diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java index a007bfa0c..a45123b8b 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssembler.java @@ -47,6 +47,7 @@ package org.broadinstitute.sting.gatk.walkers.haplotypecaller; import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; import org.apache.commons.lang.ArrayUtils; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.Haplotype; @@ -96,7 +97,24 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { MIN_KMER = minKmer; } + /** + * Main entry point into the assembly engine. Build a set of deBruijn graphs out of the provided reference sequence and list of reads + * @param activeRegion ActiveRegion object holding the reads which are to be used during assembly + * @param refHaplotype reference haplotype object + * @param fullReferenceWithPadding byte array holding the reference sequence with padding + * @param refLoc GenomeLoc object corresponding to the reference sequence with padding + * @param PRUNE_FACTOR prune kmers from the graph if their weight is <= this value + * @param activeAllelesToGenotype the alleles to inject into the haplotypes during GGA mode + * @return a non-empty list of all the haplotypes that are produced during assembly + */ + @Ensures({"result.contains(refHaplotype)"}) public List runLocalAssembly( final ActiveRegion activeRegion, final Haplotype refHaplotype, final byte[] fullReferenceWithPadding, final GenomeLoc refLoc, final int PRUNE_FACTOR, final List activeAllelesToGenotype ) { + if( activeRegion == null ) { throw new IllegalArgumentException("Assembly engine cannot be used with a null ActiveRegion."); } + if( refHaplotype == null ) { throw new IllegalArgumentException("Reference haplotype cannot be null."); } + if( fullReferenceWithPadding.length != refLoc.size() ) { throw new IllegalArgumentException("Reference bases and reference loc must be the same size."); } + if( PRUNE_FACTOR < 0 ) { throw new IllegalArgumentException("Pruning factor cannot be negative"); } + + // set the pruning factor for this run of the assembly engine this.PRUNE_FACTOR = PRUNE_FACTOR; // create the graphs @@ -109,31 +127,35 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { mergeNodes( graph ); } + // print the graphs if the appropriate debug option has been turned on if( GRAPH_WRITER != null ) { printGraphs(); } - // find the best paths in the graphs + // find the best paths in the graphs and return them as haplotypes return findBestPaths( refHaplotype, fullReferenceWithPadding, refLoc, activeAllelesToGenotype, activeRegion.getExtendedLoc() ); } + @Requires({"reads != null", "refHaplotype != null"}) protected void createDeBruijnGraphs( final List reads, final Haplotype refHaplotype ) { graphs.clear(); final int maxKmer = refHaplotype.getBases().length; - // create the graph + // create the graph for each possible kmer for( int kmer = MIN_KMER; kmer <= maxKmer; kmer += 6 ) { - final DefaultDirectedGraph graph = new DefaultDirectedGraph(DeBruijnEdge.class); - if( createGraphFromSequences( graph, reads, kmer, refHaplotype, DEBUG ) ) { + final DefaultDirectedGraph graph = createGraphFromSequences( reads, kmer, refHaplotype, DEBUG ); + if( graph != null ) { // graphs that fail during creation ( for example, because there are cycles in the reference graph ) will show up here as a null graph object graphs.add(graph); } } } + @Requires({"graph != null"}) protected static void mergeNodes( final DefaultDirectedGraph graph ) { boolean foundNodesToMerge = true; while( foundNodesToMerge ) { foundNodesToMerge = false; + for( final DeBruijnEdge e : graph.edgeSet() ) { final DeBruijnVertex outgoingVertex = graph.getEdgeTarget(e); final DeBruijnVertex incomingVertex = graph.getEdgeSource(e); @@ -211,25 +233,26 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { } } - private static boolean createGraphFromSequences( final DefaultDirectedGraph graph, final Collection reads, final int KMER_LENGTH, final Haplotype refHaplotype, final boolean DEBUG ) { + @Requires({"reads != null", "KMER_LENGTH > 0", "refHaplotype != null"}) + protected static DefaultDirectedGraph createGraphFromSequences( final List reads, final int KMER_LENGTH, final Haplotype refHaplotype, final boolean DEBUG ) { + + final DefaultDirectedGraph graph = new DefaultDirectedGraph(DeBruijnEdge.class); + + // First pull kmers from the reference haplotype and add them to the graph final byte[] refSequence = refHaplotype.getBases(); if( refSequence.length >= KMER_LENGTH + KMER_OVERLAP ) { final int kmersInSequence = refSequence.length - KMER_LENGTH + 1; - for (int i = 0; i < kmersInSequence - 1; i++) { - // get the kmers - final byte[] kmer1 = new byte[KMER_LENGTH]; - System.arraycopy(refSequence, i, kmer1, 0, KMER_LENGTH); - final byte[] kmer2 = new byte[KMER_LENGTH]; - System.arraycopy(refSequence, i+1, kmer2, 0, KMER_LENGTH); - if( !addKmersToGraph(graph, kmer1, kmer2, true) ) { + for( int iii = 0; iii < kmersInSequence - 1; iii++ ) { + if( !addKmersToGraph(graph, Arrays.copyOfRange(refSequence, iii, iii + KMER_LENGTH), Arrays.copyOfRange(refSequence, iii + 1, iii + 1 + KMER_LENGTH), true) ) { if( DEBUG ) { System.out.println("Cycle detected in reference graph for kmer = " + KMER_LENGTH + " ...skipping"); } - return false; + return null; } } } + // Next pull kmers out of every read and throw them on the graph for( final GATKSAMRecord read : reads ) { final byte[] sequence = read.getReadBases(); final byte[] qualities = read.getBaseQualities(); @@ -245,31 +268,28 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { break; } } - int countNumber = 1; - if (read.isReducedRead()) { - // compute mean number of reduced read counts in current kmer span - final byte[] counts = Arrays.copyOfRange(reducedReadCounts,iii,iii+KMER_LENGTH+1); - // precise rounding can make a difference with low consensus counts - countNumber = MathUtils.arrayMax(counts); - // countNumber = (int)Math.round((double)MathUtils.sum(counts)/counts.length); - } - if( !badKmer ) { - // get the kmers - final byte[] kmer1 = new byte[KMER_LENGTH]; - System.arraycopy(sequence, iii, kmer1, 0, KMER_LENGTH); - final byte[] kmer2 = new byte[KMER_LENGTH]; - System.arraycopy(sequence, iii+1, kmer2, 0, KMER_LENGTH); + int countNumber = 1; + if( read.isReducedRead() ) { + // compute mean number of reduced read counts in current kmer span + // precise rounding can make a difference with low consensus counts + countNumber = MathUtils.arrayMax(Arrays.copyOfRange(reducedReadCounts, iii, iii + KMER_LENGTH)); + } - for (int k=0; k < countNumber; k++) + final byte[] kmer1 = Arrays.copyOfRange(sequence, iii, iii + KMER_LENGTH); + final byte[] kmer2 = Arrays.copyOfRange(sequence, iii + 1, iii + 1 + KMER_LENGTH); + + for( int kkk=0; kkk < countNumber; kkk++ ) { addKmersToGraph(graph, kmer1, kmer2, false); + } } } } } - return true; + return graph; } + @Requires({"graph != null", "kmer1.length > 0", "kmer2.length > 0"}) protected static boolean addKmersToGraph( final DefaultDirectedGraph graph, final byte[] kmer1, final byte[] kmer2, final boolean isRef ) { final int numVertexBefore = graph.vertexSet().size(); @@ -378,6 +398,7 @@ public class SimpleDeBruijnAssembler extends LocalAssemblyEngine { return returnHaplotypes; } + // this function is slated for removal when SWing is removed private boolean addHaplotype( final Haplotype haplotype, final byte[] ref, final List haplotypeList, final int activeRegionStart, final int activeRegionStop, final boolean FORCE_INCLUSION_FOR_GGA_MODE ) { if( haplotype == null ) { return false; } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssemblerUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssemblerUnitTest.java index 24915d34b..2489f5f0f 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssemblerUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/SimpleDeBruijnAssemblerUnitTest.java @@ -56,6 +56,7 @@ import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.walkers.genotyper.ArtificialReadPileupTestProvider; import org.broadinstitute.sting.utils.Haplotype; +import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.jgrapht.graph.DefaultDirectedGraph; import org.testng.Assert; import org.testng.annotations.DataProvider; @@ -298,4 +299,15 @@ public class SimpleDeBruijnAssemblerUnitTest extends BaseTest { } return true; } + + @Test(enabled = true) + public void testReferenceCycleGraph() { + String refCycle = "ATCGAGGAGAGCGCCCCGAGATATATATATATATATTTGCGAGCGCGAGCGTTTTAAAAATTTTAGACGGAGAGATATATATATATGGGAGAGGGGATATATATATATCCCCCC"; + String noCycle = "ATCGAGGAGAGCGCCCCGAGATATTATTTGCGAGCGCGAGCGTTTTAAAAATTTTAGACGGAGAGATGGGAGAGGGGATATATAATATCCCCCC"; + final DefaultDirectedGraph g1 = SimpleDeBruijnAssembler.createGraphFromSequences(new ArrayList(), 10, new Haplotype(refCycle.getBytes(), true), false); + final DefaultDirectedGraph g2 = SimpleDeBruijnAssembler.createGraphFromSequences(new ArrayList(), 10, new Haplotype(noCycle.getBytes(), true), false); + + Assert.assertTrue(g1 == null, "Reference cycle graph should return null during creation."); + Assert.assertTrue(g2 != null, "Reference non-cycle graph should not return null during creation."); + } }