@ -541,7 +542,7 @@ public class ReadLikelihoodsUnitTest final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); final Object[][] result = new Object[SAMPLE_SETS.length * ALLELE_SETS.length * ALLELE_SETS.length][]; int nextIndex = 0; - for (int s = 0; s < SAMPLE_SETS.length; s++) + for (int s = 0; s < SAMPLE_SETS.length; s++) { for (int a = 0; a < ALLELE_SETS.length; a++) { for (int b = 0; b < ALLELE_SETS.length; b++) { if (ALLELE_SETS[b].length < ALLELE_SETS[a].length) @@ -550,6 +551,7 @@ public class ReadLikelihoodsUnitTest }; } } + } return Arrays.copyOf(result,nextIndex); }catch (final Throwable e) { throw new RuntimeException(e); @@ -590,9 +592,6 @@ public class ReadLikelihoodsUnitTest } } - final SAMFileHeader SAM_HEADER = ArtificialSAMUtils.createArtificialSamHeader(); - final GenomeLocParser locParser = new GenomeLocParser(SAM_HEADER.getSequenceDictionary()); - private Map> dataSetReads(final String[] samples, final Random rnd) { final Map> result = new HashMap<>(samples.length); @@ -608,4 +607,245 @@ public class ReadLikelihoodsUnitTest } return result; } + + @Test(dataProvider="readCountsAndAlleleCountDataSkippingNoAlleleAndWithReference") + public void testInstantiationAndBasicQueries(final int[] readCounts, final int alleleCount, final boolean hasReference) { + final SampleList sampleList = sampleList(readCounts); + + final AlleleList alleleList = alleleList(alleleCount,hasReference); + final Map> sampleToReads = ReadLikelihoodsUnitTester.sampleToReads(sampleList, readCounts); + final ReadLikelihoods subject = new ReadLikelihoods<>(sampleList,alleleList,sampleToReads); + + AlleleListUnitTester.assertAlleleList(subject,AlleleListUtils.asList(alleleList)); + SampleListUnitTester.assertSampleList(subject,SampleListUtils.asList(sampleList)); + + if (hasReference) { + final int referenceIndex = AlleleListUtils.indexOfReference(alleleList); + Assert.assertTrue(referenceIndex >= 0); + Assert.assertEquals(AlleleListUtils.indexOfReference(alleleList),referenceIndex); + } else { + Assert.assertEquals(AlleleListUtils.indexOfReference(subject), -1); + } + + testLikelihoodMatrixQueries(alleleList, sampleList, sampleToReads, subject); + testAlleleQueries(alleleList, subject); + testSampleQueries(sampleList, sampleToReads, subject); + } + + @Test(dataProvider="readCountsAndAlleleCountDataSkippingNoLikelihoodsOrNoAlleleAndWithReference") + public void testLikelihoodWriting(final int[] readCounts, final int alleleCount, final boolean hasReference) { + final SampleList sampleList = sampleList(readCounts); + + final AlleleList alleleList = alleleList(alleleCount,hasReference); + final Map> sampleToReads = ReadLikelihoodsUnitTester.sampleToReads(sampleList,readCounts); + final ReadLikelihoods subject = new ReadLikelihoods<>(sampleList,alleleList,sampleToReads); + + final int sampleCount = readCounts.length; + int totalLikelihoodsSet = 0; + int expectedLikelihoodsSet = 0; + for (int s = 0; s < sampleCount; s++) { + expectedLikelihoodsSet += readCounts[s] * alleleCount; + final ReadLikelihoods.Matrix matrix = subject.sampleMatrix(s); + final int readCount = matrix.readCount(); + for (int a = 0; a < alleleCount; a++) + for (int r = 0; r < readCount; r++) { + final double likelihood = testLikelihood(s, a, r); + Assert.assertNotEquals(likelihood,0); //Paranoia + totalLikelihoodsSet++; + matrix.set(a,r,likelihood); + Assert.assertEquals(matrix.get(a, r),likelihood); + } + + } + Assert.assertEquals(totalLikelihoodsSet,expectedLikelihoodsSet); + } + + @Test(dependsOnMethods={"testLikelihoodWriting","testInstantiationAndBasicQueries"}, + dataProvider="readCountsAndAlleleCountDataSkippingNoAlleleAndWithReference") + public void testMapConversion(final int[] readCounts, final int alleleCount, final boolean hasReference) { + final SampleList sampleList = sampleList(readCounts); + + final AlleleList alleleList = alleleList(alleleCount,hasReference); + final Map> sampleToReads = ReadLikelihoodsUnitTester.sampleToReads(sampleList,readCounts); + + final Set alleleWithLikelihoodsSet = new HashSet<>(); + final Set readsWithLikelihoodsSet = new HashSet<>(); + final Map map = new HashMap<>(sampleList.sampleCount()); + final int sampleCount = sampleList.sampleCount(); + for (int s = 0; s < sampleCount; s++) { + final String sample = sampleList.sampleAt(s); + final PerReadAlleleLikelihoodMap perSampleMap = new PerReadAlleleLikelihoodMap(); + final List reads = sampleToReads.get(sample); + for (int a = 0; a < alleleCount; a++) + for (int r = 0; r < reads.size(); r++) { + perSampleMap.add(reads.get(r), alleleList.alleleAt(a), testLikelihood(s, a, r)); + alleleWithLikelihoodsSet.add(alleleList.alleleAt(a)); + readsWithLikelihoodsSet.add(reads.get(r)); + } + map.put(sample,perSampleMap); + + } + + ReadLikelihoods subject = ReadLikelihoods.fromPerAlleleReadLikelihoodsMap(map); + + for (int s = 0; s < sampleCount; s++) { + final String sample = sampleList.sampleAt(s); + final int sIndex = subject.sampleIndex(sample); + Assert.assertTrue(sIndex >= 0); + Assert.assertTrue(sIndex < sampleCount); + final int sampleReadCount = sampleToReads.get(sample).size(); + final ReadLikelihoods.Matrix sampleLikelihoods = subject.sampleMatrix(sIndex); + for (int a = 0; a < alleleCount; a++) { + final Allele allele = alleleList.alleleAt(a); + final int aIndex = subject.alleleIndex(allele); + Assert.assertEquals(aIndex >= 0,alleleWithLikelihoodsSet.contains(allele)); + Assert.assertTrue(aIndex < alleleCount); + if (aIndex == -1) continue; + for (int r = 0; r < sampleReadCount; r++) { + final GATKSAMRecord read = sampleToReads.get(sample).get(r); + final int rIndex = subject.readIndex(sIndex,read); + final int rIndex2 = sampleLikelihoods.readIndex(read); + Assert.assertEquals(rIndex,rIndex2); + Assert.assertEquals(rIndex >= 0,readsWithLikelihoodsSet.contains(read)); + Assert.assertTrue(rIndex < sampleReadCount); + if (rIndex == -1) + continue; + final double likelihood = sampleLikelihoods.get(aIndex,rIndex); + Assert.assertEquals(likelihood,testLikelihood(s,a,r)); + } + } + } + } + + private double testLikelihood(final int sampleIndex, final int alleleIndex, final int readIndex) { + return - Math.abs(31 * (sampleIndex + 1) + 101 * alleleIndex + 1009 * readIndex); + } + + + private final Random rnd = GenomeAnalysisEngine.getRandomGenerator(); + + private void testLikelihoodMatrixQueries(final AlleleList alleles, final SampleList samples, + final Map> sampleToReads, ReadLikelihoods result) { + for (final String sample : SampleListUtils.asList(samples)) { + final int sampleIndex = result.sampleIndex(sample); + final ReadLikelihoods.Matrix likelihoodMatrix = result.sampleMatrix(sampleIndex); + final int sampleReadCount = sampleToReads.get(sample).size(); + final List reads = sampleToReads.get(sample); + Assert.assertEquals(likelihoodMatrix.alleleCount(), alleles.alleleCount()); + Assert.assertEquals(likelihoodMatrix.readCount(), sampleReadCount); + for (int a = 0; a < likelihoodMatrix.alleleCount(); a++) { + Assert.assertEquals(likelihoodMatrix.alleleAt(a),alleles.alleleAt(a)); + for (int r = 0; r < sampleReadCount; r++) { + Assert.assertEquals(likelihoodMatrix.readAt(r),reads.get(r)); + Assert.assertEquals(likelihoodMatrix.get(a, r), 0.0); + } + } + } + } + + private void testAlleleQueries(final AlleleList alleles, ReadLikelihoods result) { + final Set alleleIndices = new HashSet<>(); + for (final Allele allele : AlleleListUtils.asList(alleles)) { + final int alleleIndex = result.alleleIndex(allele); + Assert.assertTrue(alleleIndex >= 0); + Assert.assertFalse(alleleIndices.contains(alleleIndex)); + alleleIndices.add(alleleIndex); + Assert.assertSame(allele,alleles.alleleAt(alleleIndex)); + } + } + + private void testSampleQueries(final SampleList samples, Map> reads, + final ReadLikelihoods result) { + final Set sampleIds = new HashSet<>(samples.sampleCount()); + for (final String sample : SampleListUtils.asList(samples)) { + final int sampleIndex = result.sampleIndex(sample); + Assert.assertTrue(sampleIndex >= 0); + Assert.assertFalse(sampleIds.contains(sampleIndex)); + sampleIds.add(sampleIndex); + + final List sampleReads = result.sampleReads(sampleIndex); + final Set sampleReadsSet = new HashSet<>(sampleReads); + final List expectedSampleReadArray = reads.get(sample); + final Set expectedSampleReadsSet = new HashSet<>(expectedSampleReadArray); + Assert.assertEquals(sampleReadsSet,expectedSampleReadsSet); + + final int sampleReadCount = sampleReads.size(); + for (int r = 0; r < sampleReadCount; r++) { + Assert.assertSame(sampleReads.get(r), expectedSampleReadArray.get(r)); + final int readIndex = result.readIndex(sampleIndex, sampleReads.get(r)); + Assert.assertEquals(readIndex,r); + } + } + } + + private AlleleList alleleList(final int alleleCount, final boolean hasReference) { + final Allele[] alleles = AlleleListUnitTester.generateRandomAlleles(alleleCount,100); + if (hasReference) { + final int referenceIndex = rnd.nextInt(alleleCount); + alleles[referenceIndex] = Allele.create(alleles[referenceIndex].getBases(),true); + } + final AlleleList alleleList = new IndexedAlleleList<>(alleles); + if (alleleList.alleleCount() != alleles.length) + throw new SkipException("repeated alleles, should be infrequent"); + return alleleList; + } + + private SAMFileHeader SAM_HEADER = ArtificialSAMUtils.createArtificialSamHeader(10, 0, 1000); + final GenomeLocParser locParser = new GenomeLocParser(SAM_HEADER.getSequenceDictionary()); + + + private int[][] READ_COUNTS = new int[][] { + {}, + { 100 }, + { 0 }, + { 0, 0, 0 }, + { 1, 0, 1 }, + { 100, 10 , 100}, + { 1000, 10, 100, 20, 23 } + }; + + private int[] ALLELE_COUNTS = new int[] { 0, 1, 2, 3, 10, 20 }; + + @DataProvider(name="readCountsAndAlleleCountData") + public Object[][] readCountsAndAlleleCountData() { + final Object[][] result = new Object[READ_COUNTS.length * ALLELE_COUNTS.length * 2][]; + int index = 0; + for (final int[] readCounts : READ_COUNTS) + for (final int alleleCount : ALLELE_COUNTS) { + result[index++] = new Object[]{ readCounts, alleleCount, false}; + result[index++] = new Object[]{ readCounts, alleleCount, true}; + } + return result; + } + + @DataProvider(name="readCountsAndAlleleCountDataSkippingNoAlleleAndWithReference") + public Object[][] readCountsAndAlleleCountDataSkippingNoAlleleAndWithReference() { + final Object[][] raw = readCountsAndAlleleCountData(); + final List result = new ArrayList<>(raw.length); + for (final Object[] paramSet : raw) + if (!paramSet[2].equals(true) || !paramSet[1].equals(0)) + result.add(paramSet); + return result.toArray(new Object[result.size()][]); + } + + @DataProvider(name="readCountsAndAlleleCountDataSkippingNoLikelihoodsOrNoAlleleAndWithReference") + public Object[][] readCountsAndAlleleCountDataSkippingNoLikelihoodsOrNoAlleleAndWithReference() { + final Object[][] raw = readCountsAndAlleleCountDataSkippingNoAlleleAndWithReference(); + final List result = new ArrayList<>(raw.length); + for (final Object[] paramSet : raw) { + final int[] readCounts = (int[]) paramSet[0]; + final long totalReadCount = MathUtils.sum(readCounts); + if (totalReadCount > 0) + result.add(paramSet); + } + return result.toArray(new Object[result.size()][]); + } + + private SampleList sampleList(final int[] readCounts) { + final List samples = new ArrayList<>(readCounts.length); + for (int i = 0; i < readCounts.length; i++) + samples.add("SAMPLE_" + i); + return new IndexedSampleList(samples); + } + } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java index 1f0280c82..354103eae 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/GVCFWriterUnitTest.java @@ -347,7 +347,7 @@ public class GVCFWriterUnitTest extends BaseTest { @Test public void testHomRefAlt() { - final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, 2); + final GVCFWriter writer = new GVCFWriter(mockWriter, standardPartition, HomoSapiensConstants.DEFAULT_PLOIDY); writer.add(makeHomRef("20", 1, 0)); writer.add(makeHomRef("20", 2, 0)); diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java index 00d5d6984..779cc588c 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/gvcf/HomRefBlockUnitTest.java @@ -51,6 +51,7 @@ import htsjdk.variant.variantcontext.GenotypeBuilder; import htsjdk.variant.variantcontext.VariantContext; import htsjdk.variant.variantcontext.VariantContextBuilder; import org.broadinstitute.gatk.utils.BaseTest; +import org.broadinstitute.gatk.utils.variant.HomoSapiensConstants; import org.testng.Assert; import org.testng.annotations.BeforeMethod; import org.testng.annotations.DataProvider; @@ -70,7 +71,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test public void testBasicConstruction() { - final HomRefBlock band = new HomRefBlock(vc, 10, 20, 2); + final HomRefBlock band = new HomRefBlock(vc, 10, 20, HomoSapiensConstants.DEFAULT_PLOIDY); Assert.assertSame(band.getStartingVC(), vc); Assert.assertEquals(band.getRef(), vc.getReference()); Assert.assertEquals(band.getGQLowerBound(), 10); @@ -85,8 +86,9 @@ public class HomRefBlockUnitTest extends BaseTest { @Test public void testMinMedian() { //TODO - might be better to make this test use a data provider? - final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); + final HomRefBlock band = new HomRefBlock(vc, 10, 20, HomoSapiensConstants.DEFAULT_PLOIDY); final GenotypeBuilder gb = new GenotypeBuilder("NA12878"); + gb.alleles(vc.getAlleles()); int pos = vc.getStart(); band.add(pos++, gb.DP(10).GQ(11).PL(new int[]{0,11,100}).make()); @@ -116,8 +118,9 @@ public class HomRefBlockUnitTest extends BaseTest { @Test public void testBigGQIsCapped() { - final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); + final HomRefBlock band = new HomRefBlock(vc, 10, 20, HomoSapiensConstants.DEFAULT_PLOIDY); final GenotypeBuilder gb = new GenotypeBuilder("NA12878"); + gb.alleles(vc.getAlleles()); band.add(vc.getStart(), gb.DP(1000).GQ(1000).PL(new int[]{0,10,100}).make()); assertValues(band, 1000, 1000, 99, 99); @@ -125,7 +128,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test(expectedExceptions = IllegalArgumentException.class) public void testBadAdd() { - final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); + final HomRefBlock band = new HomRefBlock(vc, 10, 20, HomoSapiensConstants.DEFAULT_PLOIDY); final GenotypeBuilder gb = new GenotypeBuilder("NA12878"); band.add(vc.getStart() + 10, gb.DP(10).GQ(11).PL(new int[]{0,10,100}).make()); @@ -155,7 +158,7 @@ public class HomRefBlockUnitTest extends BaseTest { @Test(dataProvider = "ContiguousData") public void testIsContiguous(final String contig, final int pos, final boolean expected) { - final HomRefBlock band = new HomRefBlock(vc, 10, 20,2); + final HomRefBlock band = new HomRefBlock(vc, 10, 20, HomoSapiensConstants.DEFAULT_PLOIDY); final VariantContext testVC = new VariantContextBuilder(vc).chr(contig).start(pos).stop(pos).make(); Assert.assertEquals(band.isContiguous(testVC), expected); } diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/PerReadAlleleLikelihoodMap.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/PerReadAlleleLikelihoodMap.java index 553823e33..1dd8a8a1f 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/PerReadAlleleLikelihoodMap.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/PerReadAlleleLikelihoodMap.java @@ -45,9 +45,12 @@ import java.util.*; */ public class PerReadAlleleLikelihoodMap { /** A set of all of the allele, so we can efficiently determine if an allele is already present */ - private final Set allelesSet = new HashSet<>(); + private final Map allelesSet = new HashMap<>(); /** A list of the unique allele, as an ArrayList so we can call get(i) efficiently */ protected final List alleles = new ArrayList<>(); + + + protected final Map> likelihoodReadMap = new LinkedHashMap<>(); public PerReadAlleleLikelihoodMap() { } @@ -64,6 +67,10 @@ public class PerReadAlleleLikelihoodMap { if ( likelihood == null ) throw new IllegalArgumentException("Likelihood cannot be null"); if ( likelihood > 0.0 ) throw new IllegalArgumentException("Likelihood must be negative (L = log(p))"); + if (!allelesSet.containsKey(a)) { + allelesSet.put(a,alleles.size()); + alleles.add(a); + } Map likelihoodMap = likelihoodReadMap.get(read); if (likelihoodMap == null){ // LinkedHashMap will ensure iterating through alleles will be in consistent order @@ -73,10 +80,7 @@ public class PerReadAlleleLikelihoodMap { likelihoodMap.put(a,likelihood); - if (!allelesSet.contains(a)) { - allelesSet.add(a); - alleles.add(a); - } + } public ReadBackedPileup createPerAlleleDownsampledBasePileup(final ReadBackedPileup pileup, final double downsamplingFraction) { @@ -198,7 +202,7 @@ public class PerReadAlleleLikelihoodMap { * @return the log10 likelihood that this read matches this allele */ public double getLikelihoodAssociatedWithReadAndAllele(final GATKSAMRecord read, final Allele allele){ - if (!allelesSet.contains(allele) || !likelihoodReadMap.containsKey(read)) + if (!allelesSet.containsKey(allele) || !likelihoodReadMap.containsKey(read)) return 0.0; return likelihoodReadMap.get(read).get(allele); @@ -381,7 +385,7 @@ public class PerReadAlleleLikelihoodMap { * @return a non-null unmodifiable map */ public Set getAllelesSet() { - return Collections.unmodifiableSet(allelesSet); + return Collections.unmodifiableSet(allelesSet.keySet()); } /** diff --git a/public/gatk-tools-public/src/test/java/org/broadinstitute/gatk/utils/BaseTest.java b/public/gatk-tools-public/src/test/java/org/broadinstitute/gatk/utils/BaseTest.java index b8d60cf53..16e566230 100644 --- a/public/gatk-tools-public/src/test/java/org/broadinstitute/gatk/utils/BaseTest.java +++ b/public/gatk-tools-public/src/test/java/org/broadinstitute/gatk/utils/BaseTest.java @@ -26,20 +26,9 @@ package org.broadinstitute.gatk.utils; import htsjdk.tribble.Tribble; -import htsjdk.tribble.util.TabixUtils; -import org.apache.log4j.AppenderSkeleton; -import org.apache.log4j.Level; -import org.apache.log4j.Logger; -import org.apache.log4j.PatternLayout; -import org.apache.log4j.spi.LoggingEvent; import htsjdk.tribble.readers.LineIterator; import htsjdk.tribble.readers.PositionalBufferedStream; -import org.broadinstitute.gatk.utils.commandline.CommandLineUtils; -import org.broadinstitute.gatk.utils.collections.Pair; -import org.broadinstitute.gatk.utils.crypt.CryptUtils; -import org.broadinstitute.gatk.utils.exceptions.ReviewedGATKException; -import org.broadinstitute.gatk.utils.io.IOUtils; -import org.broadinstitute.gatk.utils.variant.GATKVCFUtils; +import htsjdk.tribble.util.TabixUtils; import htsjdk.variant.bcf2.BCF2Codec; import htsjdk.variant.variantcontext.Genotype; import htsjdk.variant.variantcontext.VariantContext; @@ -47,6 +36,17 @@ import htsjdk.variant.vcf.VCFCodec; import htsjdk.variant.vcf.VCFConstants; import htsjdk.variant.vcf.VCFHeader; import htsjdk.variant.vcf.VCFHeaderLine; +import org.apache.log4j.AppenderSkeleton; +import org.apache.log4j.Level; +import org.apache.log4j.Logger; +import org.apache.log4j.PatternLayout; +import org.apache.log4j.spi.LoggingEvent; +import org.broadinstitute.gatk.utils.collections.Pair; +import org.broadinstitute.gatk.utils.commandline.CommandLineUtils; +import org.broadinstitute.gatk.utils.crypt.CryptUtils; +import org.broadinstitute.gatk.utils.exceptions.ReviewedGATKException; +import org.broadinstitute.gatk.utils.io.IOUtils; +import org.broadinstitute.gatk.utils.variant.GATKVCFUtils; import org.testng.Assert; import org.testng.Reporter; import org.testng.SkipException; @@ -132,6 +132,7 @@ public abstract class BaseTest { protected static final String publicTestDirRoot = publicTestDir.replace(publicTestDirRelative, ""); public static final String keysDataLocation = validationDataLocation + "keys/"; + public static final String gatkKeyFile = CryptUtils.GATK_USER_KEY_DIRECTORY + "gsamembers_broadinstitute.org.key"; public static final String exampleFASTA = publicTestDir + "exampleFASTA.fasta"; From 8d9a55ae604d9a5076acd79e442da48a96df0375 Mon Sep 17 00:00:00 2001 From: Valentin Ruano-Rubio Date: Tue, 19 Aug 2014 10:32:02 -0400 Subject: [PATCH 7/7] Moving new omniploidy likelihood calculation classes to their final package (as far as this pull-request is concerned) in org.broadinstitute.gatk.tools.walkers.genotyper --- .../genotyper}/AlleleLikelihoodMatrixMapper.java | 2 +- .../genotyper/GeneralPloidyGenotypeLikelihoods.java | 3 --- .../walkers/genotyper}/GenotypeAlleleCounts.java | 2 +- .../genotyper}/GenotypeLikelihoodCalculator.java | 2 +- .../genotyper}/GenotypeLikelihoodCalculators.java | 2 +- .../walkers/genotyper}/GenotypingData.java | 4 ++-- .../tools/walkers/genotyper/GenotypingEngine.java | 1 - .../walkers/genotyper}/GenotypingLikelihoods.java | 2 +- .../walkers/genotyper}/GenotypingModel.java | 2 +- .../walkers/genotyper}/HomogeneousPloidyModel.java | 2 +- .../InfiniteRandomMatingPopulationModel.java | 4 ++-- .../walkers/genotyper}/PloidyModel.java | 2 +- .../tools/walkers/genotyper/UnifiedGenotyper.java | 2 -- .../walkers/genotyper/UnifiedGenotypingEngine.java | 1 - .../GraphBasedLikelihoodCalculationEngine.java | 2 +- ...raphBasedLikelihoodCalculationEngineInstance.java | 6 +++--- .../walkers/haplotypecaller/HaplotypeCaller.java | 1 - .../HaplotypeCallerGenotypingEngine.java | 6 +----- .../PairHMMLikelihoodCalculationEngine.java | 6 +++--- .../RandomLikelihoodCalculationEngine.java | 6 +++--- .../ReadLikelihoodCalculationEngine.java | 2 +- .../haplotypecaller/ReferenceConfidenceModel.java | 3 +-- .../tools/walkers/indels/PairHMMIndelErrorModel.java | 6 +++--- .../tools/walkers/variantutils/GenotypeGVCFs.java | 6 +++--- .../walkers/variantutils/RegenotypeVariants.java | 6 +++--- .../gatk/utils/haplotype/HaplotypeLDCalculator.java | 6 +++--- .../walkers/genotyper}/AlleleListUnitTester.java | 6 +++--- .../walkers/genotyper}/AlleleListUtilsUnitTest.java | 4 ++-- .../genotyper}/GenotypeAlleleCountsUnitTest.java | 5 +++-- .../GenotypeLikelihoodCalculatorUnitTest.java | 4 ++-- .../walkers/genotyper}/GenotypingDataUnitTest.java | 8 ++++---- .../walkers/genotyper}/HeterogeneousPloidyModel.java | 5 ++++- .../genotyper}/HomogeneousPloidyModelUnitTest.java | 4 ++-- .../genotyper}/IndexedAlleleListUnitTest.java | 6 +++--- .../genotyper}/IndexedSampleListUnitTest.java | 12 +++++------- .../InfiniteRandomMatingPopulationModelUnitTest.java | 4 ++-- .../genotyper}/ReadLikelihoodsUnitTester.java | 2 +- .../walkers/genotyper}/SampleListUnitTester.java | 8 +++++--- .../walkers/genotyper}/SampleListUtilsUnitTest.java | 8 +++++--- .../genotyper/UnifiedGenotyperEngineUnitTest.java | 2 -- .../HCLikelihoodCalculationEnginesBenchmark.java | 2 +- ...ThreadingLikelihoodCalculationEngineUnitTest.java | 2 +- .../ReferenceConfidenceModelUnitTest.java | 2 +- .../utils/genotyper/ReadLikelihoodsUnitTest.java | 4 ++-- .../gatk/engine/GenomeAnalysisEngine.java | 4 ++-- .../walkers/genotyper}/AlleleList.java | 2 +- .../walkers/genotyper}/AlleleListPermutation.java | 2 +- .../walkers/genotyper}/AlleleListUtils.java | 2 +- .../walkers/genotyper}/IndexedAlleleList.java | 2 +- .../walkers/genotyper}/IndexedSampleList.java | 2 +- .../walkers/genotyper}/SampleList.java | 2 +- .../walkers/genotyper}/SampleListUtils.java | 2 +- .../gatk/utils/genotyper/ReadLikelihoods.java | 4 +++- 53 files changed, 95 insertions(+), 102 deletions(-) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/AlleleLikelihoodMatrixMapper.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypeAlleleCounts.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypeLikelihoodCalculator.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypeLikelihoodCalculators.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypingData.java (98%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypingLikelihoods.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypingModel.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/HomogeneousPloidyModel.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/InfiniteRandomMatingPopulationModel.java (99%) rename protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/PloidyModel.java (99%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/AlleleListUnitTester.java (98%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/AlleleListUtilsUnitTest.java (99%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypeAlleleCountsUnitTest.java (99%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypeLikelihoodCalculatorUnitTest.java (98%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/GenotypingDataUnitTest.java (97%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/HeterogeneousPloidyModel.java (98%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/HomogeneousPloidyModelUnitTest.java (98%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/IndexedAlleleListUnitTest.java (97%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/IndexedSampleListUnitTest.java (95%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/InfiniteRandomMatingPopulationModelUnitTest.java (98%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/ReadLikelihoodsUnitTester.java (99%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/SampleListUnitTester.java (96%) rename protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/SampleListUtilsUnitTest.java (96%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/AlleleList.java (96%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/AlleleListPermutation.java (96%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/AlleleListUtils.java (99%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/IndexedAlleleList.java (98%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/IndexedSampleList.java (98%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/SampleList.java (96%) rename public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/{genotyping => tools/walkers/genotyper}/SampleListUtils.java (99%) diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleLikelihoodMatrixMapper.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleLikelihoodMatrixMapper.java index 557dfd0ad..008f194d0 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/AlleleLikelihoodMatrixMapper.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleLikelihoodMatrixMapper.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java index 5abb1cd85..33d23c592 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java @@ -50,9 +50,6 @@ import htsjdk.samtools.SAMUtils; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; import htsjdk.variant.vcf.VCFConstants; -import org.broadinstitute.gatk.genotyping.GenotypeAlleleCounts; -import org.broadinstitute.gatk.genotyping.GenotypeLikelihoodCalculator; -import org.broadinstitute.gatk.genotyping.GenotypeLikelihoodCalculators; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.ExactACcounts; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.ExactACset; import org.broadinstitute.gatk.utils.MathUtils; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeAlleleCounts.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeAlleleCounts.java index 4f55b5785..f055362fa 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCounts.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeAlleleCounts.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import org.broadinstitute.gatk.utils.MathUtils; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculator.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculator.java index b07334f04..46f6f36de 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculator.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculator.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculators.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculators.java index 4bd5bbaf0..39c4b413a 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculators.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculators.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import java.util.Arrays; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingData.java similarity index 98% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingData.java index 12214d67e..aabdcceb7 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingData.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingData.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; @@ -78,7 +78,7 @@ public class GenotypingData
implements SampleList, AlleleList< throw new IllegalArgumentException("the likelihood object cannot be null"); this.ploidyModel = ploidyModel; this.likelihoods = likelihoods; - if (!SampleListUtils.equals(ploidyModel,likelihoods)) + if (!SampleListUtils.equals(ploidyModel, likelihoods)) throw new IllegalArgumentException("sample list are different between ploidy-model and read-likelihood collection, perhaps just the order"); } diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java index 8225ba9a5..50a9d0a8c 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingEngine.java @@ -58,7 +58,6 @@ import org.broadinstitute.gatk.engine.contexts.AlignmentContext; import org.broadinstitute.gatk.engine.contexts.AlignmentContextUtils; import org.broadinstitute.gatk.engine.contexts.ReferenceContext; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; -import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.tools.walkers.annotator.VariantAnnotatorEngine; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalc; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalcFactory; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingLikelihoods.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingLikelihoods.java index 35787107f..40d296193 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingLikelihoods.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingLikelihoods.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingModel.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingModel.java index 9c84c8962..8021a4897 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/GenotypingModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingModel.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/HomogeneousPloidyModel.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/HomogeneousPloidyModel.java index ed8d59a94..c4d7a0029 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/HomogeneousPloidyModel.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; /** * {@link PloidyModel} implementation tailored to work with a homogeneous constant ploidy diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/InfiniteRandomMatingPopulationModel.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/InfiniteRandomMatingPopulationModel.java index f476d940c..968b869c3 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/InfiniteRandomMatingPopulationModel.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; @@ -97,7 +97,7 @@ public class InfiniteRandomMatingPopulationModel implements GenotypingModel { if (data == null) throw new IllegalArgumentException("the genotyping data cannot be null"); - final AlleleListPermutation permutation = AlleleListUtils.permutation(data,genotypingAlleles); + final AlleleListPermutation permutation = AlleleListUtils.permutation(data, genotypingAlleles); final AlleleLikelihoodMatrixMapper alleleLikelihoodMatrixMapper = AlleleLikelihoodMatrixMapper.newInstance(permutation); final int sampleCount = data.sampleCount(); diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/PloidyModel.java similarity index 99% rename from protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java rename to protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/PloidyModel.java index 8ca00611e..5c5d7bdce 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/genotyping/PloidyModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/PloidyModel.java @@ -44,7 +44,7 @@ * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; /** * Information about the number of chromosome per sample at a given location. diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyper.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyper.java index b98c878f3..9a2d123e5 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyper.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyper.java @@ -48,8 +48,6 @@ package org.broadinstitute.gatk.tools.walkers.genotyper; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.walkers.*; -import org.broadinstitute.gatk.genotyping.IndexedSampleList; -import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.utils.commandline.*; import org.broadinstitute.gatk.engine.CommandLineGATK; import org.broadinstitute.gatk.engine.arguments.DbsnpArgumentCollection; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java index 22bc09e98..f2bea114a 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotypingEngine.java @@ -54,7 +54,6 @@ import org.broadinstitute.gatk.engine.contexts.AlignmentContext; import org.broadinstitute.gatk.engine.contexts.AlignmentContextUtils; import org.broadinstitute.gatk.engine.contexts.ReferenceContext; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; -import org.broadinstitute.gatk.genotyping.SampleList; import org.broadinstitute.gatk.tools.walkers.genotyper.afcalc.AFCalcResult; import org.broadinstitute.gatk.utils.BaseUtils; import org.broadinstitute.gatk.utils.GenomeLocParser; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java index 0008f5b28..4a8694161 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngine.java @@ -47,7 +47,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import org.apache.log4j.Logger; -import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.SeqGraph; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java index e2229cd50..ce5e361bd 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/GraphBasedLikelihoodCalculationEngineInstance.java @@ -48,9 +48,9 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import htsjdk.variant.variantcontext.Allele; import org.apache.log4j.Logger; -import org.broadinstitute.gatk.genotyping.AlleleList; -import org.broadinstitute.gatk.genotyping.IndexedAlleleList; -import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedAlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.MultiSampleEdge; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.Path; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.graphs.Route; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java index 5e6a519ea..3bb40eaac 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCaller.java @@ -65,7 +65,6 @@ import org.broadinstitute.gatk.engine.io.GATKSAMFileWriter; import org.broadinstitute.gatk.engine.iterators.ReadTransformer; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; import org.broadinstitute.gatk.engine.walkers.*; -import org.broadinstitute.gatk.genotyping.*; import org.broadinstitute.gatk.tools.walkers.annotator.VariantAnnotatorEngine; import org.broadinstitute.gatk.tools.walkers.annotator.interfaces.AnnotatorCompatible; import org.broadinstitute.gatk.tools.walkers.genotyper.*; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java index 76c8dc772..40cf7196c 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HaplotypeCallerGenotypingEngine.java @@ -50,11 +50,7 @@ import com.google.java.contract.Ensures; import com.google.java.contract.Requires; import htsjdk.variant.variantcontext.*; import org.broadinstitute.gatk.engine.refdata.RefMetaDataTracker; -import org.broadinstitute.gatk.genotyping.*; -import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypeLikelihoodsCalculationModel; -import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypingEngine; -import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypingOutputMode; -import org.broadinstitute.gatk.tools.walkers.genotyper.OutputMode; +import org.broadinstitute.gatk.tools.walkers.genotyper.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.GenomeLocParser; import org.broadinstitute.gatk.utils.Utils; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/PairHMMLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/PairHMMLikelihoodCalculationEngine.java index a0234a9e6..c263e27a6 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/PairHMMLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/PairHMMLikelihoodCalculationEngine.java @@ -51,9 +51,9 @@ import com.google.java.contract.Requires; import htsjdk.samtools.SAMUtils; import htsjdk.variant.variantcontext.Allele; import org.apache.log4j.Logger; -import org.broadinstitute.gatk.genotyping.AlleleList; -import org.broadinstitute.gatk.genotyping.IndexedAlleleList; -import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedAlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.QualityUtils; import org.broadinstitute.gatk.utils.exceptions.UserException; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java index aa7305bcf..e5ac47a13 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/RandomLikelihoodCalculationEngine.java @@ -48,9 +48,9 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; -import org.broadinstitute.gatk.genotyping.AlleleList; -import org.broadinstitute.gatk.genotyping.IndexedAlleleList; -import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedAlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java index ccc0c18b8..36593b60f 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadLikelihoodCalculationEngine.java @@ -46,7 +46,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; -import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java index 116b27009..a8adb94b8 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModel.java @@ -51,13 +51,12 @@ import htsjdk.variant.variantcontext.*; import htsjdk.variant.vcf.VCFHeaderLine; import htsjdk.variant.vcf.VCFSimpleHeaderLine; import org.broadinstitute.gatk.engine.contexts.AlignmentContext; -import org.broadinstitute.gatk.genotyping.*; +import org.broadinstitute.gatk.tools.walkers.genotyper.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.GenomeLocParser; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.QualityUtils; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; -import org.broadinstitute.gatk.utils.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; import org.broadinstitute.gatk.utils.haplotype.Haplotype; import org.broadinstitute.gatk.utils.locusiterator.LocusIteratorByState; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java index a798c760f..362e05359 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/indels/PairHMMIndelErrorModel.java @@ -49,9 +49,9 @@ package org.broadinstitute.gatk.tools.walkers.indels; import com.google.java.contract.Ensures; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.contexts.ReferenceContext; -import org.broadinstitute.gatk.genotyping.AlleleList; -import org.broadinstitute.gatk.genotyping.IndexedAlleleList; -import org.broadinstitute.gatk.genotyping.IndexedSampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedAlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.clipping.ReadClipper; import org.broadinstitute.gatk.utils.exceptions.UserException; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java index 9d18e9981..98b849891 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/GenotypeGVCFs.java @@ -49,9 +49,9 @@ package org.broadinstitute.gatk.tools.walkers.variantutils; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.arguments.GenotypeCalculationArgumentCollection; import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypingEngine; -import org.broadinstitute.gatk.genotyping.IndexedSampleList; -import org.broadinstitute.gatk.genotyping.SampleList; -import org.broadinstitute.gatk.genotyping.SampleListUtils; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleListUtils; import org.broadinstitute.gatk.utils.commandline.*; import org.broadinstitute.gatk.engine.CommandLineGATK; import org.broadinstitute.gatk.engine.arguments.DbsnpArgumentCollection; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java index e6cc614e6..8b13d2943 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/tools/walkers/variantutils/RegenotypeVariants.java @@ -47,9 +47,9 @@ package org.broadinstitute.gatk.tools.walkers.variantutils; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; -import org.broadinstitute.gatk.genotyping.IndexedSampleList; -import org.broadinstitute.gatk.genotyping.SampleList; -import org.broadinstitute.gatk.genotyping.SampleListUtils; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleListUtils; import org.broadinstitute.gatk.utils.commandline.ArgumentCollection; import org.broadinstitute.gatk.utils.commandline.Output; import org.broadinstitute.gatk.engine.CommandLineGATK; diff --git a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java index af93892a7..e72915341 100644 --- a/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java +++ b/protected/gatk-tools-protected/src/main/java/org/broadinstitute/gatk/utils/haplotype/HaplotypeLDCalculator.java @@ -48,9 +48,9 @@ package org.broadinstitute.gatk.utils.haplotype; import com.google.java.contract.Requires; import htsjdk.variant.variantcontext.VariantContext; -import org.broadinstitute.gatk.genotyping.AlleleList; -import org.broadinstitute.gatk.genotyping.AlleleListUtils; -import org.broadinstitute.gatk.genotyping.SampleListUtils; +import org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.AlleleListUtils; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleListUtils; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.PairHMMLikelihoodCalculationEngine; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUnitTester.java similarity index 98% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUnitTester.java index 2eefe64aa..fae233c8b 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUnitTester.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUnitTester.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; @@ -70,8 +70,8 @@ public class AlleleListUnitTester { * Test that the contents of an allele-list are the ones expected. *

*

- * This method perform various consistency check involving all the {@link org.broadinstitute.gatk.genotyping.AlleleList} interface methods. - * Therefore calling this method is equivalent to a thorough check of the {@link org.broadinstitute.gatk.genotyping.AlleleList} aspect of + * This method perform various consistency check involving all the {@link org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList} interface methods. + * Therefore calling this method is equivalent to a thorough check of the {@link org.broadinstitute.gatk.tools.walkers.genotyper.AlleleList} aspect of * the {@code actual} argument. *

* diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUtilsUnitTest.java similarity index 99% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUtilsUnitTest.java index a7e2dce88..917efa9f9 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/AlleleListUtilsUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUtilsUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; @@ -56,7 +56,7 @@ import org.testng.annotations.Test; import java.util.*; /** - * Test {@link org.broadinstitute.gatk.genotyping.AlleleListUtils}. + * Test {@link org.broadinstitute.gatk.tools.walkers.genotyper.AlleleListUtils}. * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeAlleleCountsUnitTest.java similarity index 99% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeAlleleCountsUnitTest.java index 8506b96e9..3e802f8e3 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeAlleleCountsUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeAlleleCountsUnitTest.java @@ -43,8 +43,9 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; +import org.broadinstitute.gatk.tools.walkers.genotyper.GenotypeAlleleCounts; import org.testng.Assert; import org.testng.annotations.DataProvider; import org.testng.annotations.Test; @@ -52,7 +53,7 @@ import org.testng.annotations.Test; import java.util.Arrays; /** - * Test {@link GenotypeAlleleCounts} + * Test {@link org.broadinstitute.gatk.tools.walkers.genotyper.GenotypeAlleleCounts} * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculatorUnitTest.java similarity index 98% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculatorUnitTest.java index 99f4c0422..2f280258b 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypeLikelihoodCalculatorUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypeLikelihoodCalculatorUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; @@ -56,7 +56,7 @@ import org.testng.annotations.Test; import java.util.Arrays; /** - * Tests {@link GenotypeLikelihoodCalculators} and {@link GenotypeLikelihoodCalculator}. + * Tests {@link org.broadinstitute.gatk.tools.walkers.genotyper.GenotypeLikelihoodCalculators} and {@link org.broadinstitute.gatk.tools.walkers.genotyper.GenotypeLikelihoodCalculator}. * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingDataUnitTest.java similarity index 97% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingDataUnitTest.java index 59e14e14c..96973ea1d 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/GenotypingDataUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/GenotypingDataUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; @@ -55,7 +55,7 @@ import java.util.ArrayList; import java.util.List; /** - * Test {@link org.broadinstitute.gatk.genotyping.InfiniteRandomMatingPopulationModel} + * Test {@link org.broadinstitute.gatk.tools.walkers.genotyper.InfiniteRandomMatingPopulationModel} */ public class GenotypingDataUnitTest { @@ -65,8 +65,8 @@ public class GenotypingDataUnitTest { final SampleList sampleList = likelihoods; final PloidyModel ploidyModel = new HeterogeneousPloidyModel(sampleList,ploidies); final GenotypingData data = new GenotypingData<>(ploidyModel,likelihoods); - Assert.assertTrue(AlleleListUtils.equals(data,likelihoods)); - Assert.assertTrue(SampleListUtils.equals(data,likelihoods)); + Assert.assertTrue(AlleleListUtils.equals(data, likelihoods)); + Assert.assertTrue(SampleListUtils.equals(data, likelihoods)); Assert.assertEquals(data.readLikelihoods(),likelihoods); Assert.assertEquals(data.ploidyModel(),ploidyModel); } diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/HeterogeneousPloidyModel.java similarity index 98% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/HeterogeneousPloidyModel.java index 865668093..afd6da5bf 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HeterogeneousPloidyModel.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/HeterogeneousPloidyModel.java @@ -43,9 +43,12 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; +import org.broadinstitute.gatk.tools.walkers.genotyper.PloidyModel; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; + /** * General heterogeneous ploidy model. * diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/HomogeneousPloidyModelUnitTest.java similarity index 98% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/HomogeneousPloidyModelUnitTest.java index 030ebf21b..16d29f677 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/HomogeneousPloidyModelUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/HomogeneousPloidyModelUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import org.testng.Assert; import org.testng.annotations.DataProvider; @@ -53,7 +53,7 @@ import java.util.ArrayList; import java.util.List; /** - * Tests {@link HomogeneousPloidyModel} + * Tests {@link org.broadinstitute.gatk.tools.walkers.genotyper.HomogeneousPloidyModel} * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedAlleleListUnitTest.java similarity index 97% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedAlleleListUnitTest.java index 61bd9f8a7..26b6d9bd7 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedAlleleListUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedAlleleListUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; @@ -52,10 +52,10 @@ import org.testng.annotations.Test; import java.util.*; -import static org.broadinstitute.gatk.genotyping.AlleleListUnitTester.assertAlleleList; +import static org.broadinstitute.gatk.tools.walkers.genotyper.AlleleListUnitTester.assertAlleleList; /** - * Tests {@link org.broadinstitute.gatk.genotyping.IndexedSampleList}. + * Tests {@link org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList}. * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedSampleListUnitTest.java similarity index 95% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedSampleListUnitTest.java index 138ec0e31..a6e1fa85b 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/IndexedSampleListUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedSampleListUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; @@ -52,10 +52,8 @@ import org.testng.annotations.Test; import java.util.*; -import static org.broadinstitute.gatk.genotyping.SampleListUnitTester.assertSampleList; - /** - * Tests {@link IndexedSampleList}. + * Tests {@link org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList}. * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ @@ -64,7 +62,7 @@ public class IndexedSampleListUnitTest { @Test public void testEmptyConstructor() { final IndexedSampleList subject = new IndexedSampleList(); - assertSampleList(subject, Collections.EMPTY_LIST); + SampleListUnitTester.assertSampleList(subject, Collections.EMPTY_LIST); } @Test(dataProvider="sampleCountMaxSampleIndexData") @@ -73,7 +71,7 @@ public class IndexedSampleListUnitTest { final LinkedHashSet nonRepeatedNames = new LinkedHashSet<>(Arrays.asList(sampleNames)); final IndexedSampleList subject = new IndexedSampleList(sampleNames); - assertSampleList(subject, Arrays.asList(nonRepeatedNames.toArray(new String[nonRepeatedNames.size()]))); + SampleListUnitTester.assertSampleList(subject, Arrays.asList(nonRepeatedNames.toArray(new String[nonRepeatedNames.size()]))); } @Test(dataProvider="sampleCountMaxSampleIndexData") @@ -83,7 +81,7 @@ public class IndexedSampleListUnitTest { final List sampleNameList = Arrays.asList(sampleNames); final LinkedHashSet nonRepeatedNames = new LinkedHashSet<>(Arrays.asList(sampleNames)); final IndexedSampleList subject = new IndexedSampleList(sampleNameList); - assertSampleList(subject, Arrays.asList(nonRepeatedNames.toArray(new String[nonRepeatedNames.size()]))); + SampleListUnitTester.assertSampleList(subject, Arrays.asList(nonRepeatedNames.toArray(new String[nonRepeatedNames.size()]))); } /** diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/InfiniteRandomMatingPopulationModelUnitTest.java similarity index 98% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/InfiniteRandomMatingPopulationModelUnitTest.java index af4b37b18..616027549 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/InfiniteRandomMatingPopulationModelUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/InfiniteRandomMatingPopulationModelUnitTest.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import htsjdk.variant.variantcontext.GenotypeLikelihoods; @@ -58,7 +58,7 @@ import java.util.List; import java.util.Random; /** - * Test {@link InfiniteRandomMatingPopulationModel} + * Test {@link org.broadinstitute.gatk.tools.walkers.genotyper.InfiniteRandomMatingPopulationModel} */ public class InfiniteRandomMatingPopulationModelUnitTest { diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/ReadLikelihoodsUnitTester.java similarity index 99% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/ReadLikelihoodsUnitTester.java index 08bfd9f60..a8efd574c 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/ReadLikelihoodsUnitTester.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/ReadLikelihoodsUnitTester.java @@ -43,7 +43,7 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.samtools.SAMFileHeader; diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUnitTester.java similarity index 96% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUnitTester.java index 9bca352d2..3bd8e9103 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUnitTester.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUnitTester.java @@ -43,8 +43,10 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.testng.Assert; import java.util.*; @@ -60,8 +62,8 @@ public class SampleListUnitTester { * Test that the contents of a sample-list are the ones expected. * *

- * This method perform various consistency check involving all the {@link SampleList} interface methods. - * Therefore calling this method is equivalent to a thorough check of the {@link SampleList} aspect of + * This method perform various consistency check involving all the {@link org.broadinstitute.gatk.tools.walkers.genotyper.SampleList} interface methods. + * Therefore calling this method is equivalent to a thorough check of the {@link org.broadinstitute.gatk.tools.walkers.genotyper.SampleList} aspect of * the {@code actual} argument. *

* diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUtilsUnitTest.java similarity index 96% rename from protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java rename to protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUtilsUnitTest.java index 71da45838..6e4bc08f6 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/genotyping/SampleListUtilsUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUtilsUnitTest.java @@ -43,9 +43,11 @@ * 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. * 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; -import htsjdk.variant.variantcontext.Allele; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleListUtils; import org.testng.Assert; import org.testng.annotations.BeforeClass; import org.testng.annotations.DataProvider; @@ -56,7 +58,7 @@ import java.util.Arrays; import java.util.List; /** - * Test {@link AlleleListUtils}. + * Test {@link org.broadinstitute.gatk.tools.walkers.genotyper.AlleleListUtils}. * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java index 335c355d2..77c30eb19 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/genotyper/UnifiedGenotyperEngineUnitTest.java @@ -56,8 +56,6 @@ import htsjdk.variant.variantcontext.VariantContext; import htsjdk.variant.variantcontext.VariantContextBuilder; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; import org.broadinstitute.gatk.engine.arguments.GATKArgumentCollection; -import org.broadinstitute.gatk.genotyping.SampleList; -import org.broadinstitute.gatk.genotyping.SampleListUtils; import org.broadinstitute.gatk.utils.BaseTest; import org.broadinstitute.gatk.utils.MathUtils; import org.broadinstitute.gatk.utils.Utils; diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java index d36b1af16..3463fea3d 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/HCLikelihoodCalculationEnginesBenchmark.java @@ -47,7 +47,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import com.google.caliper.Param; import com.google.caliper.SimpleBenchmark; -import org.broadinstitute.gatk.genotyping.SampleListUtils; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleListUtils; import org.broadinstitute.gatk.utils.pairhmm.ActiveRegionTestDataSet; import org.broadinstitute.gatk.utils.pairhmm.FastLoglessPairHMM; import org.broadinstitute.gatk.utils.pairhmm.PairHMM; diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java index cb946aafe..06b4f2a47 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReadThreadingLikelihoodCalculationEngineUnitTest.java @@ -47,7 +47,7 @@ package org.broadinstitute.gatk.tools.walkers.haplotypecaller; import htsjdk.variant.variantcontext.Allele; -import org.broadinstitute.gatk.genotyping.SampleListUtils; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleListUtils; import org.broadinstitute.gatk.tools.walkers.haplotypecaller.readthreading.HaplotypeGraph; import org.broadinstitute.gatk.utils.collections.Pair; import org.broadinstitute.gatk.utils.genotyper.PerReadAlleleLikelihoodMap; diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java index f268ce535..39f728945 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/tools/walkers/haplotypecaller/ReferenceConfidenceModelUnitTest.java @@ -51,7 +51,7 @@ import htsjdk.variant.variantcontext.Genotype; import htsjdk.variant.variantcontext.GenotypeLikelihoods; import htsjdk.variant.variantcontext.GenotypeType; import htsjdk.variant.variantcontext.VariantContext; -import org.broadinstitute.gatk.genotyping.*; +import org.broadinstitute.gatk.tools.walkers.genotyper.*; import org.broadinstitute.gatk.utils.*; import org.broadinstitute.gatk.utils.activeregion.ActiveRegion; import org.broadinstitute.gatk.utils.genotyper.ReadLikelihoods; diff --git a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java index 65fc43579..4c9d093cf 100644 --- a/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java +++ b/protected/gatk-tools-protected/src/test/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoodsUnitTest.java @@ -48,7 +48,7 @@ package org.broadinstitute.gatk.utils.genotyper; import htsjdk.samtools.SAMFileHeader; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.engine.GenomeAnalysisEngine; -import org.broadinstitute.gatk.genotyping.*; +import org.broadinstitute.gatk.tools.walkers.genotyper.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.GenomeLocParser; import org.broadinstitute.gatk.utils.MathUtils; @@ -616,7 +616,7 @@ public class ReadLikelihoodsUnitTest final Map> sampleToReads = ReadLikelihoodsUnitTester.sampleToReads(sampleList, readCounts); final ReadLikelihoods subject = new ReadLikelihoods<>(sampleList,alleleList,sampleToReads); - AlleleListUnitTester.assertAlleleList(subject,AlleleListUtils.asList(alleleList)); + AlleleListUnitTester.assertAlleleList(subject, AlleleListUtils.asList(alleleList)); SampleListUnitTester.assertSampleList(subject,SampleListUtils.asList(sampleList)); if (hasReference) { diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java index feb41712b..c090010c3 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/engine/GenomeAnalysisEngine.java @@ -55,8 +55,8 @@ import org.broadinstitute.gatk.engine.resourcemanagement.ThreadAllocation; import org.broadinstitute.gatk.engine.samples.SampleDB; import org.broadinstitute.gatk.engine.samples.SampleDBBuilder; import org.broadinstitute.gatk.engine.walkers.*; -import org.broadinstitute.gatk.genotyping.IndexedSampleList; -import org.broadinstitute.gatk.genotyping.SampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.IndexedSampleList; +import org.broadinstitute.gatk.tools.walkers.genotyper.SampleList; import org.broadinstitute.gatk.utils.*; import org.broadinstitute.gatk.utils.classloader.PluginManager; import org.broadinstitute.gatk.utils.commandline.*; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleList.java similarity index 96% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleList.java index 2f124ed91..c222529f8 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleList.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleList.java @@ -22,7 +22,7 @@ * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListPermutation.java similarity index 96% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListPermutation.java index a2477d053..6677e32d3 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListPermutation.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListPermutation.java @@ -23,7 +23,7 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.utils.collections.Permutation; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUtils.java similarity index 99% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUtils.java index dfdfe0945..f734b0990 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/AlleleListUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/AlleleListUtils.java @@ -23,7 +23,7 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedAlleleList.java similarity index 98% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedAlleleList.java index 14de94818..bf5fba8d7 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedAlleleList.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedAlleleList.java @@ -23,7 +23,7 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import htsjdk.variant.variantcontext.Allele; import org.broadinstitute.gatk.utils.collections.IndexedSet; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedSampleList.java similarity index 98% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedSampleList.java index 277404b96..b761cf3bb 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/IndexedSampleList.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/IndexedSampleList.java @@ -23,7 +23,7 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import org.broadinstitute.gatk.utils.collections.IndexedSet; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleList.java similarity index 96% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleList.java index 3ac8b5ef7..f9eff35a5 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleList.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleList.java @@ -24,7 +24,7 @@ */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; /** * A indexed set of samples. diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUtils.java similarity index 99% rename from public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java rename to public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUtils.java index f3787568a..90ecba79f 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/genotyping/SampleListUtils.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/tools/walkers/genotyper/SampleListUtils.java @@ -23,7 +23,7 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.gatk.genotyping; +package org.broadinstitute.gatk.tools.walkers.genotyper; import java.util.*; diff --git a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java index 8deb30f49..0cdcadc44 100644 --- a/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java +++ b/public/gatk-tools-public/src/main/java/org/broadinstitute/gatk/utils/genotyper/ReadLikelihoods.java @@ -30,7 +30,7 @@ import it.unimi.dsi.fastutil.ints.IntArrayList; import it.unimi.dsi.fastutil.objects.Object2IntMap; import it.unimi.dsi.fastutil.objects.Object2IntOpenHashMap; import org.broadinstitute.gatk.engine.downsampling.AlleleBiasedDownsamplingUtils; -import org.broadinstitute.gatk.genotyping.*; +import org.broadinstitute.gatk.tools.walkers.genotyper.*; import org.broadinstitute.gatk.utils.GenomeLoc; import org.broadinstitute.gatk.utils.Utils; import org.broadinstitute.gatk.utils.sam.GATKSAMRecord; @@ -41,6 +41,8 @@ import java.util.*; /** * Read-likelihoods container implementation based on integer indexed arrays. * + * @param
the type of the allele the likelihood makes reference to. + * * @author Valentin Ruano-Rubio <valentin@broadinstitute.org> */ public class ReadLikelihoods implements SampleList, AlleleList, Cloneable {