Merge branch 'master' of ssh://gsa2.broadinstitute.org/humgen/gsa-scr1/gsa-engineering/git/unstable into testing

This commit is contained in:
Ami Levy Moonshine 2012-08-09 16:48:22 -04:00
commit 68fb04b8f7
383 changed files with 15161 additions and 9338 deletions

View File

@ -646,7 +646,7 @@
<jar jarfile="${dist.dir}/vcf.jar"> <jar jarfile="${dist.dir}/vcf.jar">
<fileset dir="${java.classes}"> <fileset dir="${java.classes}">
<include name="org/broadinstitute/sting/utils/codecs/vcf/**/*.class"/> <include name="org/broadinstitute/sting/utils/codecs/vcf/**/*.class"/>
<!-- <include name="org/broadinstitute/sting/utils/codecs/bcf2/**/*.class"/> --> <include name="org/broadinstitute/sting/utils/codecs/bcf2/**/*.class"/>
<include name="org/broadinstitute/sting/utils/variantcontext/**/*.class"/> <include name="org/broadinstitute/sting/utils/variantcontext/**/*.class"/>
<include name="org/broadinstitute/sting/utils/exceptions/**"/> <include name="org/broadinstitute/sting/utils/exceptions/**"/>
<include name="org/broadinstitute/sting/utils/help/DocumentedGATKFeature.class"/> <include name="org/broadinstitute/sting/utils/help/DocumentedGATKFeature.class"/>
@ -679,20 +679,6 @@
<fileset dir="${java.classes}" includes="**/alignment/**/*.class" /> <fileset dir="${java.classes}" includes="**/alignment/**/*.class" />
</jar> </jar>
<jar jarfile="${dist.dir}/AnalyzeCovariates.jar" whenmanifestonly="skip">
<fileset dir="${java.classes}">
<include name="**/analyzecovariates/**/*.class" />
<include name="**/gatk/walkers/recalibration/*.class" />
</fileset>
<fileset dir="${R.script.staging.dir}">
<include name="**/analyzecovariates/**/*.R"/>
<include name="**/gatk/walkers/recalibration/**/*.R"/>
</fileset>
<manifest>
<attribute name="Main-Class" value="org.broadinstitute.sting.analyzecovariates.AnalyzeCovariates" />
</manifest>
</jar>
<subant target="dist" genericantfile="build.xml"> <subant target="dist" genericantfile="build.xml">
<property name="build.dir" value="${external.build.dir}" /> <property name="build.dir" value="${external.build.dir}" />
<property name="dist.dir" value="${external.dist.dir}" /> <property name="dist.dir" value="${external.dist.dir}" />
@ -750,12 +736,6 @@
<attribute name="Class-Path" value="${jar.classpath}"/> <attribute name="Class-Path" value="${jar.classpath}"/>
</manifest> </manifest>
</jar> </jar>
<jar jarfile="${dist.dir}/AnalyzeCovariates.jar" update="true" whenmanifestonly="skip">
<manifest>
<attribute name="Class-Path" value="${jar.classpath}" />
</manifest>
</jar>
</target> </target>
<target name="queue.manifests" depends="queue.jar, init.manifests" if="include.scala"> <target name="queue.manifests" depends="queue.jar, init.manifests" if="include.scala">
@ -1249,11 +1229,7 @@
</target> </target>
<target name="committests"> <target name="committests" depends="unittest,integrationtest,pipelinetest" />
<antcall target="unittest" inheritAll="false"/>
<antcall target="integrationtest" inheritAll="false"/>
<antcall target="pipelinetest" inheritAll="false"/>
</target>
<!-- Order of the dependencies is significant in the *.release.tests targets --> <!-- Order of the dependencies is significant in the *.release.tests targets -->
<target name="gatkfull.binary.release.tests" depends="init.usecontracts,package.gatk.full,init.testgatkjar,unittest,integrationtest" /> <target name="gatkfull.binary.release.tests" depends="init.usecontracts,package.gatk.full,init.testgatkjar,unittest,integrationtest" />

132
ivy.xml
View File

@ -23,86 +23,90 @@
--> -->
<ivy-module version="1.0"> <ivy-module version="1.0">
<info organisation="org.broadinstitute" module="Sting"/> <info organisation="org.broadinstitute" module="Sting"/>
<configurations defaultconfmapping="test->default"> <configurations defaultconfmapping="test->default">
<conf name="default" description="the core dependencies for the GATK"/> <conf name="default" description="the core dependencies for the GATK"/>
<conf name="test" extends="default" description="external dependencies used for testing and metrics" /> <conf name="test" extends="default" description="external dependencies used for testing and metrics"/>
<conf name="scala" extends="default" description="the dependencies for scala"/> <conf name="scala" extends="default" description="the dependencies for scala"/>
<conf name="queue" extends="scala" description="the dependencies for Queue"/> <conf name="queue" extends="scala" description="the dependencies for Queue"/>
</configurations> </configurations>
<dependencies defaultconf="default"> <dependencies defaultconf="default">
<dependency org="net.sf" name="sam" rev="latest.integration"/> <dependency org="net.sf" name="sam" rev="latest.integration"/>
<dependency org="net.sf" name="picard" rev="latest.integration"/> <dependency org="net.sf" name="picard" rev="latest.integration"/>
<dependency org="edu.mit.broad" name="picard-private-parts" rev="latest.integration"/> <dependency org="edu.mit.broad" name="picard-private-parts" rev="latest.integration"/>
<!-- Tribble --> <!-- Tribble -->
<dependency org="org.broad" name="tribble" rev="latest.integration"/> <dependency org="org.broad" name="tribble" rev="latest.integration"/>
<dependency org="log4j" name="log4j" rev="1.2.15"/> <dependency org="log4j" name="log4j" rev="1.2.15"/>
<dependency org="javax.mail" name="mail" rev="1.4.4"/> <dependency org="javax.mail" name="mail" rev="1.4.4"/>
<dependency org="colt" name="colt" rev="1.2.0"/> <dependency org="colt" name="colt" rev="1.2.0"/>
<!-- <dependency org="jboss" name="javassist" rev="3.7.ga"/> --> <!-- <dependency org="jboss" name="javassist" rev="3.7.ga"/> -->
<dependency org="org.simpleframework" name="simple-xml" rev="2.0.4"/> <dependency org="org.simpleframework" name="simple-xml" rev="2.0.4"/>
<dependency org="org.apache.bcel" name="bcel" rev="5.2"/> <dependency org="org.apache.bcel" name="bcel" rev="5.2"/>
<!-- Dependencies for reflections mvn repository --> <!-- Dependencies for reflections mvn repository -->
<dependency org="org.reflections" name="reflections" rev="0.9.5-RC2"/> <dependency org="org.reflections" name="reflections" rev="0.9.5-RC2"/>
<!-- Matrix package from math.nist.gov --> <!-- Matrix package from math.nist.gov -->
<dependency org="gov.nist" name="Jama" rev="1.0.2"/> <dependency org="gov.nist" name="Jama" rev="1.0.2"/>
<!-- Dependencies for the graph aligner --> <!-- Dependencies for the graph aligner -->
<dependency org="org.jgrapht" name="jgrapht-jdk1.5" rev="0.7.3"/> <dependency org="net.sf.jgrapht" name="jgrapht" rev="0.8.3"/>
<!-- Dependencies for the html walker documention --> <!-- Dependencies for the html walker documention -->
<dependency org="org.freemarker" name="freemarker" rev="2.3.18"/> <dependency org="org.freemarker" name="freemarker" rev="2.3.18"/>
<!-- Commons Dependencies --> <!-- Commons Dependencies -->
<dependency org="org.apache.commons" name="commons-email" rev="1.2"/> <dependency org="org.apache.commons" name="commons-email" rev="1.2"/>
<dependency org="org.apache.commons" name="commons-jexl" rev="2.1.1"/> <dependency org="org.apache.commons" name="commons-jexl" rev="2.1.1"/>
<dependency org="commons-lang" name="commons-lang" rev="2.5"/> <dependency org="commons-lang" name="commons-lang" rev="2.5"/>
<dependency org="commons-logging" name="commons-logging" rev="1.1.1"/> <dependency org="commons-logging" name="commons-logging" rev="1.1.1"/>
<dependency org="commons-io" name="commons-io" rev="2.1"/> <dependency org="commons-io" name="commons-io" rev="2.1"/>
<dependency org="org.apache.commons" name="commons-math" rev="2.2" /> <dependency org="org.apache.commons" name="commons-math" rev="2.2"/>
<!-- Lucene core utilities --> <!-- Lucene core utilities -->
<!-- <dependency org="org.apache.lucene" name="lucene-core" rev="3.0.3"/> --> <!-- <dependency org="org.apache.lucene" name="lucene-core" rev="3.0.3"/> -->
<!-- Dependencies for LSF, DRMAA, and other C libraries --> <!-- Dependencies for LSF, DRMAA, and other C libraries -->
<dependency org="net.java.dev.jna" name="jna" rev="3.2.7"/> <dependency org="net.java.dev.jna" name="jna" rev="3.2.7"/>
<!-- Dependencies for amazon.com S3 support --> <!-- Dependencies for amazon.com S3 support -->
<dependency org="net.java.dev.jets3t" name="jets3t" rev="0.8.1"/> <dependency org="net.java.dev.jets3t" name="jets3t" rev="0.8.1"/>
<!-- Dependencies for GridEngine --> <!-- Dependencies for GridEngine -->
<dependency org="net.sf.gridscheduler" name="drmaa" rev="latest.integration"/> <dependency org="net.sf.gridscheduler" name="drmaa" rev="latest.integration"/>
<!-- Scala dependancies --> <!-- Scala dependancies -->
<dependency org="org.scala-lang" name="scala-compiler" rev="2.8.1"/> <dependency org="org.scala-lang" name="scala-compiler" rev="2.8.1"/>
<dependency org="org.scala-lang" name="scala-library" rev="2.8.1"/> <dependency org="org.scala-lang" name="scala-library" rev="2.8.1"/>
<!-- testing and evaluation dependencies --> <!-- testing and evaluation dependencies -->
<dependency org="org.testng" name="testng" rev="5.14.1" conf="test" /> <dependency org="org.testng" name="testng" rev="5.14.1" conf="test"/>
<dependency org="org.uncommons" name="reportng" rev="1.1.2" conf="test" /> <dependency org="org.uncommons" name="reportng" rev="1.1.2" conf="test"/>
<dependency org="com.google.code.caliper" name="caliper" rev="1.0-SNAPSHOT" conf="test" /> <dependency org="com.google.code.caliper" name="caliper" rev="1.0-SNAPSHOT" conf="test"/>
<!-- Contracts for Java and dependencies --> <!-- Contracts for Java and dependencies -->
<dependency org="com.google.code.cofoja" name="cofoja" rev="1.0-20110609" /> <dependency org="com.google.code.cofoja" name="cofoja" rev="1.0-r139"/>
<dependency org="asm" name="asm-all" rev="3.3.1" /> <dependency org="asm" name="asm-all" rev="3.3.1"/>
<!-- POI, for reading pipeline files --> <!-- POI, for reading pipeline files -->
<dependency org="org.apache.poi" name="poi" rev="3.8-beta3" /> <dependency org="org.apache.poi" name="poi" rev="3.8-beta3"/>
<dependency org="org.apache.poi" name="poi-ooxml" rev="3.8-beta3" /> <dependency org="org.apache.poi" name="poi-ooxml" rev="3.8-beta3"/>
<!-- snpEff annotator for pipelines --> <!-- snpEff annotator for pipelines -->
<dependency org="net.sf.snpeff" name="snpeff" rev="2.0.5" /> <dependency org="net.sf.snpeff" name="snpeff" rev="2.0.5"/>
<!-- MongoDB for the GXDB project --> <!-- MongoDB for the GXDB project -->
<dependency org="org.mongodb" name="mongo-java-driver" rev="2.7.3"/> <dependency org="org.mongodb" name="mongo-java-driver" rev="2.7.3"/>
<!-- Exclude dependencies on sun libraries where the downloads aren't available but included in the jvm. --> <!-- GSON and HTTP for talking to the REST API on Vanilla Forums -->
<exclude org="javax.servlet" /> <dependency org="com.google.code.gson" name="gson" rev="2.2.2"/>
<exclude org="javax.jms" /> <dependency org="org.apache.httpcomponents" name="httpclient" rev="4.1.1"/>
<exclude org="com.sun.*" />
</dependencies> <!-- Exclude dependencies on sun libraries where the downloads aren't available but included in the jvm. -->
<exclude org="javax.servlet"/>
<exclude org="javax.jms"/>
<exclude org="com.sun.*"/>
</dependencies>
</ivy-module> </ivy-module>

Binary file not shown.

View File

@ -1,7 +1,4 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -28,34 +25,10 @@ import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
* OTHER DEALINGS IN THE SOFTWARE. * OTHER DEALINGS IN THE SOFTWARE.
*/ */
/** import org.broadinstitute.sting.utils.classloader.ProtectedPackageSource;
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Oct 30, 2009
*
* The Read Group covariate.
*/
public class ReadGroupCovariate implements RequiredCovariate { public class DummyProtectedClass implements ProtectedPackageSource {
// Initialize any member variables using the command-line arguments passed to the walkers // THIS CLASS IS USED JUST SO THAT WE CAN TEST WHETHER WE ARE USING THE LITE OR FULL VERSION OF THE GATK
@Override // **** DO NOT REMOVE! ****
public void initialize(final RecalibrationArgumentCollection RAC) {
}
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
final String readGroupId = read.getReadGroup().getReadGroupId();
for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = readGroupId;
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return str;
}
} }

View File

@ -0,0 +1,103 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
/*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
import org.broadinstitute.sting.utils.recalibration.covariates.Covariate;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.classloader.ProtectedPackageSource;
import org.broadinstitute.sting.utils.collections.NestedIntegerArray;
import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.recalibration.EventType;
import org.broadinstitute.sting.utils.recalibration.ReadCovariates;
import org.broadinstitute.sting.utils.recalibration.RecalDatum;
import org.broadinstitute.sting.utils.recalibration.RecalibrationTables;
public class AdvancedRecalibrationEngine extends StandardRecalibrationEngine implements ProtectedPackageSource {
// optimizations: don't reallocate an array each time
private byte[] tempQualArray;
private boolean[] tempErrorArray;
public void initialize(final Covariate[] covariates, final RecalibrationTables recalibrationTables) {
super.initialize(covariates, recalibrationTables);
tempQualArray = new byte[EventType.values().length];
tempErrorArray = new boolean[EventType.values().length];
}
/**
* Loop through the list of requested covariates and pick out the value from the read, offset, and reference
* Using the list of covariate values as a key, pick out the RecalDatum and increment,
* adding one to the number of observations and potentially one to the number of mismatches for all three
* categories (mismatches, insertions and deletions).
*
* @param pileupElement The pileup element to update
* @param refBase The reference base at this locus
*/
public synchronized void updateDataForPileupElement(final PileupElement pileupElement, final byte refBase) {
final int offset = pileupElement.getOffset();
final ReadCovariates readCovariates = covariateKeySetFrom(pileupElement.getRead());
tempQualArray[EventType.BASE_SUBSTITUTION.index] = pileupElement.getQual();
tempErrorArray[EventType.BASE_SUBSTITUTION.index] = !BaseUtils.basesAreEqual(pileupElement.getBase(), refBase);
tempQualArray[EventType.BASE_INSERTION.index] = pileupElement.getBaseInsertionQual();
tempErrorArray[EventType.BASE_INSERTION.index] = (pileupElement.getRead().getReadNegativeStrandFlag()) ? pileupElement.isAfterInsertion() : pileupElement.isBeforeInsertion();
tempQualArray[EventType.BASE_DELETION.index] = pileupElement.getBaseDeletionQual();
tempErrorArray[EventType.BASE_DELETION.index] = (pileupElement.getRead().getReadNegativeStrandFlag()) ? pileupElement.isAfterDeletedBase() : pileupElement.isBeforeDeletedBase();
for (final EventType eventType : EventType.values()) {
final int[] keys = readCovariates.getKeySet(offset, eventType);
final int eventIndex = eventType.index;
final byte qual = tempQualArray[eventIndex];
final boolean isError = tempErrorArray[eventIndex];
final NestedIntegerArray<RecalDatum> rgRecalTable = recalibrationTables.getTable(RecalibrationTables.TableType.READ_GROUP_TABLE);
final RecalDatum rgPreviousDatum = rgRecalTable.get(keys[0], eventIndex);
final RecalDatum rgThisDatum = createDatumObject(qual, isError);
if (rgPreviousDatum == null) // key doesn't exist yet in the map so make a new bucket and add it
rgRecalTable.put(rgThisDatum, keys[0], eventIndex);
else
rgPreviousDatum.combine(rgThisDatum);
final NestedIntegerArray<RecalDatum> qualRecalTable = recalibrationTables.getTable(RecalibrationTables.TableType.QUALITY_SCORE_TABLE);
final RecalDatum qualPreviousDatum = qualRecalTable.get(keys[0], keys[1], eventIndex);
if (qualPreviousDatum == null)
qualRecalTable.put(createDatumObject(qual, isError), keys[0], keys[1], eventIndex);
else
qualPreviousDatum.increment(isError);
for (int i = 2; i < covariates.length; i++) {
if (keys[i] < 0)
continue;
final NestedIntegerArray<RecalDatum> covRecalTable = recalibrationTables.getTable(i);
final RecalDatum covPreviousDatum = covRecalTable.get(keys[0], keys[1], keys[i], eventIndex);
if (covPreviousDatum == null)
covRecalTable.put(createDatumObject(qual, isError), keys[0], keys[1], keys[i], eventIndex);
else
covPreviousDatum.increment(isError);
}
}
}
}

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.compression.reducereads; package org.broadinstitute.sting.gatk.walkers.compression.reducereads;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.filters.DuplicateReadFilter; import org.broadinstitute.sting.gatk.filters.DuplicateReadFilter;
@ -11,6 +12,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.LocusWalker; import org.broadinstitute.sting.gatk.walkers.LocusWalker;
import org.broadinstitute.sting.gatk.walkers.ReadFilters; import org.broadinstitute.sting.gatk.walkers.ReadFilters;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import java.util.HashMap; import java.util.HashMap;
import java.util.Map; import java.util.Map;
@ -39,8 +41,9 @@ import java.util.Map;
* @since 10/30/11 * @since 10/30/11
*/ */
@DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
@ReadFilters({UnmappedReadFilter.class,NotPrimaryAlignmentFilter.class,DuplicateReadFilter.class,FailsVendorQualityCheckFilter.class}) @ReadFilters({UnmappedReadFilter.class,NotPrimaryAlignmentFilter.class,DuplicateReadFilter.class,FailsVendorQualityCheckFilter.class})
public class CompareBAMWalker extends LocusWalker<Map<CompareBAMWalker.TestName, Boolean>, CompareBAMWalker.TestResults> { public class CompareBAM extends LocusWalker<Map<CompareBAM.TestName, Boolean>, CompareBAM.TestResults> {
@Argument(required = true, shortName = "rr", fullName = "reduced_readgroup", doc = "The read group ID corresponding to the compressed BAM being tested") public String reducedReadGroupID; @Argument(required = true, shortName = "rr", fullName = "reduced_readgroup", doc = "The read group ID corresponding to the compressed BAM being tested") public String reducedReadGroupID;
@Argument(required = false, shortName = "teq", fullName = "test_equal_bases", doc = "Test if the bases marked as '=' are indeed ref bases.") public boolean TEST_EQUAL_BASES = false; @Argument(required = false, shortName = "teq", fullName = "test_equal_bases", doc = "Test if the bases marked as '=' are indeed ref bases.") public boolean TEST_EQUAL_BASES = false;
@Argument(required = false, shortName = "tbc", fullName = "test_base_counts", doc = "Test if the base counts tag in consensus reads are accurate.") public boolean TEST_BASE_COUNTS = false; @Argument(required = false, shortName = "tbc", fullName = "test_base_counts", doc = "Test if the base counts tag in consensus reads are accurate.") public boolean TEST_BASE_COUNTS = false;

View File

@ -53,7 +53,7 @@ public class MultiSampleCompressor implements Compressor {
final double minAltProportionToTriggerVariant, final double minAltProportionToTriggerVariant,
final double minIndelProportionToTriggerVariant, final double minIndelProportionToTriggerVariant,
final int minBaseQual, final int minBaseQual,
final ReduceReadsWalker.DownsampleStrategy downsampleStrategy) { final ReduceReads.DownsampleStrategy downsampleStrategy) {
for ( String name : SampleUtils.getSAMFileSamples(header) ) { for ( String name : SampleUtils.getSAMFileSamples(header) ) {
compressorsPerSample.put(name, compressorsPerSample.put(name,
new SingleSampleCompressor(name, contextSize, downsampleCoverage, new SingleSampleCompressor(name, contextSize, downsampleCoverage,

View File

@ -25,13 +25,11 @@
package org.broadinstitute.sting.gatk.walkers.compression.reducereads; package org.broadinstitute.sting.gatk.walkers.compression.reducereads;
import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement;
import net.sf.samtools.CigarOperator;
import net.sf.samtools.util.SequenceUtil; import net.sf.samtools.util.SequenceUtil;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Hidden; import org.broadinstitute.sting.commandline.Hidden;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.filters.*; import org.broadinstitute.sting.gatk.filters.*;
@ -46,6 +44,7 @@ import org.broadinstitute.sting.utils.GenomeLocComparator;
import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.clipping.ReadClipper; import org.broadinstitute.sting.utils.clipping.ReadClipper;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils; import org.broadinstitute.sting.utils.sam.ReadUtils;
@ -81,9 +80,10 @@ import java.util.*;
* </pre> * </pre>
*/ */
@DocumentedGATKFeature( groupName = "BAM Processing and Analysis Tools", extraDocs = {CommandLineGATK.class} )
@PartitionBy(PartitionType.INTERVAL) @PartitionBy(PartitionType.INTERVAL)
@ReadFilters({UnmappedReadFilter.class, NotPrimaryAlignmentFilter.class, DuplicateReadFilter.class, FailsVendorQualityCheckFilter.class, BadCigarFilter.class}) @ReadFilters({UnmappedReadFilter.class, NotPrimaryAlignmentFilter.class, DuplicateReadFilter.class, FailsVendorQualityCheckFilter.class, BadCigarFilter.class})
public class ReduceReadsWalker extends ReadWalker<LinkedList<GATKSAMRecord>, ReduceReadsStash> { public class ReduceReads extends ReadWalker<LinkedList<GATKSAMRecord>, ReduceReadsStash> {
@Output @Output
protected StingSAMFileWriter out; protected StingSAMFileWriter out;
@ -180,7 +180,7 @@ public class ReduceReadsWalker extends ReadWalker<LinkedList<GATKSAMRecord>, Red
* A value of 0 turns downsampling off. * A value of 0 turns downsampling off.
*/ */
@Argument(fullName = "downsample_coverage", shortName = "ds", doc = "", required = false) @Argument(fullName = "downsample_coverage", shortName = "ds", doc = "", required = false)
protected int downsampleCoverage = 0; protected int downsampleCoverage = 250;
@Hidden @Hidden
@Argument(fullName = "", shortName = "dl", doc = "", required = false) @Argument(fullName = "", shortName = "dl", doc = "", required = false)
@ -251,7 +251,7 @@ public class ReduceReadsWalker extends ReadWalker<LinkedList<GATKSAMRecord>, Red
LinkedList<GATKSAMRecord> mappedReads; LinkedList<GATKSAMRecord> mappedReads;
totalReads++; totalReads++;
if (!debugRead.isEmpty() && read.getReadName().contains(debugRead)) if (!debugRead.isEmpty() && read.getReadName().contains(debugRead))
System.out.println("Found debug read!"); System.out.println("Found debug read!");
if (debugLevel == 1) if (debugLevel == 1)
System.out.printf("\nOriginal: %s %s %d %d\n", read, read.getCigar(), read.getAlignmentStart(), read.getAlignmentEnd()); System.out.printf("\nOriginal: %s %s %d %d\n", read, read.getCigar(), read.getAlignmentStart(), read.getAlignmentEnd());
@ -261,6 +261,13 @@ public class ReduceReadsWalker extends ReadWalker<LinkedList<GATKSAMRecord>, Red
read.setTemporaryAttribute(GATKSAMRecord.REDUCED_READ_ORIGINAL_ALIGNMENT_START_SHIFT, read.getAlignmentStart()); read.setTemporaryAttribute(GATKSAMRecord.REDUCED_READ_ORIGINAL_ALIGNMENT_START_SHIFT, read.getAlignmentStart());
read.setTemporaryAttribute(GATKSAMRecord.REDUCED_READ_ORIGINAL_ALIGNMENT_END_SHIFT, read.getAlignmentEnd()); read.setTemporaryAttribute(GATKSAMRecord.REDUCED_READ_ORIGINAL_ALIGNMENT_END_SHIFT, read.getAlignmentEnd());
// Check if the read goes beyond the boundaries of the chromosome, and hard clip those boundaries.
int chromosomeLength = ref.getGenomeLocParser().getContigInfo(read.getReferenceName()).getSequenceLength();
if (read.getSoftStart() < 0)
read = ReadClipper.hardClipByReadCoordinates(read, 0, -read.getSoftStart() - 1);
if (read.getSoftEnd() > chromosomeLength)
read = ReadClipper.hardClipByReadCoordinates(read, chromosomeLength - read.getSoftStart() + 1, read.getReadLength() - 1);
if (!DONT_SIMPLIFY_READS) if (!DONT_SIMPLIFY_READS)
read.simplify(); // Clear all unnecessary attributes read.simplify(); // Clear all unnecessary attributes
if (!DONT_CLIP_ADAPTOR_SEQUENCES) if (!DONT_CLIP_ADAPTOR_SEQUENCES)
@ -532,81 +539,12 @@ public class ReduceReadsWalker extends ReadWalker<LinkedList<GATKSAMRecord>, Red
if (debugLevel == 1) if (debugLevel == 1)
System.out.println("BAM: " + read.getCigar() + " " + read.getAlignmentStart() + " " + read.getAlignmentEnd()); System.out.println("BAM: " + read.getCigar() + " " + read.getAlignmentStart() + " " + read.getAlignmentEnd());
// if (!DONT_USE_SOFTCLIPPED_BASES)
// reSoftClipBases(read);
if (!DONT_COMPRESS_READ_NAMES) if (!DONT_COMPRESS_READ_NAMES)
compressReadName(read); compressReadName(read);
out.addAlignment(read); out.addAlignment(read);
} }
private void reSoftClipBases(GATKSAMRecord read) {
Integer left = (Integer) read.getTemporaryAttribute("SL");
Integer right = (Integer) read.getTemporaryAttribute("SR");
if (left != null || right != null) {
Cigar newCigar = new Cigar();
for (CigarElement element : read.getCigar().getCigarElements()) {
newCigar.add(new CigarElement(element.getLength(), element.getOperator()));
}
if (left != null) {
newCigar = updateFirstSoftClipCigarElement(left, newCigar);
read.setAlignmentStart(read.getAlignmentStart() + left);
}
if (right != null) {
Cigar invertedCigar = invertCigar(newCigar);
newCigar = invertCigar(updateFirstSoftClipCigarElement(right, invertedCigar));
}
read.setCigar(newCigar);
}
}
/**
* Facility routine to revert the first element of a Cigar string (skipping hard clips) into a soft-clip.
* To be used on both ends if provided a flipped Cigar
*
* @param softClipSize the length of the soft clipped element to add
* @param originalCigar the original Cigar string
* @return a new Cigar object with the soft clips added
*/
private Cigar updateFirstSoftClipCigarElement (int softClipSize, Cigar originalCigar) {
Cigar result = new Cigar();
CigarElement leftElement = new CigarElement(softClipSize, CigarOperator.S);
boolean updated = false;
for (CigarElement element : originalCigar.getCigarElements()) {
if (!updated && element.getOperator() == CigarOperator.M) {
result.add(leftElement);
int newLength = element.getLength() - softClipSize;
if (newLength > 0)
result.add(new CigarElement(newLength, CigarOperator.M));
updated = true;
}
else
result.add(element);
}
return result;
}
/**
* Given a cigar string, returns the inverted cigar string.
*
* @param cigar the original cigar
* @return the inverted cigar
*/
private Cigar invertCigar(Cigar cigar) {
Stack<CigarElement> stack = new Stack<CigarElement>();
for (CigarElement e : cigar.getCigarElements())
stack.push(e);
Cigar inverted = new Cigar();
while (!stack.empty()) {
inverted.add(stack.pop());
}
return inverted;
}
/** /**
* Quality control procedure that checks if the consensus reads contains too many * Quality control procedure that checks if the consensus reads contains too many
* mismatches with the reference. This should never happen and is a good trigger for * mismatches with the reference. This should never happen and is a good trigger for
@ -663,7 +601,7 @@ public class ReduceReadsWalker extends ReadWalker<LinkedList<GATKSAMRecord>, Red
* @return Returns true if the read is the original read that went through map(). * @return Returns true if the read is the original read that went through map().
*/ */
private boolean isOriginalRead(LinkedList<GATKSAMRecord> list, GATKSAMRecord read) { private boolean isOriginalRead(LinkedList<GATKSAMRecord> list, GATKSAMRecord read) {
return isWholeGenome() || (list.getFirst().equals(read) && ReadUtils.getReadAndIntervalOverlapType(read, intervalList.first()) == ReadUtils.ReadAndIntervalOverlap.OVERLAP_CONTAINED); return isWholeGenome() || list.getFirst().equals(read);
} }
/** /**

View File

@ -26,7 +26,7 @@ public class SingleSampleCompressor implements Compressor {
protected double minIndelProportionToTriggerVariant; protected double minIndelProportionToTriggerVariant;
protected int minBaseQual; protected int minBaseQual;
protected ReduceReadsWalker.DownsampleStrategy downsampleStrategy; protected ReduceReads.DownsampleStrategy downsampleStrategy;
public SingleSampleCompressor(final String sampleName, public SingleSampleCompressor(final String sampleName,
final int contextSize, final int contextSize,
@ -35,7 +35,7 @@ public class SingleSampleCompressor implements Compressor {
final double minAltProportionToTriggerVariant, final double minAltProportionToTriggerVariant,
final double minIndelProportionToTriggerVariant, final double minIndelProportionToTriggerVariant,
final int minBaseQual, final int minBaseQual,
final ReduceReadsWalker.DownsampleStrategy downsampleStrategy) { final ReduceReads.DownsampleStrategy downsampleStrategy) {
this.sampleName = sampleName; this.sampleName = sampleName;
this.contextSize = contextSize; this.contextSize = contextSize;
this.downsampleCoverage = downsampleCoverage; this.downsampleCoverage = downsampleCoverage;

View File

@ -53,7 +53,7 @@ public class SlidingWindow {
protected int MIN_BASE_QUAL_TO_COUNT; // qual has to be greater than or equal to this value protected int MIN_BASE_QUAL_TO_COUNT; // qual has to be greater than or equal to this value
protected int MIN_MAPPING_QUALITY; protected int MIN_MAPPING_QUALITY;
protected ReduceReadsWalker.DownsampleStrategy downsampleStrategy; protected ReduceReads.DownsampleStrategy downsampleStrategy;
private boolean hasIndelQualities; private boolean hasIndelQualities;
/** /**
@ -82,7 +82,7 @@ public class SlidingWindow {
} }
public SlidingWindow(String contig, int contigIndex, int contextSize, SAMFileHeader header, GATKSAMReadGroupRecord readGroupAttribute, int windowNumber, final double minAltProportionToTriggerVariant, final double minIndelProportionToTriggerVariant, int minBaseQual, int minMappingQuality, int downsampleCoverage, final ReduceReadsWalker.DownsampleStrategy downsampleStrategy, boolean hasIndelQualities) { public SlidingWindow(String contig, int contigIndex, int contextSize, SAMFileHeader header, GATKSAMReadGroupRecord readGroupAttribute, int windowNumber, final double minAltProportionToTriggerVariant, final double minIndelProportionToTriggerVariant, int minBaseQual, int minMappingQuality, int downsampleCoverage, final ReduceReads.DownsampleStrategy downsampleStrategy, boolean hasIndelQualities) {
this.stopLocation = -1; this.stopLocation = -1;
this.contextSize = contextSize; this.contextSize = contextSize;
this.downsampleCoverage = downsampleCoverage; this.downsampleCoverage = downsampleCoverage;
@ -499,7 +499,7 @@ public class SlidingWindow {
result.addAll(addToSyntheticReads(0, start)); result.addAll(addToSyntheticReads(0, start));
result.addAll(finalizeAndAdd(ConsensusType.BOTH)); result.addAll(finalizeAndAdd(ConsensusType.BOTH));
for (GATKSAMRecord read : result) { for (GATKSAMRecord read : allReads) {
readsInWindow.remove(read); // todo -- not optimal, but needs to be done so the next region doesn't try to remove the same reads from the header counts. readsInWindow.remove(read); // todo -- not optimal, but needs to be done so the next region doesn't try to remove the same reads from the header counts.
} }
@ -536,6 +536,10 @@ public class SlidingWindow {
* @return a list of reads selected by the downsampler to cover the window to at least the desired coverage * @return a list of reads selected by the downsampler to cover the window to at least the desired coverage
*/ */
protected List<GATKSAMRecord> downsampleVariantRegion(final List<GATKSAMRecord> allReads) { protected List<GATKSAMRecord> downsampleVariantRegion(final List<GATKSAMRecord> allReads) {
int nReads = allReads.size();
if (nReads == 0)
return allReads;
double fraction = 100 / allReads.size(); double fraction = 100 / allReads.size();
if (fraction >= 1) if (fraction >= 1)
return allReads; return allReads;
@ -545,6 +549,7 @@ public class SlidingWindow {
return downsampler.consumeDownsampledItems(); return downsampler.consumeDownsampledItems();
} }
/** /**
* Properly closes a Sliding Window, finalizing all consensus and variant * Properly closes a Sliding Window, finalizing all consensus and variant
* regions that still exist regardless of being able to fulfill the * regions that still exist regardless of being able to fulfill the
@ -627,7 +632,7 @@ public class SlidingWindow {
int locationIndex = startLocation < 0 ? 0 : readStart - startLocation; int locationIndex = startLocation < 0 ? 0 : readStart - startLocation;
if (removeRead && locationIndex < 0) if (removeRead && locationIndex < 0)
throw new ReviewedStingException("read is behind the Sliding Window. read: " + read + " cigar: " + read.getCigarString() + " window: " + startLocation + "," + stopLocation); throw new ReviewedStingException("read is behind the Sliding Window. read: " + read + " start " + read.getUnclippedStart() + "," + read.getUnclippedEnd() + " cigar: " + read.getCigarString() + " window: " + startLocation + "," + stopLocation);
if (!removeRead) { // we only need to create new header elements if we are adding the read, not when we're removing it if (!removeRead) { // we only need to create new header elements if we are adding the read, not when we're removing it
if (locationIndex < 0) { // Do we need to add extra elements before the start of the header? -- this may happen if the previous read was clipped and this alignment starts before the beginning of the window if (locationIndex < 0) { // Do we need to add extra elements before the start of the header? -- this may happen if the previous read was clipped and this alignment starts before the beginning of the window

View File

@ -5,7 +5,7 @@ import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement; import net.sf.samtools.CigarElement;
import net.sf.samtools.CigarOperator; import net.sf.samtools.CigarOperator;
import net.sf.samtools.SAMFileHeader; import net.sf.samtools.SAMFileHeader;
import org.broadinstitute.sting.gatk.walkers.bqsr.EventType; import org.broadinstitute.sting.utils.recalibration.EventType;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord;
@ -102,7 +102,7 @@ public class SyntheticRead {
* @param base the base to add * @param base the base to add
* @param count number of reads with this base * @param count number of reads with this base
*/ */
@Requires("count < Byte.MAX_VALUE") @Requires("count <= Byte.MAX_VALUE")
public void add(BaseIndex base, byte count, byte qual, byte insQual, byte delQual, double mappingQuality) { public void add(BaseIndex base, byte count, byte qual, byte insQual, byte delQual, double mappingQuality) {
counts.add(count); counts.add(count);
bases.add(base); bases.add(base);

View File

@ -0,0 +1,295 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import com.google.java.contract.Requires;
import org.apache.commons.lang.ArrayUtils;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.walkers.indels.PairHMMIndelErrorModel;
import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.util.Arrays;
import java.util.HashMap;
import java.util.LinkedHashMap;
/**
* Created by IntelliJ IDEA.
* User: carneiro
* Date: 7/21/11
* Time: 2:21 PM
*
* This is a site based implementation of an Error Model. The error model is a probability
* distribution for the site given the phred scaled quality.
*/
public class ErrorModel {
private byte maxQualityScore;
private byte minQualityScore;
private byte phredScaledPrior;
private double log10minPower;
private int refDepth;
private boolean hasData = false;
private ProbabilityVector probabilityVector;
private static final boolean compressRange = false;
private static final double log10MinusE = Math.log10(Math.exp(1.0));
private static final boolean DEBUG = false;
/**
* Calculates the probability of the data (reference sample reads) given the phred scaled site quality score.
*
* @param UAC Argument Collection
* @param refSamplePileup Reference sample pileup
* @param refSampleVC VC with True alleles in reference sample pileup
*/
public ErrorModel (final UnifiedArgumentCollection UAC,
final ReadBackedPileup refSamplePileup,
VariantContext refSampleVC, final ReferenceContext refContext) {
this.maxQualityScore = UAC.maxQualityScore;
this.minQualityScore = UAC.minQualityScore;
this.phredScaledPrior = UAC.phredScaledPrior;
log10minPower = Math.log10(UAC.minPower);
PairHMMIndelErrorModel pairModel = null;
LinkedHashMap<Allele, Haplotype> haplotypeMap = null;
HashMap<PileupElement, LinkedHashMap<Allele, Double>> indelLikelihoodMap = null;
double[][] perReadLikelihoods = null;
double[] model = new double[maxQualityScore+1];
Arrays.fill(model,Double.NEGATIVE_INFINITY);
boolean hasCalledAlleles = false;
if (refSampleVC != null) {
for (Allele allele : refSampleVC.getAlleles()) {
if (allele.isCalled()) {
hasCalledAlleles = true;
break;
}
}
haplotypeMap = new LinkedHashMap<Allele, Haplotype>();
if (refSampleVC.isIndel()) {
pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY,
UAC.OUTPUT_DEBUG_INDEL_INFO, !UAC.DONT_DO_BANDED_INDEL_COMPUTATION);
indelLikelihoodMap = new HashMap<PileupElement, LinkedHashMap<Allele, Double>>();
IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles(refSampleVC.getAlleles(), refContext, refContext.getLocus(), haplotypeMap); // will update haplotypeMap adding elements
}
}
double p = MathUtils.phredScaleToLog10Probability((byte)(maxQualityScore-minQualityScore));
if (refSamplePileup == null || refSampleVC == null || !hasCalledAlleles) {
for (byte q=minQualityScore; q<=maxQualityScore; q++) {
// maximum uncertainty if there's no ref data at site
model[q] = p;
}
this.refDepth = 0;
}
else {
hasData = true;
int matches = 0;
int coverage = 0;
Allele refAllele = refSampleVC.getReference();
if (refSampleVC.isIndel()) {
final int readCounts[] = new int[refSamplePileup.getNumberOfElements()];
//perReadLikelihoods = new double[readCounts.length][refSampleVC.getAlleles().size()];
final int eventLength = IndelGenotypeLikelihoodsCalculationModel.getEventLength(refSampleVC.getAlleles());
if (!haplotypeMap.isEmpty())
perReadLikelihoods = pairModel.computeGeneralReadHaplotypeLikelihoods(refSamplePileup,haplotypeMap,refContext, eventLength, indelLikelihoodMap, readCounts);
}
int idx = 0;
for (PileupElement refPileupElement : refSamplePileup) {
if (DEBUG)
System.out.println(refPileupElement.toString());
boolean isMatch = false;
for (Allele allele : refSampleVC.getAlleles()) {
boolean m = pileupElementMatches(refPileupElement, allele, refAllele, refContext.getBase());
if (DEBUG) System.out.println(m);
isMatch |= m;
}
if (refSampleVC.isIndel() && !haplotypeMap.isEmpty()) {
// ignore match/mismatch if reads, as determined by their likelihood, are not informative
double[] perAlleleLikelihoods = perReadLikelihoods[idx++];
if (!isInformativeElement(perAlleleLikelihoods))
matches++;
else
matches += (isMatch?1:0);
} else {
matches += (isMatch?1:0);
}
coverage++;
}
int mismatches = coverage - matches;
//System.out.format("Cov:%d match:%d mismatch:%d\n",coverage, matches, mismatches);
for (byte q=minQualityScore; q<=maxQualityScore; q++) {
if (coverage==0)
model[q] = p;
else
model[q] = log10PoissonProbabilitySiteGivenQual(q,coverage, mismatches);
}
this.refDepth = coverage;
}
// compress probability vector
this.probabilityVector = new ProbabilityVector(model, compressRange);
}
@Requires("likelihoods.length>0")
private boolean isInformativeElement(double[] likelihoods) {
// if likelihoods are the same, they're not informative
final double thresh = 0.1;
int maxIdx = MathUtils.maxElementIndex(likelihoods);
int minIdx = MathUtils.minElementIndex(likelihoods);
if (likelihoods[maxIdx]-likelihoods[minIdx]< thresh)
return false;
else
return true;
}
/**
* Simple constructor that just takes a given log-probability vector as error model.
* Only intended for unit testing, not general usage.
* @param pvector Given vector of log-probabilities
*
*/
public ErrorModel(double[] pvector) {
this.maxQualityScore = (byte)(pvector.length-1);
this.minQualityScore = 0;
this.probabilityVector = new ProbabilityVector(pvector, compressRange);
this.hasData = true;
}
public static boolean pileupElementMatches(PileupElement pileupElement, Allele allele, Allele refAllele, byte refBase) {
if (DEBUG)
System.out.format("PE: base:%s isNextToDel:%b isNextToIns:%b eventBases:%s eventLength:%d Allele:%s RefAllele:%s\n",
pileupElement.getBase(), pileupElement.isBeforeDeletionStart(),
pileupElement.isBeforeInsertion(),pileupElement.getEventBases(),pileupElement.getEventLength(), allele.toString(), refAllele.toString());
//pileupElement.
// if test allele is ref, any base mismatch, or any insertion/deletion at start of pileup count as mismatch
if (allele.isReference()) {
// for a ref allele, any base mismatch or new indel is a mismatch.
if(allele.getBases().length>0)
// todo - can't check vs. allele because allele is not padded so it doesn't include the reference base at this location
// could clean up/simplify this when unpadding is removed
return (pileupElement.getBase() == refBase && !pileupElement.isBeforeInsertion() && !pileupElement.isBeforeDeletionStart());
else
// either null allele to compare, or ref/alt lengths are different (indel by definition).
// if we have an indel that we are comparing against a REF allele, any indel presence (of any length/content) is a mismatch
return (!pileupElement.isBeforeInsertion() && !pileupElement.isBeforeDeletionStart());
}
// for non-ref alleles to compare:
if (refAllele.getBases().length == allele.getBases().length)
// alleles have the same length (eg snp or mnp)
return pileupElement.getBase() == allele.getBases()[0];
// for non-ref alleles,
byte[] alleleBases = allele.getBases();
int eventLength = alleleBases.length - refAllele.getBases().length;
if (eventLength < 0 && pileupElement.isBeforeDeletionStart() && pileupElement.getEventLength() == -eventLength)
return true;
if (eventLength > 0 && pileupElement.isBeforeInsertion() &&
Arrays.equals(pileupElement.getEventBases().getBytes(),alleleBases))
return true;
return false;
}
/**
* What's the log-likelihood that a site's quality is equal to q? If we see N observations and n mismatches,
* and assuming each match is independent of each other and that the match probability is just dependent of
* the site quality, so p = 10.^-q/10.
* Since we'll normally have relatively high Q sites and deep coverage in reference samples (ie p small, N high),
* to avoid underflows we'll use the Poisson approximation with lambda = N*p.
* Hence, the log-likelihood of q i.e. Pr(Nmismatches = n | SiteQ = q) ~ Poisson(n | lambda = p*N) with p as above.
* @param q Desired q to get likelihood from
* @param coverage Total coverage
* @param mismatches Number of mismatches
* @return Likelihood of observations as a function of q
*/
@Requires({
"q >= minQualityScore",
"q <= maxQualityScore",
"coverage >= 0",
"mismatches >= 0",
"mismatches <= coverage"
})
private double log10PoissonProbabilitySiteGivenQual(byte q, int coverage, int mismatches) {
// same as log10ProbabilitySiteGivenQual but with Poisson approximation to avoid numerical underflows
double lambda = MathUtils.phredScaleToProbability(q) * (double )coverage;
// log10(e^-lambda*lambda^k/k!) = -lambda + k*log10(lambda) - log10factorial(k)
return Math.log10(lambda)*mismatches - lambda*log10MinusE- MathUtils.log10Factorial(mismatches);
}
@Requires({"qual-minQualityScore <= maxQualityScore"})
public double getSiteLogErrorProbabilityGivenQual (int qual) {
return probabilityVector.getLogProbabilityForIndex(qual);
}
public byte getMaxQualityScore() {
return maxQualityScore;
}
public byte getMinQualityScore() {
return minQualityScore;
}
public int getMinSignificantQualityScore() {
return new ProbabilityVector(probabilityVector,true).getMinVal();
}
public int getMaxSignificantQualityScore() {
return new ProbabilityVector(probabilityVector,true).getMaxVal();
}
public int getReferenceDepth() {
return refDepth;
}
public boolean hasData() {
return hasData;
}
public ProbabilityVector getErrorModelVector() {
return probabilityVector;
}
public String toString() {
String result = "(";
boolean skipComma = true;
for (double v : probabilityVector.getProbabilityVector()) {
if (skipComma) {
skipComma = false;
}
else {
result += ",";
}
result += String.format("%.4f", v);
}
return result + ")";
}
public static int getTotalReferenceDepth(HashMap<String, ErrorModel> perLaneErrorModels) {
int n=0;
for (ErrorModel e : perLaneErrorModels.values()) {
n += e.getReferenceDepth();
}
return n;
}
/*
@Requires({"maxAlleleCount >= 0"})
//todo -- memoize this function
public boolean hasPowerForMaxAC (int maxAlleleCount) {
int siteQ = (int) Math.ceil(MathUtils.probabilityToPhredScale((double) 1/maxAlleleCount));
double log10CumSum = getCumulativeSum(siteQ);
return log10CumSum < log10minPower;
} */
}

View File

@ -0,0 +1,706 @@
/*
* Copyright (c) 2010.
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.variantcontext.*;
import java.io.PrintStream;
import java.util.*;
public class GeneralPloidyExactAFCalculationModel extends AlleleFrequencyCalculationModel {
static final int MAX_LENGTH_FOR_POOL_PL_LOGGING = 10; // if PL vectors longer than this # of elements, don't log them
final protected UnifiedArgumentCollection UAC;
private final int ploidy;
private final static double MAX_LOG10_ERROR_TO_STOP_EARLY = 6; // we want the calculation to be accurate to 1 / 10^6
private final static boolean VERBOSE = false;
protected GeneralPloidyExactAFCalculationModel(UnifiedArgumentCollection UAC, int N, Logger logger, PrintStream verboseWriter) {
super(UAC, N, logger, verboseWriter);
ploidy = UAC.samplePloidy;
this.UAC = UAC;
}
public List<Allele> getLog10PNonRef(final VariantContext vc,
final double[] log10AlleleFrequencyPriors,
final AlleleFrequencyCalculationResult result) {
GenotypesContext GLs = vc.getGenotypes();
List<Allele> alleles = vc.getAlleles();
// don't try to genotype too many alternate alleles
if ( vc.getAlternateAlleles().size() > MAX_ALTERNATE_ALLELES_TO_GENOTYPE ) {
logger.warn("this tool is currently set to genotype at most " + MAX_ALTERNATE_ALLELES_TO_GENOTYPE + " alternate alleles in a given context, but the context at " + vc.getChr() + ":" + vc.getStart() + " has " + (vc.getAlternateAlleles().size()) + " alternate alleles so only the top alleles will be used; see the --max_alternate_alleles argument");
alleles = new ArrayList<Allele>(MAX_ALTERNATE_ALLELES_TO_GENOTYPE + 1);
alleles.add(vc.getReference());
alleles.addAll(chooseMostLikelyAlternateAlleles(vc, MAX_ALTERNATE_ALLELES_TO_GENOTYPE, ploidy));
GLs = subsetAlleles(vc, alleles, false, ploidy);
}
combineSinglePools(GLs, alleles.size(), ploidy, log10AlleleFrequencyPriors, result);
return alleles;
}
/**
* Simple wrapper class to hold values of combined pool likelihoods.
* For fast hashing and fast retrieval, there's a hash map that shadows main list.
*
*/
static class CombinedPoolLikelihoods {
private LinkedList<ExactACset> alleleCountSetList;
private HashMap<ExactACcounts,ExactACset> conformationMap;
private double maxLikelihood;
public CombinedPoolLikelihoods() {
// final int numElements = GenotypeLikelihoods.numLikelihoods();
alleleCountSetList = new LinkedList<ExactACset>();
conformationMap = new HashMap<ExactACcounts,ExactACset>();
maxLikelihood = Double.NEGATIVE_INFINITY;
}
public void add(ExactACset set) {
alleleCountSetList.add(set);
conformationMap.put(set.ACcounts, set);
final double likelihood = set.log10Likelihoods[0];
if (likelihood > maxLikelihood )
maxLikelihood = likelihood;
}
public boolean hasConformation(int[] ac) {
return conformationMap.containsKey(new ExactACcounts(ac));
}
public double getLikelihoodOfConformation(int[] ac) {
return conformationMap.get(new ExactACcounts(ac)).log10Likelihoods[0];
}
public double getGLOfACZero() {
return alleleCountSetList.get(0).log10Likelihoods[0]; // AC 0 is always at beginning of list
}
public int getLength() {
return alleleCountSetList.size();
}
}
/**
*
* Chooses N most likely alleles in a set of pools (samples) based on GL sum over alt alleles
* @param vc Input variant context
* @param numAllelesToChoose Number of alleles to choose
* @param ploidy Ploidy per pool
* @return list of numAllelesToChoose most likely alleles
*/
private static List<Allele> chooseMostLikelyAlternateAlleles(VariantContext vc, int numAllelesToChoose, int ploidy) {
final int numOriginalAltAlleles = vc.getAlternateAlleles().size();
final LikelihoodSum[] likelihoodSums = new LikelihoodSum[numOriginalAltAlleles];
for ( int i = 0; i < numOriginalAltAlleles; i++ )
likelihoodSums[i] = new LikelihoodSum(vc.getAlternateAllele(i));
// based on the GLs, find the alternate alleles with the most probability; sum the GLs for the most likely genotype
final ArrayList<double[]> GLs = getGLs(vc.getGenotypes());
for ( final double[] likelihoods : GLs ) {
final int PLindexOfBestGL = MathUtils.maxElementIndex(likelihoods);
final int[] acCount = GeneralPloidyGenotypeLikelihoods.getAlleleCountFromPLIndex(1 + numOriginalAltAlleles, ploidy, PLindexOfBestGL);
// by convention, first count coming from getAlleleCountFromPLIndex comes from reference allele
for (int k=1; k < acCount.length;k++) {
if (acCount[k] > 0)
likelihoodSums[k-1].sum += likelihoods[PLindexOfBestGL];
}
}
// sort them by probability mass and choose the best ones
Collections.sort(Arrays.asList(likelihoodSums));
final ArrayList<Allele> bestAlleles = new ArrayList<Allele>(numAllelesToChoose);
for ( int i = 0; i < numAllelesToChoose; i++ )
bestAlleles.add(likelihoodSums[i].allele);
final ArrayList<Allele> orderedBestAlleles = new ArrayList<Allele>(numAllelesToChoose);
for ( Allele allele : vc.getAlternateAlleles() ) {
if ( bestAlleles.contains(allele) )
orderedBestAlleles.add(allele);
}
return orderedBestAlleles;
}
/**
* Simple non-optimized version that combines GLs from several pools and produces global AF distribution.
* @param GLs Inputs genotypes context with per-pool GLs
* @param numAlleles Number of alternate alleles
* @param ploidyPerPool Number of samples per pool
* @param log10AlleleFrequencyPriors Frequency priors
* @param result object to fill with output values
*/
protected static void combineSinglePools(final GenotypesContext GLs,
final int numAlleles,
final int ploidyPerPool,
final double[] log10AlleleFrequencyPriors,
final AlleleFrequencyCalculationResult result) {
final ArrayList<double[]> genotypeLikelihoods = getGLs(GLs);
int combinedPloidy = 0;
// Combine each pool incrementally - likelihoods will be renormalized at each step
CombinedPoolLikelihoods combinedPoolLikelihoods = new CombinedPoolLikelihoods();
// first element: zero ploidy, e.g. trivial degenerate distribution
final int[] zeroCounts = new int[numAlleles];
final ExactACset set = new ExactACset(1, new ExactACcounts(zeroCounts));
set.log10Likelihoods[0] = 0.0;
combinedPoolLikelihoods.add(set);
for (int p=1; p<genotypeLikelihoods.size(); p++) {
result.reset();
combinedPoolLikelihoods = fastCombineMultiallelicPool(combinedPoolLikelihoods, genotypeLikelihoods.get(p), combinedPloidy, ploidyPerPool,
numAlleles, log10AlleleFrequencyPriors, result);
combinedPloidy = ploidyPerPool + combinedPloidy; // total number of chromosomes in combinedLikelihoods
}
}
public static CombinedPoolLikelihoods fastCombineMultiallelicPool(final CombinedPoolLikelihoods originalPool, double[] newGL, int originalPloidy, int newGLPloidy, int numAlleles,
final double[] log10AlleleFrequencyPriors,
final AlleleFrequencyCalculationResult result) {
final LinkedList<ExactACset> ACqueue = new LinkedList<ExactACset>();
// mapping of ExactACset indexes to the objects
final HashMap<ExactACcounts, ExactACset> indexesToACset = new HashMap<ExactACcounts, ExactACset>();
final CombinedPoolLikelihoods newPool = new CombinedPoolLikelihoods();
// add AC=0 to the queue
final int[] zeroCounts = new int[numAlleles];
final int newPloidy = originalPloidy + newGLPloidy;
zeroCounts[0] = newPloidy;
ExactACset zeroSet = new ExactACset(1, new ExactACcounts(zeroCounts));
ACqueue.add(zeroSet);
indexesToACset.put(zeroSet.ACcounts, zeroSet);
// keep processing while we have AC conformations that need to be calculated
double maxLog10L = Double.NEGATIVE_INFINITY;
while ( !ACqueue.isEmpty() ) {
// compute log10Likelihoods
final ExactACset ACset = ACqueue.remove();
final double log10LofKs = calculateACConformationAndUpdateQueue(ACset, newPool, originalPool, newGL, log10AlleleFrequencyPriors, originalPloidy, newGLPloidy, result, maxLog10L, ACqueue, indexesToACset);
maxLog10L = Math.max(maxLog10L, log10LofKs);
// clean up memory
indexesToACset.remove(ACset.ACcounts);
if ( VERBOSE )
System.out.printf(" *** removing used set=%s%n", ACset.ACcounts);
}
return newPool;
}
// todo - refactor, function almost identical except for log10LofK computation in GeneralPloidyGenotypeLikelihoods
/**
*
* @param set ExactACset holding conformation to be computed
* @param newPool New pool likelihood holder
* @param originalPool Original likelihood holder
* @param newGL New pool GL vector to combine
* @param log10AlleleFrequencyPriors Prior object
* @param originalPloidy Total ploidy of original combined pool
* @param newGLPloidy Ploidy of GL vector
* @param result AFResult object
* @param maxLog10L max likelihood observed so far
* @param ACqueue Queue of conformations to compute
* @param indexesToACset AC indices of objects in queue
* @return max log likelihood
*/
private static double calculateACConformationAndUpdateQueue(final ExactACset set,
final CombinedPoolLikelihoods newPool,
final CombinedPoolLikelihoods originalPool,
final double[] newGL,
final double[] log10AlleleFrequencyPriors,
final int originalPloidy,
final int newGLPloidy,
final AlleleFrequencyCalculationResult result,
final double maxLog10L,
final LinkedList<ExactACset> ACqueue,
final HashMap<ExactACcounts, ExactACset> indexesToACset) {
// compute likeihood in "set" of new set based on original likelihoods
final int numAlleles = set.ACcounts.counts.length;
final int newPloidy = set.getACsum();
final double log10LofK = computeLofK(set, originalPool, newGL, log10AlleleFrequencyPriors, numAlleles, originalPloidy, newGLPloidy, result);
// add to new pool
if (!Double.isInfinite(log10LofK))
newPool.add(set);
if ( log10LofK < maxLog10L - MAX_LOG10_ERROR_TO_STOP_EARLY ) {
if ( VERBOSE )
System.out.printf(" *** breaking early set=%s log10L=%.2f maxLog10L=%.2f%n", set.ACcounts, log10LofK, maxLog10L);
return log10LofK;
}
// iterate over higher frequencies if possible
// by convention, ACcounts contained in set have full vector of possible pool ac counts including ref count.
// so, if first element is zero, it automatically means we have no wiggle since we're in a corner of the conformation space
final int ACwiggle = set.ACcounts.counts[0];
if ( ACwiggle == 0 ) // all alternate alleles already sum to 2N so we cannot possibly go to higher frequencies
return log10LofK;
// add conformations for other cases
for ( int allele = 1; allele < numAlleles; allele++ ) {
final int[] ACcountsClone = set.ACcounts.getCounts().clone();
ACcountsClone[allele]++;
// is this a valid conformation?
int altSum = (int)MathUtils.sum(ACcountsClone) - ACcountsClone[0];
ACcountsClone[0] = newPloidy - altSum;
if (ACcountsClone[0] < 0)
continue;
GeneralPloidyGenotypeLikelihoods.updateACset(ACcountsClone, ACqueue, indexesToACset);
}
return log10LofK;
}
/**
* Naive combiner of two multiallelic pools - number of alt alleles must be the same.
* Math is generalization of biallelic combiner.
*
* For vector K representing an allele count conformation,
* Pr(D | AC = K) = Sum_G Pr(D|AC1 = G) Pr (D|AC2=K-G) * F(G,K)
* where F(G,K) = choose(m1,[g0 g1 ...])*choose(m2,[...]) / choose(m1+m2,[k1 k2 ...])
* @param originalPool First log-likelihood pool GL vector
* @param yy Second pool GL vector
* @param ploidy1 Ploidy of first pool (# of chromosomes in it)
* @param ploidy2 Ploidy of second pool
* @param numAlleles Number of alleles
* @param log10AlleleFrequencyPriors Array of biallelic priors
* @param result Af calculation result object
*/
public static void combineMultiallelicPoolNaively(CombinedPoolLikelihoods originalPool, double[] yy, int ploidy1, int ploidy2, int numAlleles,
final double[] log10AlleleFrequencyPriors,
final AlleleFrequencyCalculationResult result) {
/*
final int dim1 = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy1);
final int dim2 = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy2);
if (dim1 != originalPool.getLength() || dim2 != yy.length)
throw new ReviewedStingException("BUG: Inconsistent vector length");
if (ploidy2 == 0)
return;
final int newPloidy = ploidy1 + ploidy2;
// Say L1(K) = Pr(D|AC1=K) * choose(m1,K)
// and L2(K) = Pr(D|AC2=K) * choose(m2,K)
GeneralPloidyGenotypeLikelihoods.SumIterator firstIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy1);
final double[] x = originalPool.getLikelihoodsAsVector(true);
while(firstIterator.hasNext()) {
x[firstIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy1,firstIterator.getCurrentVector());
firstIterator.next();
}
GeneralPloidyGenotypeLikelihoods.SumIterator secondIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy2);
final double[] y = yy.clone();
while(secondIterator.hasNext()) {
y[secondIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy2,secondIterator.getCurrentVector());
secondIterator.next();
}
// initialize output to -log10(choose(m1+m2,[k1 k2...])
final int outputDim = GenotypeLikelihoods.numLikelihoods(numAlleles, newPloidy);
final GeneralPloidyGenotypeLikelihoods.SumIterator outputIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,newPloidy);
// Now, result(K) = logSum_G (L1(G)+L2(K-G)) where G are all possible vectors that sum UP to K
while(outputIterator.hasNext()) {
final ExactACset set = new ExactACset(1, new ExactACcounts(outputIterator.getCurrentAltVector()));
double likelihood = computeLofK(set, x,y, log10AlleleFrequencyPriors, numAlleles, ploidy1, ploidy2, result);
originalPool.add(likelihood, set, outputIterator.getLinearIndex());
outputIterator.next();
}
*/
}
/**
* Compute likelihood of a particular AC conformation and update AFresult object
* @param set Set of AC counts to compute
* @param firstGLs Original pool likelihoods before combining
* @param secondGL New GL vector with additional pool
* @param log10AlleleFrequencyPriors Allele frequency priors
* @param numAlleles Number of alleles (including ref)
* @param ploidy1 Ploidy of original pool (combined)
* @param ploidy2 Ploidy of new pool
* @param result AFResult object
* @return log-likehood of requested conformation
*/
private static double computeLofK(final ExactACset set,
final CombinedPoolLikelihoods firstGLs,
final double[] secondGL,
final double[] log10AlleleFrequencyPriors,
final int numAlleles, final int ploidy1, final int ploidy2,
final AlleleFrequencyCalculationResult result) {
final int newPloidy = ploidy1 + ploidy2;
// sanity check
int totalAltK = set.getACsum();
if (newPloidy != totalAltK)
throw new ReviewedStingException("BUG: inconsistent sizes of set.getACsum and passed ploidy values");
totalAltK -= set.ACcounts.counts[0];
// totalAltK has sum of alt alleles of conformation now
// special case for k = 0 over all k
if ( totalAltK == 0 ) { // all-ref case
final double log10Lof0 = firstGLs.getGLOfACZero() + secondGL[HOM_REF_INDEX];
set.log10Likelihoods[0] = log10Lof0;
result.setLog10LikelihoodOfAFzero(log10Lof0);
result.setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]);
} else {
// initialize result with denominator
// ExactACset holds by convention the conformation of all alleles, and the sum of all allele count is just the ploidy.
// To compute n!/k1!k2!k3!... we need to compute first n!/(k2!k3!...) and then further divide by k1! where k1=ploidy-sum_k_i
int[] currentCount = set.ACcounts.getCounts();
double denom = -MathUtils.log10MultinomialCoefficient(newPloidy, currentCount);
// for current conformation, get all possible ways to break vector K into two components G1 and G2
final GeneralPloidyGenotypeLikelihoods.SumIterator innerIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy2);
set.log10Likelihoods[0] = Double.NEGATIVE_INFINITY;
while (innerIterator.hasNext()) {
// check if breaking current conformation into g1 and g2 is feasible.
final int[] acCount2 = innerIterator.getCurrentVector();
final int[] acCount1 = MathUtils.vectorDiff(currentCount, acCount2);
final int idx2 = innerIterator.getLinearIndex();
// see if conformation is valid and if original pool had this conformation
// for conformation to be valid, all elements of g2 have to be <= elements of current AC set
if (isValidConformation(acCount1,ploidy1) && firstGLs.hasConformation(acCount1)) {
final double gl2 = secondGL[idx2];
if (!Double.isInfinite(gl2)) {
final double firstGL = firstGLs.getLikelihoodOfConformation(acCount1);
final double num1 = MathUtils.log10MultinomialCoefficient(ploidy1, acCount1);
final double num2 = MathUtils.log10MultinomialCoefficient(ploidy2, acCount2);
final double sum = firstGL + gl2 + num1 + num2;
set.log10Likelihoods[0] = MathUtils.approximateLog10SumLog10(set.log10Likelihoods[0], sum);
}
}
innerIterator.next();
}
set.log10Likelihoods[0] += denom;
}
double log10LofK = set.log10Likelihoods[0];
// update the MLE if necessary
final int altCounts[] = Arrays.copyOfRange(set.ACcounts.counts,1, set.ACcounts.counts.length);
result.updateMLEifNeeded(log10LofK, altCounts);
// apply the priors over each alternate allele
for (final int ACcount : altCounts ) {
if ( ACcount > 0 )
log10LofK += log10AlleleFrequencyPriors[ACcount];
}
result.updateMAPifNeeded(log10LofK, altCounts);
return log10LofK;
}
/**
* Small helper routine - is a particular AC conformationv vector valid? ie are all elements non-negative and sum to ploidy?
* @param set AC conformation vector
* @param ploidy Ploidy of set
* @return Valid conformation
*/
private static boolean isValidConformation(final int[] set, final int ploidy) {
int sum=0;
for (final int ac: set) {
if (ac < 0)
return false;
sum += ac;
}
return (sum == ploidy);
}
/**
* Combines naively two biallelic pools (of arbitrary size).
* For two pools of size m1 and m2, we can compute the combined likelihood as:
* Pr(D|AC=k) = Sum_{j=0}^k Pr(D|AC1=j) Pr(D|AC2=k-j) * choose(m1,j)*choose(m2,k-j)/choose(m1+m2,k)
* @param originalPool Pool likelihood vector, x[k] = Pr(AC_i = k) for alt allele i
* @param newPLVector Second GL vector
* @param ploidy1 Ploidy of first pool (# of chromosomes in it)
* @param ploidy2 Ploidy of second pool
* @param log10AlleleFrequencyPriors Array of biallelic priors
* @param result Af calculation result object
* @return Combined likelihood vector
*/
public static ProbabilityVector combineBiallelicPoolsNaively(final ProbabilityVector originalPool, final double[] newPLVector,
final int ploidy1, final int ploidy2, final double[] log10AlleleFrequencyPriors,
final AlleleFrequencyCalculationResult result) {
final int newPloidy = ploidy1 + ploidy2;
final double[] combinedLikelihoods = new double[1+newPloidy];
/** Pre-fill result array and incorporate weights into input vectors
* Say L1(k) = Pr(D|AC1=k) * choose(m1,k)
* and L2(k) = Pr(D|AC2=k) * choose(m2,k)
* equation reduces to
* Pr(D|AC=k) = 1/choose(m1+m2,k) * Sum_{j=0}^k L1(k) L2(k-j)
* which is just plain convolution of L1 and L2 (with pre-existing vector)
*/
// intialize result vector to -infinity
Arrays.fill(combinedLikelihoods,Double.NEGATIVE_INFINITY);
final double[] x = Arrays.copyOf(originalPool.getProbabilityVector(),1+ploidy1);
for (int k=originalPool.getProbabilityVector().length; k< x.length; k++)
x[k] = Double.NEGATIVE_INFINITY;
final double[] y = newPLVector.clone();
final double log10Lof0 = x[0]+y[0];
result.setLog10LikelihoodOfAFzero(log10Lof0);
result.setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]);
double maxElement = log10Lof0;
int maxElementIdx = 0;
int[] alleleCounts = new int[1];
for (int k= originalPool.getMinVal() ; k <= newPloidy; k++) {
double[] acc = new double[k+1];
Arrays.fill(acc,Double.NEGATIVE_INFINITY);
double innerMax = Double.NEGATIVE_INFINITY;
for (int j=0; j <=k; j++) {
double x1,y1;
if (k-j>=0 && k-j < y.length)
y1 = y[k-j] + MathUtils.log10BinomialCoefficient(ploidy2,k-j);
else
continue;
if (j < x.length)
x1 = x[j] + MathUtils.log10BinomialCoefficient(ploidy1,j);
else
continue;
if (Double.isInfinite(x1) || Double.isInfinite(y1))
continue;
acc[j] = x1 + y1;
if (acc[j] > innerMax)
innerMax = acc[j];
else if (acc[j] < innerMax - MAX_LOG10_ERROR_TO_STOP_EARLY)
break;
}
combinedLikelihoods[k] = MathUtils.log10sumLog10(acc) - MathUtils.log10BinomialCoefficient(newPloidy,k);
maxElementIdx = k;
double maxDiff = combinedLikelihoods[k] - maxElement;
if (maxDiff > 0)
maxElement = combinedLikelihoods[k];
else if (maxDiff < maxElement - MAX_LOG10_ERROR_TO_STOP_EARLY) {
break;
}
alleleCounts[0] = k;
result.updateMLEifNeeded(combinedLikelihoods[k],alleleCounts);
result.updateMAPifNeeded(combinedLikelihoods[k] + log10AlleleFrequencyPriors[k],alleleCounts);
}
return new ProbabilityVector(MathUtils.normalizeFromLog10(Arrays.copyOf(combinedLikelihoods,maxElementIdx+1),false, true));
}
/**
* From a given variant context, extract a given subset of alleles, and update genotype context accordingly,
* including updating the PL's, and assign genotypes accordingly
* @param vc variant context with alleles and genotype likelihoods
* @param allelesToUse alleles to subset
* @param assignGenotypes true: assign hard genotypes, false: leave as no-call
* @param ploidy number of chromosomes per sample (pool)
* @return GenotypesContext with new PLs
*/
public GenotypesContext subsetAlleles(final VariantContext vc,
final List<Allele> allelesToUse,
final boolean assignGenotypes,
final int ploidy) {
// the genotypes with PLs
final GenotypesContext oldGTs = vc.getGenotypes();
List<Allele> NO_CALL_ALLELES = new ArrayList<Allele>(ploidy);
for (int k=0; k < ploidy; k++)
NO_CALL_ALLELES.add(Allele.NO_CALL);
// samples
final List<String> sampleIndices = oldGTs.getSampleNamesOrderedByName();
// the new genotypes to create
final GenotypesContext newGTs = GenotypesContext.create();
// we need to determine which of the alternate alleles (and hence the likelihoods) to use and carry forward
final int numOriginalAltAlleles = vc.getAlternateAlleles().size();
final int numNewAltAlleles = allelesToUse.size() - 1;
// create the new genotypes
for ( int k = 0; k < oldGTs.size(); k++ ) {
final Genotype g = oldGTs.get(sampleIndices.get(k));
if ( !g.hasLikelihoods() ) {
newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES));
continue;
}
// create the new likelihoods array from the alleles we are allowed to use
final double[] originalLikelihoods = g.getLikelihoods().getAsVector();
double[] newLikelihoods;
if ( numOriginalAltAlleles == numNewAltAlleles) {
newLikelihoods = originalLikelihoods;
} else {
newLikelihoods = GeneralPloidyGenotypeLikelihoods.subsetToAlleles(originalLikelihoods, ploidy, vc.getAlleles(), allelesToUse);
// might need to re-normalize
newLikelihoods = MathUtils.normalizeFromLog10(newLikelihoods, false, true);
}
// if there is no mass on the (new) likelihoods, then just no-call the sample
if ( MathUtils.sum(newLikelihoods) > VariantContextUtils.SUM_GL_THRESH_NOCALL ) {
newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES));
}
else {
final GenotypeBuilder gb = new GenotypeBuilder(g);
if ( numNewAltAlleles == 0 )
gb.noPL();
else
gb.PL(newLikelihoods);
// if we weren't asked to assign a genotype, then just no-call the sample
if ( !assignGenotypes || MathUtils.sum(newLikelihoods) > VariantContextUtils.SUM_GL_THRESH_NOCALL )
gb.alleles(NO_CALL_ALLELES);
else
assignGenotype(gb, newLikelihoods, allelesToUse, ploidy);
newGTs.add(gb.make());
}
}
return newGTs;
}
/**
* Assign genotypes (GTs) to the samples in the Variant Context greedily based on the PLs
*
* @param newLikelihoods the PL array
* @param allelesToUse the list of alleles to choose from (corresponding to the PLs)
* @param numChromosomes Number of chromosomes per pool
*
* @return genotype
*/
private static void assignGenotype(final GenotypeBuilder gb,
final double[] newLikelihoods,
final List<Allele> allelesToUse,
final int numChromosomes) {
final int numNewAltAlleles = allelesToUse.size() - 1;
// find the genotype with maximum likelihoods
final int PLindex = numNewAltAlleles == 0 ? 0 : MathUtils.maxElementIndex(newLikelihoods);
final int[] mlAlleleCount = GeneralPloidyGenotypeLikelihoods.getAlleleCountFromPLIndex(allelesToUse.size(), numChromosomes, PLindex);
final ArrayList<Double> alleleFreqs = new ArrayList<Double>();
final ArrayList<Integer> alleleCounts = new ArrayList<Integer>();
for (int k=1; k < mlAlleleCount.length; k++) {
alleleCounts.add(mlAlleleCount[k]);
final double freq = (double)mlAlleleCount[k] / (double)numChromosomes;
alleleFreqs.add(freq);
}
// per-pool logging of AC and AF
gb.attribute(VCFConstants.MLE_PER_SAMPLE_ALLELE_COUNT_KEY, alleleCounts.size() == 1 ? alleleCounts.get(0) : alleleCounts);
gb.attribute(VCFConstants.MLE_PER_SAMPLE_ALLELE_FRACTION_KEY, alleleFreqs.size() == 1 ? alleleFreqs.get(0) : alleleFreqs);
// remove PLs if necessary
if (newLikelihoods.length > MAX_LENGTH_FOR_POOL_PL_LOGGING)
gb.noPL();
ArrayList<Allele> myAlleles = new ArrayList<Allele>();
// add list of called ML genotypes to alleles list
// TODO - too unwieldy?
int idx = 0;
for (int mlind = 0; mlind < mlAlleleCount.length; mlind++) {
for (int k=0; k < mlAlleleCount[mlind]; k++)
myAlleles.add(idx++,allelesToUse.get(mlind));
}
gb.alleles(myAlleles);
if ( numNewAltAlleles > 0 )
gb.log10PError(GenotypeLikelihoods.getGQLog10FromLikelihoods(PLindex, newLikelihoods));
}
}

View File

@ -0,0 +1,656 @@
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.genotyper;
import net.sf.samtools.SAMUtils;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.GenotypeLikelihoods;
import java.util.*;
public abstract class GeneralPloidyGenotypeLikelihoods {
protected final int numChromosomes;
private final static double MAX_LOG10_ERROR_TO_STOP_EARLY = 6; // we want the calculation to be accurate to 1 / 10^6
protected static final boolean VERBOSE = false;
protected static final double qualVec[] = new double[SAMUtils.MAX_PHRED_SCORE+1];
//
// The fundamental data arrays associated with a Genotype Likelhoods object
//
protected double[] log10Likelihoods;
protected double[][] logMismatchProbabilityArray;
protected final int nSamplesPerPool;
protected final HashMap<String, ErrorModel> perLaneErrorModels;
protected final int likelihoodDim;
protected final boolean ignoreLaneInformation;
protected final double LOG10_PLOIDY;
protected boolean hasReferenceSampleData;
protected final int nAlleles;
protected final List<Allele> alleles;
private static final double MIN_LIKELIHOOD = Double.NEGATIVE_INFINITY;
private static final int MAX_NUM_ALLELES_TO_CACHE = 20;
private static final int MAX_NUM_SAMPLES_PER_POOL = 1000;
private static final boolean FAST_GL_COMPUTATION = true;
// constructor with given logPL elements
public GeneralPloidyGenotypeLikelihoods(final List<Allele> alleles, final double[] logLikelihoods, final int ploidy,
final HashMap<String, ErrorModel> perLaneErrorModels, final boolean ignoreLaneInformation) {
this.alleles = alleles;
this.nAlleles = alleles.size();
numChromosomes = ploidy;
nSamplesPerPool = numChromosomes/2;
this.perLaneErrorModels = perLaneErrorModels;
this.ignoreLaneInformation = ignoreLaneInformation;
// check if at least one lane has actual data
if (perLaneErrorModels == null || perLaneErrorModels.isEmpty())
hasReferenceSampleData = false;
else {
for (Map.Entry<String,ErrorModel> elt : perLaneErrorModels.entrySet()) {
if (elt.getValue().hasData()) {
hasReferenceSampleData = true;
break;
}
}
}
// check sizes
if (nAlleles > MAX_NUM_ALLELES_TO_CACHE)
throw new UserException("No support for this number of alleles");
if (nSamplesPerPool > MAX_NUM_SAMPLES_PER_POOL)
throw new UserException("No support for such large number of samples per pool");
likelihoodDim = GenotypeLikelihoods.numLikelihoods(nAlleles, numChromosomes);
if (logLikelihoods == null){
log10Likelihoods = new double[likelihoodDim];
Arrays.fill(log10Likelihoods, MIN_LIKELIHOOD);
} else {
if (logLikelihoods.length != likelihoodDim)
throw new ReviewedStingException("BUG: inconsistent parameters when creating GeneralPloidyGenotypeLikelihoods object");
log10Likelihoods = logLikelihoods; //.clone(); // is clone needed?
}
fillCache();
LOG10_PLOIDY = Math.log10((double)numChromosomes);
}
/**
* Crucial inner class that handles addressing elements of pool likelihoods. We store likelihoods as a map
* of form int[] -> double (to be more precise, IntArrayWrapper -> Double).
* For a given ploidy (chromosome count) and number of alleles, we need a form to iterate deterministically
* across all possible allele conformations.
* Problem equivalent to listing in determistic order all possible ways in which N integers will sum to P,
* where N is number of alleles and P is number of chromosomes.
* There's an option to list all integers so that sum will be UP to P.
* For example, with P=2,N=2, restrictSumTo = 2 iterator will produce
* [2 0 ] [1 1] [ 0 2]
*
*
*/
protected static class SumIterator {
private int[] currentState;
private final int[] finalState;
private final int restrictSumTo;
private final int dim;
private boolean hasNext;
private int linearIndex;
private int currentSum;
/**
* Default constructor. Typical use case: restrictSumTo = -1 if there's no sum restriction, or will generate int[]
* vectors so that all add to this value.
*
* @param finalState End state - typically we should set value to (P,P,P,...)
* @param restrictSumTo See above
*/
public SumIterator(final int[] finalState,final int restrictSumTo) {
this.finalState = finalState;
this.dim = finalState.length;
this.restrictSumTo = restrictSumTo;
currentState = new int[dim];
reset();
}
/**
* Shortcut constructor for common use case: iterator will produce
* all vectors of length numAlleles whose sum = numChromosomes
* @param numAlleles Number of alleles
* @param numChromosomes Ploidy
*/
public SumIterator(final int numAlleles, final int numChromosomes) {
this(getInitialStateVector(numAlleles,numChromosomes), numChromosomes);
}
private static int[] getInitialStateVector(final int nAlleles, final int numChromosomes) {
int[] initialState = new int[nAlleles];
Arrays.fill(initialState,numChromosomes);
return initialState;
}
public void setInitialStateVector(final int[] stateVector) {
if (restrictSumTo > 0) {
// check that desired vector is valid
if (MathUtils.sum(stateVector) != restrictSumTo)
throw new ReviewedStingException("BUG: initial state vector nor compatible with sum iterator");
final int numAlleles = currentState.length;
final int ploidy = restrictSumTo;
linearIndex = GeneralPloidyGenotypeLikelihoods.getLinearIndex(stateVector, numAlleles, ploidy);
}
else
throw new ReviewedStingException("BUG: Not supported");
}
public void next() {
int initialDim = (restrictSumTo > 0)?1:0;
hasNext = next(finalState, initialDim);
if (hasNext)
linearIndex++;
}
private boolean next(final int[] finalState, int initialDim) {
boolean hasNextState = false;
for (int currentDim=initialDim; currentDim < finalState.length; currentDim++) {
final int x = currentState[currentDim]+1;
if (x > finalState[currentDim] || (currentSum >= restrictSumTo && initialDim > 0)) {
// update vector sum, and reset position
currentSum -= currentState[currentDim];
currentState[currentDim] = 0;
if (currentDim >= dim-1) {
hasNextState = false;
break;
}
}
else {
currentState[currentDim] = x;
hasNextState = true;
currentSum++;
break;
}
}
if (initialDim > 0) {
currentState[0] = restrictSumTo - currentSum;
}
return hasNextState;
}
public void reset() {
Arrays.fill(currentState, 0);
if (restrictSumTo > 0)
currentState[0] = restrictSumTo;
hasNext = true;
linearIndex = 0;
currentSum = 0;
}
public int[] getCurrentVector() {
return currentState;
}
public int[] getCurrentAltVector() {
return Arrays.copyOfRange(currentState,1,currentState.length);
}
/* public int getCurrentSum() {
return currentSum;
}
*/
public int getLinearIndex() {
return linearIndex;
}
public boolean hasNext() {
return hasNext;
}
}
public List<Allele> getAlleles() { return alleles;}
/**
* Returns an array of log10 likelihoods for each genotype conformation, with ordering determined by SumIterator class.
*
* @return likelihoods array
*/
public double[] getLikelihoods() {
return log10Likelihoods;
}
/**
* Set particular element of logPL vector
* @param idx index of allele count conformation to modify
* @param pl Likelihood to associate with map
*/
public void setLogPLs(final int idx, final double pl) {
log10Likelihoods[idx] = pl;
}
public void renormalize() {
log10Likelihoods = MathUtils.normalizeFromLog10(log10Likelihoods,false,true);
}
/** Compute most likely AC conformation based on currently stored PL's - just loop through log PL map and output max value
*
* @return vector with most likely allele count, ordered according to this object's alleles
*/
public Pair<int[],Double> getMostLikelyACCount() {
int[] mlInd = null;
double maxVal = Double.NEGATIVE_INFINITY;
final SumIterator iterator = new SumIterator(alleles.size(),numChromosomes);
int idx = 0;
while (iterator.hasNext()) {
double pl = log10Likelihoods[idx++];
if (pl > maxVal) {
maxVal = pl;
mlInd = iterator.getCurrentVector().clone();
}
iterator.next();
}
if (VERBOSE) {
System.out.println(VCFConstants.MLE_ALLELE_COUNT_KEY + ": " + Arrays.toString(mlInd));
}
return new Pair<int[], Double>(mlInd,maxVal);
}
/**
* Given set of alleles with corresponding vector of likelihoods, subset to a new set of alleles
*
* @param oldLikelihoods Vector of PL's corresponding to original alleles
* @param numChromosomes Ploidy (number of chromosomes describing PL's)
* @param originalAlleles List of original alleles
* @param allelesToSubset Alleles to subset
* @return Vector of new PL's, ordered accorrding to SumIterator's ordering
*/
public static double[] subsetToAlleles(final double[] oldLikelihoods, final int numChromosomes,
final List<Allele> originalAlleles, final List<Allele> allelesToSubset) {
int newPLSize = GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(allelesToSubset.size(), numChromosomes);
double[] newPLs = new double[newPLSize];
int idx = 0;
// First fill boolean array stating whether each original allele is present in new mapping
final boolean [] allelePresent = new boolean[originalAlleles.size()];
for ( Allele allele : originalAlleles )
allelePresent[idx++] = allelesToSubset.contains(allele);
// compute mapping from old idx to new idx
// This might be needed in case new allele set is not ordered in the same way as old set
// Example. Original alleles: {T*,C,G,A}. New alleles: {G,C}. Permutation key = [2,1]
int[] permutationKey = new int[allelesToSubset.size()];
for (int k=0; k < allelesToSubset.size(); k++)
// for each allele to subset, find corresponding index in original allele list
permutationKey[k] = originalAlleles.indexOf(allelesToSubset.get(k));
if (VERBOSE) {
System.out.println("permutationKey:"+Arrays.toString(permutationKey));
}
final SumIterator iterator = new SumIterator(originalAlleles.size(),numChromosomes);
while (iterator.hasNext()) {
// for each entry in logPL table, associated originally with allele count stored in vec[],
// see if this allele count conformation will be present in new logPL table.
// For entry to be present, elements in dimensions not present in requested allele list have to have count = 0
int[] pVec = iterator.getCurrentVector();
double pl = oldLikelihoods[iterator.getLinearIndex()];
boolean keyPresent = true;
for (int k=0; k < allelePresent.length; k++)
if ( pVec[k]>0 && !allelePresent[k] )
keyPresent = false;
if (keyPresent) {// skip to next entry in logPLs if this conformation is not present in subset
final int[] newCount = new int[allelesToSubset.size()];
// map from old allele mapping count to new allele mapping
// In pseudo-Matlab notation: newCount = vec[permutationKey] for permutationKey vector
for (idx = 0; idx < newCount.length; idx++)
newCount[idx] = pVec[permutationKey[idx]];
// get corresponding index from new count
int outputIdx = GeneralPloidyGenotypeLikelihoods.getLinearIndex(newCount, allelesToSubset.size(), numChromosomes);
newPLs[outputIdx] = pl;
if (VERBOSE) {
System.out.println("Old Key:"+Arrays.toString(pVec));
System.out.println("New Key:"+Arrays.toString(newCount));
}
}
iterator.next();
}
return newPLs;
}
public static int getLinearIndex(int[] vectorIdx, int numAlleles, int ploidy) {
if (ploidy <= 0)
return 0;
int linearIdx = 0;
int cumSum = ploidy;
for (int k=numAlleles-1;k>=1; k--) {
int idx = vectorIdx[k];
// how many blocks are before current position
if (idx == 0)
continue;
for (int p=0; p < idx; p++)
linearIdx += getNumLikelihoodElements( k, cumSum-p);
cumSum -= idx;
}
return linearIdx;
}
/**
* Given a scalar index, what's the alelle count conformation corresponding to it?
* @param nAlleles Number of alleles
* @param numChromosomes Ploidy
* @param PLindex Index to query
* @return Allele count conformation, according to iteration order from SumIterator
*/
public static int[] getAlleleCountFromPLIndex(final int nAlleles, final int numChromosomes, final int PLindex) {
// todo - another brain-dead inefficient implementation, can do much better by computing in closed form
final SumIterator iterator = new SumIterator(nAlleles,numChromosomes);
while (iterator.hasNext()) {
final int[] plVec = iterator.getCurrentVector();
if (iterator.getLinearIndex() == PLindex)
return plVec;
iterator.next();
}
return null;
}
/*
* a cache of the PL ivector sizes as a function of # of alleles and pool sizes
*/
public static int getNumLikelihoodElements(int numAlleles, int ploidy) {
return GenotypeLikelihoodVectorSizes[numAlleles][ploidy];
}
private final static int[][] GenotypeLikelihoodVectorSizes = fillGLVectorSizeCache(MAX_NUM_ALLELES_TO_CACHE, 2*MAX_NUM_SAMPLES_PER_POOL);
private static int[][] fillGLVectorSizeCache(int maxAlleles, int maxPloidy) {
int[][] cache = new int[maxAlleles][maxPloidy];
for (int numAlleles=1; numAlleles < maxAlleles; numAlleles++) {
for (int ploidy=0; ploidy < maxPloidy; ploidy++) {
if (numAlleles == 1)
cache[numAlleles][ploidy] = 1;
else if (ploidy == 1)
cache[numAlleles][ploidy] = numAlleles;
else {
int acc =0;
for (int k=0; k <= ploidy; k++ )
acc += cache[numAlleles-1][ploidy-k];
cache[numAlleles][ploidy] = acc;
}
}
}
return cache;
}
/**
* Return a string representation of this object in a moderately usable form
*
* @return string representation
*/
public String toString() {
StringBuilder s = new StringBuilder(1000);
s.append("Alleles:");
for (Allele a: this.alleles){
s.append(a.getDisplayString());
s.append(",");
}
s.append("\nGLs:\n");
SumIterator iterator = new SumIterator(nAlleles,numChromosomes);
while (iterator.hasNext()) {
if (!Double.isInfinite(getLikelihoods()[iterator.getLinearIndex()])) {
s.append("Count [");
StringBuilder b = new StringBuilder(iterator.getCurrentVector().length*2);
for (int it:iterator.getCurrentVector()) {
b.append(it);
b.append(",");
}
s.append(b.toString());
s.append(String.format("] GL=%4.3f\n",this.getLikelihoods()[iterator.getLinearIndex()]) );
}
iterator.next();
}
return s.toString();
}
public void computeLikelihoods(ErrorModel errorModel,
List<Allele> alleleList, List<Integer> numObservations, ReadBackedPileup pileup) {
if (FAST_GL_COMPUTATION) {
// queue up elements to be computed. Assumptions:
// GLs distributions are unimodal
// GLs are continuous
// Hence, once an AC conformation is computed, we queue up its immediate topological neighbors.
// If neighbors fall below maximum - threshold, we don't queue up THEIR own neighbors
// and we repeat until queue is empty
// queue of AC conformations to process
final LinkedList<AlleleFrequencyCalculationModel.ExactACset> ACqueue = new LinkedList<AlleleFrequencyCalculationModel.ExactACset>();
// mapping of ExactACset indexes to the objects
final HashMap<AlleleFrequencyCalculationModel.ExactACcounts, AlleleFrequencyCalculationModel.ExactACset> indexesToACset = new HashMap<AlleleFrequencyCalculationModel.ExactACcounts, AlleleFrequencyCalculationModel.ExactACset>(likelihoodDim);
// add AC=0 to the queue
final int[] zeroCounts = new int[nAlleles];
zeroCounts[0] = numChromosomes;
AlleleFrequencyCalculationModel.ExactACset zeroSet =
new AlleleFrequencyCalculationModel.ExactACset(1, new AlleleFrequencyCalculationModel.ExactACcounts(zeroCounts));
ACqueue.add(zeroSet);
indexesToACset.put(zeroSet.ACcounts, zeroSet);
// keep processing while we have AC conformations that need to be calculated
double maxLog10L = Double.NEGATIVE_INFINITY;
while ( !ACqueue.isEmpty() ) {
// compute log10Likelihoods
final AlleleFrequencyCalculationModel.ExactACset ACset = ACqueue.remove();
final double log10LofKs = calculateACConformationAndUpdateQueue(ACset, errorModel, alleleList, numObservations, maxLog10L, ACqueue, indexesToACset, pileup);
// adjust max likelihood seen if needed
maxLog10L = Math.max(maxLog10L, log10LofKs);
// clean up memory
indexesToACset.remove(ACset.ACcounts);
if ( VERBOSE )
System.out.printf(" *** removing used set=%s%n", ACset.ACcounts);
}
} else {
int plIdx = 0;
SumIterator iterator = new SumIterator(nAlleles, numChromosomes);
while (iterator.hasNext()) {
AlleleFrequencyCalculationModel.ExactACset ACset =
new AlleleFrequencyCalculationModel.ExactACset(1, new AlleleFrequencyCalculationModel.ExactACcounts(iterator.getCurrentVector()));
// for observed base X, add Q(jX,k) to likelihood vector for all k in error model
//likelihood(jA,jC,jG,jT) = logsum(logPr (errorModel[k],nA*Q(jA,k) + nC*Q(jC,k) + nG*Q(jG,k) + nT*Q(jT,k))
getLikelihoodOfConformation(ACset, errorModel, alleleList, numObservations, pileup);
setLogPLs(plIdx++, ACset.log10Likelihoods[0]);
iterator.next();
}
}
// normalize PL's
renormalize();
}
private double calculateACConformationAndUpdateQueue(final ExactAFCalculationModel.ExactACset set,
final ErrorModel errorModel,
final List<Allele> alleleList,
final List<Integer> numObservations,
final double maxLog10L,
final LinkedList<AlleleFrequencyCalculationModel.ExactACset> ACqueue,
final HashMap<AlleleFrequencyCalculationModel.ExactACcounts,
AlleleFrequencyCalculationModel.ExactACset> indexesToACset,
final ReadBackedPileup pileup) {
// compute likelihood of set
getLikelihoodOfConformation(set, errorModel, alleleList, numObservations, pileup);
final double log10LofK = set.log10Likelihoods[0];
// log result in PL vector
int idx = getLinearIndex(set.ACcounts.getCounts(), nAlleles, numChromosomes);
setLogPLs(idx, log10LofK);
// can we abort early because the log10Likelihoods are so small?
if ( log10LofK < maxLog10L - MAX_LOG10_ERROR_TO_STOP_EARLY ) {
if ( VERBOSE )
System.out.printf(" *** breaking early set=%s log10L=%.2f maxLog10L=%.2f%n", set.ACcounts, log10LofK, maxLog10L);
return log10LofK;
}
// iterate over higher frequencies if possible
// by convention, ACcounts contained in set have full vector of possible pool ac counts including ref count.
final int ACwiggle = numChromosomes - set.getACsum() + set.ACcounts.counts[0];
if ( ACwiggle == 0 ) // all alternate alleles already sum to 2N so we cannot possibly go to higher frequencies
return log10LofK;
// add conformations for other cases
for ( int allele = 1; allele < nAlleles; allele++ ) {
final int[] ACcountsClone = set.ACcounts.getCounts().clone();
ACcountsClone[allele]++;
// is this a valid conformation?
int altSum = (int)MathUtils.sum(ACcountsClone) - ACcountsClone[0];
ACcountsClone[0] = numChromosomes - altSum;
if (ACcountsClone[0] < 0)
continue;
updateACset(ACcountsClone, ACqueue, indexesToACset);
}
return log10LofK;
}
/**
* Abstract methods, must be implemented in subclasses
*
* @param ACset Count to compute
* @param errorModel Site-specific error model object
* @param alleleList List of alleles
* @param numObservations Number of observations for each allele
* @param pileup Read backed pileup in case it's necessary
*/
public abstract void getLikelihoodOfConformation(final AlleleFrequencyCalculationModel.ExactACset ACset,
final ErrorModel errorModel,
final List<Allele> alleleList,
final List<Integer> numObservations,
final ReadBackedPileup pileup);
public abstract int add(ReadBackedPileup pileup, UnifiedArgumentCollection UAC);
// Static methods
public static void updateACset(final int[] newSetCounts,
final LinkedList<AlleleFrequencyCalculationModel.ExactACset> ACqueue,
final HashMap<AlleleFrequencyCalculationModel.ExactACcounts, AlleleFrequencyCalculationModel.ExactACset> indexesToACset) {
final AlleleFrequencyCalculationModel.ExactACcounts index = new AlleleFrequencyCalculationModel.ExactACcounts(newSetCounts);
if ( !indexesToACset.containsKey(index) ) {
AlleleFrequencyCalculationModel.ExactACset newSet = new AlleleFrequencyCalculationModel.ExactACset(1, index);
indexesToACset.put(index, newSet);
ACqueue.add(newSet);
if (VERBOSE)
System.out.println(" *** Adding set to queue:" + index.toString());
}
}
// -----------------------------------------------------------------------------------------------------------------
//
//
// helper routines
//
//
// -----------------------------------------------------------------------------------------------------------------
//
// Constant static data
//
static {
// cache 10^(-k/10)
for (int j=0; j <= SAMUtils.MAX_PHRED_SCORE; j++)
qualVec[j] = Math.pow(10.0,-(double)j/10.0);
}
private void fillCache() {
// cache Q(j,k) = log10(j/2N*(1-ek) + (2N-j)/2N*ek) for j = 0:2N
logMismatchProbabilityArray = new double[1+numChromosomes][1+SAMUtils.MAX_PHRED_SCORE];
for (int i=0; i <= numChromosomes; i++) {
for (int j=0; j <= SAMUtils.MAX_PHRED_SCORE; j++) {
double phi = (double)i/numChromosomes;
logMismatchProbabilityArray[i][j] = Math.log10(phi * (1.0-qualVec[j]) + qualVec[j]/3.0 * (1.0-phi));
}
}
}
}

View File

@ -0,0 +1,353 @@
/*
* Copyright (c) 2010, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.AlignmentContextUtils;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.variantcontext.*;
import java.util.*;
public abstract class GeneralPloidyGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel {
//protected Set<String> laneIDs;
public enum Model {
SNP,
INDEL,
POOLSNP,
POOLINDEL,
BOTH
}
final protected UnifiedArgumentCollection UAC;
protected GeneralPloidyGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) {
super(UAC,logger);
this.UAC = UAC;
}
/*
Get vc with alleles from reference sample. Can be null if there's no ref sample call or no ref sample coverage at this site.
*/
protected VariantContext getTrueAlleles(final RefMetaDataTracker tracker,
final ReferenceContext ref,
Map<String,AlignmentContext> contexts) {
// Get reference base from VCF or Reference
if (UAC.referenceSampleName == null)
return null;
AlignmentContext context = contexts.get(UAC.referenceSampleName);
ArrayList<Allele> trueReferenceAlleles = new ArrayList<Allele>();
VariantContext referenceSampleVC;
if (tracker != null && context != null)
referenceSampleVC = tracker.getFirstValue(UAC.referenceSampleRod, context.getLocation());
else
return null;
if (referenceSampleVC == null) {
trueReferenceAlleles.add(Allele.create(ref.getBase(),true));
return new VariantContextBuilder("pc",ref.getLocus().getContig(), ref.getLocus().getStart(), ref.getLocus().getStop(),trueReferenceAlleles).make();
}
else {
Genotype referenceGenotype = referenceSampleVC.getGenotype(UAC.referenceSampleName);
List<Allele> referenceAlleles = referenceGenotype.getAlleles();
return new VariantContextBuilder("pc",referenceSampleVC.getChr(), referenceSampleVC.getStart(), referenceSampleVC.getEnd(),
referenceSampleVC.getAlleles())
.genotypes(new GenotypeBuilder(UAC.referenceSampleName, referenceAlleles).GQ(referenceGenotype.getGQ()).make())
.make();
}
}
/**
* GATK Engine creates readgroups of the form XXX.Y.Z
* XXX.Y is the unique lane identifier.
* Z is the id of the sample to make the read group id unique
* This function returns the list of lane identifiers.
*
* @param readGroups readGroups A collection of read group strings (obtained from the alignment context pileup)
* @return a collection of lane ids.
*/
public static Set<String> parseLaneIDs(Collection<String> readGroups) {
HashSet<String> result = new HashSet<String>();
for (String readGroup : readGroups) {
result.add(getLaneIDFromReadGroupString(readGroup));
}
return result;
}
/**
* GATK Engine creates readgroups of the form XXX.Y.Z
* XXX.Y is the unique lane identifier.
* Z is the id of the sample to make the read group id unique
*
* @param readGroupID the read group id string
* @return just the lane id (the XXX.Y string)
*/
public static String getLaneIDFromReadGroupString(String readGroupID) {
// System.out.println(readGroupID);
String [] parsedID = readGroupID.split("\\.");
if (parsedID.length > 1)
return parsedID[0] + "." + parsedID[1];
else
return parsedID[0] + ".0";
}
/** Wrapper class that encapsulates likelihood object and sample name
*
*/
protected static class PoolGenotypeData {
public final String name;
public final GeneralPloidyGenotypeLikelihoods GL;
public final int depth;
public final List<Allele> alleles;
public PoolGenotypeData(final String name, final GeneralPloidyGenotypeLikelihoods GL, final int depth, final List<Allele> alleles) {
this.name = name;
this.GL = GL;
this.depth = depth;
this.alleles = alleles;
}
}
// determines the alleles to use
protected List<Allele> determineAlternateAlleles(final List<PoolGenotypeData> sampleDataList) {
if (sampleDataList.isEmpty())
return Collections.emptyList();
final int REFERENCE_IDX = 0;
final List<Allele> allAlleles = sampleDataList.get(0).GL.getAlleles();
double[] likelihoodSums = new double[allAlleles.size()];
// based on the GLs, find the alternate alleles with enough probability
for ( PoolGenotypeData sampleData : sampleDataList ) {
final Pair<int[],Double> mlACPair = sampleData.GL.getMostLikelyACCount();
final double topLogGL = mlACPair.second;
if (sampleData.GL.getAlleles().size() != allAlleles.size())
throw new ReviewedStingException("BUG: inconsistent size of alleles!");
// ref allele is always first in array list
if (sampleData.GL.alleles.get(0).isNonReference())
throw new ReviewedStingException("BUG: first allele in list is not reference!");
double refGL = sampleData.GL.getLikelihoods()[REFERENCE_IDX];
// check if maximum likelihood AC is all-ref for current pool. If so, skip
if (mlACPair.first[REFERENCE_IDX] == sampleData.GL.numChromosomes)
continue;
// most likely AC is not all-ref: for all non-ref alleles, add difference of max likelihood and all-ref likelihood
for (int i=0; i < mlACPair.first.length; i++) {
if (i==REFERENCE_IDX) continue;
if (mlACPair.first[i] > 0)
likelihoodSums[i] += topLogGL - refGL;
}
}
final List<Allele> allelesToUse = new ArrayList<Allele>();
for ( int i = 0; i < likelihoodSums.length; i++ ) {
if ( likelihoodSums[i] > 0.0 )
allelesToUse.add(allAlleles.get(i));
}
return allelesToUse;
}
public VariantContext getLikelihoods(final RefMetaDataTracker tracker,
final ReferenceContext ref,
Map<String, AlignmentContext> contexts,
final AlignmentContextUtils.ReadOrientation contextType,
final List<Allele> allAllelesToUse,
final boolean useBAQedPileup,
final GenomeLocParser locParser) {
HashMap<String, ErrorModel> perLaneErrorModels = getPerLaneErrorModels(tracker, ref, contexts);
if (perLaneErrorModels == null && UAC.referenceSampleName != null)
return null;
if (UAC.TREAT_ALL_READS_AS_SINGLE_POOL) {
AlignmentContext mergedContext = AlignmentContextUtils.joinContexts(contexts.values());
Map<String,AlignmentContext> newContext = new HashMap<String,AlignmentContext>();
newContext.put(DUMMY_SAMPLE_NAME,mergedContext);
contexts = newContext;
}
// get initial alleles to genotype
final List<Allele> allAlleles = new ArrayList<Allele>();
if (allAllelesToUse == null || allAllelesToUse.isEmpty())
allAlleles.addAll(getInitialAllelesToUse(tracker, ref,contexts,contextType,locParser, allAllelesToUse));
else
allAlleles.addAll(allAllelesToUse);
if (allAlleles.isEmpty())
return null;
final ArrayList<PoolGenotypeData> GLs = new ArrayList<PoolGenotypeData>(contexts.size());
for ( Map.Entry<String, AlignmentContext> sample : contexts.entrySet() ) {
// skip reference sample
if (UAC.referenceSampleName != null && sample.getKey().equals(UAC.referenceSampleName))
continue;
ReadBackedPileup pileup = AlignmentContextUtils.stratify(sample.getValue(), contextType).getBasePileup();
// create the GenotypeLikelihoods object
final GeneralPloidyGenotypeLikelihoods GL = getPoolGenotypeLikelihoodObject(allAlleles, null, UAC.samplePloidy, perLaneErrorModels, useBAQedPileup, ref, UAC.IGNORE_LANE_INFO);
// actually compute likelihoods
final int nGoodBases = GL.add(pileup, UAC);
if ( nGoodBases > 0 )
// create wrapper object for likelihoods and add to list
GLs.add(new PoolGenotypeData(sample.getKey(), GL, getFilteredDepth(pileup), allAlleles));
}
// find the alternate allele(s) that we should be using
final List<Allele> alleles = getFinalAllelesToUse(tracker, ref, allAllelesToUse, GLs);
if (alleles == null || alleles.isEmpty())
return null;
// start making the VariantContext
final GenomeLoc loc = ref.getLocus();
final int endLoc = getEndLocation(tracker, ref, alleles);
final VariantContextBuilder builder = new VariantContextBuilder("UG_call", loc.getContig(), loc.getStart(), endLoc, alleles);
builder.alleles(alleles);
final HashMap<String, Object> attributes = new HashMap<String, Object>();
if (UAC.referenceSampleName != null && perLaneErrorModels != null)
attributes.put(VCFConstants.REFSAMPLE_DEPTH_KEY, ErrorModel.getTotalReferenceDepth(perLaneErrorModels));
builder.attributes(attributes);
// create the genotypes; no-call everyone for now
final GenotypesContext genotypes = GenotypesContext.create();
final List<Allele> noCall = new ArrayList<Allele>();
noCall.add(Allele.NO_CALL);
for ( PoolGenotypeData sampleData : GLs ) {
// extract from multidimensional array
final double[] myLikelihoods = GeneralPloidyGenotypeLikelihoods.subsetToAlleles(sampleData.GL.getLikelihoods(), sampleData.GL.numChromosomes,
allAlleles, alleles);
// normalize in log space so that max element is zero.
final GenotypeBuilder gb = new GenotypeBuilder(sampleData.name, noCall);
gb.DP(sampleData.depth);
gb.PL(MathUtils.normalizeFromLog10(myLikelihoods, false, true));
genotypes.add(gb.make());
}
return builder.genotypes(genotypes).make();
}
protected HashMap<String, ErrorModel> getPerLaneErrorModels(final RefMetaDataTracker tracker,
final ReferenceContext ref,
Map<String, AlignmentContext> contexts) {
VariantContext refVC = getTrueAlleles(tracker, ref, contexts);
// Build error model for site based on reference sample, and keep stratified for each lane.
AlignmentContext refContext = null;
if (UAC.referenceSampleName != null)
refContext = contexts.get(UAC.referenceSampleName);
ReadBackedPileup refPileup = null;
if (refContext != null) {
HashMap<String, ErrorModel> perLaneErrorModels = new HashMap<String, ErrorModel>();
refPileup = refContext.getBasePileup();
Set<String> laneIDs = new TreeSet<String>();
if (UAC.TREAT_ALL_READS_AS_SINGLE_POOL || UAC.IGNORE_LANE_INFO)
laneIDs.add(DUMMY_LANE);
else
laneIDs = parseLaneIDs(refPileup.getReadGroups());
// build per-lane error model for all lanes present in ref sample
for (String laneID : laneIDs) {
// get reference pileup for this lane
ReadBackedPileup refLanePileup = refPileup;
// subset for this lane
if (refPileup != null && !(UAC.TREAT_ALL_READS_AS_SINGLE_POOL || UAC.IGNORE_LANE_INFO))
refLanePileup = refPileup.getPileupForLane(laneID);
//ReferenceSample referenceSample = new ReferenceSample(UAC.referenceSampleName, refLanePileup, trueReferenceAlleles);
perLaneErrorModels.put(laneID, new ErrorModel(UAC, refLanePileup, refVC, ref));
}
return perLaneErrorModels;
}
else
return null;
}
/*
Abstract methods - must be implemented in derived classes
*/
protected abstract GeneralPloidyGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List<Allele> alleles,
final double[] logLikelihoods,
final int ploidy,
final HashMap<String, ErrorModel> perLaneErrorModels,
final boolean useBQAedPileup,
final ReferenceContext ref,
final boolean ignoreLaneInformation);
protected abstract List<Allele> getInitialAllelesToUse(final RefMetaDataTracker tracker,
final ReferenceContext ref,
Map<String, AlignmentContext> contexts,
final AlignmentContextUtils.ReadOrientation contextType,
final GenomeLocParser locParser,
final List<Allele> allAllelesToUse);
protected abstract List<Allele> getFinalAllelesToUse(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final List<Allele> allAllelesToUse,
final ArrayList<PoolGenotypeData> GLs);
protected abstract int getEndLocation(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final List<Allele> alternateAllelesToUse);
}

View File

@ -0,0 +1,221 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.walkers.indels.PairHMMIndelErrorModel;
import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import java.util.*;
/**
* Created by IntelliJ IDEA.
* User: delangel
* Date: 5/18/12
* Time: 10:06 AM
* To change this template use File | Settings | File Templates.
*/
public class GeneralPloidyIndelGenotypeLikelihoods extends GeneralPloidyGenotypeLikelihoods {
final PairHMMIndelErrorModel pairModel;
final LinkedHashMap<Allele, Haplotype> haplotypeMap;
final ReferenceContext refContext;
final int eventLength;
double[][] readHaplotypeLikelihoods;
final byte refBase;
public GeneralPloidyIndelGenotypeLikelihoods(final List<Allele> alleles,
final double[] logLikelihoods,
final int ploidy,
final HashMap<String, ErrorModel> perLaneErrorModels,
final boolean ignoreLaneInformation,
final PairHMMIndelErrorModel pairModel,
final LinkedHashMap<Allele, Haplotype> haplotypeMap,
final ReferenceContext referenceContext) {
super(alleles, logLikelihoods, ploidy, perLaneErrorModels, ignoreLaneInformation);
this.pairModel = pairModel;
this.haplotypeMap = haplotypeMap;
this.refContext = referenceContext;
this.eventLength = IndelGenotypeLikelihoodsCalculationModel.getEventLength(alleles);
// todo - not needed if indel alleles have base at current position
this.refBase = referenceContext.getBase();
}
// -------------------------------------------------------------------------------------
//
// add() routines. These are the workhorse routines for calculating the overall genotype
// likelihoods given observed bases and reads. Includes high-level operators all the
// way down to single base and qual functions.
//
// -------------------------------------------------------------------------------------
/**
* Updates likelihoods and posteriors to reflect the additional observations contained within the
* read-based pileup up by calling add(observedBase, qualityScore) for each base / qual in the
* pileup
*
* @param pileup read pileup
* @param UAC the minimum base quality at which to consider a base valid
* @return the number of good bases found in the pileup
*/
public int add(ReadBackedPileup pileup, UnifiedArgumentCollection UAC) {
int n = 0;
if (!hasReferenceSampleData) {
// no error models
return add(pileup, (ErrorModel)null);
}
for (String laneID : perLaneErrorModels.keySet() ) {
// get pileup for this lane
ReadBackedPileup perLanePileup;
if (ignoreLaneInformation)
perLanePileup = pileup;
else
perLanePileup = pileup.getPileupForLane(laneID);
if (perLanePileup == null || perLanePileup.isEmpty())
continue;
ErrorModel errorModel = perLaneErrorModels.get(laneID);
n += add(perLanePileup, errorModel);
if (ignoreLaneInformation)
break;
}
return n;
}
/**
* Calculates the pool's probability for all possible allele counts for all indel alleles observed.
* Calculation is based on the error model
* generated by the reference sample on the same lane. The probability is given by :
*
* Pr(ac = j1,j2,.. | pool, errorModel) = sum_over_all_Qs ( Pr(j1,j2,.. * Pr(errorModel_q) *
* Pr(ac=j1,j2,..| pool, errorModel) = sum_over_all_Qs ( Pr(ac=j1,j2,..) * Pr(errorModel_q) *
* [j1 * (1-eq)/2n + eq/3*(2*N-j1)
* [jA*(1-eq)/2n + eq/3*(jc+jg+jt)/2N)^nA * jC*(1-eq)/2n + eq/3*(ja+jg+jt)/2N)^nC *
* jG*(1-eq)/2n + eq/3*(jc+ja+jt)/2N)^nG * jT*(1-eq)/2n + eq/3*(jc+jg+ja)/2N)^nT
*
* log Pr(ac=jA,jC,jG,jT| pool, errorModel) = logsum( Pr(ac=jA,jC,jG,jT) * Pr(errorModel_q) *
* [jA*(1-eq)/2n + eq/3*(jc+jg+jt)/2N)^nA * jC*(1-eq)/2n + eq/3*(ja+jg+jt)/2N)^nC *
* jG*(1-eq)/2n + eq/3*(jc+ja+jt)/2N)^nG * jT*(1-eq)/2n + eq/3*(jc+jg+ja)/2N)^nT)
* = logsum(logPr(ac=jA,jC,jG,jT) + log(Pr(error_Model(q)
* )) + nA*log(jA/2N(1-eq)+eq/3*(2N-jA)/2N) + nC*log(jC/2N(1-eq)+eq/3*(2N-jC)/2N)
* + log(jG/2N(1-eq)+eq/3*(2N-jG)/2N) + log(jT/2N(1-eq)+eq/3*(2N-jT)/2N)
*
* Let Q(j,k) = log(j/2N*(1-e[k]) + (2N-j)/2N*e[k]/3)
*
* Then logPr(ac=jA,jC,jG,jT|D,errorModel) = logPR(ac=Ja,jC,jG,jT) + logsum_k( logPr (errorModel[k],
* nA*Q(jA,k) + nC*Q(jC,k) + nG*Q(jG,k) + nT*Q(jT,k))
*
* If pileup data comes from several error models (because lanes can have different error models),
* Pr(Ac=j|D,E1,E2) = sum(Pr(AC1=j1|D,E1,E2) * Pr(AC2=j-j2|D,E1,E2))
* = sum(Pr(AC1=j1|D,E1)*Pr(AC2=j-j1|D,E2)) from j=0..2N
*
* So, for each lane, build error model and combine lanes.
* To store model, can do
* for jA=0:2N
* for jC = 0:2N-jA
* for jG = 0:2N-jA-jC
* for jT = 0:2N-jA-jC-jG
* Q(jA,jC,jG,jT)
* for k = minSiteQual:maxSiteQual
* likelihood(jA,jC,jG,jT) = logsum(logPr (errorModel[k],nA*Q(jA,k) + nC*Q(jC,k) + nG*Q(jG,k) + nT*Q(jT,k))
*
*
*
* where: nA,nC,nG,nT = counts of bases observed in pileup.
*
*
* @param pileup Base pileup
* @param errorModel Site error model
* @return Number of bases added
*/
private int add(ReadBackedPileup pileup, ErrorModel errorModel) {
int n=0;
// Number of alleless in pileup, in that order
List<Integer> numSeenBases = new ArrayList<Integer>(this.alleles.size());
if (!hasReferenceSampleData) {
final int numHaplotypes = haplotypeMap.size();
final int readCounts[] = new int[pileup.getNumberOfElements()];
readHaplotypeLikelihoods = pairModel.computeGeneralReadHaplotypeLikelihoods(pileup, haplotypeMap, refContext, eventLength, IndelGenotypeLikelihoodsCalculationModel.getIndelLikelihoodMap(), readCounts);
n = readHaplotypeLikelihoods.length;
} else {
Allele refAllele = null;
for (Allele a:alleles) {
numSeenBases.add(0);
if (a.isReference())
refAllele = a;
}
if (refAllele == null)
throw new ReviewedStingException("BUG: no ref alleles in passed in allele list!");
// count number of elements in pileup
for (PileupElement elt : pileup) {
if (VERBOSE)
System.out.format("base:%s isNextToDel:%b isNextToIns:%b eventBases:%s eventLength:%d\n",elt.getBase(), elt.isBeforeDeletionStart(),elt.isBeforeInsertion(),elt.getEventBases(),elt.getEventLength());
int idx =0;
for (Allele allele : alleles) {
int cnt = numSeenBases.get(idx);
numSeenBases.set(idx++,cnt + (ErrorModel.pileupElementMatches(elt, allele, refAllele, refBase)?1:0));
}
n++;
}
}
computeLikelihoods(errorModel, alleles, numSeenBases, pileup);
return n;
}
/**
* Compute likelihood of current conformation
*
* @param ACset Count to compute
* @param errorModel Site-specific error model object
* @param alleleList List of alleles
* @param numObservations Number of observations for each allele in alleleList
*/
public void getLikelihoodOfConformation(final AlleleFrequencyCalculationModel.ExactACset ACset,
final ErrorModel errorModel,
final List<Allele> alleleList,
final List<Integer> numObservations,
final ReadBackedPileup pileup) {
final int[] currentCnt = Arrays.copyOf(ACset.ACcounts.counts, alleleList.size());
double p1 = 0.0;
if (!hasReferenceSampleData) {
// no error model: use pair HMM likelihoods
for (int i=0; i < readHaplotypeLikelihoods.length; i++) {
double acc[] = new double[alleleList.size()];
for (int k=0; k < acc.length; k++ )
acc[k] = readHaplotypeLikelihoods[i][k] + MathUtils.log10Cache[currentCnt[k]]-LOG10_PLOIDY;
p1 += MathUtils.log10sumLog10(acc);
}
} else {
final int minQ = errorModel.getMinSignificantQualityScore();
final int maxQ = errorModel.getMaxSignificantQualityScore();
final double[] acVec = new double[maxQ - minQ + 1];
for (int k=minQ; k<=maxQ; k++) {
int idx=0;
for (int n : numObservations)
acVec[k-minQ] += n*logMismatchProbabilityArray[currentCnt[idx++]][k];
}
p1 = MathUtils.logDotProduct(errorModel.getErrorModelVector().getProbabilityVector(minQ, maxQ), acVec);
}
ACset.log10Likelihoods[0] = p1;
}
}

View File

@ -0,0 +1,125 @@
/*
* Copyright (c) 2010.
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.AlignmentContextUtils;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.indels.PairHMMIndelErrorModel;
import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.variantcontext.*;
import java.util.*;
public class GeneralPloidyIndelGenotypeLikelihoodsCalculationModel extends GeneralPloidyGenotypeLikelihoodsCalculationModel {
private static final int MAX_NUM_ALLELES_TO_GENOTYPE = 4;
private PairHMMIndelErrorModel pairModel;
/*
private static ThreadLocal<HashMap<PileupElement, LinkedHashMap<Allele, Double>>> indelLikelihoodMap =
new ThreadLocal<HashMap<PileupElement, LinkedHashMap<Allele, Double>>>() {
protected synchronized HashMap<PileupElement, LinkedHashMap<Allele, Double>> initialValue() {
return new HashMap<PileupElement, LinkedHashMap<Allele, Double>>();
}
};
*/
private LinkedHashMap<Allele, Haplotype> haplotypeMap;
/*
static {
indelLikelihoodMap.set(new HashMap<PileupElement, LinkedHashMap<Allele, Double>>());
}
*/
protected GeneralPloidyIndelGenotypeLikelihoodsCalculationModel(final UnifiedArgumentCollection UAC, final Logger logger) {
super(UAC, logger);
pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY,
UAC.OUTPUT_DEBUG_INDEL_INFO, !UAC.DONT_DO_BANDED_INDEL_COMPUTATION);
haplotypeMap = new LinkedHashMap<Allele, Haplotype>();
}
protected GeneralPloidyGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List<Allele> alleles,
final double[] logLikelihoods,
final int ploidy,
final HashMap<String, ErrorModel> perLaneErrorModels,
final boolean useBQAedPileup,
final ReferenceContext ref,
final boolean ignoreLaneInformation){
return new GeneralPloidyIndelGenotypeLikelihoods(alleles, logLikelihoods, ploidy,perLaneErrorModels,ignoreLaneInformation, pairModel, haplotypeMap, ref);
}
protected List<Allele> getInitialAllelesToUse(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final Map<String, AlignmentContext> contexts,
final AlignmentContextUtils.ReadOrientation contextType,
final GenomeLocParser locParser,
final List<Allele> allAllelesToUse){
List<Allele> alleles = IndelGenotypeLikelihoodsCalculationModel.getInitialAlleleList(tracker, ref, contexts, contextType, locParser, UAC,true);
if (alleles.size() > MAX_NUM_ALLELES_TO_GENOTYPE)
alleles = alleles.subList(0,MAX_NUM_ALLELES_TO_GENOTYPE);
if (contextType == AlignmentContextUtils.ReadOrientation.COMPLETE) {
IndelGenotypeLikelihoodsCalculationModel.getIndelLikelihoodMap().clear();
haplotypeMap.clear();
}
IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles(alleles, ref, ref.getLocus(), haplotypeMap);
// sanity check: if haplotype map couldn't be created, clear allele list
if (haplotypeMap.isEmpty())
alleles.clear();
return alleles;
}
protected List<Allele> getFinalAllelesToUse(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final List<Allele> allAllelesToUse,
final ArrayList<PoolGenotypeData> GLs) {
// find the alternate allele(s) that we should be using
final List<Allele> alleles = new ArrayList<Allele>();
if ( allAllelesToUse != null )
alleles.addAll(allAllelesToUse);
else if (!GLs.isEmpty())
alleles.addAll(GLs.get(0).alleles);
return alleles;
}
protected int getEndLocation(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final List<Allele> allelesToUse) {
return ref.getLocus().getStart() + allelesToUse.get(0).length() - 1;
}
}

View File

@ -0,0 +1,356 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import net.sf.samtools.SAMUtils;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileupImpl;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import java.util.*;
import static java.lang.Math.log10;
import static java.lang.Math.pow;
/**
* Stable, error checking version of the pool genotyper. Useful for calculating the likelihoods, priors,
* and posteriors given a pile of bases and quality scores
*
*/
public class GeneralPloidySNPGenotypeLikelihoods extends GeneralPloidyGenotypeLikelihoods/* implements Cloneable*/ {
final List<Allele> myAlleles;
final int[] alleleIndices;
final boolean useBAQedPileup;
final byte refByte;
int mbq;
//final double[] PofDGivenBase;
protected static final double[][][] qualLikelihoodCache;
/**
* Create a new GenotypeLikelhoods object with given priors and PCR error rate for each pool genotype
* @param alleles Alleles associated with this likelihood object
* @param logLikelihoods Likelihoods (can be null if no likelihoods known)
* @param ploidy Ploidy of sample (# of chromosomes)
* @param perLaneErrorModels error model objects for each lane
* @param useBQAedPileup Use BAQed pileup
* @param ignoreLaneInformation If true, lane info is ignored
*/
public GeneralPloidySNPGenotypeLikelihoods(final List<Allele> alleles, final double[] logLikelihoods, final int ploidy,
final HashMap<String, ErrorModel> perLaneErrorModels, final boolean useBQAedPileup, final boolean ignoreLaneInformation) {
super(alleles, logLikelihoods, ploidy, perLaneErrorModels, ignoreLaneInformation);
this.useBAQedPileup = useBQAedPileup;
myAlleles = new ArrayList<Allele>(alleles);
Allele refAllele = alleles.get(0);
//sanity check: by construction, first allele should ALWAYS be the reference alleles
if (!refAllele.isReference())
throw new ReviewedStingException("BUG: First allele in list passed to GeneralPloidySNPGenotypeLikelihoods should be reference!");
refByte = refAllele.getBases()[0]; // by construction, first allele in list is always ref!
if (myAlleles.size() < BaseUtils.BASES.length) {
// likelihood only defined for subset of possible alleles. Fill then with other alleles to have all possible ones,
for (byte b : BaseUtils.BASES) {
// if base is not included in myAlleles, add new allele
boolean isRef = (b==refByte);
if (!myAlleles.contains(Allele.create(b,isRef)))
myAlleles.add(Allele.create(b,isRef));
}
}
// compute permutation vector to figure out mapping from indices to bases
int idx = 0;
alleleIndices = new int[myAlleles.size()];
for (byte b : BaseUtils.BASES) {
boolean isRef = (b==refByte);
alleleIndices[idx++] = myAlleles.indexOf(Allele.create(b,isRef));
}
}
// -------------------------------------------------------------------------------------
//
// add() routines. These are the workhorse routines for calculating the overall genotype
// likelihoods given observed bases and reads. Includes high-level operators all the
// way down to single base and qual functions.
//
// -------------------------------------------------------------------------------------
public int add(ReadBackedPileup pileup, UnifiedArgumentCollection UAC) {
mbq = UAC.MIN_BASE_QUALTY_SCORE; // record for later use
return add(pileup, true, true, mbq);
}
/**
* Updates likelihoods and posteriors to reflect the additional observations contained within the
* read-based pileup up by calling add(observedBase, qualityScore) for each base / qual in the
* pileup
*
* @param pileup read pileup
* @param ignoreBadBases should we ignore bad bases?
* @param capBaseQualsAtMappingQual should we cap a base's quality by its read's mapping quality?
* @param minBaseQual the minimum base quality at which to consider a base valid
* @return the number of good bases found in the pileup
*/
public int add(ReadBackedPileup pileup, boolean ignoreBadBases, boolean capBaseQualsAtMappingQual, int minBaseQual) {
int n = 0;
if ( useBAQedPileup )
pileup = createBAQedPileup( pileup );
if (!hasReferenceSampleData) {
return add(pileup, ignoreBadBases, capBaseQualsAtMappingQual, minBaseQual, null);
}
for (String laneID : perLaneErrorModels.keySet() ) {
// get pileup for this lane
ReadBackedPileup perLanePileup;
if (ignoreLaneInformation)
perLanePileup = pileup;
else
perLanePileup = pileup.getPileupForLane(laneID);
if (perLanePileup == null || perLanePileup.isEmpty())
continue;
ErrorModel errorModel = perLaneErrorModels.get(laneID);
n += add(perLanePileup, ignoreBadBases, capBaseQualsAtMappingQual, minBaseQual, errorModel);
if (ignoreLaneInformation)
break;
}
return n;
}
/**
* Calculates the pool's probability for all possible allele counts for all bases. Calculation is based on the error model
* generated by the reference sample on the same lane. The probability is given by :
*
* Pr(ac=jA,jC,jG,jT| pool, errorModel) = sum_over_all_Qs ( Pr(ac=jA,jC,jG,jT) * Pr(errorModel_q) *
* [jA*(1-eq)/2n + eq/3*(jc+jg+jt)/2N)^nA * jC*(1-eq)/2n + eq/3*(ja+jg+jt)/2N)^nC *
* jG*(1-eq)/2n + eq/3*(jc+ja+jt)/2N)^nG * jT*(1-eq)/2n + eq/3*(jc+jg+ja)/2N)^nT
*
* log Pr(ac=jA,jC,jG,jT| pool, errorModel) = logsum( Pr(ac=jA,jC,jG,jT) * Pr(errorModel_q) *
* [jA*(1-eq)/2n + eq/3*(jc+jg+jt)/2N)^nA * jC*(1-eq)/2n + eq/3*(ja+jg+jt)/2N)^nC *
* jG*(1-eq)/2n + eq/3*(jc+ja+jt)/2N)^nG * jT*(1-eq)/2n + eq/3*(jc+jg+ja)/2N)^nT)
* = logsum(logPr(ac=jA,jC,jG,jT) + log(Pr(error_Model(q)
* )) + nA*log(jA/2N(1-eq)+eq/3*(2N-jA)/2N) + nC*log(jC/2N(1-eq)+eq/3*(2N-jC)/2N)
* + log(jG/2N(1-eq)+eq/3*(2N-jG)/2N) + log(jT/2N(1-eq)+eq/3*(2N-jT)/2N)
*
* Let Q(j,k) = log(j/2N*(1-e[k]) + (2N-j)/2N*e[k]/3)
*
* Then logPr(ac=jA,jC,jG,jT|D,errorModel) = logPR(ac=Ja,jC,jG,jT) + logsum_k( logPr (errorModel[k],
* nA*Q(jA,k) + nC*Q(jC,k) + nG*Q(jG,k) + nT*Q(jT,k))
*
* If pileup data comes from several error models (because lanes can have different error models),
* Pr(Ac=j|D,E1,E2) = sum(Pr(AC1=j1|D,E1,E2) * Pr(AC2=j-j2|D,E1,E2))
* = sum(Pr(AC1=j1|D,E1)*Pr(AC2=j-j1|D,E2)) from j=0..2N
*
* So, for each lane, build error model and combine lanes.
* To store model, can do
* for jA=0:2N
* for jC = 0:2N-jA
* for jG = 0:2N-jA-jC
* for jT = 0:2N-jA-jC-jG
* Q(jA,jC,jG,jT)
* for k = minSiteQual:maxSiteQual
* likelihood(jA,jC,jG,jT) = logsum(logPr (errorModel[k],nA*Q(jA,k) + nC*Q(jC,k) + nG*Q(jG,k) + nT*Q(jT,k))
*
*
*
* where: nA,nC,nG,nT = counts of bases observed in pileup.
*
*
* @param pileup Base pileup
* @param ignoreBadBases Whether to ignore bad bases
* @param capBaseQualsAtMappingQual Cap base at mapping qual
* @param minBaseQual Minimum base quality to consider
* @param errorModel Site error model
* @return Number of bases added
*/
private int add(ReadBackedPileup pileup, boolean ignoreBadBases, boolean capBaseQualsAtMappingQual, int minBaseQual, ErrorModel errorModel) {
// Number of [A C G T]'s in pileup, in that order
List<Integer> numSeenBases = new ArrayList<Integer>(BaseUtils.BASES.length);
for (byte b: BaseUtils.BASES)
numSeenBases.add(0);
if (hasReferenceSampleData) {
// count number of elements in pileup
for (PileupElement elt : pileup) {
byte obsBase = elt.getBase();
byte qual = qualToUse(elt, ignoreBadBases, capBaseQualsAtMappingQual, minBaseQual);
if ( qual == 0 )
continue;
int idx = 0;
for (byte base:BaseUtils.BASES) {
int cnt = numSeenBases.get(idx);
numSeenBases.set(idx++,cnt + (base == obsBase?1:0));
}
}
if (VERBOSE)
System.out.format("numSeenBases: %d %d %d %d\n",numSeenBases.get(0),numSeenBases.get(1),numSeenBases.get(2),numSeenBases.get(3));
}
computeLikelihoods(errorModel, myAlleles, numSeenBases, pileup);
return pileup.getNumberOfElements();
}
/**
* Compute likelihood of current conformation
*
* @param ACset Count to compute
* @param errorModel Site-specific error model object
* @param alleleList List of alleles
* @param numObservations Number of observations for each allele in alleleList
*/
public void getLikelihoodOfConformation(final AlleleFrequencyCalculationModel.ExactACset ACset,
final ErrorModel errorModel,
final List<Allele> alleleList,
final List<Integer> numObservations,
final ReadBackedPileup pileup) {
final int[] currentCnt = Arrays.copyOf(ACset.ACcounts.counts, BaseUtils.BASES.length);
final int[] ac = new int[BaseUtils.BASES.length];
for (int k=0; k < BaseUtils.BASES.length; k++ )
ac[k] = currentCnt[alleleIndices[k]];
double p1 = 0.0;
if (!hasReferenceSampleData) {
// no error model: loop throught pileup to compute likalihoods just on base qualities
for (final PileupElement elt : pileup) {
final byte obsBase = elt.getBase();
final byte qual = qualToUse(elt, true, true, mbq);
if ( qual == 0 )
continue;
final double acc[] = new double[ACset.ACcounts.counts.length];
for (int k=0; k < acc.length; k++ )
acc[k] = qualLikelihoodCache[BaseUtils.simpleBaseToBaseIndex(alleleList.get(k).getBases()[0])][BaseUtils.simpleBaseToBaseIndex(obsBase)][qual] +MathUtils.log10Cache[ACset.ACcounts.counts[k]]
- LOG10_PLOIDY;
p1 += MathUtils.log10sumLog10(acc);
}
}
else {
final int minQ = errorModel.getMinSignificantQualityScore();
final int maxQ = errorModel.getMaxSignificantQualityScore();
final double[] acVec = new double[maxQ - minQ + 1];
final int nA = numObservations.get(0);
final int nC = numObservations.get(1);
final int nG = numObservations.get(2);
final int nT = numObservations.get(3);
for (int k=minQ; k<=maxQ; k++)
acVec[k-minQ] = nA*logMismatchProbabilityArray[ac[0]][k] +
nC*logMismatchProbabilityArray[ac[1]][k] +
nG*logMismatchProbabilityArray[ac[2]][k] +
nT*logMismatchProbabilityArray[ac[3]][k];
p1 = MathUtils.logDotProduct(errorModel.getErrorModelVector().getProbabilityVector(minQ,maxQ), acVec);
}
ACset.log10Likelihoods[0] = p1;
/* System.out.println(Arrays.toString(ACset.ACcounts.getCounts())+" "+String.valueOf(p1));
System.out.println(Arrays.toString(errorModel.getErrorModelVector().getProbabilityVector(minQ,maxQ)));
*/
}
public ReadBackedPileup createBAQedPileup( final ReadBackedPileup pileup ) {
final List<PileupElement> BAQedElements = new ArrayList<PileupElement>();
for( final PileupElement PE : pileup ) {
final PileupElement newPE = new BAQedPileupElement( PE );
BAQedElements.add( newPE );
}
return new ReadBackedPileupImpl( pileup.getLocation(), BAQedElements );
}
public class BAQedPileupElement extends PileupElement {
public BAQedPileupElement( final PileupElement PE ) {
super(PE.getRead(), PE.getOffset(), PE.isDeletion(), PE.isBeforeDeletedBase(), PE.isAfterDeletedBase(), PE.isBeforeInsertion(), PE.isAfterInsertion(), PE.isNextToSoftClip());
}
@Override
public byte getQual( final int offset ) { return BAQ.calcBAQFromTag(getRead(), offset, true); }
}
/**
* Helper function that returns the phred-scaled base quality score we should use for calculating
* likelihoods for a pileup element. May return 0 to indicate that the observation is bad, and may
* cap the quality score by the mapping quality of the read itself.
*
* @param p Pileup element
* @param ignoreBadBases Flag to ignore bad bases
* @param capBaseQualsAtMappingQual Whether to cap base Q at mapping quality
* @param minBaseQual Min qual to use
* @return New phred-scaled base quality
*/
private static byte qualToUse(PileupElement p, boolean ignoreBadBases, boolean capBaseQualsAtMappingQual, int minBaseQual) {
if ( ignoreBadBases && !BaseUtils.isRegularBase( p.getBase() ) )
return 0;
byte qual = p.getQual();
if ( qual > SAMUtils.MAX_PHRED_SCORE )
throw new UserException.MalformedBAM(p.getRead(), String.format("the maximum allowed quality score is %d, but a quality of %d was observed in read %s. Perhaps your BAM incorrectly encodes the quality scores in Sanger format; see http://en.wikipedia.org/wiki/FASTQ_format for more details", SAMUtils.MAX_PHRED_SCORE, qual, p.getRead().getReadName()));
if ( capBaseQualsAtMappingQual )
qual = (byte)Math.min((int)qual, p.getMappingQual());
if ( (int)qual < minBaseQual )
qual = (byte)0;
return qual;
}
static {
qualLikelihoodCache = new double[BaseUtils.BASES.length][BaseUtils.BASES.length][1+SAMUtils.MAX_PHRED_SCORE];
for (byte j=0; j <= SAMUtils.MAX_PHRED_SCORE; j++) {
for (byte b1:BaseUtils.BASES) {
for (byte b2:BaseUtils.BASES) {
qualLikelihoodCache[BaseUtils.simpleBaseToBaseIndex(b1)][BaseUtils.simpleBaseToBaseIndex(b2)][j] = log10PofObservingBaseGivenChromosome(b1,b2,j);
}
}
}
}
/**
*
* @param observedBase observed base
* @param chromBase target base
* @param qual base quality
* @return log10 likelihood
*/
private static double log10PofObservingBaseGivenChromosome(byte observedBase, byte chromBase, byte qual) {
final double log10_3 = log10(3.0);
double logP;
if ( observedBase == chromBase ) {
// the base is consistent with the chromosome -- it's 1 - e
//logP = oneMinusData[qual];
double e = pow(10, (qual / -10.0));
logP = log10(1.0 - e);
} else {
// the base is inconsistent with the chromosome -- it's e * P(chromBase | observedBase is an error)
logP = qual / -10.0 + (-log10_3);
}
//System.out.printf("%c %c %d => %f%n", observedBase, chromBase, qual, logP);
return logP;
}
}

View File

@ -0,0 +1,128 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
/*
* Copyright (c) 2010.
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
import org.apache.log4j.Logger;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.AlignmentContextUtils;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.variantcontext.*;
import java.util.*;
public class GeneralPloidySNPGenotypeLikelihoodsCalculationModel extends GeneralPloidyGenotypeLikelihoodsCalculationModel {
protected GeneralPloidySNPGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) {
super(UAC, logger);
}
protected GeneralPloidyGenotypeLikelihoods getPoolGenotypeLikelihoodObject(final List<Allele> alleles,
final double[] logLikelihoods,
final int ploidy,
final HashMap<String, ErrorModel> perLaneErrorModels,
final boolean useBQAedPileup,
final ReferenceContext ref,
final boolean ignoreLaneInformation) {
return new GeneralPloidySNPGenotypeLikelihoods(alleles, null, UAC.samplePloidy, perLaneErrorModels, useBQAedPileup, UAC.IGNORE_LANE_INFO);
}
protected List<Allele> getInitialAllelesToUse(final RefMetaDataTracker tracker,
final ReferenceContext ref,
Map<String, AlignmentContext> contexts,
final AlignmentContextUtils.ReadOrientation contextType,
final GenomeLocParser locParser,
final List<Allele> allAllelesToUse) {
if (allAllelesToUse != null)
return allAllelesToUse;
final byte refBase = ref.getBase();
final List<Allele> allAlleles = new ArrayList<Allele>();
// first add ref allele
allAlleles.add(Allele.create(refBase, true));
// add all possible alt alleles
for (byte b: BaseUtils.BASES) {
if (refBase != b)
allAlleles.add(Allele.create(b));
}
return allAlleles;
}
protected List<Allele> getFinalAllelesToUse(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final List<Allele> allAllelesToUse,
final ArrayList<PoolGenotypeData> GLs) {
// find the alternate allele(s) that we should be using
final List<Allele> alleles = new ArrayList<Allele>();
if ( allAllelesToUse != null ) {
alleles.addAll(allAllelesToUse);
} else if ( UAC.GenotypingMode == GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) {
final VariantContext vc = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, ref, ref.getLocus(), true, logger, UAC.alleles);
// ignore places where we don't have a SNP
if ( vc == null || !vc.isSNP() )
return null;
alleles.addAll(vc.getAlleles());
} else {
alleles.add(Allele.create(ref.getBase(),true));
alleles.addAll(determineAlternateAlleles( GLs));
// if there are no non-ref alleles...
if ( alleles.size() == 1 ) {
final int indexOfRefBase = BaseUtils.simpleBaseToBaseIndex(ref.getBase());
// if we only want variants, then we don't need to calculate genotype likelihoods
if ( UAC.OutputMode != UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY )
// otherwise, choose any alternate allele (it doesn't really matter)
alleles.add(Allele.create(BaseUtils.baseIndexToSimpleBase(indexOfRefBase == 0 ? 1 : 0)));
}
}
return alleles;
}
/**
* @param tracker dummy parameter here
* @param ref Reference context
* @param alternateAllelesToUse alt allele list
* @return end location for vc to be created
*/
protected int getEndLocation(final RefMetaDataTracker tracker,
final ReferenceContext ref,
final List<Allele> alternateAllelesToUse) {
// for SNPs, end loc is is the same as start loc
return ref.getLocus().getStart();
}
}

View File

@ -0,0 +1,58 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.broadinstitute.sting.gatk.walkers.indels.HaplotypeIndelErrorModel;
import org.broadinstitute.sting.utils.MathUtils;
public class PoolGenotypePriors implements GenotypePriors {
private final double[] flatPriors;
private final double heterozygosity;
private final int samplesPerPool;
private double[] priors = null;
/**
* Create a new DiploidGenotypePriors object with flat priors for each diploid genotype
*/
public PoolGenotypePriors(double heterozygosity, int samplesPerPool) {
flatPriors = new double[2*samplesPerPool+1];
for (int k=0; k <flatPriors.length; k++)
flatPriors[k] = Math.log10(heterozygosity);
priors = flatPriors.clone();
this.samplesPerPool = samplesPerPool;
this.heterozygosity = heterozygosity;
}
/**
* Returns an array of priors for each genotype, indexed by DiploidGenotype.ordinal values().
*
* @return log10 prior as a double array
*/
public double[] getPriors() {
return priors;
}
public double getHeterozygosity() { return heterozygosity; }
public int getNSamplesPerPool() { return samplesPerPool; }
public boolean validate(boolean throwException) {
try {
for (int i=0; i < priors.length; i++ ) {
if ( ! MathUtils.wellFormedDouble(priors[i]) || ! MathUtils.isNegativeOrZero(priors[i]) ) {
String bad = String.format("Prior %f is badly formed %b", priors[i], MathUtils.isNegativeOrZero(priors[i]));
throw new IllegalStateException(String.format("At %d: %s", i, bad));
}
}
} catch ( IllegalStateException e ) {
if ( throwException )
throw new RuntimeException(e);
else
return false;
}
return true;
}
}

View File

@ -0,0 +1,159 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.Arrays;
/**
* Created by IntelliJ IDEA.
* User: delangel
* Date: 4/11/12
* Time: 10:25 AM
* To change this template use File | Settings | File Templates.
*/
public class ProbabilityVector {
private final double[] probabilityArray;
private final int minVal;
private final int maxVal;
final static double LOG_DYNAMIC_RANGE = 10; // values X below max vector value will be removed
/**
* Default constructor: take vector in log-space, with support from range [0,len-1]
* @param vec Probability (or likelihood) vector in log space
* @param compressRange If true, compress by eliminating edges with little support
*/
public ProbabilityVector(double[] vec, boolean compressRange) {
int maxValIdx = MathUtils.maxElementIndex(vec);
double maxv = vec[maxValIdx];
if (maxv > 0.0)
throw new ReviewedStingException("BUG: Attempting to create a log-probability vector with positive elements");
if (compressRange) {
minVal = getMinIdx(vec, maxValIdx);
maxVal = getMaxIdx(vec, maxValIdx);
probabilityArray = Arrays.copyOfRange(vec, minVal, maxVal+1);
} else {
probabilityArray = vec;
minVal = 0;
maxVal = vec.length-1;
}
}
public ProbabilityVector(double[] vec) {
this(vec,true);
}
public ProbabilityVector(ProbabilityVector other, boolean compressRange) {
// create new probability vector from other.
this(other.getUncompressedProbabilityVector(), compressRange);
}
public int getMinVal() { return minVal;}
public int getMaxVal() { return maxVal;}
public double[] getProbabilityVector() { return probabilityArray;}
public double[] getProbabilityVector(int minVal, int maxVal) {
// get vector in specified range. If range is outside of current vector, fill with negative infinities
double[] x = new double[maxVal - minVal + 1];
for (int k=minVal; k <= maxVal; k++)
x[k-minVal] = getLogProbabilityForIndex(k);
return x;
}
public double[] getUncompressedProbabilityVector() {
double x[] = new double[maxVal+1];
for (int i=0; i < minVal; i++)
x[i] = Double.NEGATIVE_INFINITY;
for (int i=minVal; i <=maxVal; i++)
x[i] = probabilityArray[i-minVal];
return x;
}
/**
* Return log Probability for original index i
* @param idx Index to probe
* @return log10(Pr X = i) )
*/
public double getLogProbabilityForIndex(int idx) {
if (idx < minVal || idx > maxVal)
return Double.NEGATIVE_INFINITY;
else
return probabilityArray[idx-minVal];
}
//public ProbabilityVector
public static ProbabilityVector compressVector(double[] vec ) {
return new ProbabilityVector(vec, true);
}
/**
* Determine left-most index where a vector exceeds (max Value - DELTA)
* @param vec Input vector
* @param maxValIdx Index to stop - usually index with max value in vector
* @return Min index where vector > vec[maxValIdx]-LOG_DYNAMIC_RANGE
*/
private static int getMinIdx(double[] vec, int maxValIdx) {
int edgeIdx;
for (edgeIdx=0; edgeIdx<=maxValIdx; edgeIdx++ ) {
if (vec[edgeIdx] > vec[maxValIdx]-LOG_DYNAMIC_RANGE)
break;
}
return edgeIdx;
}
/**
* Determine right-most index where a vector exceeds (max Value - DELTA)
* @param vec Input vector
* @param maxValIdx Index to stop - usually index with max value in vector
* @return Max index where vector > vec[maxValIdx]-LOG_DYNAMIC_RANGE
*/
private static int getMaxIdx(double[] vec, int maxValIdx) {
int edgeIdx;
for (edgeIdx=vec.length-1; edgeIdx>=maxValIdx; edgeIdx-- ) {
if (vec[edgeIdx] > vec[maxValIdx]-LOG_DYNAMIC_RANGE)
break;
}
return edgeIdx;
}
/**
*
* @param other
* @return
*/
public double logDotProduct(ProbabilityVector other) {
// find overlap in range
int minRange = Math.max(this.minVal, other.getMinVal());
int maxRange = Math.min(this.maxVal, other.getMaxVal());
if (minRange > maxRange)
return Double.NEGATIVE_INFINITY;
// x = 0,1,2, y = 2,3,4. minRange = 2, maxRange = 2
double[] result = new double[maxRange - minRange+1];
for (int k=0; k <= maxRange-minRange; k++) {
int startI = minRange - this.minVal;
int startJ = minRange - other.getMinVal();
result[k] = this.probabilityArray[k+startI] + other.probabilityArray[k+startJ];
}
return MathUtils.approximateLog10SumLog10(result);
}
}

View File

@ -0,0 +1,60 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import org.jgrapht.graph.DefaultDirectedGraph;
/**
* Created by IntelliJ IDEA.
* User: ebanks
* Date: Mar 23, 2011
*/
// simple edge class for connecting nodes in the graph
public class DeBruijnEdge implements Comparable<DeBruijnEdge> {
private int multiplicity;
private boolean isRef;
public DeBruijnEdge() {
multiplicity = 1;
isRef = false;
}
public DeBruijnEdge( final boolean isRef ) {
multiplicity = 1;
this.isRef = isRef;
}
public DeBruijnEdge( final boolean isRef, final int multiplicity ) {
this.multiplicity = multiplicity;
this.isRef = isRef;
}
public int getMultiplicity() {
return multiplicity;
}
public void setMultiplicity( final int value ) {
multiplicity = value;
}
public boolean getIsRef() {
return isRef;
}
public void setIsRef( final boolean isRef ) {
this.isRef = isRef;
}
public boolean equals( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final DeBruijnEdge edge ) {
return (graph.getEdgeSource(this).equals(graph.getEdgeSource(edge))) && (graph.getEdgeTarget(this).equals(graph.getEdgeTarget(edge)));
}
public boolean equals( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final DeBruijnEdge edge, final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph2 ) {
return (graph.getEdgeSource(this).equals(graph2.getEdgeSource(edge))) && (graph.getEdgeTarget(this).equals(graph2.getEdgeTarget(edge)));
}
@Override
public int compareTo( final DeBruijnEdge that ) {
return this.multiplicity - that.multiplicity;
}
}

View File

@ -0,0 +1,46 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import java.util.Arrays;
/**
* Created by IntelliJ IDEA.
* User: ebanks
* Date: Mar 23, 2011
*/
// simple node class for storing kmer sequences
public class DeBruijnVertex {
protected final byte[] sequence;
public final int kmer;
public DeBruijnVertex( final byte[] sequence, final int kmer ) {
this.sequence = sequence;
this.kmer = kmer;
}
@Override
public boolean equals( Object v ) {
return v instanceof DeBruijnVertex && Arrays.equals(sequence, ((DeBruijnVertex) v).sequence);
}
@Override
public int hashCode() { // necessary to override here so that graph.containsVertex() works the same way as vertex.equals() as one might expect
return Arrays.hashCode(sequence);
}
public String toString() {
return new String(sequence);
}
public String getSuffixString() {
return new String( getSuffix() );
}
public byte[] getSequence() {
return sequence;
}
public byte[] getSuffix() {
return Arrays.copyOfRange( sequence, kmer - 1, sequence.length );
}
}

View File

@ -0,0 +1,616 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement;
import org.apache.commons.lang.ArrayUtils;
import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine;
import org.broadinstitute.sting.gatk.walkers.genotyper.VariantCallContext;
import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.variantcontext.*;
import java.util.*;
public class GenotypingEngine {
private final boolean DEBUG;
private final int MNP_LOOK_AHEAD;
private final boolean OUTPUT_FULL_HAPLOTYPE_SEQUENCE;
private final static List<Allele> noCall = new ArrayList<Allele>(); // used to noCall all genotypes until the exact model is applied
private final static Allele SYMBOLIC_UNASSEMBLED_EVENT_ALLELE = Allele.create("<UNASSEMBLED_EVENT>", false);
public GenotypingEngine( final boolean DEBUG, final int MNP_LOOK_AHEAD, final boolean OUTPUT_FULL_HAPLOTYPE_SEQUENCE ) {
this.DEBUG = DEBUG;
this.MNP_LOOK_AHEAD = MNP_LOOK_AHEAD;
this.OUTPUT_FULL_HAPLOTYPE_SEQUENCE = OUTPUT_FULL_HAPLOTYPE_SEQUENCE;
noCall.add(Allele.NO_CALL);
}
// This function is the streamlined approach, currently not being used
@Requires({"refLoc.containsP(activeRegionWindow)", "haplotypes.size() > 0"})
public List<Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>> assignGenotypeLikelihoodsAndCallHaplotypeEvents( final UnifiedGenotyperEngine UG_engine, final ArrayList<Haplotype> haplotypes, final byte[] ref, final GenomeLoc refLoc,
final GenomeLoc activeRegionWindow, final GenomeLocParser genomeLocParser ) {
// Prepare the list of haplotype indices to genotype
final ArrayList<Allele> allelesToGenotype = new ArrayList<Allele>();
for( final Haplotype h : haplotypes ) {
allelesToGenotype.add( Allele.create(h.getBases(), h.isReference()) );
}
final int numHaplotypes = haplotypes.size();
// Grab the genotype likelihoods from the appropriate places in the haplotype likelihood matrix -- calculation performed independently per sample
final GenotypesContext genotypes = GenotypesContext.create(haplotypes.get(0).getSampleKeySet().size());
for( final String sample : haplotypes.get(0).getSampleKeySet() ) { // BUGBUG: assume all haplotypes saw the same samples
final double[] genotypeLikelihoods = new double[numHaplotypes * (numHaplotypes+1) / 2];
final double[][] haplotypeLikelihoodMatrix = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(haplotypes, sample);
int glIndex = 0;
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
genotypeLikelihoods[glIndex++] = haplotypeLikelihoodMatrix[iii][jjj]; // for example: AA,AB,BB,AC,BC,CC
}
}
genotypes.add(new GenotypeBuilder(sample, noCall).PL(genotypeLikelihoods).make());
}
final VariantCallContext call = UG_engine.calculateGenotypes(new VariantContextBuilder().loc(activeRegionWindow).alleles(allelesToGenotype).genotypes(genotypes).make(), UG_engine.getUAC().GLmodel);
if( call == null ) { return Collections.emptyList(); } // exact model says that the call confidence is below the specified confidence threshold so nothing to do here
// Prepare the list of haplotypes that need to be run through Smith-Waterman for output to VCF
final ArrayList<Haplotype> haplotypesToRemove = new ArrayList<Haplotype>();
for( final Haplotype h : haplotypes ) {
if( call.getAllele(h.getBases()) == null ) { // exact model removed this allele from the list so no need to run SW and output to VCF
haplotypesToRemove.add(h);
}
}
haplotypes.removeAll(haplotypesToRemove);
if( OUTPUT_FULL_HAPLOTYPE_SEQUENCE ) {
final List<Pair<VariantContext, HashMap<Allele, ArrayList<Haplotype>>>> returnVCs = new ArrayList<Pair<VariantContext, HashMap<Allele, ArrayList<Haplotype>>>>();
// set up the default 1-to-1 haplotype mapping object
final HashMap<Allele,ArrayList<Haplotype>> haplotypeMapping = new HashMap<Allele,ArrayList<Haplotype>>();
for( final Haplotype h : haplotypes ) {
final ArrayList<Haplotype> list = new ArrayList<Haplotype>();
list.add(h);
haplotypeMapping.put(call.getAllele(h.getBases()), list);
}
returnVCs.add( new Pair<VariantContext, HashMap<Allele, ArrayList<Haplotype>>>(call,haplotypeMapping) );
return returnVCs;
}
final ArrayList<Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>> returnCalls = new ArrayList<Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>>();
// Using the cigar from each called haplotype figure out what events need to be written out in a VCF file
final TreeSet<Integer> startPosKeySet = new TreeSet<Integer>();
int count = 0;
if( DEBUG ) { System.out.println("=== Best Haplotypes ==="); }
for( final Haplotype h : haplotypes ) {
if( DEBUG ) {
System.out.println( h.toString() );
System.out.println( "> Cigar = " + h.getCigar() );
}
// Walk along the alignment and turn any difference from the reference into an event
h.setEventMap( generateVCsFromAlignment( h.getAlignmentStartHapwrtRef(), h.getCigar(), ref, h.getBases(), refLoc, "HC" + count++, MNP_LOOK_AHEAD ) );
startPosKeySet.addAll(h.getEventMap().keySet());
}
// Create the VC merge priority list
final ArrayList<String> priorityList = new ArrayList<String>();
for( int iii = 0; iii < haplotypes.size(); iii++ ) {
priorityList.add("HC" + iii);
}
// Walk along each position in the key set and create each event to be outputted
for( final int loc : startPosKeySet ) {
if( loc >= activeRegionWindow.getStart() && loc <= activeRegionWindow.getStop() ) {
final ArrayList<VariantContext> eventsAtThisLoc = new ArrayList<VariantContext>();
for( final Haplotype h : haplotypes ) {
final HashMap<Integer,VariantContext> eventMap = h.getEventMap();
final VariantContext vc = eventMap.get(loc);
if( vc != null && !containsVCWithMatchingAlleles(eventsAtThisLoc, vc) ) {
eventsAtThisLoc.add(vc);
}
}
// Create the allele mapping object which maps the original haplotype alleles to the alleles present in just this event
final ArrayList<ArrayList<Haplotype>> alleleMapper = createAlleleMapper( loc, eventsAtThisLoc, haplotypes );
// Merge the event to find a common reference representation
final VariantContext mergedVC = VariantContextUtils.simpleMerge(genomeLocParser, eventsAtThisLoc, priorityList, VariantContextUtils.FilteredRecordMergeType.KEEP_IF_ANY_UNFILTERED, VariantContextUtils.GenotypeMergeType.PRIORITIZE, false, false, null, false, false);
final HashMap<Allele, ArrayList<Haplotype>> alleleHashMap = new HashMap<Allele, ArrayList<Haplotype>>();
int aCount = 0;
for( final Allele a : mergedVC.getAlleles() ) {
alleleHashMap.put(a, alleleMapper.get(aCount++)); // BUGBUG: needs to be cleaned up and merged with alleleMapper
}
if( DEBUG ) {
System.out.println("Genotyping event at " + loc + " with alleles = " + mergedVC.getAlleles());
//System.out.println("Event/haplotype allele mapping = " + alleleMapper);
}
// Grab the genotype likelihoods from the appropriate places in the haplotype likelihood matrix -- calculation performed independently per sample
final GenotypesContext myGenotypes = GenotypesContext.create(haplotypes.get(0).getSampleKeySet().size());
for( final String sample : haplotypes.get(0).getSampleKeySet() ) { // BUGBUG: assume all haplotypes saw the same samples
final int myNumHaplotypes = alleleMapper.size();
final double[] genotypeLikelihoods = new double[myNumHaplotypes * (myNumHaplotypes+1) / 2];
final double[][] haplotypeLikelihoodMatrix = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(sample, alleleMapper);
int glIndex = 0;
for( int iii = 0; iii < myNumHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
genotypeLikelihoods[glIndex++] = haplotypeLikelihoodMatrix[iii][jjj]; // for example: AA,AB,BB,AC,BC,CC
}
}
// using the allele mapping object translate the haplotype allele into the event allele
final Genotype g = new GenotypeBuilder(sample)
.alleles(findEventAllelesInSample(mergedVC.getAlleles(), call.getAlleles(), call.getGenotype(sample).getAlleles(), alleleMapper, haplotypes))
.phased(loc != startPosKeySet.first())
.PL(genotypeLikelihoods).make();
myGenotypes.add(g);
}
returnCalls.add( new Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>(
new VariantContextBuilder(mergedVC).log10PError(call.getLog10PError()).genotypes(myGenotypes).make(), alleleHashMap) );
}
}
return returnCalls;
}
@Requires({"refLoc.containsP(activeRegionWindow)", "haplotypes.size() > 0"})
public List<Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>> assignGenotypeLikelihoodsAndCallIndependentEvents( final UnifiedGenotyperEngine UG_engine,
final ArrayList<Haplotype> haplotypes,
final byte[] ref,
final GenomeLoc refLoc,
final GenomeLoc activeRegionWindow,
final GenomeLocParser genomeLocParser,
final ArrayList<VariantContext> activeAllelesToGenotype ) {
final ArrayList<Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>> returnCalls = new ArrayList<Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>>();
// Using the cigar from each called haplotype figure out what events need to be written out in a VCF file
final TreeSet<Integer> startPosKeySet = new TreeSet<Integer>();
int count = 0;
if( DEBUG ) { System.out.println("=== Best Haplotypes ==="); }
for( final Haplotype h : haplotypes ) {
// Walk along the alignment and turn any difference from the reference into an event
h.setEventMap( generateVCsFromAlignment( h, h.getAlignmentStartHapwrtRef(), h.getCigar(), ref, h.getBases(), refLoc, "HC" + count++, MNP_LOOK_AHEAD ) );
if( activeAllelesToGenotype.isEmpty() ) { startPosKeySet.addAll(h.getEventMap().keySet()); }
if( DEBUG ) {
System.out.println( h.toString() );
System.out.println( "> Cigar = " + h.getCigar() );
System.out.println( "> Left and right breaks = (" + h.leftBreakPoint + " , " + h.rightBreakPoint + ")");
System.out.println( ">> Events = " + h.getEventMap());
}
}
// Create the VC merge priority list
final ArrayList<String> priorityList = new ArrayList<String>();
for( int iii = 0; iii < haplotypes.size(); iii++ ) {
priorityList.add("HC" + iii);
}
cleanUpSymbolicUnassembledEvents( haplotypes, priorityList );
if( activeAllelesToGenotype.isEmpty() && haplotypes.get(0).getSampleKeySet().size() >= 3 ) { // if not in GGA mode and have at least 3 samples try to create MNP and complex events by looking at LD structure
mergeConsecutiveEventsBasedOnLD( haplotypes, startPosKeySet, ref, refLoc );
}
if( !activeAllelesToGenotype.isEmpty() ) { // we are in GGA mode!
for( final VariantContext compVC : activeAllelesToGenotype ) {
startPosKeySet.add( compVC.getStart() );
}
}
// Walk along each position in the key set and create each event to be outputted
for( final int loc : startPosKeySet ) {
if( loc >= activeRegionWindow.getStart() && loc <= activeRegionWindow.getStop() ) {
final ArrayList<VariantContext> eventsAtThisLoc = new ArrayList<VariantContext>();
if( activeAllelesToGenotype.isEmpty() ) {
for( final Haplotype h : haplotypes ) {
final HashMap<Integer,VariantContext> eventMap = h.getEventMap();
final VariantContext vc = eventMap.get(loc);
if( vc != null && !containsVCWithMatchingAlleles(eventsAtThisLoc, vc) ) {
eventsAtThisLoc.add(vc);
}
}
} else { // we are in GGA mode!
for( final VariantContext compVC : activeAllelesToGenotype ) {
if( compVC.getStart() == loc ) {
priorityList.clear();
int alleleCount = 0;
for( final Allele compAltAllele : compVC.getAlternateAlleles() ) {
HashSet<Allele> alleleSet = new HashSet<Allele>(2);
alleleSet.add(compVC.getReference());
alleleSet.add(compAltAllele);
priorityList.add("Allele" + alleleCount);
eventsAtThisLoc.add(new VariantContextBuilder(compVC).alleles(alleleSet).source("Allele"+alleleCount).make());
alleleCount++;
}
}
}
}
if( eventsAtThisLoc.isEmpty() ) { continue; }
// Create the allele mapping object which maps the original haplotype alleles to the alleles present in just this event
final ArrayList<ArrayList<Haplotype>> alleleMapper = createAlleleMapper( loc, eventsAtThisLoc, haplotypes );
// Merge the event to find a common reference representation
final VariantContext mergedVC = VariantContextUtils.simpleMerge(genomeLocParser, eventsAtThisLoc, priorityList, VariantContextUtils.FilteredRecordMergeType.KEEP_IF_ANY_UNFILTERED, VariantContextUtils.GenotypeMergeType.PRIORITIZE, false, false, null, false, false);
if( mergedVC == null ) { continue; }
final HashMap<Allele, ArrayList<Haplotype>> alleleHashMap = new HashMap<Allele, ArrayList<Haplotype>>();
int aCount = 0;
for( final Allele a : mergedVC.getAlleles() ) {
alleleHashMap.put(a, alleleMapper.get(aCount++)); // BUGBUG: needs to be cleaned up and merged with alleleMapper
}
if( DEBUG ) {
System.out.println("Genotyping event at " + loc + " with alleles = " + mergedVC.getAlleles());
//System.out.println("Event/haplotype allele mapping = " + alleleMapper);
}
// Grab the genotype likelihoods from the appropriate places in the haplotype likelihood matrix -- calculation performed independently per sample
final GenotypesContext genotypes = GenotypesContext.create(haplotypes.get(0).getSampleKeySet().size());
for( final String sample : haplotypes.get(0).getSampleKeySet() ) { // BUGBUG: assume all haplotypes saw the same samples
final int numHaplotypes = alleleMapper.size();
final double[] genotypeLikelihoods = new double[numHaplotypes * (numHaplotypes+1) / 2];
final double[][] haplotypeLikelihoodMatrix = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(sample, alleleMapper);
int glIndex = 0;
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
genotypeLikelihoods[glIndex++] = haplotypeLikelihoodMatrix[iii][jjj]; // for example: AA,AB,BB,AC,BC,CC
}
}
genotypes.add( new GenotypeBuilder(sample).alleles(noCall).PL(genotypeLikelihoods).make() );
}
final VariantCallContext call = UG_engine.calculateGenotypes(new VariantContextBuilder(mergedVC).genotypes(genotypes).make(), UG_engine.getUAC().GLmodel);
if( call != null ) {
returnCalls.add( new Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>>(call, alleleHashMap) );
}
}
}
return returnCalls;
}
protected static void cleanUpSymbolicUnassembledEvents( final ArrayList<Haplotype> haplotypes, final ArrayList<String> priorityList ) {
final ArrayList<Haplotype> haplotypesToRemove = new ArrayList<Haplotype>();
final ArrayList<String> stringsToRemove = new ArrayList<String>();
for( final Haplotype h : haplotypes ) {
for( final VariantContext vc : h.getEventMap().values() ) {
if( vc.isSymbolic() ) {
for( final Haplotype h2 : haplotypes ) {
for( final VariantContext vc2 : h2.getEventMap().values() ) {
if( vc.getStart() == vc2.getStart() && vc2.isIndel() ) {
haplotypesToRemove.add(h);
stringsToRemove.add(vc.getSource());
break;
}
}
}
}
}
}
haplotypes.removeAll(haplotypesToRemove);
priorityList.removeAll(stringsToRemove);
}
protected void mergeConsecutiveEventsBasedOnLD( final ArrayList<Haplotype> haplotypes, final TreeSet<Integer> startPosKeySet, final byte[] ref, final GenomeLoc refLoc ) {
final int MAX_SIZE_TO_COMBINE = 15;
final double MERGE_EVENTS_R2_THRESHOLD = 0.95;
if( startPosKeySet.size() <= 1 ) { return; }
boolean mapWasUpdated = true;
while( mapWasUpdated ) {
mapWasUpdated = false;
// loop over the set of start locations and consider pairs that start near each other
final Iterator<Integer> iter = startPosKeySet.iterator();
int thisStart = iter.next();
while( iter.hasNext() ) {
final int nextStart = iter.next();
if( nextStart - thisStart < MAX_SIZE_TO_COMBINE) {
boolean isBiallelic = true;
VariantContext thisVC = null;
VariantContext nextVC = null;
double x11 = Double.NEGATIVE_INFINITY;
double x12 = Double.NEGATIVE_INFINITY;
double x21 = Double.NEGATIVE_INFINITY;
double x22 = Double.NEGATIVE_INFINITY;
for( final Haplotype h : haplotypes ) {
// only make complex substitutions out of consecutive biallelic sites
final VariantContext thisHapVC = h.getEventMap().get(thisStart);
if( thisHapVC != null && !thisHapVC.isSymbolic() ) { // something was found at this location on this haplotype
if( thisVC == null ) {
thisVC = thisHapVC;
} else if( !thisHapVC.hasSameAllelesAs( thisVC ) ) {
isBiallelic = false;
break;
}
}
final VariantContext nextHapVC = h.getEventMap().get(nextStart);
if( nextHapVC != null && !nextHapVC.isSymbolic() ) { // something was found at the next location on this haplotype
if( nextVC == null ) {
nextVC = nextHapVC;
} else if( !nextHapVC.hasSameAllelesAs( nextVC ) ) {
isBiallelic = false;
break;
}
}
// count up the co-occurrences of the events for the R^2 calculation
final ArrayList<Haplotype> haplotypeList = new ArrayList<Haplotype>();
haplotypeList.add(h);
for( final String sample : haplotypes.get(0).getSampleKeySet() ) {
final double haplotypeLikelihood = LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods( haplotypeList, sample )[0][0];
if( thisHapVC == null ) {
if( nextHapVC == null ) { x11 = MathUtils.approximateLog10SumLog10(x11, haplotypeLikelihood); }
else { x12 = MathUtils.approximateLog10SumLog10(x12, haplotypeLikelihood); }
} else {
if( nextHapVC == null ) { x21 = MathUtils.approximateLog10SumLog10(x21, haplotypeLikelihood); }
else { x22 = MathUtils.approximateLog10SumLog10(x22, haplotypeLikelihood); }
}
}
}
if( thisVC == null || nextVC == null ) {
continue;
}
if( isBiallelic ) {
final double R2 = calculateR2LD( Math.pow(10.0, x11), Math.pow(10.0, x12), Math.pow(10.0, x21), Math.pow(10.0, x22) );
if( DEBUG ) {
System.out.println("Found consecutive biallelic events with R^2 = " + String.format("%.4f", R2));
System.out.println("-- " + thisVC);
System.out.println("-- " + nextVC);
}
if( R2 > MERGE_EVENTS_R2_THRESHOLD ) {
final VariantContext mergedVC = createMergedVariantContext(thisVC, nextVC, ref, refLoc);
// remove the old event from the eventMap on every haplotype and the start pos key set, replace with merged event
for( final Haplotype h : haplotypes ) {
final HashMap<Integer, VariantContext> eventMap = h.getEventMap();
if( eventMap.containsKey(thisStart) && eventMap.containsKey(nextStart) ) {
eventMap.remove(thisStart);
eventMap.remove(nextStart);
eventMap.put(mergedVC.getStart(), mergedVC);
}
}
startPosKeySet.add(mergedVC.getStart());
boolean containsStart = false;
boolean containsNext = false;
for( final Haplotype h : haplotypes ) {
final HashMap<Integer, VariantContext> eventMap = h.getEventMap();
if( eventMap.containsKey(thisStart) ) { containsStart = true; }
if( eventMap.containsKey(nextStart) ) { containsNext = true; }
}
if(!containsStart) { startPosKeySet.remove(thisStart); }
if(!containsNext) { startPosKeySet.remove(nextStart); }
if( DEBUG ) { System.out.println("====> " + mergedVC); }
mapWasUpdated = true;
break; // break out of tree set iteration since it was just updated, start over from the beginning and keep merging events
}
}
}
thisStart = nextStart;
}
}
}
// BUGBUG: make this merge function more general
protected static VariantContext createMergedVariantContext( final VariantContext thisVC, final VariantContext nextVC, final byte[] ref, final GenomeLoc refLoc ) {
final int thisStart = thisVC.getStart();
final int nextStart = nextVC.getStart();
byte[] refBases = new byte[]{};
byte[] altBases = new byte[]{};
refBases = ArrayUtils.addAll(refBases, thisVC.getReference().getBases());
altBases = ArrayUtils.addAll(altBases, thisVC.getAlternateAllele(0).getBases());
int locus;
for( locus = thisStart + refBases.length; locus < nextStart; locus++ ) {
final byte refByte = ref[locus - refLoc.getStart()];
refBases = ArrayUtils.add(refBases, refByte);
altBases = ArrayUtils.add(altBases, refByte);
}
refBases = ArrayUtils.addAll(refBases, ArrayUtils.subarray(nextVC.getReference().getBases(), locus > nextStart ? 1 : 0, nextVC.getReference().getBases().length)); // special case of deletion including the padding base of consecutive indel
altBases = ArrayUtils.addAll(altBases, nextVC.getAlternateAllele(0).getBases());
int iii = 0;
if( refBases.length == altBases.length ) { // insertion + deletion of same length creates an MNP --> trim common prefix bases off the beginning of the allele
while( iii < refBases.length && refBases[iii] == altBases[iii] ) { iii++; }
}
final ArrayList<Allele> mergedAlleles = new ArrayList<Allele>();
mergedAlleles.add( Allele.create( ArrayUtils.subarray(refBases, iii, refBases.length), true ) );
mergedAlleles.add( Allele.create( ArrayUtils.subarray(altBases, iii, altBases.length), false ) );
return new VariantContextBuilder("merged", thisVC.getChr(), thisVC.getStart() + iii, nextVC.getEnd(), mergedAlleles).make();
}
protected static double calculateR2LD( final double x11, final double x12, final double x21, final double x22 ) {
final double total = x11 + x12 + x21 + x22;
final double pa1b1 = x11 / total;
final double pa1b2 = x12 / total;
final double pa2b1 = x21 / total;
final double pa1 = pa1b1 + pa1b2;
final double pb1 = pa1b1 + pa2b1;
return ((pa1b1 - pa1*pb1) * (pa1b1 - pa1*pb1)) / ( pa1 * (1.0 - pa1) * pb1 * (1.0 - pb1) );
}
@Requires({"haplotypes.size() >= eventsAtThisLoc.size() + 1"})
@Ensures({"result.size() == eventsAtThisLoc.size() + 1"})
protected static ArrayList<ArrayList<Haplotype>> createAlleleMapper( final int loc, final ArrayList<VariantContext> eventsAtThisLoc, final ArrayList<Haplotype> haplotypes ) {
final ArrayList<ArrayList<Haplotype>> alleleMapper = new ArrayList<ArrayList<Haplotype>>();
final ArrayList<Haplotype> refList = new ArrayList<Haplotype>();
for( final Haplotype h : haplotypes ) {
if( h.getEventMap().get(loc) == null ) { // no event at this location so this is a reference-supporting haplotype
refList.add(h);
} else {
boolean foundInEventList = false;
for( final VariantContext vcAtThisLoc : eventsAtThisLoc ) {
if( h.getEventMap().get(loc).hasSameAllelesAs(vcAtThisLoc) ) {
foundInEventList = true;
}
}
if( !foundInEventList ) { // event at this location isn't one of the genotype-able options (during GGA) so this is a reference-supporting haplotype
refList.add(h);
}
}
}
alleleMapper.add(refList);
for( final VariantContext vcAtThisLoc : eventsAtThisLoc ) {
final ArrayList<Haplotype> list = new ArrayList<Haplotype>();
for( final Haplotype h : haplotypes ) {
if( h.getEventMap().get(loc) != null && h.getEventMap().get(loc).hasSameAllelesAs(vcAtThisLoc) ) {
list.add(h);
}
}
alleleMapper.add(list);
}
return alleleMapper;
}
@Ensures({"result.size() == haplotypeAllelesForSample.size()"})
protected static List<Allele> findEventAllelesInSample( final List<Allele> eventAlleles, final List<Allele> haplotypeAlleles, final List<Allele> haplotypeAllelesForSample, final ArrayList<ArrayList<Haplotype>> alleleMapper, final ArrayList<Haplotype> haplotypes ) {
if( haplotypeAllelesForSample.contains(Allele.NO_CALL) ) { return noCall; }
final ArrayList<Allele> eventAllelesForSample = new ArrayList<Allele>();
for( final Allele a : haplotypeAllelesForSample ) {
final Haplotype haplotype = haplotypes.get(haplotypeAlleles.indexOf(a));
for( int iii = 0; iii < alleleMapper.size(); iii++ ) {
final ArrayList<Haplotype> mappedHaplotypes = alleleMapper.get(iii);
if( mappedHaplotypes.contains(haplotype) ) {
eventAllelesForSample.add(eventAlleles.get(iii));
break;
}
}
}
return eventAllelesForSample;
}
protected static boolean containsVCWithMatchingAlleles( final List<VariantContext> list, final VariantContext vcToTest ) {
for( final VariantContext vc : list ) {
if( vc.hasSameAllelesAs(vcToTest) ) {
return true;
}
}
return false;
}
protected static HashMap<Integer,VariantContext> generateVCsFromAlignment( final int alignmentStartHapwrtRef, final Cigar cigar, final byte[] ref, final byte[] alignment, final GenomeLoc refLoc, final String sourceNameToAdd, final int MNP_LOOK_AHEAD ) {
return generateVCsFromAlignment(null, alignmentStartHapwrtRef, cigar, ref, alignment, refLoc, sourceNameToAdd, MNP_LOOK_AHEAD); // BUGBUG: needed for compatibility with HaplotypeResolver code
}
protected static HashMap<Integer,VariantContext> generateVCsFromAlignment( final Haplotype haplotype, final int alignmentStartHapwrtRef, final Cigar cigar, final byte[] ref, final byte[] alignment, final GenomeLoc refLoc, final String sourceNameToAdd, final int MNP_LOOK_AHEAD ) {
final HashMap<Integer,VariantContext> vcs = new HashMap<Integer,VariantContext>();
int refPos = alignmentStartHapwrtRef;
if( refPos < 0 ) { return null; } // Protection against SW failures
int alignmentPos = 0;
for( final CigarElement ce : cigar.getCigarElements() ) {
final int elementLength = ce.getLength();
switch( ce.getOperator() ) {
case I:
final ArrayList<Allele> insertionAlleles = new ArrayList<Allele>();
final int insertionStart = refLoc.getStart() + refPos - 1;
insertionAlleles.add( Allele.create(ref[refPos-1], true) );
if( haplotype != null && (haplotype.leftBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() - 1 == insertionStart + elementLength + 1 || haplotype.rightBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() - 1 == insertionStart + elementLength + 1) ) {
insertionAlleles.add( SYMBOLIC_UNASSEMBLED_EVENT_ALLELE );
} else {
byte[] insertionBases = new byte[]{};
insertionBases = ArrayUtils.add(insertionBases, ref[refPos-1]); // add the padding base
insertionBases = ArrayUtils.addAll(insertionBases, Arrays.copyOfRange( alignment, alignmentPos, alignmentPos + elementLength ));
insertionAlleles.add( Allele.create(insertionBases, false) );
}
vcs.put(insertionStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), insertionStart, insertionStart, insertionAlleles).make());
alignmentPos += elementLength;
break;
case S:
alignmentPos += elementLength;
break;
case D:
final byte[] deletionBases = Arrays.copyOfRange( ref, refPos - 1, refPos + elementLength ); // add padding base
final ArrayList<Allele> deletionAlleles = new ArrayList<Allele>();
final int deletionStart = refLoc.getStart() + refPos - 1;
// BUGBUG: how often does this symbolic deletion allele case happen?
//if( haplotype != null && ( (haplotype.leftBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() + elementLength - 1 >= deletionStart && haplotype.leftBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() + elementLength - 1 < deletionStart + elementLength)
// || (haplotype.rightBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() + elementLength - 1 >= deletionStart && haplotype.rightBreakPoint + alignmentStartHapwrtRef + refLoc.getStart() + elementLength - 1 < deletionStart + elementLength) ) ) {
// deletionAlleles.add( Allele.create(ref[refPos-1], true) );
// deletionAlleles.add( SYMBOLIC_UNASSEMBLED_EVENT_ALLELE );
// vcs.put(deletionStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), deletionStart, deletionStart, deletionAlleles).make());
//} else {
deletionAlleles.add( Allele.create(deletionBases, true) );
deletionAlleles.add( Allele.create(ref[refPos-1], false) );
vcs.put(deletionStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), deletionStart, deletionStart + elementLength, deletionAlleles).make());
//}
refPos += elementLength;
break;
case M:
int numSinceMismatch = -1;
int stopOfMismatch = -1;
int startOfMismatch = -1;
int refPosStartOfMismatch = -1;
for( int iii = 0; iii < elementLength; iii++ ) {
if( ref[refPos] != alignment[alignmentPos] && alignment[alignmentPos] != ((byte) 'N') ) {
// SNP or start of possible MNP
if( stopOfMismatch == -1 ) {
startOfMismatch = alignmentPos;
stopOfMismatch = alignmentPos;
numSinceMismatch = 0;
refPosStartOfMismatch = refPos;
} else {
stopOfMismatch = alignmentPos;
}
}
if( stopOfMismatch != -1) {
numSinceMismatch++;
}
if( numSinceMismatch > MNP_LOOK_AHEAD || (iii == elementLength - 1 && stopOfMismatch != -1) ) {
final byte[] refBases = Arrays.copyOfRange( ref, refPosStartOfMismatch, refPosStartOfMismatch + (stopOfMismatch - startOfMismatch) + 1 );
final byte[] mismatchBases = Arrays.copyOfRange( alignment, startOfMismatch, stopOfMismatch + 1 );
final ArrayList<Allele> snpAlleles = new ArrayList<Allele>();
snpAlleles.add( Allele.create( refBases, true ) );
snpAlleles.add( Allele.create( mismatchBases, false ) );
final int snpStart = refLoc.getStart() + refPosStartOfMismatch;
vcs.put(snpStart, new VariantContextBuilder(sourceNameToAdd, refLoc.getContig(), snpStart, snpStart + (stopOfMismatch - startOfMismatch), snpAlleles).make());
numSinceMismatch = -1;
stopOfMismatch = -1;
startOfMismatch = -1;
refPosStartOfMismatch = -1;
}
refPos++;
alignmentPos++;
}
break;
case N:
case H:
case P:
default:
throw new ReviewedStingException( "Unsupported cigar operator created during SW alignment: " + ce.getOperator() );
}
}
return vcs;
}
}

View File

@ -0,0 +1,567 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import com.google.java.contract.Ensures;
import net.sf.picard.reference.IndexedFastaSequenceFile;
import org.broadinstitute.sting.utils.activeregion.ActivityProfileResult;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.commandline.*;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.gatk.arguments.DbsnpArgumentCollection;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.AlignmentContextUtils;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.filters.BadMateFilter;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.ActiveRegionExtension;
import org.broadinstitute.sting.gatk.walkers.ActiveRegionWalker;
import org.broadinstitute.sting.gatk.walkers.PartitionBy;
import org.broadinstitute.sting.gatk.walkers.PartitionType;
import org.broadinstitute.sting.gatk.walkers.annotator.VariantAnnotatorEngine;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.genotyper.GenotypeLikelihoodsCalculationModel;
import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedArgumentCollection;
import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine;
import org.broadinstitute.sting.gatk.walkers.genotyper.VariantCallContext;
import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.clipping.ReadClipper;
import org.broadinstitute.sting.utils.codecs.vcf.*;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile;
import org.broadinstitute.sting.utils.fragments.FragmentCollection;
import org.broadinstitute.sting.utils.fragments.FragmentUtils;
import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.sam.AlignmentUtils;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils;
import org.broadinstitute.sting.utils.variantcontext.*;
import org.broadinstitute.sting.utils.variantcontext.writer.VariantContextWriter;
import java.io.FileNotFoundException;
import java.io.PrintStream;
import java.util.*;
/**
* Call SNPs and indels simultaneously via local de-novo assembly of haplotypes in an active region. Haplotypes are evaluated using an affine gap penalty Pair HMM.
*
* <h2>Input</h2>
* <p>
* Input bam file(s) from which to make calls
* </p>
*
* <h2>Output</h2>
* <p>
* VCF file with raw, unrecalibrated SNP and indel calls.
* </p>
*
* <h2>Examples</h2>
* <pre>
* java
* -jar GenomeAnalysisTK.jar
* -T HaplotypeCaller
* -R reference/human_g1k_v37.fasta
* -I sample1.bam [-I sample2.bam ...] \
* --dbsnp dbSNP.vcf \
* -stand_call_conf [50.0] \
* -stand_emit_conf 10.0 \
* [-L targets.interval_list]
* -o output.raw.snps.indels.vcf
* </pre>
*
* <h2>Caveats</h2>
* <ul>
* <li>The system is under active and continuous development. All outputs, the underlying likelihood model, and command line arguments are likely to change often.</li>
* </ul>
*
* @author rpoplin
* @since 8/22/11
*/
@DocumentedGATKFeature( groupName = "Variant Discovery Tools", extraDocs = {CommandLineGATK.class} )
@PartitionBy(PartitionType.LOCUS)
@ActiveRegionExtension(extension=65, maxRegion=300)
public class HaplotypeCaller extends ActiveRegionWalker<Integer, Integer> implements AnnotatorCompatible {
/**
* A raw, unfiltered, highly sensitive callset in VCF format.
*/
@Output(doc="File to which variants should be written", required = true)
protected VariantContextWriter vcfWriter = null;
@Output(fullName="graphOutput", shortName="graph", doc="File to which debug assembly graph information should be written", required = false)
protected PrintStream graphWriter = null;
@Hidden
@Argument(fullName="keepRG", shortName="keepRG", doc="Only use read from this read group when making calls (but use all reads to build the assembly)", required = false)
protected String keepRG = null;
@Hidden
@Argument(fullName="mnpLookAhead", shortName="mnpLookAhead", doc = "The number of bases to combine together to form MNPs out of nearby consecutive SNPs on the same haplotype", required = false)
protected int MNP_LOOK_AHEAD = 0;
@Argument(fullName="minPruning", shortName="minPruning", doc = "The minimum allowed pruning factor in assembly graph. Paths with <= X supporting kmers are pruned from the graph", required = false)
protected int MIN_PRUNE_FACTOR = 1;
@Advanced
@Argument(fullName="genotypeFullActiveRegion", shortName="genotypeFullActiveRegion", doc = "If specified, alternate alleles are considered to be the full active region for the purposes of genotyping", required = false)
protected boolean GENOTYPE_FULL_ACTIVE_REGION = false;
@Advanced
@Argument(fullName="fullHaplotype", shortName="fullHaplotype", doc = "If specified, output the full haplotype sequence instead of converting to individual variants w.r.t. the reference", required = false)
protected boolean OUTPUT_FULL_HAPLOTYPE_SEQUENCE = false;
@Advanced
@Argument(fullName="gcpHMM", shortName="gcpHMM", doc="Gap continuation penalty for use in the Pair HMM", required = false)
protected int gcpHMM = 10;
@Argument(fullName="downsampleRegion", shortName="dr", doc="coverage, per-sample, to downsample each active region to", required = false)
protected int DOWNSAMPLE_PER_SAMPLE_PER_REGION = 1000;
@Argument(fullName="useAllelesTrigger", shortName="allelesTrigger", doc = "If specified, use additional trigger on variants found in an external alleles file", required=false)
protected boolean USE_ALLELES_TRIGGER = false;
/**
* rsIDs from this file are used to populate the ID column of the output. Also, the DB INFO flag will be set when appropriate.
* dbSNP is not used in any way for the calculations themselves.
*/
@ArgumentCollection
protected DbsnpArgumentCollection dbsnp = new DbsnpArgumentCollection();
public RodBinding<VariantContext> getDbsnpRodBinding() { return dbsnp.dbsnp; }
/**
* If a call overlaps with a record from the provided comp track, the INFO field will be annotated
* as such in the output with the track name (e.g. -comp:FOO will have 'FOO' in the INFO field).
* Records that are filtered in the comp track will be ignored.
* Note that 'dbSNP' has been special-cased (see the --dbsnp argument).
*/
@Input(fullName="comp", shortName = "comp", doc="comparison VCF file", required=false)
public List<RodBinding<VariantContext>> comps = Collections.emptyList();
public List<RodBinding<VariantContext>> getCompRodBindings() { return comps; }
// The following are not used by the Unified Genotyper
public RodBinding<VariantContext> getSnpEffRodBinding() { return null; }
public List<RodBinding<VariantContext>> getResourceRodBindings() { return Collections.emptyList(); }
public boolean alwaysAppendDbsnpId() { return false; }
/**
* Which annotations to add to the output VCF file. See the VariantAnnotator -list argument to view available annotations.
*/
@Argument(fullName="annotation", shortName="A", doc="One or more specific annotations to apply to variant calls", required=false)
protected List<String> annotationsToUse = new ArrayList<String>(Arrays.asList(new String[]{"ClippingRankSumTest"}));
/**
* Which annotations to exclude from output in the VCF file. Note that this argument has higher priority than the -A or -G arguments,
* so annotations will be excluded even if they are explicitly included with the other options.
*/
@Argument(fullName="excludeAnnotation", shortName="XA", doc="One or more specific annotations to exclude", required=false)
protected List<String> annotationsToExclude = new ArrayList<String>(Arrays.asList(new String[]{"HaplotypeScore", "MappingQualityZero", "SpanningDeletions", "TandemRepeatAnnotator"}));
/**
* Which groups of annotations to add to the output VCF file. See the VariantAnnotator -list argument to view available groups.
*/
@Argument(fullName="group", shortName="G", doc="One or more classes/groups of annotations to apply to variant calls", required=false)
protected String[] annotationClassesToUse = { "Standard" };
@ArgumentCollection
private UnifiedArgumentCollection UAC = new UnifiedArgumentCollection();
// the calculation arguments
private UnifiedGenotyperEngine UG_engine = null;
private UnifiedGenotyperEngine UG_engine_simple_genotyper = null;
@Argument(fullName="debug", shortName="debug", doc="If specified, print out very verbose debug information about each triggering active region", required = false)
protected boolean DEBUG;
// the assembly engine
LocalAssemblyEngine assemblyEngine = null;
// the likelihoods engine
LikelihoodCalculationEngine likelihoodCalculationEngine = null;
// the genotyping engine
GenotypingEngine genotypingEngine = null;
// the annotation engine
private VariantAnnotatorEngine annotationEngine;
// fasta reference reader to supplement the edges of the reference sequence
private IndexedFastaSequenceFile referenceReader;
// reference base padding size
private static final int REFERENCE_PADDING = 900;
// bases with quality less than or equal to this value are trimmed off the tails of the reads
private static final byte MIN_TAIL_QUALITY = 20;
private ArrayList<String> samplesList = new ArrayList<String>();
private final static double LOG_ONE_HALF = -Math.log10(2.0);
private final static double LOG_ONE_THIRD = -Math.log10(3.0);
private final ArrayList<VariantContext> allelesToGenotype = new ArrayList<VariantContext>();
private final static Allele FAKE_REF_ALLELE = Allele.create("N", true); // used in isActive function to call into UG Engine. Should never appear anywhere in a VCF file
private final static Allele FAKE_ALT_ALLELE = Allele.create("<FAKE_ALT>", false); // used in isActive function to call into UG Engine. Should never appear anywhere in a VCF file
//---------------------------------------------------------------------------------------------------------------
//
// initialize
//
//---------------------------------------------------------------------------------------------------------------
public void initialize() {
super.initialize();
// get all of the unique sample names
Set<String> samples = SampleUtils.getSAMFileSamples(getToolkit().getSAMFileHeader());
samplesList.addAll( samples );
// initialize the UnifiedGenotyper Engine which is used to call into the exact model
UAC.GLmodel = GenotypeLikelihoodsCalculationModel.Model.SNP; // the GLmodel isn't used by the HaplotypeCaller but it is dangerous to let the user change this argument
UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC.clone(), logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY);
UAC.OutputMode = UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY; // low values used for isActive determination only, default/user-specified values used for actual calling
UAC.GenotypingMode = GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.DISCOVERY; // low values used for isActive determination only, default/user-specified values used for actual calling
UAC.STANDARD_CONFIDENCE_FOR_CALLING = Math.max( 4.0, UAC.STANDARD_CONFIDENCE_FOR_CALLING);
UAC.STANDARD_CONFIDENCE_FOR_EMITTING = Math.max( 4.0, UAC.STANDARD_CONFIDENCE_FOR_EMITTING);
UG_engine_simple_genotyper = new UnifiedGenotyperEngine(getToolkit(), UAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY);
// initialize the output VCF header
annotationEngine = new VariantAnnotatorEngine(Arrays.asList(annotationClassesToUse), annotationsToUse, annotationsToExclude, this, getToolkit());
Set<VCFHeaderLine> headerInfo = new HashSet<VCFHeaderLine>();
// all annotation fields from VariantAnnotatorEngine
headerInfo.addAll(annotationEngine.getVCFAnnotationDescriptions());
// all callers need to add these standard annotation header lines
VCFStandardHeaderLines.addStandardInfoLines(headerInfo, true,
VCFConstants.DOWNSAMPLED_KEY,
VCFConstants.MLE_ALLELE_COUNT_KEY,
VCFConstants.MLE_ALLELE_FREQUENCY_KEY);
// all callers need to add these standard FORMAT field header lines
VCFStandardHeaderLines.addStandardFormatLines(headerInfo, true,
VCFConstants.GENOTYPE_KEY,
VCFConstants.GENOTYPE_QUALITY_KEY,
VCFConstants.DEPTH_KEY,
VCFConstants.GENOTYPE_PL_KEY);
// header lines for the experimental HaplotypeCaller-specific annotations
headerInfo.add(new VCFInfoHeaderLine("NVH", 1, VCFHeaderLineType.Integer, "Number of variants found on the haplotype that contained this variant"));
headerInfo.add(new VCFInfoHeaderLine("NumHapEval", 1, VCFHeaderLineType.Integer, "Number of haplotypes that were chosen for evaluation in this active region"));
headerInfo.add(new VCFInfoHeaderLine("NumHapAssembly", 1, VCFHeaderLineType.Integer, "Number of haplotypes created during the assembly of this active region"));
headerInfo.add(new VCFInfoHeaderLine("ActiveRegionSize", 1, VCFHeaderLineType.Integer, "Number of base pairs that comprise this active region"));
headerInfo.add(new VCFInfoHeaderLine("EVENTLENGTH", 1, VCFHeaderLineType.Integer, "Max length of all the alternate alleles"));
headerInfo.add(new VCFInfoHeaderLine("TYPE", 1, VCFHeaderLineType.String, "Type of event: SNP or INDEL"));
headerInfo.add(new VCFInfoHeaderLine("extType", 1, VCFHeaderLineType.String, "Extended type of event: SNP, MNP, INDEL, or COMPLEX"));
headerInfo.add(new VCFInfoHeaderLine("QDE", 1, VCFHeaderLineType.Float, "QD value divided by the number of variants found on the haplotype that contained this variant"));
vcfWriter.writeHeader(new VCFHeader(headerInfo, samples));
try {
// fasta reference reader to supplement the edges of the reference sequence
referenceReader = new CachingIndexedFastaSequenceFile(getToolkit().getArguments().referenceFile);
} catch( FileNotFoundException e ) {
throw new UserException.CouldNotReadInputFile(getToolkit().getArguments().referenceFile, e);
}
assemblyEngine = new SimpleDeBruijnAssembler( DEBUG, graphWriter );
likelihoodCalculationEngine = new LikelihoodCalculationEngine( (byte)gcpHMM, DEBUG, false );
genotypingEngine = new GenotypingEngine( DEBUG, MNP_LOOK_AHEAD, OUTPUT_FULL_HAPLOTYPE_SEQUENCE );
}
//---------------------------------------------------------------------------------------------------------------
//
// isActive
//
//---------------------------------------------------------------------------------------------------------------
// enable deletions in the pileup
@Override
public boolean includeReadsWithDeletionAtLoci() { return true; }
// enable non primary reads in the active region
@Override
public boolean wantsNonPrimaryReads() { return true; }
@Override
@Ensures({"result.isActiveProb >= 0.0", "result.isActiveProb <= 1.0"})
public ActivityProfileResult isActive( final RefMetaDataTracker tracker, final ReferenceContext ref, final AlignmentContext context ) {
if( UG_engine.getUAC().GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) {
for( final VariantContext vc : tracker.getValues(UG_engine.getUAC().alleles, ref.getLocus()) ) {
if( !allelesToGenotype.contains(vc) ) {
allelesToGenotype.add(vc); // save for later for processing during the ActiveRegion's map call. Should be folded into a ReadMetaDataTracker object
}
}
if( tracker.getValues(UG_engine.getUAC().alleles, ref.getLocus()).size() > 0 ) {
return new ActivityProfileResult(1.0);
}
}
if( USE_ALLELES_TRIGGER ) {
return new ActivityProfileResult( tracker.getValues(UG_engine.getUAC().alleles, ref.getLocus()).size() > 0 ? 1.0 : 0.0 );
}
if( context == null ) { return new ActivityProfileResult(0.0); }
final List<Allele> noCall = new ArrayList<Allele>(); // used to noCall all genotypes until the exact model is applied
noCall.add(Allele.NO_CALL);
final Map<String, AlignmentContext> splitContexts = AlignmentContextUtils.splitContextBySampleName(context);
final GenotypesContext genotypes = GenotypesContext.create(splitContexts.keySet().size());
final MathUtils.RunningAverage averageHQSoftClips = new MathUtils.RunningAverage();
for( final Map.Entry<String, AlignmentContext> sample : splitContexts.entrySet() ) {
final double[] genotypeLikelihoods = new double[3]; // ref versus non-ref (any event)
Arrays.fill(genotypeLikelihoods, 0.0);
for( final PileupElement p : sample.getValue().getBasePileup() ) {
final byte qual = p.getQual();
if( p.isDeletion() || qual > (byte) 18) {
int AA = 0; final int AB = 1; int BB = 2;
if( p.getBase() != ref.getBase() || p.isDeletion() || p.isBeforeDeletedBase() || p.isAfterDeletedBase() || p.isBeforeInsertion() || p.isAfterInsertion() || p.isNextToSoftClip() ) {
AA = 2;
BB = 0;
if( p.isNextToSoftClip() ) {
averageHQSoftClips.add(AlignmentUtils.calcNumHighQualitySoftClips(p.getRead(), (byte) 28));
}
}
genotypeLikelihoods[AA] += p.getRepresentativeCount() * QualityUtils.qualToProbLog10(qual);
genotypeLikelihoods[AB] += p.getRepresentativeCount() * MathUtils.approximateLog10SumLog10( QualityUtils.qualToProbLog10(qual) + LOG_ONE_HALF, QualityUtils.qualToErrorProbLog10(qual) + LOG_ONE_THIRD + LOG_ONE_HALF );
genotypeLikelihoods[BB] += p.getRepresentativeCount() * QualityUtils.qualToErrorProbLog10(qual) + LOG_ONE_THIRD;
}
}
genotypes.add( new GenotypeBuilder(sample.getKey()).alleles(noCall).PL(genotypeLikelihoods).make() );
}
final ArrayList<Allele> alleles = new ArrayList<Allele>();
alleles.add( FAKE_REF_ALLELE );
alleles.add( FAKE_ALT_ALLELE );
final VariantCallContext vcOut = UG_engine_simple_genotyper.calculateGenotypes(new VariantContextBuilder("HCisActive!", context.getContig(), context.getLocation().getStart(), context.getLocation().getStop(), alleles).genotypes(genotypes).make(), GenotypeLikelihoodsCalculationModel.Model.INDEL);
final double isActiveProb = vcOut == null ? 0.0 : QualityUtils.qualToProb( vcOut.getPhredScaledQual() );
return new ActivityProfileResult( isActiveProb, averageHQSoftClips.mean() > 6.0 ? ActivityProfileResult.ActivityProfileResultState.HIGH_QUALITY_SOFT_CLIPS : ActivityProfileResult.ActivityProfileResultState.NONE, averageHQSoftClips.mean() );
}
//---------------------------------------------------------------------------------------------------------------
//
// map
//
//---------------------------------------------------------------------------------------------------------------
@Override
public Integer map( final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion, final RefMetaDataTracker metaDataTracker ) {
final ArrayList<VariantContext> activeAllelesToGenotype = new ArrayList<VariantContext>();
if( UG_engine.getUAC().GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) {
for( final VariantContext vc : allelesToGenotype ) {
if( activeRegion.getLocation().overlapsP( getToolkit().getGenomeLocParser().createGenomeLoc(vc) ) ) {
activeAllelesToGenotype.add(vc); // do something with these VCs during GGA mode
}
}
allelesToGenotype.removeAll( activeAllelesToGenotype );
}
if( !activeRegion.isActive ) { return 0; } // Not active so nothing to do!
if( activeRegion.size() == 0 && UG_engine.getUAC().GenotypingMode != GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) { return 0; } // No reads here so nothing to do!
if( UG_engine.getUAC().GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES && activeAllelesToGenotype.isEmpty() ) { return 0; } // No alleles found in this region so nothing to do!
finalizeActiveRegion( activeRegion ); // merge overlapping fragments, clip adapter and low qual tails
final Haplotype referenceHaplotype = new Haplotype(activeRegion.getActiveRegionReference(referenceReader)); // Create the reference haplotype which is the bases from the reference that make up the active region
referenceHaplotype.setIsReference(true);
final byte[] fullReferenceWithPadding = activeRegion.getFullReference(referenceReader, REFERENCE_PADDING);
//int PRUNE_FACTOR = Math.max(MIN_PRUNE_FACTOR, determinePruneFactorFromCoverage( activeRegion ));
final ArrayList<Haplotype> haplotypes = assemblyEngine.runLocalAssembly( activeRegion, referenceHaplotype, fullReferenceWithPadding, getPaddedLoc(activeRegion), MIN_PRUNE_FACTOR, activeAllelesToGenotype );
if( haplotypes.size() == 1 ) { return 1; } // only the reference haplotype remains so nothing else to do!
activeRegion.hardClipToActiveRegion(); // only evaluate the parts of reads that are overlapping the active region
final List<GATKSAMRecord> filteredReads = filterNonPassingReads( activeRegion ); // filter out reads from genotyping which fail mapping quality based criteria
if( activeRegion.size() == 0 ) { return 1; } // no reads remain after filtering so nothing else to do!
// evaluate each sample's reads against all haplotypes
final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList = splitReadsBySample( activeRegion.getReads() );
final HashMap<String, ArrayList<GATKSAMRecord>> perSampleFilteredReadList = splitReadsBySample( filteredReads );
likelihoodCalculationEngine.computeReadLikelihoods( haplotypes, perSampleReadList );
// subset down to only the best haplotypes to be genotyped in all samples ( in GGA mode use all discovered haplotypes )
final ArrayList<Haplotype> bestHaplotypes = ( UG_engine.getUAC().GenotypingMode != GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ? likelihoodCalculationEngine.selectBestHaplotypes( haplotypes ) : haplotypes );
for( final Pair<VariantContext, HashMap<Allele, ArrayList<Haplotype>>> callResult :
( GENOTYPE_FULL_ACTIVE_REGION && UG_engine.getUAC().GenotypingMode != GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES
? genotypingEngine.assignGenotypeLikelihoodsAndCallHaplotypeEvents( UG_engine, bestHaplotypes, fullReferenceWithPadding, getPaddedLoc(activeRegion), activeRegion.getLocation(), getToolkit().getGenomeLocParser() )
: genotypingEngine.assignGenotypeLikelihoodsAndCallIndependentEvents( UG_engine, bestHaplotypes, fullReferenceWithPadding, getPaddedLoc(activeRegion), activeRegion.getLocation(), getToolkit().getGenomeLocParser(), activeAllelesToGenotype ) ) ) {
if( DEBUG ) { System.out.println(callResult.getFirst().toStringWithoutGenotypes()); }
final Map<String, Map<Allele, List<GATKSAMRecord>>> stratifiedReadMap = LikelihoodCalculationEngine.partitionReadsBasedOnLikelihoods( getToolkit().getGenomeLocParser(), perSampleReadList, perSampleFilteredReadList, callResult );
final VariantContext annotatedCall = annotationEngine.annotateContext(stratifiedReadMap, callResult.getFirst());
// add some custom annotations to the calls
final Map<String, Object> myAttributes = new LinkedHashMap<String, Object>(annotatedCall.getAttributes());
// Calculate the number of variants on the haplotype
int maxNumVar = 0;
for( final Allele allele : callResult.getFirst().getAlleles() ) {
if( !allele.isReference() ) {
for( final Haplotype haplotype : callResult.getSecond().get(allele) ) {
final int numVar = haplotype.getEventMap().size();
if( numVar > maxNumVar ) { maxNumVar = numVar; }
}
}
}
// Calculate the event length
int maxLength = 0;
for ( final Allele a : annotatedCall.getAlternateAlleles() ) {
final int length = a.length() - annotatedCall.getReference().length();
if( Math.abs(length) > Math.abs(maxLength) ) { maxLength = length; }
}
myAttributes.put("NVH", maxNumVar);
myAttributes.put("NumHapEval", bestHaplotypes.size());
myAttributes.put("NumHapAssembly", haplotypes.size());
myAttributes.put("ActiveRegionSize", activeRegion.getLocation().size());
myAttributes.put("EVENTLENGTH", maxLength);
myAttributes.put("TYPE", (annotatedCall.isSNP() || annotatedCall.isMNP() ? "SNP" : "INDEL") );
myAttributes.put("extType", annotatedCall.getType().toString() );
//if( likelihoodCalculationEngine.haplotypeScore != null ) {
// myAttributes.put("HaplotypeScore", String.format("%.4f", likelihoodCalculationEngine.haplotypeScore));
//}
if( annotatedCall.hasAttribute("QD") ) {
myAttributes.put("QDE", String.format("%.2f", Double.parseDouble((String)annotatedCall.getAttribute("QD")) / ((double)maxNumVar)) );
}
vcfWriter.add( new VariantContextBuilder(annotatedCall).attributes(myAttributes).make() );
}
if( DEBUG ) { System.out.println("----------------------------------------------------------------------------------"); }
return 1; // One active region was processed during this map call
}
//---------------------------------------------------------------------------------------------------------------
//
// reduce
//
//---------------------------------------------------------------------------------------------------------------
@Override
public Integer reduceInit() {
return 0;
}
@Override
public Integer reduce(Integer cur, Integer sum) {
return cur + sum;
}
@Override
public void onTraversalDone(Integer result) {
logger.info("Ran local assembly on " + result + " active regions");
}
//---------------------------------------------------------------------------------------------------------------
//
// private helper functions
//
//---------------------------------------------------------------------------------------------------------------
private void finalizeActiveRegion( final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion ) {
if( DEBUG ) { System.out.println("\nAssembling " + activeRegion.getLocation() + " with " + activeRegion.size() + " reads: (with overlap region = " + activeRegion.getExtendedLoc() + ")"); }
final ArrayList<GATKSAMRecord> finalizedReadList = new ArrayList<GATKSAMRecord>();
final FragmentCollection<GATKSAMRecord> fragmentCollection = FragmentUtils.create( ReadUtils.sortReadsByCoordinate(activeRegion.getReads()) );
activeRegion.clearReads();
// Join overlapping paired reads to create a single longer read
finalizedReadList.addAll( fragmentCollection.getSingletonReads() );
for( final List<GATKSAMRecord> overlappingPair : fragmentCollection.getOverlappingPairs() ) {
finalizedReadList.addAll( FragmentUtils.mergeOverlappingPairedFragments(overlappingPair) );
}
Collections.shuffle(finalizedReadList, GenomeAnalysisEngine.getRandomGenerator());
// Loop through the reads hard clipping the adaptor and low quality tails
for( final GATKSAMRecord myRead : finalizedReadList ) {
final GATKSAMRecord postAdapterRead = ( myRead.getReadUnmappedFlag() ? myRead : ReadClipper.hardClipAdaptorSequence( myRead ) );
if( postAdapterRead != null && !postAdapterRead.isEmpty() && postAdapterRead.getCigar().getReadLength() > 0 ) {
final GATKSAMRecord clippedRead = ReadClipper.hardClipLowQualEnds( postAdapterRead, MIN_TAIL_QUALITY );
// protect against INTERVALS with abnormally high coverage
if( clippedRead.getReadLength() > 0 && activeRegion.size() < samplesList.size() * DOWNSAMPLE_PER_SAMPLE_PER_REGION ) {
activeRegion.add(clippedRead);
}
}
}
}
private List<GATKSAMRecord> filterNonPassingReads( final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion ) {
final ArrayList<GATKSAMRecord> readsToRemove = new ArrayList<GATKSAMRecord>();
for( final GATKSAMRecord rec : activeRegion.getReads() ) {
if( rec.getReadLength() < 24 || rec.getMappingQuality() < 20 || BadMateFilter.hasBadMate(rec) || (keepRG != null && !rec.getReadGroup().getId().equals(keepRG)) ) {
readsToRemove.add(rec);
}
}
activeRegion.removeAll( readsToRemove );
return readsToRemove;
}
private GenomeLoc getPaddedLoc( final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion ) {
final int padLeft = Math.max(activeRegion.getReferenceLoc().getStart()-REFERENCE_PADDING, 1);
final int padRight = Math.min(activeRegion.getReferenceLoc().getStop()+REFERENCE_PADDING, referenceReader.getSequenceDictionary().getSequence(activeRegion.getReferenceLoc().getContig()).getSequenceLength());
return getToolkit().getGenomeLocParser().createGenomeLoc(activeRegion.getReferenceLoc().getContig(), padLeft, padRight);
}
private HashMap<String, ArrayList<GATKSAMRecord>> splitReadsBySample( final List<GATKSAMRecord> reads ) {
final HashMap<String, ArrayList<GATKSAMRecord>> returnMap = new HashMap<String, ArrayList<GATKSAMRecord>>();
for( final String sample : samplesList) {
ArrayList<GATKSAMRecord> readList = returnMap.get( sample );
if( readList == null ) {
readList = new ArrayList<GATKSAMRecord>();
returnMap.put(sample, readList);
}
}
for( final GATKSAMRecord read : reads ) {
returnMap.get(read.getReadGroup().getSample()).add(read);
}
return returnMap;
}
/*
private int determinePruneFactorFromCoverage( final ActiveRegion activeRegion ) {
final ArrayList<Integer> readLengthDistribution = new ArrayList<Integer>();
for( final GATKSAMRecord read : activeRegion.getReads() ) {
readLengthDistribution.add(read.getReadLength());
}
final double meanReadLength = MathUtils.average(readLengthDistribution);
final double meanCoveragePerSample = (double) activeRegion.getReads().size() / ((double) activeRegion.getExtendedLoc().size() / meanReadLength) / (double) samplesList.size();
int PRUNE_FACTOR = 0;
if( meanCoveragePerSample > 8.5 ) {
PRUNE_FACTOR = (int) Math.floor( Math.sqrt( meanCoveragePerSample - 5.0 ) );
} else if( meanCoveragePerSample > 3.0 ) {
PRUNE_FACTOR = 1;
}
if( DEBUG ) { System.out.println(String.format("Mean coverage per sample = %.1f --> prune factor = %d", meanCoveragePerSample, PRUNE_FACTOR)); }
return PRUNE_FACTOR;
}
*/
}

View File

@ -0,0 +1,444 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.commandline.RodBinding;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.Reference;
import org.broadinstitute.sting.gatk.walkers.RodWalker;
import org.broadinstitute.sting.gatk.walkers.Window;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.SWPairwiseAlignment;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeader;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLine;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import org.broadinstitute.sting.utils.variantcontext.VariantContextBuilder;
import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils;
import org.broadinstitute.sting.utils.variantcontext.writer.VariantContextWriter;
import org.broadinstitute.sting.utils.variantcontext.writer.VariantContextWriterFactory;
import java.util.*;
/**
* Haplotype-based resolution of variants in 2 different eval files.
*
* <p>
* HaplotypeResolver is a tool that takes 2 VCF files and constructs haplotypes based on the variants inside them.
* From that, it can resolve potential differences in variant calls that are inherently the same (or similar) variants.
* Records are annotated with the set and status attributes.
*
* <h2>Input</h2>
* <p>
* 2 variant files to resolve.
* </p>
*
* <h2>Output</h2>
* <p>
* A single consensus VCF.
* </p>
*
* <h2>Examples</h2>
* <pre>
* java -Xmx1g -jar GenomeAnalysisTK.jar \
* -R ref.fasta \
* -T HaplotypeResolver \
* -V:v1 input1.vcf \
* -V:v2 input2.vcf \
* -o output.vcf
* </pre>
*
*/
@DocumentedGATKFeature( groupName = "Variant Evaluation and Manipulation Tools", extraDocs = {CommandLineGATK.class} )
@Reference(window=@Window(start=-HaplotypeResolver.ACTIVE_WINDOW,stop= HaplotypeResolver.ACTIVE_WINDOW))
public class HaplotypeResolver extends RodWalker<Integer, Integer> {
protected static final String INTERSECTION_SET = "intersection";
protected static final String SAME_STATUS = "same";
protected static final String SOME_ALLELES_MATCH_STATUS = "someAllelesMatch";
protected static final String SAME_START_DIFFERENT_ALLELES_STATUS = "sameStartDifferentAlleles";
protected static final String SAME_BY_HAPLOTYPE_STATUS = "sameByHaplotype";
protected static final String ONE_ALLELE_SUBSET_OF_OTHER_STATUS = "OneAlleleSubsetOfOther";
protected static final String OVERLAPPING_EVENTS_STATUS = "overlappingEvents";
protected final static int MAX_DISTANCE_BETWEEN_MERGED_RECORDS = 50;
protected final static int MAX_HAPLOTYPE_TO_CONSIDER = 1000;
protected final static int MAX_VARIANT_SIZE_TO_CONSIDER = 100;
protected final static int ACTIVE_WINDOW = MAX_HAPLOTYPE_TO_CONSIDER + MAX_VARIANT_SIZE_TO_CONSIDER;
@Input(fullName="variant", shortName = "V", doc="Input VCF file", required=true)
public List<RodBinding<VariantContext>> variants;
@Output(doc="File to which variants should be written", required=true)
protected VariantContextWriter baseWriter = null;
private VariantContextWriter writer;
/**
* Set to 'null' if you don't want the set field emitted.
*/
@Argument(fullName="setKey", shortName="setKey", doc="Key used in the INFO key=value tag emitted describing which set the combined VCF record came from", required=false)
protected String SET_KEY = "set";
/**
* Set to 'null' if you don't want the status field emitted.
*/
@Argument(fullName="statusKey", shortName="statusKey", doc="Key used in the INFO key=value tag emitted describing the extent to which records match", required=false)
protected String STATUS_KEY = "status";
private final LinkedList<VCcontext> queue = new LinkedList<VCcontext>();
private String source1, source2;
private final List<VariantContext> sourceVCs1 = new ArrayList<VariantContext>();
private final List<VariantContext> sourceVCs2 = new ArrayList<VariantContext>();
private class VCcontext {
public final Collection<VariantContext> vcs;
public final GenomeLoc loc;
public final ReferenceContext ref;
public VCcontext(final Collection<VariantContext> vcs, final ReferenceContext ref) {
this.vcs = vcs;
this.loc = getToolkit().getGenomeLocParser().createGenomeLoc(vcs.iterator().next());
this.ref = ref;
}
}
public void initialize() {
if ( variants.size() != 2 ) {
throw new UserException.BadArgumentValue("variant", "this tool requires exactly 2 input variant files");
}
source1 = variants.get(0).getName();
source2 = variants.get(1).getName();
if ( SET_KEY.toLowerCase().equals("null") )
SET_KEY = null;
if ( STATUS_KEY.toLowerCase().equals("null") )
STATUS_KEY = null;
// for now, INFO and FORMAT fields are not propagated to the output VCF (so they aren't put into the header)
Set<VCFHeaderLine> headerLines = new HashSet<VCFHeaderLine>();
if ( SET_KEY != null )
headerLines.add(new VCFInfoHeaderLine(SET_KEY, 1, VCFHeaderLineType.String, "Source VCF for the merged record"));
if ( STATUS_KEY != null )
headerLines.add(new VCFInfoHeaderLine(STATUS_KEY, 1, VCFHeaderLineType.String, "Extent to which records match"));
final VCFHeader vcfHeader = new VCFHeader(headerLines, Collections.<String>emptySet());
baseWriter.writeHeader(vcfHeader);
writer = VariantContextWriterFactory.sortOnTheFly(baseWriter, ACTIVE_WINDOW);
}
public Integer map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {
if ( tracker == null )
return 0;
final Collection<VariantContext> VCs = tracker.getValues(variants, context.getLocation());
if ( VCs.size() == 0 )
return 0;
final VCcontext vc = new VCcontext(VariantContextUtils.sitesOnlyVariantContexts(VCs), ref);
// TODO -- what should we do about filtered records?
if ( !queue.isEmpty() ) {
final VCcontext previous = queue.getLast();
if ( !previous.loc.onSameContig(vc.loc) ||
previous.loc.distance(vc.loc) > MAX_DISTANCE_BETWEEN_MERGED_RECORDS ||
queue.getFirst().loc.distance(vc.loc) > MAX_HAPLOTYPE_TO_CONSIDER ) {
purgeQueue();
}
}
queue.addLast(vc);
return 0;
}
public Integer reduceInit() { return 0; }
public Integer reduce(Integer value, Integer sum) {
return sum + value;
}
public void onTraversalDone(Integer result) {
if ( !queue.isEmpty() )
purgeQueue();
writer.close();
}
private void purgeQueue() {
final ReferenceContext refContext = queue.getFirst().ref;
// divide them up by source
while ( !queue.isEmpty() ) {
VCcontext context = queue.removeFirst();
for ( final VariantContext vc: context.vcs ) {
if ( vc.getSource().equals(source1) )
sourceVCs1.add(vc);
else
sourceVCs2.add(vc);
}
}
writeAndPurgeAllEqualVariants(sourceVCs1, sourceVCs2, SAME_STATUS);
if ( sourceVCs1.isEmpty() ) {
writeAll(sourceVCs2, source2, null);
} else if ( sourceVCs2.isEmpty() ) {
writeAll(sourceVCs1, source1, null);
} else {
resolveByHaplotype(refContext);
}
// allow for GC of the data
sourceVCs1.clear();
sourceVCs2.clear();
}
private void writeAll(final List<VariantContext> sourceVCs, final String set, final String status) {
for ( final VariantContext vc : sourceVCs ) {
writeOne(vc, set, status);
}
}
private void writeOne(final VariantContext vc, final String set, final String status) {
final Map<String, Object> attrs = new HashMap<String, Object>(vc.getAttributes());
if ( SET_KEY != null && set != null )
attrs.put(SET_KEY, set);
if ( STATUS_KEY != null && status != null )
attrs.put(STATUS_KEY, status);
writer.add(new VariantContextBuilder(vc).attributes(attrs).make());
}
private void writeAndPurgeAllEqualVariants(final List<VariantContext> sourceVCs1, final List<VariantContext> sourceVCs2, final String status) {
int currentIndex1 = 0, currentIndex2 = 0;
int size1 = sourceVCs1.size(), size2 = sourceVCs2.size();
VariantContext current1 = (currentIndex1 < size1 ? sourceVCs1.get(currentIndex1): null);
VariantContext current2 = (currentIndex2 < size2 ? sourceVCs2.get(currentIndex2): null);
while ( current1 != null && current2 != null ) {
final GenomeLoc loc1 = getToolkit().getGenomeLocParser().createGenomeLoc(current1);
final GenomeLoc loc2 = getToolkit().getGenomeLocParser().createGenomeLoc(current2);
if ( loc1.equals(loc2) ||
(loc1.getStart() == loc2.getStart() && (current1.getAlternateAlleles().size() > 1 || current2.getAlternateAlleles().size() > 1)) ) {
// test the alleles
if ( determineAndWriteOverlap(current1, current2, status) ) {
sourceVCs1.remove(currentIndex1);
sourceVCs2.remove(currentIndex2);
size1--;
size2--;
} else {
currentIndex1++;
currentIndex2++;
}
current1 = (currentIndex1 < size1 ? sourceVCs1.get(currentIndex1): null);
current2 = (currentIndex2 < size2 ? sourceVCs2.get(currentIndex2): null);
} else if ( loc1.isBefore(loc2) ) {
currentIndex1++;
current1 = (currentIndex1 < size1 ? sourceVCs1.get(currentIndex1): null);
} else {
currentIndex2++;
current2 = (currentIndex2 < size2 ? sourceVCs2.get(currentIndex2): null);
}
}
}
private boolean determineAndWriteOverlap(final VariantContext vc1, final VariantContext vc2, final String status) {
final int allelesFrom1In2 = findOverlap(vc1, vc2);
final int allelesFrom2In1 = findOverlap(vc2, vc1);
final int totalAllelesIn1 = vc1.getAlternateAlleles().size();
final int totalAllelesIn2 = vc2.getAlternateAlleles().size();
final boolean allAllelesFrom1Overlap = allelesFrom1In2 == totalAllelesIn1;
final boolean allAllelesFrom2Overlap = allelesFrom2In1 == totalAllelesIn2;
boolean thereIsOverlap = true;
if ( allAllelesFrom1Overlap && allAllelesFrom2Overlap ) {
writeOne(vc1, INTERSECTION_SET, status);
} else if ( allAllelesFrom1Overlap ) {
writeOne(vc2, INTERSECTION_SET, source1 + "IsSubsetOf" + source2);
} else if ( allAllelesFrom2Overlap ) {
writeOne(vc1, INTERSECTION_SET, source2 + "IsSubsetOf" + source1);
} else if ( allelesFrom1In2 > 0 ) {
writeOne(vc1, INTERSECTION_SET, SOME_ALLELES_MATCH_STATUS);
} else if ( totalAllelesIn1 > 1 || totalAllelesIn2 > 1 ) { // we don't handle multi-allelics in the haplotype-based reconstruction
writeOne(vc1, INTERSECTION_SET, SAME_START_DIFFERENT_ALLELES_STATUS);
} else {
thereIsOverlap = false;
}
return thereIsOverlap;
}
private static int findOverlap(final VariantContext target, final VariantContext comparison) {
int overlap = 0;
for ( final Allele allele : target.getAlternateAlleles() ) {
if ( comparison.hasAlternateAllele(allele) )
overlap++;
}
return overlap;
}
private static final double SW_MATCH = 4.0;
private static final double SW_MISMATCH = -10.0;
private static final double SW_GAP = -25.0;
private static final double SW_GAP_EXTEND = -1.3;
private void resolveByHaplotype(final ReferenceContext refContext) {
final byte[] source1Haplotype = generateHaplotype(sourceVCs1, refContext);
final byte[] source2Haplotype = generateHaplotype(sourceVCs2, refContext);
final SWPairwiseAlignment swConsensus1 = new SWPairwiseAlignment( refContext.getBases(), source1Haplotype, SW_MATCH, SW_MISMATCH, SW_GAP, SW_GAP_EXTEND );
final SWPairwiseAlignment swConsensus2 = new SWPairwiseAlignment( refContext.getBases(), source2Haplotype, SW_MATCH, SW_MISMATCH, SW_GAP, SW_GAP_EXTEND );
// protect against SW failures
if( swConsensus1.getCigar().toString().contains("S") || swConsensus1.getCigar().getReferenceLength() < 20 ||
swConsensus2.getCigar().toString().contains("S") || swConsensus2.getCigar().getReferenceLength() < 20 ) {
// TODO -- handle errors appropriately
logger.debug("Bad SW alignment; aborting at " + refContext.getLocus());
return;
}
// order results by start position
final TreeMap<Integer, VariantContext> source1Map = new TreeMap<Integer, VariantContext>(GenotypingEngine.generateVCsFromAlignment(0, swConsensus1.getCigar(), refContext.getBases(), source1Haplotype, refContext.getWindow(), source1, 0));
final TreeMap<Integer, VariantContext> source2Map = new TreeMap<Integer, VariantContext>(GenotypingEngine.generateVCsFromAlignment(0, swConsensus2.getCigar(), refContext.getBases(), source2Haplotype, refContext.getWindow(), source2, 0));
if ( source1Map.size() == 0 || source2Map.size() == 0 ) {
// TODO -- handle errors appropriately
logger.debug("No source alleles; aborting at " + refContext.getLocus());
return;
}
// create lists and test for equality
final List<VariantContext> source1Alleles = new ArrayList<VariantContext>(source1Map.values());
final List<VariantContext> source2Alleles = new ArrayList<VariantContext>(source2Map.values());
writeAndPurgeAllEqualVariants(source1Alleles, source2Alleles, SAME_BY_HAPLOTYPE_STATUS);
if ( source1Alleles.isEmpty() ) {
writeAll(source2Alleles, source2, null);
} else if ( source2Alleles.isEmpty() ) {
writeAll(source1Alleles, source1, null);
} else {
writeDifferences(source1Alleles, source2Alleles);
}
}
private byte[] generateHaplotype(final List<VariantContext> sourceVCs, final ReferenceContext refContext) {
final StringBuilder sb = new StringBuilder();
final int startPos = refContext.getWindow().getStart();
int currentPos = startPos;
final byte[] reference = refContext.getBases();
for ( final VariantContext vc : sourceVCs ) {
// add any missing reference context
int vcStart = vc.getStart();
final int refAlleleLength = vc.getReference().length();
if ( refAlleleLength == vc.getEnd() - vc.getStart() ) // this is a deletion (whereas for other events the padding base isn't part of the position)
vcStart++;
while ( currentPos < vcStart )
sb.append((char)reference[currentPos++ - startPos]);
// add the alt allele
sb.append(vc.getAlternateAllele(0).getBaseString());
// skip the reference allele
currentPos += refAlleleLength;
}
// add any missing reference context
final int stopPos = refContext.getWindow().getStop();
while ( currentPos < stopPos )
sb.append((char)reference[currentPos++ - startPos]);
return sb.toString().getBytes();
}
private void writeDifferences(final List<VariantContext> source1Alleles, final List<VariantContext> source2Alleles) {
int currentIndex1 = 0, currentIndex2 = 0;
final int size1 = source1Alleles.size(), size2 = source2Alleles.size();
VariantContext current1 = source1Alleles.get(0);
VariantContext current2 = source2Alleles.get(0);
while ( currentIndex1 < size1 || currentIndex2 < size2 ) {
if ( current1 == null ) {
writeOne(current2, source2, null);
currentIndex2++;
current2 = (currentIndex2 < size2 ? source2Alleles.get(currentIndex2): null);
} else if ( current2 == null ) {
writeOne(current1, source1, null);
currentIndex1++;
current1 = (currentIndex1 < size1 ? source1Alleles.get(currentIndex1): null);
} else {
final GenomeLoc loc1 = getToolkit().getGenomeLocParser().createGenomeLoc(current1);
final GenomeLoc loc2 = getToolkit().getGenomeLocParser().createGenomeLoc(current2);
if ( loc1.getStart() == loc2.getStart() || loc1.overlapsP(loc2) ) {
String status;
if ( loc1.getStart() == loc2.getStart() ) {
final String allele1 = current1.getAlternateAllele(0).getBaseString();
final String allele2 = current2.getAlternateAllele(0).getBaseString();
if ( allele1.indexOf(allele2) != -1 || allele2.indexOf(allele1) != -1 )
status = ONE_ALLELE_SUBSET_OF_OTHER_STATUS;
else
status = SAME_START_DIFFERENT_ALLELES_STATUS;
} else {
status = OVERLAPPING_EVENTS_STATUS;
}
writeOne(current1, INTERSECTION_SET, status);
currentIndex1++;
currentIndex2++;
current1 = (currentIndex1 < size1 ? source1Alleles.get(currentIndex1): null);
current2 = (currentIndex2 < size2 ? source2Alleles.get(currentIndex2): null);
} else if ( loc1.isBefore(loc2) ) {
writeOne(current1, source1, null);
currentIndex1++;
current1 = (currentIndex1 < size1 ? source1Alleles.get(currentIndex1): null);
} else {
writeOne(current2, source2, null);
currentIndex2++;
current2 = (currentIndex2 < size2 ? source2Alleles.get(currentIndex2): null);
}
}
}
}
}

View File

@ -0,0 +1,149 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import org.apache.commons.lang.ArrayUtils;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.jgrapht.graph.DefaultDirectedGraph;
import java.util.*;
/**
* Created by IntelliJ IDEA.
* User: ebanks
* Date: Mar 23, 2011
*/
// Class for finding the K best paths (as determined by the sum of multiplicities of the edges) in a graph.
// This is different from most graph traversals because we want to test paths from any source node to any sink node.
public class KBestPaths {
// static access only
protected KBestPaths() { }
private static int MAX_PATHS_TO_HOLD = 100;
protected static class MyInt { public int val = 0; }
// class to keep track of paths
protected static class Path {
// the last vertex seen in the path
private DeBruijnVertex lastVertex;
// the list of edges comprising the path
private ArrayList<DeBruijnEdge> edges;
// the scores for the path
private int totalScore = 0, lowestEdge = -1;
public Path( final DeBruijnVertex initialVertex ) {
lastVertex = initialVertex;
edges = new ArrayList<DeBruijnEdge>(0);
}
public Path( final Path p, final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final DeBruijnEdge edge ) {
lastVertex = graph.getEdgeTarget(edge);
edges = new ArrayList<DeBruijnEdge>(p.edges);
edges.add(edge);
totalScore = p.totalScore + edge.getMultiplicity();
lowestEdge = ( p.lowestEdge == -1 ) ? edge.getMultiplicity() : Math.min(p.lowestEdge, edge.getMultiplicity());
}
public boolean containsEdge( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final DeBruijnEdge edge ) {
final DeBruijnVertex targetVertex = graph.getEdgeTarget(edge);
for( final DeBruijnEdge e : edges ) {
if( e.equals(graph, edge) || graph.getEdgeTarget(e).equals(targetVertex) ) {
return true;
}
}
return false;
}
public ArrayList<DeBruijnEdge> getEdges() { return edges; }
public int getScore() { return totalScore; }
public int getLowestEdge() { return lowestEdge; }
public DeBruijnVertex getLastVertexInPath() { return lastVertex; }
public byte[] getBases( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph ) {
if( edges.size() == 0 ) { return lastVertex.getSequence(); }
byte[] bases = graph.getEdgeSource( edges.get(0) ).getSequence();
for( final DeBruijnEdge e : edges ) {
bases = ArrayUtils.addAll(bases, graph.getEdgeTarget( e ).getSuffix());
}
return bases;
}
}
protected static class PathComparatorTotalScore implements Comparator<Path> {
public int compare(final Path path1, final Path path2) {
return path1.totalScore - path2.totalScore;
}
}
//protected static class PathComparatorLowestEdge implements Comparator<Path> {
// public int compare(final Path path1, final Path path2) {
// return path2.lowestEdge - path1.lowestEdge;
// }
//}
public static List<Path> getKBestPaths( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final int k ) {
if( k > MAX_PATHS_TO_HOLD/2 ) { throw new ReviewedStingException("Asked for more paths than MAX_PATHS_TO_HOLD!"); }
final ArrayList<Path> bestPaths = new ArrayList<Path>();
// run a DFS for best paths
for( final DeBruijnVertex v : graph.vertexSet() ) {
if( graph.inDegreeOf(v) == 0 ) {
findBestPaths(graph, new Path(v), bestPaths);
}
}
Collections.sort(bestPaths, new PathComparatorTotalScore() );
Collections.reverse(bestPaths);
return bestPaths.subList(0, Math.min(k, bestPaths.size()));
}
private static void findBestPaths( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final Path path, final List<Path> bestPaths ) {
findBestPaths(graph, path, bestPaths, new MyInt());
}
private static void findBestPaths( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final Path path, final List<Path> bestPaths, MyInt n ) {
// did we hit the end of a path?
if ( allOutgoingEdgesHaveBeenVisited(graph, path) ) {
if ( bestPaths.size() >= MAX_PATHS_TO_HOLD ) {
// clean out some low scoring paths
Collections.sort(bestPaths, new PathComparatorTotalScore() );
for(int iii = 0; iii < 20; iii++) { bestPaths.remove(0); } // BUGBUG: assumes MAX_PATHS_TO_HOLD >> 20
}
bestPaths.add(path);
} else if( n.val > 10000) {
// do nothing, just return
} else {
// recursively run DFS
final ArrayList<DeBruijnEdge> edgeArrayList = new ArrayList<DeBruijnEdge>();
edgeArrayList.addAll(graph.outgoingEdgesOf(path.lastVertex));
Collections.sort(edgeArrayList);
Collections.reverse(edgeArrayList);
for ( final DeBruijnEdge edge : edgeArrayList ) {
// make sure the edge is not already in the path
if ( path.containsEdge(graph, edge) )
continue;
final Path newPath = new Path(path, graph, edge);
n.val++;
findBestPaths(graph, newPath, bestPaths, n);
}
}
}
private static boolean allOutgoingEdgesHaveBeenVisited( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final Path path ) {
for( final DeBruijnEdge edge : graph.outgoingEdgesOf(path.lastVertex) ) {
if( !path.containsEdge(graph, edge) ) {
return false;
}
}
return true;
}
}

View File

@ -0,0 +1,386 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.util.*;
public class LikelihoodCalculationEngine {
private static final double LOG_ONE_HALF = -Math.log10(2.0);
private static final double BEST_LIKELIHOOD_THRESHOLD = 0.1;
private final byte constantGCP;
private final boolean DEBUG;
private final PairHMM pairHMM;
public LikelihoodCalculationEngine( final byte constantGCP, final boolean debug, final boolean noBanded ) {
pairHMM = new PairHMM( noBanded );
this.constantGCP = constantGCP;
DEBUG = debug;
}
public void computeReadLikelihoods( final ArrayList<Haplotype> haplotypes, final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList ) {
int X_METRIC_LENGTH = 0;
for( final Map.Entry<String, ArrayList<GATKSAMRecord>> sample : perSampleReadList.entrySet() ) {
for( final GATKSAMRecord read : sample.getValue() ) {
final int readLength = read.getReadLength();
if( readLength > X_METRIC_LENGTH ) { X_METRIC_LENGTH = readLength; }
}
}
int Y_METRIC_LENGTH = 0;
for( final Haplotype h : haplotypes ) {
final int haplotypeLength = h.getBases().length;
if( haplotypeLength > Y_METRIC_LENGTH ) { Y_METRIC_LENGTH = haplotypeLength; }
}
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
X_METRIC_LENGTH += 2;
Y_METRIC_LENGTH += 2;
// initial arrays to hold the probabilities of being in the match, insertion and deletion cases
final double[][] matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
final double[][] XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
final double[][] YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
PairHMM.initializeArrays(matchMetricArray, XMetricArray, YMetricArray, X_METRIC_LENGTH);
// for each sample's reads
for( final String sample : perSampleReadList.keySet() ) {
//if( DEBUG ) { System.out.println("Evaluating sample " + sample + " with " + perSampleReadList.get( sample ).size() + " passing reads"); }
// evaluate the likelihood of the reads given those haplotypes
computeReadLikelihoods( haplotypes, perSampleReadList.get(sample), sample, matchMetricArray, XMetricArray, YMetricArray );
}
}
private void computeReadLikelihoods( final ArrayList<Haplotype> haplotypes, final ArrayList<GATKSAMRecord> reads, final String sample,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
final int numHaplotypes = haplotypes.size();
final int numReads = reads.size();
final double[][] readLikelihoods = new double[numHaplotypes][numReads];
final int[][] readCounts = new int[numHaplotypes][numReads];
for( int iii = 0; iii < numReads; iii++ ) {
final GATKSAMRecord read = reads.get(iii);
final int readCount = ReadUtils.getMeanRepresentativeReadCount(read);
final byte[] overallGCP = new byte[read.getReadLength()];
Arrays.fill( overallGCP, constantGCP ); // Is there a way to derive empirical estimates for this from the data?
Haplotype previousHaplotypeSeen = null;
final byte[] readQuals = read.getBaseQualities();
final byte[] readInsQuals = read.getBaseInsertionQualities();
final byte[] readDelQuals = read.getBaseDeletionQualities();
for( int kkk = 0; kkk < readQuals.length; kkk++ ) {
readQuals[kkk] = ( readQuals[kkk] > (byte) read.getMappingQuality() ? (byte) read.getMappingQuality() : readQuals[kkk] ); // cap base quality by mapping quality
//readQuals[kkk] = ( readQuals[kkk] > readInsQuals[kkk] ? readInsQuals[kkk] : readQuals[kkk] ); // cap base quality by base insertion quality, needs to be evaluated
//readQuals[kkk] = ( readQuals[kkk] > readDelQuals[kkk] ? readDelQuals[kkk] : readQuals[kkk] ); // cap base quality by base deletion quality, needs to be evaluated
readQuals[kkk] = ( readQuals[kkk] < (byte) 18 ? QualityUtils.MIN_USABLE_Q_SCORE : readQuals[kkk] );
}
for( int jjj = 0; jjj < numHaplotypes; jjj++ ) {
final Haplotype haplotype = haplotypes.get(jjj);
final int haplotypeStart = ( previousHaplotypeSeen == null ? 0 : computeFirstDifferingPosition(haplotype.getBases(), previousHaplotypeSeen.getBases()) );
previousHaplotypeSeen = haplotype;
readLikelihoods[jjj][iii] = pairHMM.computeReadLikelihoodGivenHaplotype(haplotype.getBases(), read.getReadBases(),
readQuals, readInsQuals, readDelQuals, overallGCP,
haplotypeStart, matchMetricArray, XMetricArray, YMetricArray);
readCounts[jjj][iii] = readCount;
}
}
for( int jjj = 0; jjj < numHaplotypes; jjj++ ) {
haplotypes.get(jjj).addReadLikelihoods( sample, readLikelihoods[jjj], readCounts[jjj] );
}
}
private static int computeFirstDifferingPosition( final byte[] b1, final byte[] b2 ) {
for( int iii = 0; iii < b1.length && iii < b2.length; iii++ ){
if( b1[iii] != b2[iii] ) {
return iii;
}
}
return b1.length;
}
@Requires({"haplotypes.size() > 0"})
@Ensures({"result.length == result[0].length", "result.length == haplotypes.size()"})
public static double[][] computeDiploidHaplotypeLikelihoods( final ArrayList<Haplotype> haplotypes, final String sample ) {
// set up the default 1-to-1 haplotype mapping object, BUGBUG: target for future optimization?
final ArrayList<ArrayList<Haplotype>> haplotypeMapping = new ArrayList<ArrayList<Haplotype>>();
for( final Haplotype h : haplotypes ) {
final ArrayList<Haplotype> list = new ArrayList<Haplotype>();
list.add(h);
haplotypeMapping.add(list);
}
return computeDiploidHaplotypeLikelihoods( sample, haplotypeMapping );
}
// This function takes just a single sample and a haplotypeMapping
@Requires({"haplotypeMapping.size() > 0"})
@Ensures({"result.length == result[0].length", "result.length == haplotypeMapping.size()"})
public static double[][] computeDiploidHaplotypeLikelihoods( final String sample, final ArrayList<ArrayList<Haplotype>> haplotypeMapping ) {
final TreeSet<String> sampleSet = new TreeSet<String>();
sampleSet.add(sample);
return computeDiploidHaplotypeLikelihoods(sampleSet, haplotypeMapping);
}
// This function takes a set of samples to pool over and a haplotypeMapping
@Requires({"haplotypeMapping.size() > 0"})
@Ensures({"result.length == result[0].length", "result.length == haplotypeMapping.size()"})
public static double[][] computeDiploidHaplotypeLikelihoods( final Set<String> samples, final ArrayList<ArrayList<Haplotype>> haplotypeMapping ) {
final int numHaplotypes = haplotypeMapping.size();
final double[][] haplotypeLikelihoodMatrix = new double[numHaplotypes][numHaplotypes];
for( int iii = 0; iii < numHaplotypes; iii++ ) {
Arrays.fill(haplotypeLikelihoodMatrix[iii], Double.NEGATIVE_INFINITY);
}
// compute the diploid haplotype likelihoods
// todo - needs to be generalized to arbitrary ploidy, cleaned and merged with PairHMMIndelErrorModel code
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
for( final Haplotype iii_mapped : haplotypeMapping.get(iii) ) {
for( final Haplotype jjj_mapped : haplotypeMapping.get(jjj) ) {
double haplotypeLikelihood = 0.0;
for( final String sample : samples ) {
final double[] readLikelihoods_iii = iii_mapped.getReadLikelihoods(sample);
final int[] readCounts_iii = iii_mapped.getReadCounts(sample);
final double[] readLikelihoods_jjj = jjj_mapped.getReadLikelihoods(sample);
for( int kkk = 0; kkk < readLikelihoods_iii.length; kkk++ ) {
// Compute log10(10^x1/2 + 10^x2/2) = log10(10^x1+10^x2)-log10(2)
// log10(10^(a*x1) + 10^(b*x2)) ???
// First term is approximated by Jacobian log with table lookup.
haplotypeLikelihood += readCounts_iii[kkk] * ( MathUtils.approximateLog10SumLog10(readLikelihoods_iii[kkk], readLikelihoods_jjj[kkk]) + LOG_ONE_HALF );
}
}
haplotypeLikelihoodMatrix[iii][jjj] = Math.max(haplotypeLikelihoodMatrix[iii][jjj], haplotypeLikelihood); // MathUtils.approximateLog10SumLog10(haplotypeLikelihoodMatrix[iii][jjj], haplotypeLikelihood); // BUGBUG: max or sum?
}
}
}
}
// normalize the diploid likelihoods matrix
return normalizeDiploidLikelihoodMatrixFromLog10( haplotypeLikelihoodMatrix );
}
@Requires({"likelihoodMatrix.length == likelihoodMatrix[0].length"})
@Ensures({"result.length == result[0].length", "result.length == likelihoodMatrix.length"})
protected static double[][] normalizeDiploidLikelihoodMatrixFromLog10( final double[][] likelihoodMatrix ) {
final int numHaplotypes = likelihoodMatrix.length;
double[] genotypeLikelihoods = new double[numHaplotypes*(numHaplotypes+1)/2];
int index = 0;
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ){
genotypeLikelihoods[index++] = likelihoodMatrix[iii][jjj];
}
}
genotypeLikelihoods = MathUtils.normalizeFromLog10(genotypeLikelihoods, false, true);
index = 0;
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ){
likelihoodMatrix[iii][jjj] = genotypeLikelihoods[index++];
}
}
return likelihoodMatrix;
}
/*
@Requires({"haplotypes.size() > 0"})
@Ensures({"result.size() <= haplotypes.size()"})
public ArrayList<Haplotype> selectBestHaplotypes( final ArrayList<Haplotype> haplotypes ) {
// BUGBUG: This function needs a lot of work. Need to use 4-gamete test or Tajima's D to decide to break up events into separate pieces for genotyping
final int numHaplotypes = haplotypes.size();
final Set<String> sampleKeySet = haplotypes.get(0).getSampleKeySet(); // BUGBUG: assume all haplotypes saw the same samples
final ArrayList<Integer> bestHaplotypesIndexList = new ArrayList<Integer>();
bestHaplotypesIndexList.add(0); // always start with the reference haplotype
final double[][][] haplotypeLikelihoodMatrix = new double[sampleKeySet.size()][numHaplotypes][numHaplotypes];
int sampleCount = 0;
for( final String sample : sampleKeySet ) {
haplotypeLikelihoodMatrix[sampleCount++] = computeDiploidHaplotypeLikelihoods( haplotypes, sample );
}
int hap1 = 0;
int hap2 = 0;
int chosenSample = 0;
//double bestElement = Double.NEGATIVE_INFINITY;
final int maxChosenHaplotypes = Math.min( 15, sampleKeySet.size() * 2 + 1 );
while( bestHaplotypesIndexList.size() < maxChosenHaplotypes ) {
double maxElement = Double.NEGATIVE_INFINITY;
for( int kkk = 0; kkk < sampleCount; kkk++ ) {
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
if( haplotypeLikelihoodMatrix[kkk][iii][jjj] > maxElement ) {
maxElement = haplotypeLikelihoodMatrix[kkk][iii][jjj];
hap1 = iii;
hap2 = jjj;
chosenSample = kkk;
}
}
}
}
if( maxElement == Double.NEGATIVE_INFINITY ) { break; }
if( !bestHaplotypesIndexList.contains(hap1) ) { bestHaplotypesIndexList.add(hap1); }
if( !bestHaplotypesIndexList.contains(hap2) ) { bestHaplotypesIndexList.add(hap2); }
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
haplotypeLikelihoodMatrix[chosenSample][iii][jjj] = Double.NEGATIVE_INFINITY;
}
}
}
if( DEBUG ) { System.out.println("Chose " + (bestHaplotypesIndexList.size() - 1) + " alternate haplotypes to genotype in all samples."); }
final ArrayList<Haplotype> bestHaplotypes = new ArrayList<Haplotype>();
for( final int hIndex : bestHaplotypesIndexList ) {
bestHaplotypes.add( haplotypes.get(hIndex) );
}
return bestHaplotypes;
}
*/
@Requires({"haplotypes.size() > 0"})
@Ensures({"result.size() <= haplotypes.size()"})
public ArrayList<Haplotype> selectBestHaplotypes( final ArrayList<Haplotype> haplotypes ) {
final int numHaplotypes = haplotypes.size();
final Set<String> sampleKeySet = haplotypes.get(0).getSampleKeySet(); // BUGBUG: assume all haplotypes saw the same samples
final ArrayList<Integer> bestHaplotypesIndexList = new ArrayList<Integer>();
bestHaplotypesIndexList.add(0); // always start with the reference haplotype
// set up the default 1-to-1 haplotype mapping object
final ArrayList<ArrayList<Haplotype>> haplotypeMapping = new ArrayList<ArrayList<Haplotype>>();
for( final Haplotype h : haplotypes ) {
final ArrayList<Haplotype> list = new ArrayList<Haplotype>();
list.add(h);
haplotypeMapping.add(list);
}
final double[][] haplotypeLikelihoodMatrix = computeDiploidHaplotypeLikelihoods( sampleKeySet, haplotypeMapping ); // all samples pooled together
int hap1 = 0;
int hap2 = 0;
//double bestElement = Double.NEGATIVE_INFINITY;
final int maxChosenHaplotypes = Math.min( 13, sampleKeySet.size() * 2 + 1 );
while( bestHaplotypesIndexList.size() < maxChosenHaplotypes ) {
double maxElement = Double.NEGATIVE_INFINITY;
for( int iii = 0; iii < numHaplotypes; iii++ ) {
for( int jjj = 0; jjj <= iii; jjj++ ) {
if( haplotypeLikelihoodMatrix[iii][jjj] > maxElement ) {
maxElement = haplotypeLikelihoodMatrix[iii][jjj];
hap1 = iii;
hap2 = jjj;
}
}
}
if( maxElement == Double.NEGATIVE_INFINITY ) { break; }
if( DEBUG ) { System.out.println("Chose haplotypes " + hap1 + " and " + hap2 + " with diploid likelihood = " + haplotypeLikelihoodMatrix[hap1][hap2]); }
haplotypeLikelihoodMatrix[hap1][hap2] = Double.NEGATIVE_INFINITY;
if( !bestHaplotypesIndexList.contains(hap1) ) { bestHaplotypesIndexList.add(hap1); }
if( !bestHaplotypesIndexList.contains(hap2) ) { bestHaplotypesIndexList.add(hap2); }
}
if( DEBUG ) { System.out.println("Chose " + (bestHaplotypesIndexList.size() - 1) + " alternate haplotypes to genotype in all samples."); }
final ArrayList<Haplotype> bestHaplotypes = new ArrayList<Haplotype>();
for( final int hIndex : bestHaplotypesIndexList ) {
bestHaplotypes.add( haplotypes.get(hIndex) );
}
return bestHaplotypes;
}
public static Map<String, Map<Allele, List<GATKSAMRecord>>> partitionReadsBasedOnLikelihoods( final GenomeLocParser parser, final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList, final HashMap<String, ArrayList<GATKSAMRecord>> perSampleFilteredReadList, final Pair<VariantContext, HashMap<Allele,ArrayList<Haplotype>>> call) {
final Map<String, Map<Allele, List<GATKSAMRecord>>> returnMap = new HashMap<String, Map<Allele, List<GATKSAMRecord>>>();
final GenomeLoc callLoc = parser.createGenomeLoc(call.getFirst());
for( final Map.Entry<String, ArrayList<GATKSAMRecord>> sample : perSampleReadList.entrySet() ) {
final Map<Allele, List<GATKSAMRecord>> alleleReadMap = new HashMap<Allele, List<GATKSAMRecord>>();
final ArrayList<GATKSAMRecord> readsForThisSample = sample.getValue();
for( int iii = 0; iii < readsForThisSample.size(); iii++ ) {
final GATKSAMRecord read = readsForThisSample.get(iii); // BUGBUG: assumes read order in this list and haplotype likelihood list are the same!
// only count the read if it overlaps the event, otherwise it is not added to the output read list at all
if( callLoc.overlapsP(parser.createGenomeLoc(read)) ) {
final double likelihoods[] = new double[call.getFirst().getAlleles().size()];
int count = 0;
for( final Allele a : call.getFirst().getAlleles() ) { // find the allele with the highest haplotype likelihood
double maxLikelihood = Double.NEGATIVE_INFINITY;
for( final Haplotype h : call.getSecond().get(a) ) { // use the max likelihood from all the haplotypes which mapped to this allele (achieved via the haplotype mapper object)
final double likelihood = h.getReadLikelihoods(sample.getKey())[iii];
if( likelihood > maxLikelihood ) {
maxLikelihood = likelihood;
}
}
likelihoods[count++] = maxLikelihood;
}
final int bestAllele = MathUtils.maxElementIndex(likelihoods);
final double bestLikelihood = likelihoods[bestAllele];
Allele allele = Allele.NO_CALL;
boolean isInformativeRead = false;
for( final double likelihood : likelihoods ) {
if( bestLikelihood - likelihood > BEST_LIKELIHOOD_THRESHOLD ) {
isInformativeRead = true;
break;
}
}
// uninformative reads get the no call Allele
if( isInformativeRead ) {
allele = call.getFirst().getAlleles().get(bestAllele);
}
List<GATKSAMRecord> readList = alleleReadMap.get(allele);
if( readList == null ) {
readList = new ArrayList<GATKSAMRecord>();
alleleReadMap.put(allele, readList);
}
readList.add(read);
}
}
// add all filtered reads to the NO_CALL list because they weren't given any likelihoods
List<GATKSAMRecord> readList = alleleReadMap.get(Allele.NO_CALL);
if( readList == null ) {
readList = new ArrayList<GATKSAMRecord>();
alleleReadMap.put(Allele.NO_CALL, readList);
}
for( final GATKSAMRecord read : perSampleFilteredReadList.get(sample.getKey()) ) {
// only count the read if it overlaps the event, otherwise it is not added to the output read list at all
if( callLoc.overlapsP(parser.createGenomeLoc(read)) ) {
readList.add(read);
}
}
returnMap.put(sample.getKey(), alleleReadMap);
}
return returnMap;
}
}

View File

@ -0,0 +1,25 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.activeregion.ActiveRegion;
import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.util.ArrayList;
/**
* Created by IntelliJ IDEA.
* User: ebanks
* Date: Mar 14, 2011
*/
public abstract class LocalAssemblyEngine {
public enum ASSEMBLER {
SIMPLE_DE_BRUIJN
}
protected LocalAssemblyEngine() {
}
public abstract ArrayList<Haplotype> runLocalAssembly(ActiveRegion activeRegion, Haplotype refHaplotype, byte[] fullReferenceWithPadding, GenomeLoc refLoc, int PRUNE_FACTOR, ArrayList<VariantContext> activeAllelesToGenotype);
}

View File

@ -0,0 +1,384 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import com.google.java.contract.Ensures;
import org.apache.commons.lang.ArrayUtils;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.SWPairwiseAlignment;
import org.broadinstitute.sting.utils.activeregion.ActiveRegion;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.sam.AlignmentUtils;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import org.jgrapht.graph.DefaultDirectedGraph;
import java.io.PrintStream;
import java.util.*;
/**
* Created by IntelliJ IDEA.
* User: ebanks, rpoplin
* Date: Mar 14, 2011
*/
public class SimpleDeBruijnAssembler extends LocalAssemblyEngine {
private static final int KMER_OVERLAP = 5; // the additional size of a valid chunk of sequence, used to string together k-mers
private static final int NUM_BEST_PATHS_PER_KMER_GRAPH = 11;
private static final byte MIN_QUALITY = (byte) 17;
// Smith-Waterman parameters originally copied from IndelRealigner
private static final double SW_MATCH = 5.0; // 1.0;
private static final double SW_MISMATCH = -10.0; //-1.0/3.0;
private static final double SW_GAP = -22.0; //-1.0-1.0/3.0;
private static final double SW_GAP_EXTEND = -1.2; //-1.0/.0;
private final boolean DEBUG;
private final PrintStream GRAPH_WRITER;
private final ArrayList<DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>> graphs = new ArrayList<DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>>();
private int PRUNE_FACTOR = 1;
public SimpleDeBruijnAssembler( final boolean debug, final PrintStream graphWriter ) {
super();
DEBUG = debug;
GRAPH_WRITER = graphWriter;
}
public ArrayList<Haplotype> runLocalAssembly( final ActiveRegion activeRegion, final Haplotype refHaplotype, final byte[] fullReferenceWithPadding, final GenomeLoc refLoc, final int PRUNE_FACTOR, final ArrayList<VariantContext> activeAllelesToGenotype ) {
this.PRUNE_FACTOR = PRUNE_FACTOR;
// create the graphs
createDeBruijnGraphs( activeRegion.getReads(), refHaplotype );
// clean up the graphs by pruning and merging
for( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph : graphs ) {
pruneGraph( graph, PRUNE_FACTOR );
//eliminateNonRefPaths( graph );
mergeNodes( graph );
}
if( GRAPH_WRITER != null ) {
printGraphs();
}
// find the best paths in the graphs
return findBestPaths( refHaplotype, fullReferenceWithPadding, refLoc, activeAllelesToGenotype, activeRegion.getExtendedLoc() );
}
protected void createDeBruijnGraphs( final List<GATKSAMRecord> reads, final Haplotype refHaplotype ) {
graphs.clear();
// create the graph
for( int kmer = 31; kmer <= 75; kmer += 6 ) {
final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
if( createGraphFromSequences( graph, reads, kmer, refHaplotype, DEBUG ) ) {
graphs.add(graph);
}
}
}
protected static void mergeNodes( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph ) {
boolean foundNodesToMerge = true;
while( foundNodesToMerge ) {
foundNodesToMerge = false;
for( final DeBruijnEdge e : graph.edgeSet() ) {
final DeBruijnVertex outgoingVertex = graph.getEdgeTarget(e);
final DeBruijnVertex incomingVertex = graph.getEdgeSource(e);
if( !outgoingVertex.equals(incomingVertex) && graph.inDegreeOf(outgoingVertex) == 1 && graph.outDegreeOf(incomingVertex) == 1) {
final Set<DeBruijnEdge> outEdges = graph.outgoingEdgesOf(outgoingVertex);
final Set<DeBruijnEdge> inEdges = graph.incomingEdgesOf(incomingVertex);
if( inEdges.size() == 1 && outEdges.size() == 1 ) {
inEdges.iterator().next().setMultiplicity( inEdges.iterator().next().getMultiplicity() + ( e.getMultiplicity() / 2 ) );
outEdges.iterator().next().setMultiplicity( outEdges.iterator().next().getMultiplicity() + ( e.getMultiplicity() / 2 ) );
} else if( inEdges.size() == 1 ) {
inEdges.iterator().next().setMultiplicity( inEdges.iterator().next().getMultiplicity() + ( e.getMultiplicity() - 1 ) );
} else if( outEdges.size() == 1 ) {
outEdges.iterator().next().setMultiplicity( outEdges.iterator().next().getMultiplicity() + ( e.getMultiplicity() - 1 ) );
}
final DeBruijnVertex addedVertex = new DeBruijnVertex( ArrayUtils.addAll(incomingVertex.getSequence(), outgoingVertex.getSuffix()), outgoingVertex.kmer );
graph.addVertex(addedVertex);
for( final DeBruijnEdge edge : outEdges ) {
graph.addEdge(addedVertex, graph.getEdgeTarget(edge), new DeBruijnEdge(edge.getIsRef(), edge.getMultiplicity()));
}
for( final DeBruijnEdge edge : inEdges ) {
graph.addEdge(graph.getEdgeSource(edge), addedVertex, new DeBruijnEdge(edge.getIsRef(), edge.getMultiplicity()));
}
graph.removeVertex( incomingVertex );
graph.removeVertex( outgoingVertex );
foundNodesToMerge = true;
break;
}
}
}
}
protected static void pruneGraph( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final int pruneFactor ) {
final ArrayList<DeBruijnEdge> edgesToRemove = new ArrayList<DeBruijnEdge>();
for( final DeBruijnEdge e : graph.edgeSet() ) {
if( e.getMultiplicity() <= pruneFactor && !e.getIsRef() ) { // remove non-reference edges with weight less than or equal to the pruning factor
edgesToRemove.add(e);
}
}
graph.removeAllEdges(edgesToRemove);
// Run through the graph and clean up singular orphaned nodes
final ArrayList<DeBruijnVertex> verticesToRemove = new ArrayList<DeBruijnVertex>();
for( final DeBruijnVertex v : graph.vertexSet() ) {
if( graph.inDegreeOf(v) == 0 && graph.outDegreeOf(v) == 0 ) {
verticesToRemove.add(v);
}
}
graph.removeAllVertices(verticesToRemove);
}
protected static void eliminateNonRefPaths( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph ) {
final ArrayList<DeBruijnVertex> verticesToRemove = new ArrayList<DeBruijnVertex>();
boolean done = false;
while( !done ) {
done = true;
for( final DeBruijnVertex v : graph.vertexSet() ) {
if( graph.inDegreeOf(v) == 0 || graph.outDegreeOf(v) == 0 ) {
boolean isRefNode = false;
for( final DeBruijnEdge e : graph.edgesOf(v) ) {
if( e.getIsRef() ) {
isRefNode = true;
break;
}
}
if( !isRefNode ) {
done = false;
verticesToRemove.add(v);
}
}
}
graph.removeAllVertices(verticesToRemove);
verticesToRemove.clear();
}
}
private static boolean createGraphFromSequences( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final Collection<GATKSAMRecord> reads, final int KMER_LENGTH, final Haplotype refHaplotype, final boolean DEBUG ) {
final byte[] refSequence = refHaplotype.getBases();
if( refSequence.length >= KMER_LENGTH + KMER_OVERLAP ) {
final int kmersInSequence = refSequence.length - KMER_LENGTH + 1;
for (int i = 0; i < kmersInSequence - 1; i++) {
// get the kmers
final byte[] kmer1 = new byte[KMER_LENGTH];
System.arraycopy(refSequence, i, kmer1, 0, KMER_LENGTH);
final byte[] kmer2 = new byte[KMER_LENGTH];
System.arraycopy(refSequence, i+1, kmer2, 0, KMER_LENGTH);
if( !addKmersToGraph(graph, kmer1, kmer2, true) ) {
if( DEBUG ) {
System.out.println("Cycle detected in reference graph for kmer = " + KMER_LENGTH + " ...skipping");
}
return false;
}
}
}
for( final GATKSAMRecord read : reads ) {
final byte[] sequence = read.getReadBases();
final byte[] qualities = read.getBaseQualities();
final byte[] reducedReadCounts = read.getReducedReadCounts(); // will be null if read is not readuced
if( sequence.length > KMER_LENGTH + KMER_OVERLAP ) {
final int kmersInSequence = sequence.length - KMER_LENGTH + 1;
for( int iii = 0; iii < kmersInSequence - 1; iii++ ) {
// if the qualities of all the bases in the kmers are high enough
boolean badKmer = false;
for( int jjj = iii; jjj < iii + KMER_LENGTH + 1; jjj++) {
if( qualities[jjj] < MIN_QUALITY ) {
badKmer = true;
break;
}
}
int countNumber = 1;
if (read.isReducedRead()) {
// compute mean number of reduced read counts in current kmer span
final byte[] counts = Arrays.copyOfRange(reducedReadCounts,iii,iii+KMER_LENGTH+1);
// precise rounding can make a difference with low consensus counts
countNumber = (int)Math.round((double)MathUtils.sum(counts)/counts.length);
}
if( !badKmer ) {
// get the kmers
final byte[] kmer1 = new byte[KMER_LENGTH];
System.arraycopy(sequence, iii, kmer1, 0, KMER_LENGTH);
final byte[] kmer2 = new byte[KMER_LENGTH];
System.arraycopy(sequence, iii+1, kmer2, 0, KMER_LENGTH);
for (int k=0; k < countNumber; k++)
addKmersToGraph(graph, kmer1, kmer2, false);
}
}
}
}
return true;
}
protected static boolean addKmersToGraph( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph, final byte[] kmer1, final byte[] kmer2, final boolean isRef ) {
final int numVertexBefore = graph.vertexSet().size();
final DeBruijnVertex v1 = new DeBruijnVertex( kmer1, kmer1.length );
graph.addVertex(v1);
final DeBruijnVertex v2 = new DeBruijnVertex( kmer2, kmer2.length );
graph.addVertex(v2);
if( isRef && graph.vertexSet().size() == numVertexBefore ) { return false; }
final DeBruijnEdge targetEdge = graph.getEdge(v1, v2);
if ( targetEdge == null ) {
graph.addEdge(v1, v2, new DeBruijnEdge( isRef ));
} else {
if( isRef ) {
targetEdge.setIsRef( true );
}
targetEdge.setMultiplicity(targetEdge.getMultiplicity() + 1);
}
return true;
}
protected void printGraphs() {
int count = 0;
for( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph : graphs ) {
GRAPH_WRITER.println("digraph kmer" + count++ +" {");
for( final DeBruijnEdge edge : graph.edgeSet() ) {
if( edge.getMultiplicity() > PRUNE_FACTOR ) {
GRAPH_WRITER.println("\t" + graph.getEdgeSource(edge).toString() + " -> " + graph.getEdgeTarget(edge).toString() + " [" + (edge.getMultiplicity() <= PRUNE_FACTOR ? "style=dotted,color=grey" : "label=\""+ edge.getMultiplicity() +"\"") + "];");
}
if( edge.getIsRef() ) {
GRAPH_WRITER.println("\t" + graph.getEdgeSource(edge).toString() + " -> " + graph.getEdgeTarget(edge).toString() + " [color=red];");
}
if( !edge.getIsRef() && edge.getMultiplicity() <= PRUNE_FACTOR ) { System.out.println("Graph pruning warning!"); }
}
for( final DeBruijnVertex v : graph.vertexSet() ) {
final String label = ( graph.inDegreeOf(v) == 0 ? v.toString() : v.getSuffixString() );
GRAPH_WRITER.println("\t" + v.toString() + " [label=\"" + label + "\"]");
}
GRAPH_WRITER.println("}");
}
}
@Ensures({"result.contains(refHaplotype)"})
private ArrayList<Haplotype> findBestPaths( final Haplotype refHaplotype, final byte[] fullReferenceWithPadding, final GenomeLoc refLoc, final ArrayList<VariantContext> activeAllelesToGenotype, final GenomeLoc activeRegionWindow ) {
final ArrayList<Haplotype> returnHaplotypes = new ArrayList<Haplotype>();
// add the reference haplotype separately from all the others
final SWPairwiseAlignment swConsensus = new SWPairwiseAlignment( fullReferenceWithPadding, refHaplotype.getBases(), SW_MATCH, SW_MISMATCH, SW_GAP, SW_GAP_EXTEND );
refHaplotype.setAlignmentStartHapwrtRef( swConsensus.getAlignmentStart2wrt1() );
refHaplotype.setCigar( swConsensus.getCigar() );
if( !returnHaplotypes.add( refHaplotype ) ) {
throw new ReviewedStingException("Unable to add reference haplotype during assembly: " + refHaplotype);
}
final int activeRegionStart = refHaplotype.getAlignmentStartHapwrtRef();
final int activeRegionStop = refHaplotype.getAlignmentStartHapwrtRef() + refHaplotype.getCigar().getReferenceLength();
for( final VariantContext compVC : activeAllelesToGenotype ) { // for GGA mode, add the desired allele into the haplotype
for( final Allele compAltAllele : compVC.getAlternateAlleles() ) {
final Haplotype insertedRefHaplotype = refHaplotype.insertAllele(compVC.getReference(), compAltAllele, activeRegionStart + compVC.getStart() - activeRegionWindow.getStart());
if( !addHaplotype( insertedRefHaplotype, fullReferenceWithPadding, returnHaplotypes, activeRegionStart, activeRegionStop ) ) {
return returnHaplotypes;
//throw new ReviewedStingException("Unable to add reference+allele haplotype during GGA-enabled assembly: " + insertedRefHaplotype);
}
}
}
for( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph : graphs ) {
for ( final KBestPaths.Path path : KBestPaths.getKBestPaths(graph, NUM_BEST_PATHS_PER_KMER_GRAPH) ) {
final Haplotype h = new Haplotype( path.getBases( graph ), path.getScore() );
if( addHaplotype( h, fullReferenceWithPadding, returnHaplotypes, activeRegionStart, activeRegionStop ) ) {
if( !activeAllelesToGenotype.isEmpty() ) { // for GGA mode, add the desired allele into the haplotype if it isn't already present
final HashMap<Integer,VariantContext> eventMap = GenotypingEngine.generateVCsFromAlignment( h, h.getAlignmentStartHapwrtRef(), h.getCigar(), fullReferenceWithPadding, h.getBases(), refLoc, "HCassembly", 0 ); // BUGBUG: need to put this function in a shared place
for( final VariantContext compVC : activeAllelesToGenotype ) { // for GGA mode, add the desired allele into the haplotype if it isn't already present
final VariantContext vcOnHaplotype = eventMap.get(compVC.getStart());
if( vcOnHaplotype == null || !vcOnHaplotype.hasSameAllelesAs(compVC) ) {
for( final Allele compAltAllele : compVC.getAlternateAlleles() ) {
addHaplotype( h.insertAllele(compVC.getReference(), compAltAllele, activeRegionStart + compVC.getStart() - activeRegionWindow.getStart()), fullReferenceWithPadding, returnHaplotypes, activeRegionStart, activeRegionStop );
}
}
}
}
}
}
}
if( DEBUG ) {
if( returnHaplotypes.size() > 1 ) {
System.out.println("Found " + returnHaplotypes.size() + " candidate haplotypes to evaluate every read against.");
} else {
System.out.println("Found only the reference haplotype in the assembly graph.");
}
for( final Haplotype h : returnHaplotypes ) {
System.out.println( h.toString() );
System.out.println( "> Cigar = " + h.getCigar() );
}
}
return returnHaplotypes;
}
private boolean addHaplotype( final Haplotype haplotype, final byte[] ref, final ArrayList<Haplotype> haplotypeList, final int activeRegionStart, final int activeRegionStop ) {
if( haplotype == null ) { return false; }
final SWPairwiseAlignment swConsensus = new SWPairwiseAlignment( ref, haplotype.getBases(), SW_MATCH, SW_MISMATCH, SW_GAP, SW_GAP_EXTEND );
haplotype.setAlignmentStartHapwrtRef( swConsensus.getAlignmentStart2wrt1() );
haplotype.setCigar( AlignmentUtils.leftAlignIndel(swConsensus.getCigar(), ref, haplotype.getBases(), swConsensus.getAlignmentStart2wrt1(), 0) );
if( swConsensus.getCigar().toString().contains("S") || swConsensus.getCigar().getReferenceLength() < 60 ) { // protect against SW failures
return false;
}
final int hapStart = ReadUtils.getReadCoordinateForReferenceCoordinate( haplotype.getAlignmentStartHapwrtRef(), haplotype.getCigar(), activeRegionStart, ReadUtils.ClippingTail.LEFT_TAIL, true );
int hapStop = ReadUtils.getReadCoordinateForReferenceCoordinate( haplotype.getAlignmentStartHapwrtRef(), haplotype.getCigar(), activeRegionStop, ReadUtils.ClippingTail.RIGHT_TAIL, true );
if( hapStop == ReadUtils.CLIPPING_GOAL_NOT_REACHED && activeRegionStop == haplotype.getAlignmentStartHapwrtRef() + haplotype.getCigar().getReferenceLength() ) {
hapStop = activeRegionStop; // contract for getReadCoordinateForReferenceCoordinate function says that if read ends at boundary then it is outside of the clipping goal
}
byte[] newHaplotypeBases;
// extend partial haplotypes to contain the full active region sequence
int leftBreakPoint = 0;
int rightBreakPoint = 0;
if( hapStart == ReadUtils.CLIPPING_GOAL_NOT_REACHED && hapStop == ReadUtils.CLIPPING_GOAL_NOT_REACHED ) {
newHaplotypeBases = ArrayUtils.addAll( ArrayUtils.addAll( ArrayUtils.subarray(ref, activeRegionStart, swConsensus.getAlignmentStart2wrt1()),
haplotype.getBases()),
ArrayUtils.subarray(ref, swConsensus.getAlignmentStart2wrt1() + swConsensus.getCigar().getReferenceLength(), activeRegionStop) );
leftBreakPoint = swConsensus.getAlignmentStart2wrt1() - activeRegionStart;
rightBreakPoint = leftBreakPoint + haplotype.getBases().length;
//newHaplotypeBases = haplotype.getBases();
//return false; // piece of haplotype isn't anchored within the active region so don't build a haplotype out of it
} else if( hapStart == ReadUtils.CLIPPING_GOAL_NOT_REACHED ) {
//return false;
newHaplotypeBases = ArrayUtils.addAll( ArrayUtils.subarray(ref, activeRegionStart, swConsensus.getAlignmentStart2wrt1()), ArrayUtils.subarray(haplotype.getBases(), 0, hapStop) );
//newHaplotypeBases = ArrayUtils.subarray(haplotype.getBases(), 0, hapStop);
leftBreakPoint = swConsensus.getAlignmentStart2wrt1() - activeRegionStart;
} else if( hapStop == ReadUtils.CLIPPING_GOAL_NOT_REACHED ) {
//return false;
newHaplotypeBases = ArrayUtils.addAll( ArrayUtils.subarray(haplotype.getBases(), hapStart, haplotype.getBases().length), ArrayUtils.subarray(ref, swConsensus.getAlignmentStart2wrt1() + swConsensus.getCigar().getReferenceLength(), activeRegionStop) );
//newHaplotypeBases = ArrayUtils.subarray(haplotype.getBases(), hapStart, haplotype.getBases().length);
rightBreakPoint = haplotype.getBases().length - hapStart;
} else {
newHaplotypeBases = ArrayUtils.subarray(haplotype.getBases(), hapStart, hapStop);
}
final Haplotype h = new Haplotype( newHaplotypeBases );
final SWPairwiseAlignment swConsensus2 = new SWPairwiseAlignment( ref, h.getBases(), SW_MATCH, SW_MISMATCH, SW_GAP, SW_GAP_EXTEND );
h.setAlignmentStartHapwrtRef( swConsensus2.getAlignmentStart2wrt1() );
h.setCigar( AlignmentUtils.leftAlignIndel(swConsensus2.getCigar(), ref, h.getBases(), swConsensus2.getAlignmentStart2wrt1(), 0) );
h.leftBreakPoint = leftBreakPoint;
h.rightBreakPoint = rightBreakPoint;
if( swConsensus2.getCigar().toString().contains("S") || swConsensus2.getCigar().getReferenceLength() != activeRegionStop - activeRegionStart ) { // protect against SW failures
return false;
}
if( !haplotypeList.contains(h) ) {
haplotypeList.add(h);
return true;
} else {
return false;
}
}
}

View File

@ -0,0 +1,134 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.WalkerTest;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
import java.util.Arrays;
/**
* @author ebanks
* @since 7/16/12
*/
public class BQSRIntegrationTest extends WalkerTest {
private static class BQSRTest {
final String reference;
final String interval;
final String bam;
final String args;
final String md5;
private BQSRTest(String reference, String bam, String interval, String args, String md5) {
this.reference = reference;
this.bam = bam;
this.interval = interval;
this.args = args;
this.md5 = md5;
}
public String getCommandLine() {
return " -T BaseRecalibrator" +
" -R " + reference +
" -I " + bam +
" -L " + interval +
args +
" --no_plots" +
" -knownSites " + (reference.equals(b36KGReference) ? b36dbSNP129 : hg18dbSNP132) +
" -o %s";
}
@Override
public String toString() {
return String.format("BQSR(bam='%s', args='%s')", bam, args);
}
}
@DataProvider(name = "BQSRTest")
public Object[][] createBQSRTestData() {
String HiSeqBam = privateTestDir + "HiSeq.1mb.1RG.bam";
String HiSeqInterval = "chr1:10,000,000-10,100,000";
return new Object[][]{
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, "", "239ce3387b4540faf44ec000d844ccd1")},
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, " --no_standard_covs -cov ContextCovariate", "d69127341938910c38166dd18449598d")},
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, " --no_standard_covs -cov CycleCovariate", "b77e621bed1b0dc57970399a35efd0da")},
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, " --indels_context_size 4", "2697f38d467a7856c40abce0f778456a")},
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, " --low_quality_tail 5", "a55018b1643ca3964dbb50783db9f3e4")},
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, " --quantizing_levels 6", "54fe8d1f5573845e6a2aa9688f6dd950")},
{new BQSRTest(hg18Reference, HiSeqBam, HiSeqInterval, " --mismatches_context_size 4", "6b518ad3c56d66c6f5ea812d058f5c4d")},
{new BQSRTest(b36KGReference, validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.1Mb.1RG.bam", "1:10,000,000-10,200,000", "", "3ddb9730f00ee3a612b42209ed9f7e03")},
{new BQSRTest(b36KGReference, validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "1:10,000,000-10,200,000", "", "4cd4fb754e1ef142ad691cb35c74dc4c")},
{new BQSRTest(b36KGReference, validationDataLocation + "NA12873.454.SRP000031.2009_06.chr1.10_20mb.1RG.bam", "1:10,000,000-10,200,000", "", "364eab693e5e4c7d18a77726b6460f3f")},
{new BQSRTest(b36KGReference, validationDataLocation + "originalQuals.1kg.chr1.1-1K.1RG.bam", "1:1-1,000", " -OQ", "c449cfca61d605b534f0dce35581339d")},
{new BQSRTest(b36KGReference, validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "1:10,000,000-20,000,000", " --solid_recal_mode REMOVE_REF_BIAS", "5268cb5a4b69335568751d5e5ab80d43")},
{new BQSRTest(b36KGReference, validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.1Mb.1RG.bam", "1:10,000,000-10,200,000", " -knownSites:anyNameABCD,VCF " + privateTestDir + "vcfexample3.vcf", "3ddb9730f00ee3a612b42209ed9f7e03")},
{new BQSRTest(b36KGReference, validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.1Mb.1RG.bam", "1:10,000,000-10,200,000", " -knownSites:bed " + validationDataLocation + "bqsrKnownTest.bed", "4a786ba42e38e7fd101947c34a6883ed")},
};
}
@Test(dataProvider = "BQSRTest")
public void testBQSR(BQSRTest params) {
WalkerTestSpec spec = new WalkerTestSpec(
params.getCommandLine(),
Arrays.asList(params.md5));
executeTest("testBQSR-"+params.args, spec).getFirst();
WalkerTestSpec specNT2 = new WalkerTestSpec(
params.getCommandLine() + " -nt 2",
Arrays.asList(params.md5));
executeTest("testBQSR-nt2-"+params.args, specNT2).getFirst();
}
@Test
public void testBQSRFailWithoutDBSNP() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
" -T BaseRecalibrator" +
" -R " + b36KGReference +
" -I " + validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam" +
" -L 1:10,000,000-10,200,000" +
" --no_plots" +
" -o %s",
1, // just one output file
UserException.CommandLineException.class);
executeTest("testBQSRFailWithoutDBSNP", spec);
}
private static class PRTest {
final String args;
final String md5;
private PRTest(String args, String md5) {
this.args = args;
this.md5 = md5;
}
@Override
public String toString() {
return String.format("PrintReads(args='%s')", args);
}
}
@DataProvider(name = "PRTest")
public Object[][] createPRTestData() {
return new Object[][]{
{new PRTest("", "d2d6ed8667cdba7e56f5db97d6262676")},
{new PRTest(" -qq -1", "b7053d3d67aba6d8892f0a60f0ded338")},
{new PRTest(" -qq 6", "bfbf0855185b2b70aa35237fb71e4487")},
{new PRTest(" -DIQ", "66aa65223f192ee39c1773aa187fd493")}
};
}
@Test(dataProvider = "PRTest")
public void testPR(PRTest params) {
WalkerTestSpec spec = new WalkerTestSpec(
"-T PrintReads" +
" -R " + hg18Reference +
" -I " + privateTestDir + "HiSeq.1mb.1RG.bam" +
" -BQSR " + privateTestDir + "HiSeq.1mb.1RG.table" +
params.args +
" -o %s",
Arrays.asList(params.md5));
executeTest("testPrintReads-"+params.args, spec).getFirst();
}
}

View File

@ -11,6 +11,8 @@ public class ReduceReadsIntegrationTest extends WalkerTest {
final String DELETION_BAM = validationDataLocation + "filtered_deletion_for_reduce_reads.bam"; final String DELETION_BAM = validationDataLocation + "filtered_deletion_for_reduce_reads.bam";
final String STASH_BAM = validationDataLocation + "ReduceReadsStashBug.bam"; final String STASH_BAM = validationDataLocation + "ReduceReadsStashBug.bam";
final String STASH_L = " -L 14:73718184-73718284 -L 14:73718294-73718330 -L 14:73718360-73718556"; final String STASH_L = " -L 14:73718184-73718284 -L 14:73718294-73718330 -L 14:73718360-73718556";
final String DIVIDEBYZERO_BAM = validationDataLocation + "ReduceReadsDivideByZeroBug.bam";
final String DIVIDEBYZERO_L = " -L " + validationDataLocation + "ReduceReadsDivideByZeroBug.intervals";
final String L = " -L 20:10,100,000-10,120,000 "; final String L = " -L 20:10,100,000-10,120,000 ";
private void RRTest(String testName, String args, String md5) { private void RRTest(String testName, String args, String md5) {
@ -21,28 +23,28 @@ public class ReduceReadsIntegrationTest extends WalkerTest {
@Test(enabled = true) @Test(enabled = true)
public void testDefaultCompression() { public void testDefaultCompression() {
RRTest("testDefaultCompression ", L, "323dd4deabd7767efa0f2c6e7fa4189f"); RRTest("testDefaultCompression ", L, "72eb6db9d7a09a0cc25eaac1aafa97b7");
} }
@Test(enabled = true) @Test(enabled = true)
public void testMultipleIntervals() { public void testMultipleIntervals() {
String intervals = "-L 20:10,100,000-10,100,500 -L 20:10,200,000-10,200,500 -L 20:10,300,000-10,300,500 -L 20:10,400,000-10,500,000 -L 20:10,500,050-10,500,060 -L 20:10,600,000-10,600,015 -L 20:10,700,000-10,700,110"; String intervals = "-L 20:10,100,000-10,100,500 -L 20:10,200,000-10,200,500 -L 20:10,300,000-10,300,500 -L 20:10,400,000-10,500,000 -L 20:10,500,050-10,500,060 -L 20:10,600,000-10,600,015 -L 20:10,700,000-10,700,110";
RRTest("testMultipleIntervals ", intervals, "c437fb160547ff271f8eba30e5f3ff76"); RRTest("testMultipleIntervals ", intervals, "104b1a1d9fa5394c6fea95cd32967b78");
} }
@Test(enabled = true) @Test(enabled = true)
public void testHighCompression() { public void testHighCompression() {
RRTest("testHighCompression ", " -cs 10 -minvar 0.3 -mindel 0.3 " + L, "3a607bc3ebaf84e9dc44e005c5f8a047"); RRTest("testHighCompression ", " -cs 10 -minvar 0.3 -mindel 0.3 " + L, "c55140cec60fa8c35161680289d74d47");
} }
@Test(enabled = true) @Test(enabled = true)
public void testLowCompression() { public void testLowCompression() {
RRTest("testLowCompression ", " -cs 30 -minvar 0.01 -mindel 0.01 -minmap 5 -minqual 5 " + L, "afd39459c841b68a442abdd5ef5f8f27"); RRTest("testLowCompression ", " -cs 30 -minvar 0.01 -mindel 0.01 -minmap 5 -minqual 5 " + L, "0f2e57b7f6de03cc4da1ffcc8cf8f1a7");
} }
@Test(enabled = true) @Test(enabled = true)
public void testIndelCompression() { public void testIndelCompression() {
RRTest("testIndelCompression ", " -cs 50 -L 20:10,100,500-10,100,600 ", "f7b9fa44c10bc4b2247813d2b8dc1973"); RRTest("testIndelCompression ", " -cs 50 -L 20:10,100,500-10,100,600 ", "dda0c95f56f90e5f633c2437c2b21031");
} }
@Test(enabled = true) @Test(enabled = true)
@ -64,5 +66,16 @@ public class ReduceReadsIntegrationTest extends WalkerTest {
String base = String.format("-T ReduceReads %s -npt -R %s -I %s", STASH_L, REF, STASH_BAM) + " -o %s "; String base = String.format("-T ReduceReads %s -npt -R %s -I %s", STASH_L, REF, STASH_BAM) + " -o %s ";
executeTest("testAddingReadAfterTailingTheStash", new WalkerTestSpec(base, Arrays.asList("886b43e1f26ff18425814dc7563931c6"))); executeTest("testAddingReadAfterTailingTheStash", new WalkerTestSpec(base, Arrays.asList("886b43e1f26ff18425814dc7563931c6")));
} }
/**
* Divide by zero bug reported by GdA and users in the forum. Happens when the downsampler goes over a region where all reads get
* filtered out.
*/
@Test(enabled = true)
public void testDivideByZero() {
String base = String.format("-T ReduceReads %s -npt -R %s -I %s", DIVIDEBYZERO_L, REF, DIVIDEBYZERO_BAM) + " -o %s ";
executeTest("testDivideByZero", new WalkerTestSpec(base, Arrays.asList("137505c3efd1e9f8d9209dbdf8419ff9")));
}
} }

View File

@ -0,0 +1,156 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.Genotype;
import org.broadinstitute.sting.utils.variantcontext.GenotypeBuilder;
import org.broadinstitute.sting.utils.variantcontext.GenotypesContext;
import org.testng.Assert;
import org.testng.annotations.BeforeSuite;
import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
import java.util.Arrays;
/**
* Created by IntelliJ IDEA.
* User: delangel
* Date: 3/28/12
* Time: 7:44 AM
* To change this template use File | Settings | File Templates.
*/
public class GeneralPloidyAFCalculationModelUnitTest extends BaseTest {
static double[] AA1, AB1, BB1;
static double[] AA2, AB2, AC2, BB2, BC2, CC2;
static double[] A4_1, B4_1, C4_1, D4_1, E4_1,F4_1;
static double[] A4_400, B4_310, C4_220, D4_130, E4_121, F4_013;
static final int numSamples = 4;
static final int samplePloidy = 4; // = 2*samplesPerPool
@BeforeSuite
public void before() {
// legacy diploid cases
AA1 = new double[]{-5.0, -20.0, -20.0};
AB1 = new double[]{-20.0, 0.0, -20.0};
BB1 = new double[]{-20.0, -20.0, 0.0};
// diploid, nAlleles = 3. Ordering is [2 0 0] [1 1 0] [0 2 0] [1 0 1] [0 1 1] [0 0 2], ie AA AB BB AC BC CC
AA2 = new double[]{0.0, -20.0, -20.0, -20.0, -20.0, -20.0};
AB2 = new double[]{-20.0, 0.0, -20.0, -20.0, -20.0, -20.0};
AC2 = new double[]{-20.0, -20.0, -20.0, 0.0, -20.0, -20.0};
BB2 = new double[]{-20.0, -20.0, 0.0, -20.0, -20.0, -20.0};
BC2 = new double[]{-20.0, -20.0, -20.0, -20.0, 0.0, -20.0};
CC2 = new double[]{-20.0, -20.0, -20.0, -20.0, -20.0, 0.0};
// pool (i.e. polyploid cases)
// NAlleles = 2, ploidy=4
// ordering is [4 0] [3 1] [2 2 ] [1 3] [0 4]
A4_1 = new double[]{-3.0, -20.0, -20.0, -20.0, -20.0};
B4_1 = new double[]{-20.0, 0.0, -20.0, -20.0, -20.0};
C4_1 = new double[]{-20.0, -20.0, 0.0, -20.0, -20.0};
D4_1 = new double[]{-20.0, -20.0, 0.0, 0.0, -20.0};
E4_1 = new double[]{-20.0, -20.0, 0.0, 0.0, -20.0};
F4_1 = new double[]{-20.0, -20.0, -20.0, -20.0, 0.0};
// NAlleles = 3, ploidy = 4
// ordering is [4 0 0] [3 1 0] [2 2 0] [1 3 0] [0 4 0] [3 0 1] [2 1 1] [1 2 1] [0 3 1] [2 0 2] [1 1 2] [0 2 2] [1 0 3] [0 1 3] [0 0 4]
A4_400 = new double[]{0.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0};
B4_310 = new double[]{-20.0, 0.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0};
C4_220 = new double[]{-20.0, -20.0, 0.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0};
D4_130 = new double[]{-20.0, -20.0, -20.0, 0.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0};
E4_121 = new double[]{-20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, 0.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0};
F4_013 = new double[]{-20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, -20.0, 0.0, -20.0};
}
private class GetGLsTest extends TestDataProvider {
GenotypesContext GLs;
int numAltAlleles;
String name;
int ploidy;
private GetGLsTest(String name, int numAltAlleles, int ploidy, Genotype... arg) {
super(GetGLsTest.class, name);
GLs = GenotypesContext.create(arg);
this.name = name;
this.numAltAlleles = numAltAlleles;
this.ploidy = ploidy;
}
public String toString() {
return String.format("%s input=%s", super.toString(), GLs);
}
}
private static Genotype createGenotype(String name, double[] gls, int ploidy) {
Allele[] alleles = new Allele[ploidy];
for (int i=0; i < ploidy; i++)
alleles[i] = Allele.NO_CALL;
return new GenotypeBuilder(name, Arrays.asList(alleles)).PL(gls).make();
}
@DataProvider(name = "getGLs")
public Object[][] createGLsData() {
// bi-allelic diploid case
new GetGLsTest("B0", 1, 2, createGenotype("AA1", AA1,2), createGenotype("AA2", AA1,2), createGenotype("AA3", AA1,2));
new GetGLsTest("B1", 1, 2, createGenotype("AA1", AA1,2), createGenotype("AA2", AA1,2), createGenotype("AB", AB1,2));
new GetGLsTest("B2", 1, 2, createGenotype("AA1", AA1,2), createGenotype("BB", BB1,2), createGenotype("AA2", AA1,2));
new GetGLsTest("B3a", 1, 2, createGenotype("AB", AB1,2), createGenotype("AA", AA1,2), createGenotype("BB", BB1,2));
new GetGLsTest("B3b", 1, 2, createGenotype("AB1", AB1,2), createGenotype("AB2", AB1,2), createGenotype("AB3", AB1,2));
new GetGLsTest("B4", 1, 2, createGenotype("BB1", BB1,2), createGenotype("BB2", BB1,2), createGenotype("AA", AA1,2));
new GetGLsTest("B5", 1, 2, createGenotype("BB1", BB1,2), createGenotype("AB", AB1,2), createGenotype("BB2", BB1,2));
new GetGLsTest("B6", 1, 2, createGenotype("BB1", BB1,2), createGenotype("BB2", BB1,2), createGenotype("BB3", BB1,2));
// tri-allelic diploid case
new GetGLsTest("B1C0", 2, 2, createGenotype("AA1", AA2,2), createGenotype("AA2", AA2,2), createGenotype("AB", AB2,2));
new GetGLsTest("B0C1", 2, 2, createGenotype("AA1", AA2,2), createGenotype("AA2", AA2,2), createGenotype("AC", AC2,2));
new GetGLsTest("B1C1a", 2,2, createGenotype("AA", AA2,2), createGenotype("AB", AB2,2), createGenotype("AC", AC2,2));
new GetGLsTest("B1C1b", 2,2, createGenotype("AA1", AA2,2), createGenotype("AA2", AA2,2), createGenotype("BC", BC2,2));
new GetGLsTest("B2C1", 2, 2, createGenotype("AB1", AB2,2), createGenotype("AB2", AB2,2), createGenotype("AC", AC2,2));
new GetGLsTest("B3C2a", 2, 2, createGenotype("AB", AB2,2), createGenotype("BC1", BC2,2), createGenotype("BC2", BC2,2));
new GetGLsTest("B3C2b", 2, 2, createGenotype("AB", AB2,2), createGenotype("BB", BB2,2), createGenotype("CC", CC2,2));
// bi-allelic pool case
new GetGLsTest("P0", 1, samplePloidy, createGenotype("A4_1", A4_1,samplePloidy), createGenotype("A4_1", A4_1,samplePloidy), createGenotype("A4_1", A4_1,samplePloidy));
new GetGLsTest("P1", 1, samplePloidy,createGenotype("A4_1", A4_1,samplePloidy), createGenotype("B4_1", B4_1,samplePloidy), createGenotype("A4_1", A4_1,samplePloidy));
new GetGLsTest("P2a", 1,samplePloidy, createGenotype("A4_1", A4_1,samplePloidy), createGenotype("C4_1", C4_1,samplePloidy), createGenotype("A4_1", A4_1,samplePloidy));
new GetGLsTest("P2b", 1, samplePloidy,createGenotype("B4_1", B4_1,samplePloidy), createGenotype("B4_1", B4_1,samplePloidy), createGenotype("A4_1", A4_1,samplePloidy));
new GetGLsTest("P4", 1, samplePloidy,createGenotype("A4_1", A4_1,samplePloidy), createGenotype("C4_1", C4_1,samplePloidy), createGenotype("C4_1", C4_1,samplePloidy));
new GetGLsTest("P6", 1, samplePloidy,createGenotype("A4_1", A4_1,samplePloidy), createGenotype("F4_1", F4_1,samplePloidy), createGenotype("C4_1", C4_1,samplePloidy));
new GetGLsTest("P8", 1, samplePloidy,createGenotype("A4_1", A4_1,samplePloidy), createGenotype("F4_1", F4_1,samplePloidy), createGenotype("F4_1", F4_1,samplePloidy));
// multi-allelic pool case
new GetGLsTest("B1C3", 2, samplePloidy,createGenotype("A4_400", A4_400,samplePloidy), createGenotype("A4_400", A4_400,samplePloidy), createGenotype("F4_013", F4_013,samplePloidy));
new GetGLsTest("B3C9", 2, samplePloidy,createGenotype("F4_013", F4_013,samplePloidy), createGenotype("F4_013", F4_013,samplePloidy), createGenotype("F4_013", F4_013,samplePloidy));
new GetGLsTest("B6C0", 2, samplePloidy,createGenotype("B4_310", B4_310,samplePloidy), createGenotype("C4_220", C4_220,samplePloidy), createGenotype("D4_130", D4_130,samplePloidy));
new GetGLsTest("B6C4", 2, samplePloidy,createGenotype("D4_130", D4_130,samplePloidy), createGenotype("E4_121", E4_121,samplePloidy), createGenotype("F4_013", F4_013,samplePloidy));
new GetGLsTest("B4C7", 2, samplePloidy,createGenotype("F4_013", F4_013,samplePloidy), createGenotype("E4_121", E4_121,samplePloidy), createGenotype("F4_013", F4_013,samplePloidy));
new GetGLsTest("B2C3", 2, samplePloidy,createGenotype("A4_400", A4_400,samplePloidy), createGenotype("F4_013", F4_013,samplePloidy), createGenotype("B4_310", B4_310,samplePloidy));
return GetGLsTest.getTests(GetGLsTest.class);
}
@Test(dataProvider = "getGLs")
public void testGLs(GetGLsTest cfg) {
final AlleleFrequencyCalculationResult result = new AlleleFrequencyCalculationResult(cfg.numAltAlleles);
final int len = GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(1 + cfg.numAltAlleles, cfg.ploidy * cfg.GLs.size());
double[] priors = new double[len]; // flat priors
GeneralPloidyExactAFCalculationModel.combineSinglePools(cfg.GLs, 1 + cfg.numAltAlleles, cfg.ploidy, priors, result);
int nameIndex = 1;
for ( int allele = 0; allele < cfg.numAltAlleles; allele++, nameIndex+=2 ) {
int expectedAlleleCount = Integer.valueOf(cfg.name.substring(nameIndex, nameIndex+1));
int calculatedAlleleCount = result.getAlleleCountsOfMAP()[allele];
// System.out.format( "%s Expected:%d Calc:%d\n",cfg.toString(),expectedAlleleCount, calculatedAlleleCount);
Assert.assertEquals(calculatedAlleleCount, expectedAlleleCount);
}
}
}

View File

@ -0,0 +1,514 @@
/*
* Copyright (c) 2010.
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.genotyper;
import net.sf.samtools.SAMUtils;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.variantcontext.*;
import org.testng.Assert;
import org.testng.annotations.Test;
import java.io.File;
import java.io.PrintStream;
import java.util.*;
public class GeneralPloidyGenotypeLikelihoodsUnitTest {
final UnifiedArgumentCollection UAC = new UnifiedArgumentCollection();
final Logger logger = Logger.getLogger(Walker.class);
private static final boolean VERBOSE = false;
private static final boolean SIMULATE_NOISY_PILEUP = false;
private static final int NUM_SIMULATED_OBS = 10;
void PoolGenotypeLikelihoodsUnitTest() {
UAC.minQualityScore = 5;
UAC.maxQualityScore = 40;
UAC.phredScaledPrior = (byte)20;
UAC.minPower = 0.0;
}
@Test
public void testStoringLikelihoodElements() {
// basic test storing a given PL vector in a GeneralPloidyGenotypeLikelihoods object and then retrieving it back
int ploidy = 20;
int numAlleles = 4;
int res = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy);
// System.out.format("Alt Alleles: %d, Ploidy: %d, #Likelihoods: %d\n", numAltAlleles, ploidy, res);
List<Allele> alleles = new ArrayList<Allele>();
alleles.add(Allele.create("T",true));
alleles.add(Allele.create("C",false));
alleles.add(Allele.create("A",false));
alleles.add(Allele.create("G",false));
double[] gls = new double[res];
for (int k=0; k < gls.length; k++)
gls[k]= (double)k;
GeneralPloidyGenotypeLikelihoods gl = new GeneralPloidySNPGenotypeLikelihoods(alleles, gls,ploidy, null, false,true);
double[] glnew = gl.getLikelihoods();
Assert.assertEquals(gls, glnew);
}
@Test
public void testElementStorageCache() {
// compare cached element storage with compuationally hard-coded iterative computation
for (int ploidy = 2; ploidy < 10; ploidy++) {
for (int nAlleles = 2; nAlleles < 10; nAlleles++)
Assert.assertEquals(GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(nAlleles, ploidy),
GenotypeLikelihoods.numLikelihoods(nAlleles, ploidy));
}
}
@Test
public void testVectorToLinearIndex() {
// create iterator, compare linear index given by iterator with closed form function
int numAlleles = 4;
int ploidy = 2;
GeneralPloidyGenotypeLikelihoods.SumIterator iterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles, ploidy);
while(iterator.hasNext()) {
System.out.format("\n%d:",iterator.getLinearIndex());
int[] a = iterator.getCurrentVector();
for (int aa: a)
System.out.format("%d ",aa);
int computedIdx = GeneralPloidyGenotypeLikelihoods.getLinearIndex(a, numAlleles, ploidy);
System.out.format("Computed idx = %d\n",computedIdx);
iterator.next();
}
}
@Test
public void testSubsetToAlleles() {
int ploidy = 2;
int numAlleles = 4;
int res = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy);
// System.out.format("Alt Alleles: %d, Ploidy: %d, #Likelihoods: %d\n", numAltAlleles, ploidy, res);
List<Allele> originalAlleles = new ArrayList<Allele>();
originalAlleles.add(Allele.create("T",true));
originalAlleles.add(Allele.create("C",false));
originalAlleles.add(Allele.create("A",false));
originalAlleles.add(Allele.create("G",false));
double[] oldLikelihoods = new double[res];
for (int k=0; k < oldLikelihoods.length; k++)
oldLikelihoods[k]= (double)k;
List<Allele> allelesToSubset = new ArrayList<Allele>();
allelesToSubset.add(Allele.create("A",false));
allelesToSubset.add(Allele.create("C",false));
double[] newGLs = GeneralPloidyGenotypeLikelihoods.subsetToAlleles(oldLikelihoods, ploidy,
originalAlleles, allelesToSubset);
/*
For P=2, N=4, default iteration order:
0:2 0 0 0
1:1 1 0 0
2:0 2 0 0
3:1 0 1 0
4:0 1 1 0
5:0 0 2 0
6:1 0 0 1
7:0 1 0 1
8:0 0 1 1
9:0 0 0 2
For P=2,N=2, iteration order is:
0:2 0
1:1 1
2:0 2
From first list, if we're extracting alleles 2 and 1, we need all elements that have zero at positions 0 and 3.
These are only elements {2,4,5}. Since test is flipping alleles 2 and 1, order is reversed.
*/
Assert.assertEquals(newGLs,new double[]{5.0,4.0,2.0});
}
@Test
public void testIndexIterator() {
int[] seed = new int[]{1,2,3,4};
GeneralPloidyGenotypeLikelihoods.SumIterator iterator = runIterator(seed,-1);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),prod(seed)-1);
seed = new int[]{1,0,1,1};
iterator = runIterator(seed,-1);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),prod(seed)-1);
seed = new int[]{5};
iterator = runIterator(seed,-1);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),prod(seed)-1);
// Diploid, # alleles = 4
seed = new int[]{2,2,2,2};
iterator = runIterator(seed,2);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),9);
// Diploid, # alleles = 2
seed = new int[]{2,2};
iterator = runIterator(seed,2);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),2);
// Diploid, # alleles = 3
seed = new int[]{2,2,2};
iterator = runIterator(seed,2);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),5);
// Triploid, # alleles = 2
seed = new int[]{3,3};
iterator = runIterator(seed,3);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),3);
// Triploid, # alleles = 3
seed = new int[]{3,3,3};
iterator = runIterator(seed,3);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),9);
// Triploid, # alleles = 4
seed = new int[]{3,3,3,3};
iterator = runIterator(seed,3);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),19);
// 8-ploid, # alleles = 6
seed = new int[]{8,8,8,8,8,8};
iterator = runIterator(seed,8);
// Assert.assertTrue(compareIntArrays(iterator.getCurrentVector(), seed));
Assert.assertEquals(iterator.getLinearIndex(),1286);
}
private GeneralPloidyGenotypeLikelihoods.SumIterator runIterator(int[] seed, int restrictSumTo) {
GeneralPloidyGenotypeLikelihoods.SumIterator iterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(seed, restrictSumTo);
while(iterator.hasNext()) {
int[] a = iterator.getCurrentVector();
int idx = GeneralPloidyGenotypeLikelihoods.getLinearIndex(a, a.length, restrictSumTo);
if (VERBOSE) {
System.out.format("%d:",iterator.getLinearIndex());
for (int i=0; i < seed.length; i++)
System.out.format("%d ",a[i]);
System.out.format(" LI:%d\n", idx);
}
iterator.next();
}
return iterator;
}
private static int prod(int[] x) {
int prod = 1;
for (int xx : x) {
prod *= (1+xx);
}
return prod;
}
@Test
public void testErrorModel() {
final ArtificialReadPileupTestProvider refPileupTestProvider = new ArtificialReadPileupTestProvider(1,"ref");
final byte refByte = refPileupTestProvider.getRefByte();
final byte altByte = refByte == (byte)'T'? (byte) 'C': (byte)'T';
final String refSampleName = refPileupTestProvider.getSampleNames().get(0);
final List<Allele> trueAlleles = new ArrayList<Allele>();
trueAlleles.add(Allele.create(refByte, true));
final VariantContext refVC = new VariantContextBuilder("test","chr1",5, 5,
trueAlleles).genotypes(GenotypeBuilder.create(refSampleName, trueAlleles)).make();
final int[] matchArray = {95, 995, 9995, 10000};
final int[] mismatchArray = {1,5,10,20};
if (VERBOSE) System.out.println("Running SNP error model test");
for (int matches: matchArray) {
for (int mismatches: mismatchArray) {
// get artificial alignment context for ref sample - no noise
Map<String,AlignmentContext> refContext = refPileupTestProvider.getAlignmentContextFromAlleles(0, new String(new byte[]{altByte}), new int[]{matches, mismatches}, false, 30);
final ReadBackedPileup refPileup = refContext.get(refSampleName).getBasePileup();
final ErrorModel emodel = new ErrorModel(UAC, refPileup, refVC, refPileupTestProvider.getReferenceContext());
final double[] errorVec = emodel.getErrorModelVector().getProbabilityVector();
final double mlEst = -10.0*Math.log10((double)mismatches/(double)(matches+mismatches));
final int peakIdx = (int)Math.round(mlEst);
if (VERBOSE) System.out.format("Matches:%d Mismatches:%d maxV:%d peakIdx:%d\n",matches, mismatches, MathUtils.maxElementIndex(errorVec),peakIdx);
Assert.assertEquals(MathUtils.maxElementIndex(errorVec),peakIdx);
}
}
}
@Test
public void testIndelErrorModel() {
final ArtificialReadPileupTestProvider refPileupTestProvider = new ArtificialReadPileupTestProvider(1,"ref");
final byte refByte = refPileupTestProvider.getRefByte();
final String altBases = "TCA";
final String refSampleName = refPileupTestProvider.getSampleNames().get(0);
final List<Allele> trueAlleles = new ArrayList<Allele>();
trueAlleles.add(Allele.create(refByte, true));
trueAlleles.add(Allele.create((char)refByte + "TC", false));
final String fw = new String(refPileupTestProvider.getReferenceContext().getForwardBases());
final VariantContext refInsertionVC = new VariantContextBuilder("test","chr1",refPileupTestProvider.getReferenceContext().getLocus().getStart(),
refPileupTestProvider.getReferenceContext().getLocus().getStart(), trueAlleles).
genotypes(GenotypeBuilder.create(refSampleName, trueAlleles)).make();
final int[] matchArray = {95, 995, 9995, 10000};
final int[] mismatchArray = {1,5,10,20};
if (VERBOSE) System.out.println("Running indel error model test");
for (int matches: matchArray) {
for (int mismatches: mismatchArray) {
// get artificial alignment context for ref sample - no noise
// CASE 1: Test HET insertion
// Ref sample has TC insertion but pileup will have TCA inserted instead to test mismatches
Map<String,AlignmentContext> refContext = refPileupTestProvider.getAlignmentContextFromAlleles(1+altBases.length(), altBases, new int[]{matches, mismatches}, false, 30);
final ReadBackedPileup refPileup = refContext.get(refSampleName).getBasePileup();
final ErrorModel emodel = new ErrorModel(UAC, refPileup, refInsertionVC, refPileupTestProvider.getReferenceContext());
final double[] errorVec = emodel.getErrorModelVector().getProbabilityVector();
final double mlEst = -10.0*Math.log10((double)mismatches/(double)(matches+mismatches));
final int peakIdx = (int)Math.round(mlEst);
if (VERBOSE) System.out.format("Matches:%d Mismatches:%d peakIdx:%d\n",matches, mismatches, peakIdx);
Assert.assertEquals(MathUtils.maxElementIndex(errorVec),peakIdx);
// CASE 2: Test HET deletion
}
}
// create deletion VC
final int delLength = 4;
final List<Allele> delAlleles = new ArrayList<Allele>();
delAlleles.add(Allele.create(fw.substring(0,delLength+1), true));
delAlleles.add(Allele.create(refByte, false));
final VariantContext refDeletionVC = new VariantContextBuilder("test","chr1",refPileupTestProvider.getReferenceContext().getLocus().getStart(),
refPileupTestProvider.getReferenceContext().getLocus().getStart()+delLength, delAlleles).
genotypes(GenotypeBuilder.create(refSampleName, delAlleles)).make();
for (int matches: matchArray) {
for (int mismatches: mismatchArray) {
// get artificial alignment context for ref sample - no noise
// CASE 1: Test HET deletion
// Ref sample has 4bp deletion but pileup will have 3 bp deletion instead to test mismatches
Map<String,AlignmentContext> refContext = refPileupTestProvider.getAlignmentContextFromAlleles(-delLength+1, altBases, new int[]{matches, mismatches}, false, 30);
final ReadBackedPileup refPileup = refContext.get(refSampleName).getBasePileup();
final ErrorModel emodel = new ErrorModel(UAC, refPileup, refDeletionVC, refPileupTestProvider.getReferenceContext());
final double[] errorVec = emodel.getErrorModelVector().getProbabilityVector();
final double mlEst = -10.0*Math.log10((double)mismatches/(double)(matches+mismatches));
final int peakIdx = (int)Math.round(mlEst);
if (VERBOSE) System.out.format("Matches:%d Mismatches:%d peakIdx:%d\n",matches, mismatches, peakIdx);
Assert.assertEquals(MathUtils.maxElementIndex(errorVec),peakIdx);
// CASE 2: Test HET deletion
}
}
}
@Test
public void testAddPileupToPoolGL() {
// dummy error model - Q=infinity FAPP so that there's no source of uncertainty
final double[] emv = new double[SAMUtils.MAX_PHRED_SCORE+1];
// error rate for noisy tests
final int PHRED_SITE_ERROR_RATE = 20;
Arrays.fill(emv, Double.NEGATIVE_INFINITY);
emv[SAMUtils.MAX_PHRED_SCORE] = 0;
final int numSamples = 1;
// have a high quality site say Q40 site, and create artificial pileups for one single sample, at coverage N, with given
// true pool AC = x.
final ArtificialReadPileupTestProvider readPileupTestProvider = new ArtificialReadPileupTestProvider(numSamples,"sample", (byte)SAMUtils.MAX_PHRED_SCORE);
final ErrorModel noiselessErrorModel = new ErrorModel(emv);
final double[] emverr = new double[SAMUtils.MAX_PHRED_SCORE+1];
Arrays.fill(emverr, Double.NEGATIVE_INFINITY);
emverr[PHRED_SITE_ERROR_RATE] = 0;
final ErrorModel Q30ErrorModel = new ErrorModel(emverr);
final int eventLength = 0; // test snp only
final byte refByte = readPileupTestProvider.getRefByte();
final byte altByte = refByte == (byte)'T'? (byte) 'C': (byte)'T';
final List<Allele> allAlleles = new ArrayList<Allele>(); // this contains only ref Allele up to now
final Set<String> laneIDs = new TreeSet<String>();
laneIDs.add(GenotypeLikelihoodsCalculationModel.DUMMY_LANE);
final HashMap<String, ErrorModel> noiselessErrorModels = new HashMap<String, ErrorModel>();
// build per-lane error model for all lanes present in ref sample
for (String laneID : laneIDs)
noiselessErrorModels.put(laneID, noiselessErrorModel);
final HashMap<String, ErrorModel> noisyErrorModels = new HashMap<String, ErrorModel>();
// build per-lane error model for all lanes present in ref sample
for (String laneID : laneIDs)
noisyErrorModels.put(laneID, Q30ErrorModel);
// all first ref allele
allAlleles.add(Allele.create(refByte,true));
for (byte b: BaseUtils.BASES) {
if (refByte != b)
allAlleles.add(Allele.create(b, false));
}
final int refIdx = 0;
int altIdx = -1;
for (int k=0; k < allAlleles.size(); k++)
if (altByte == allAlleles.get(k).getBases()[0]) {
altIdx = k;
break;
}
PrintStream out = null;
if (SIMULATE_NOISY_PILEUP) {
try {
out = new PrintStream(new File("GLUnitTest.table"));
// out = new PrintStream(new File("/Users/delangel/GATK/Sting_unstable/GLUnitTest.table"));
}
catch (Exception e) {}
// write header
out.format("Depth\tPoolPloidy\tACTrue\tACEst\tREF\tALTTrue\tALTEst\n");
}
final int[] depthVector = {1000,10000};
//final double[] alleleFrequencyVector = {0.01,0.1,0.5,1.0};
final int[] spVector = {10,100};
//final int[] spVector = {1};
for (int depth : depthVector) {
for (int nSamplesPerPool : spVector) {
final int ploidy = 2*nSamplesPerPool;
for (int ac =2; ac <=ploidy; ac++) {
// simulate pileup with given AC and depth
int altDepth = (int)Math.round( (double)ac/(double)ploidy * (double)depth);
final int[] numReadsPerAllele = {depth-altDepth,altDepth};
final Map<String,AlignmentContext> alignmentContextMap =
readPileupTestProvider.getAlignmentContextFromAlleles(eventLength, new String(new byte[]{altByte}), numReadsPerAllele);
// get now likelihoods for this
final GeneralPloidySNPGenotypeLikelihoods GL = new GeneralPloidySNPGenotypeLikelihoods(allAlleles, null, nSamplesPerPool*2, noiselessErrorModels, false, true);
final int nGoodBases = GL.add(alignmentContextMap.get("sample0000").getBasePileup(), true, false, UAC.MIN_BASE_QUALTY_SCORE);
if (VERBOSE) {
System.out.format("Depth:%d, AC:%d, altDepth:%d, samplesPerPool:%d\nGLs:", depth,ac,altDepth, nSamplesPerPool);
System.out.println(GL.toString());
}
Assert.assertEquals(nGoodBases, depth);
Pair<int[],Double> mlPair = GL.getMostLikelyACCount();
// Most likely element has to be conformation REF = nSamples-AC,ALT = AC
if (ac == 0) {
Assert.assertEquals(mlPair.first[refIdx],ploidy);
} else {
Assert.assertEquals(mlPair.first[altIdx],ac);
Assert.assertEquals(mlPair.first[refIdx],ploidy-ac);
}
// simulate now pileup with base error rate
if (SIMULATE_NOISY_PILEUP) {
System.out.format("Depth:%d, AC:%d, altDepth:%d, samplesPerPool:%d\n", depth,ac,altDepth, nSamplesPerPool);
for (int k=0; k < NUM_SIMULATED_OBS; k++) {
final Map<String,AlignmentContext> noisyAlignmentContextMap =
readPileupTestProvider.getAlignmentContextFromAlleles(eventLength, new String(new byte[]{altByte}), numReadsPerAllele,
true, PHRED_SITE_ERROR_RATE);
// get now likelihoods for this
final GeneralPloidySNPGenotypeLikelihoods noisyGL = new GeneralPloidySNPGenotypeLikelihoods(allAlleles, null, nSamplesPerPool*2, noisyErrorModels, false,true);
noisyGL.add(noisyAlignmentContextMap.get("sample0000").getBasePileup(), true, false, UAC.MIN_BASE_QUALTY_SCORE);
mlPair = noisyGL.getMostLikelyACCount();
// Most likely element has to be conformation REF = nSamples-AC,ALT = AC
int acEst;
if (ac == 0) {
acEst = mlPair.first[refIdx];
} else {
acEst = mlPair.first[altIdx];
}
byte altEst = BaseUtils.baseIndexToSimpleBase(MathUtils.maxElementIndex(mlPair.first));
out.format("%d\t%d\t%d\t%d\t%c\t%c\t%c\n",depth, ploidy, ac, acEst, refByte, altByte, altEst);
}
}
}
}
}
if (SIMULATE_NOISY_PILEUP)
out.close();
}
}

View File

@ -0,0 +1,78 @@
package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.broadinstitute.sting.WalkerTest;
import java.util.Arrays;
import org.testng.annotations.Test;
/**
* Created by IntelliJ IDEA.
* User: delangel
* Date: 4/5/12
* Time: 11:28 AM
* To change this template use File | Settings | File Templates.
*/
public class UnifiedGenotyperGeneralPloidyIntegrationTest extends WalkerTest {
final static String REF = b37KGReference;
final String CEUTRIO_BAM = "/humgen/gsa-hpprojects/NA12878Collection/bams/CEUTrio.HiSeq.WGS.b37.list";
final String LSV_BAM = validationDataLocation +"93pools_NA12878_ref_chr20_40m_41m.bam";
final String REFSAMPLE_MT_CALLS = comparisonDataLocation + "Unvalidated/mtDNA/NA12878.snp.vcf";
final String REFSAMPLE_NAME = "NA12878";
final String MTINTERVALS = "MT:1-3000";
final String LSVINTERVALS = "20:40,000,000-41,000,000";
final String NA12891_CALLS = comparisonDataLocation + "Unvalidated/mtDNA/NA12891.snp.vcf";
final String NA12878_WG_CALLS = comparisonDataLocation + "Unvalidated/NA12878/CEUTrio.HiSeq.WGS.b37_decoy.recal.ts_95.snp_indel_combined.vcf";
final String LSV_ALLELES = validationDataLocation + "ALL.chr20_40m_41m.largeScaleValidationSites.vcf";
private void PC_MT_Test(String bam, String args, String name, String md5) {
final String base = String.format("-T UnifiedGenotyper -dcov 10000 -R %s -I %s -L %s --reference_sample_calls %s -refsample %s -ignoreLane ",
REF, bam, MTINTERVALS, REFSAMPLE_MT_CALLS, REFSAMPLE_NAME) + " --no_cmdline_in_header -o %s";
final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5));
executeTest("testPoolCaller:"+name+" args=" + args, spec);
}
private void PC_LSV_Test(String args, String name, String model, String md5) {
final String base = String.format("-T UnifiedGenotyper -dcov 10000 -R %s -I %s -L %s --reference_sample_calls %s -refsample %s -glm %s -ignoreLane ",
REF, LSV_BAM, LSVINTERVALS, NA12878_WG_CALLS, REFSAMPLE_NAME, model) + " --no_cmdline_in_header -o %s";
final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5));
executeTest("testPoolCaller:"+name+" args=" + args, spec);
}
private void PC_LSV_Test_NoRef(String args, String name, String model, String md5) {
final String base = String.format("-T UnifiedGenotyper -dcov 10000 -R %s -I %s -L %s -glm %s -ignoreLane",
REF, LSV_BAM, LSVINTERVALS, model) + " --no_cmdline_in_header -o %s";
final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5));
executeTest("testPoolCaller:"+name+" args=" + args, spec);
}
@Test
public void testBOTH_GGA_Pools() {
PC_LSV_Test(String.format(" -maxAltAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_BOTH_GGA","BOTH","0934f72865388999efec64bd9d4a9b93");
}
@Test
public void testINDEL_GGA_Pools() {
PC_LSV_Test(String.format(" -maxAltAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_INDEL_GGA","INDEL","126581c72d287722437274d41b6fed7b");
}
@Test
public void testINDEL_maxAltAlleles2_ploidy3_Pools_noRef() {
PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","INDEL","b543aa1c3efedb301e525c1d6c50ed8d");
}
@Test
public void testINDEL_maxAltAlleles2_ploidy1_Pools_noRef() {
PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 1","LSV_INDEL_DISC_NOREF_p1","INDEL","55b20557a836bb92688e68f12d7f5dc4");
}
@Test
public void testMT_SNP_DISCOVERY_sp4() {
PC_MT_Test(CEUTRIO_BAM, " -maxAltAlleles 1 -ploidy 8", "MT_SNP_DISCOVERY_sp4","7eb889e8e07182f4c3d64609591f9459");
}
@Test
public void testMT_SNP_GGA_sp10() {
PC_MT_Test(CEUTRIO_BAM, String.format(" -maxAltAlleles 1 -ploidy 20 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",NA12891_CALLS), "MT_SNP_GGA_sp10", "db8114877b99b14f7180fdcd24b040a7");
}
}

View File

@ -0,0 +1,400 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 3/15/12
*/
import net.sf.picard.reference.ReferenceSequenceFile;
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import org.broadinstitute.sting.utils.variantcontext.VariantContextBuilder;
import org.testng.Assert;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
import java.io.File;
import java.io.FileNotFoundException;
import java.util.*;
/**
* Unit tests for GenotypingEngine
*/
public class GenotypingEngineUnitTest extends BaseTest {
private static ReferenceSequenceFile seq;
private GenomeLocParser genomeLocParser;
@BeforeClass
public void init() throws FileNotFoundException {
// sequence
seq = new CachingIndexedFastaSequenceFile(new File(b37KGReference));
genomeLocParser = new GenomeLocParser(seq);
}
@Test
public void testFindHomVarEventAllelesInSample() {
final List<Allele> eventAlleles = new ArrayList<Allele>();
eventAlleles.add( Allele.create("A", true) );
eventAlleles.add( Allele.create("C", false) );
final List<Allele> haplotypeAlleles = new ArrayList<Allele>();
haplotypeAlleles.add( Allele.create("AATA", true) );
haplotypeAlleles.add( Allele.create("AACA", false) );
haplotypeAlleles.add( Allele.create("CATA", false) );
haplotypeAlleles.add( Allele.create("CACA", false) );
final ArrayList<Haplotype> haplotypes = new ArrayList<Haplotype>();
haplotypes.add(new Haplotype("AATA".getBytes()));
haplotypes.add(new Haplotype("AACA".getBytes()));
haplotypes.add(new Haplotype("CATA".getBytes()));
haplotypes.add(new Haplotype("CACA".getBytes()));
final List<Allele> haplotypeAllelesForSample = new ArrayList<Allele>();
haplotypeAllelesForSample.add( Allele.create("CATA", false) );
haplotypeAllelesForSample.add( Allele.create("CACA", false) );
final ArrayList<ArrayList<Haplotype>> alleleMapper = new ArrayList<ArrayList<Haplotype>>();
ArrayList<Haplotype> Aallele = new ArrayList<Haplotype>();
Aallele.add(haplotypes.get(0));
Aallele.add(haplotypes.get(1));
ArrayList<Haplotype> Callele = new ArrayList<Haplotype>();
Callele.add(haplotypes.get(2));
Callele.add(haplotypes.get(3));
alleleMapper.add(Aallele);
alleleMapper.add(Callele);
final List<Allele> eventAllelesForSample = new ArrayList<Allele>();
eventAllelesForSample.add( Allele.create("C", false) );
eventAllelesForSample.add( Allele.create("C", false) );
if(!compareAlleleLists(eventAllelesForSample, GenotypingEngine.findEventAllelesInSample(eventAlleles, haplotypeAlleles, haplotypeAllelesForSample, alleleMapper, haplotypes))) {
logger.warn("calc alleles = " + GenotypingEngine.findEventAllelesInSample(eventAlleles, haplotypeAlleles, haplotypeAllelesForSample, alleleMapper, haplotypes));
logger.warn("expected alleles = " + eventAllelesForSample);
}
Assert.assertTrue(compareAlleleLists(eventAllelesForSample, GenotypingEngine.findEventAllelesInSample(eventAlleles, haplotypeAlleles, haplotypeAllelesForSample, alleleMapper, haplotypes)));
}
@Test
public void testFindHetEventAllelesInSample() {
final List<Allele> eventAlleles = new ArrayList<Allele>();
eventAlleles.add( Allele.create("A", true) );
eventAlleles.add( Allele.create("C", false) );
eventAlleles.add( Allele.create("T", false) );
final List<Allele> haplotypeAlleles = new ArrayList<Allele>();
haplotypeAlleles.add( Allele.create("AATA", true) );
haplotypeAlleles.add( Allele.create("AACA", false) );
haplotypeAlleles.add( Allele.create("CATA", false) );
haplotypeAlleles.add( Allele.create("CACA", false) );
haplotypeAlleles.add( Allele.create("TACA", false) );
haplotypeAlleles.add( Allele.create("TTCA", false) );
haplotypeAlleles.add( Allele.create("TTTA", false) );
final ArrayList<Haplotype> haplotypes = new ArrayList<Haplotype>();
haplotypes.add(new Haplotype("AATA".getBytes()));
haplotypes.add(new Haplotype("AACA".getBytes()));
haplotypes.add(new Haplotype("CATA".getBytes()));
haplotypes.add(new Haplotype("CACA".getBytes()));
haplotypes.add(new Haplotype("TACA".getBytes()));
haplotypes.add(new Haplotype("TTCA".getBytes()));
haplotypes.add(new Haplotype("TTTA".getBytes()));
final List<Allele> haplotypeAllelesForSample = new ArrayList<Allele>();
haplotypeAllelesForSample.add( Allele.create("TTTA", false) );
haplotypeAllelesForSample.add( Allele.create("AATA", true) );
final ArrayList<ArrayList<Haplotype>> alleleMapper = new ArrayList<ArrayList<Haplotype>>();
ArrayList<Haplotype> Aallele = new ArrayList<Haplotype>();
Aallele.add(haplotypes.get(0));
Aallele.add(haplotypes.get(1));
ArrayList<Haplotype> Callele = new ArrayList<Haplotype>();
Callele.add(haplotypes.get(2));
Callele.add(haplotypes.get(3));
ArrayList<Haplotype> Tallele = new ArrayList<Haplotype>();
Tallele.add(haplotypes.get(4));
Tallele.add(haplotypes.get(5));
Tallele.add(haplotypes.get(6));
alleleMapper.add(Aallele);
alleleMapper.add(Callele);
alleleMapper.add(Tallele);
final List<Allele> eventAllelesForSample = new ArrayList<Allele>();
eventAllelesForSample.add( Allele.create("A", true) );
eventAllelesForSample.add( Allele.create("T", false) );
if(!compareAlleleLists(eventAllelesForSample, GenotypingEngine.findEventAllelesInSample(eventAlleles, haplotypeAlleles, haplotypeAllelesForSample, alleleMapper, haplotypes))) {
logger.warn("calc alleles = " + GenotypingEngine.findEventAllelesInSample(eventAlleles, haplotypeAlleles, haplotypeAllelesForSample, alleleMapper, haplotypes));
logger.warn("expected alleles = " + eventAllelesForSample);
}
Assert.assertTrue(compareAlleleLists(eventAllelesForSample, GenotypingEngine.findEventAllelesInSample(eventAlleles, haplotypeAlleles, haplotypeAllelesForSample, alleleMapper, haplotypes)));
}
private boolean compareAlleleLists(List<Allele> l1, List<Allele> l2) {
if( l1.size() != l2.size() ) {
return false; // sanity check
}
for( int i=0; i < l1.size(); i++ ){
if ( !l2.contains(l1.get(i)) )
return false;
}
return true;
}
private class BasicGenotypingTestProvider extends TestDataProvider {
byte[] ref;
byte[] hap;
HashMap<Integer,Byte> expected;
GenotypingEngine ge = new GenotypingEngine(false, 0, false);
public BasicGenotypingTestProvider(String refString, String hapString, HashMap<Integer, Byte> expected) {
super(BasicGenotypingTestProvider.class, String.format("Haplotype to VCF test: ref = %s, alignment = %s", refString,hapString));
ref = refString.getBytes();
hap = hapString.getBytes();
this.expected = expected;
}
public HashMap<Integer,VariantContext> calcAlignment() {
final SWPairwiseAlignment alignment = new SWPairwiseAlignment(ref, hap);
return ge.generateVCsFromAlignment( alignment.getAlignmentStart2wrt1(), alignment.getCigar(), ref, hap, genomeLocParser.createGenomeLoc("4",1,1+ref.length), "name", 0);
}
}
@DataProvider(name = "BasicGenotypingTestProvider")
public Object[][] makeBasicGenotypingTests() {
for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGACTAGCCGATAG", map);
}
for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(2 + contextSize, (byte)'M');
map.put(21 + contextSize, (byte)'M');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG", "ATCTCGCATCGCGAGCATCGCCTAGCCGATAG", map);
}
for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'I');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGACACTAGCCGATAG", map);
}
for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'D');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGCTAGCCGATAG", map);
}
for( int contextSize : new int[]{1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1, (byte)'M');
map.put(20, (byte)'D');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider("AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGCTAGCCGATAG", map);
}
for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(2 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'I');
map.put(30 + contextSize, (byte)'D');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "ACCTCGCATCGCGAGCATCGTTACTAGCCGATG", map);
}
for( int contextSize : new int[]{0,1,5,9,24,36} ) {
HashMap<Integer, Byte> map = new HashMap<Integer, Byte>();
map.put(1 + contextSize, (byte)'M');
map.put(20 + contextSize, (byte)'D');
map.put(28 + contextSize, (byte)'M');
final String context = Utils.dupString('G', contextSize);
new BasicGenotypingTestProvider(context + "AGCTCGCATCGCGAGCATCGACTAGCCGATAG" + context, "CGCTCGCATCGCGAGCATCGCTAGCCCATAG", map);
}
return BasicGenotypingTestProvider.getTests(BasicGenotypingTestProvider.class);
}
@Test(dataProvider = "BasicGenotypingTestProvider", enabled = true)
public void testHaplotypeToVCF(BasicGenotypingTestProvider cfg) {
HashMap<Integer,VariantContext> calculatedMap = cfg.calcAlignment();
HashMap<Integer,Byte> expectedMap = cfg.expected;
logger.warn(String.format("Test: %s", cfg.toString()));
if(!compareVCMaps(calculatedMap, expectedMap)) {
logger.warn("calc map = " + calculatedMap);
logger.warn("expected map = " + expectedMap);
}
Assert.assertTrue(compareVCMaps(calculatedMap, expectedMap));
}
/**
* Tests that we get the right values from the R^2 calculation
*/
@Test
public void testCalculateR2LD() {
logger.warn("Executing testCalculateR2LD");
Assert.assertEquals(GenotypingEngine.calculateR2LD(1,1,1,1), 0.0, 0.00001);
Assert.assertEquals(GenotypingEngine.calculateR2LD(100,100,100,100), 0.0, 0.00001);
Assert.assertEquals(GenotypingEngine.calculateR2LD(1,0,0,1), 1.0, 0.00001);
Assert.assertEquals(GenotypingEngine.calculateR2LD(100,0,0,100), 1.0, 0.00001);
Assert.assertEquals(GenotypingEngine.calculateR2LD(1,2,3,4), (0.1 - 0.12) * (0.1 - 0.12) / (0.3 * 0.7 * 0.4 * 0.6), 0.00001);
}
@Test
public void testCreateMergedVariantContext() {
logger.warn("Executing testCreateMergedVariantContext");
final byte[] ref = "AATTCCGGAATTCCGGAATT".getBytes();
final GenomeLoc refLoc = genomeLocParser.createGenomeLoc("2", 1700, 1700 + ref.length);
// SNP + SNP = simple MNP
VariantContext thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make();
VariantContext nextVC = new VariantContextBuilder().loc("2", 1704, 1704).alleles("C","G").make();
VariantContext truthVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","GG").source("merged").make();
VariantContext mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// SNP + ref + SNP = MNP with ref base gap
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","GCG").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// insertion + SNP
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TAAAAA").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TAAAAACG").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// SNP + insertion
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","CAAAAA").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","GCCAAAAA").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// deletion + SNP
thisVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","T").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","G").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TG").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// SNP + deletion
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","G").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1706).alleles("TCCG","GCC").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// insertion + deletion = MNP
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TA").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make();
truthVC = new VariantContextBuilder().loc("2", 1704, 1706).alleles("CCG","ACC").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// insertion + deletion
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TAAAAA").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1706).alleles("TCCG","TAAAAACC").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// insertion + insertion
thisVC = new VariantContextBuilder().loc("2", 1703, 1703).alleles("T","TA").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1705).alleles("C","CA").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1705).alleles("TCC","TACCA").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// deletion + deletion
thisVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","A").make();
nextVC = new VariantContextBuilder().loc("2", 1705, 1706).alleles("CG","C").make();
truthVC = new VariantContextBuilder().loc("2", 1701, 1706).alleles("ATTCCG","ATCC").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// deletion + insertion (abutting)
thisVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","A").make();
nextVC = new VariantContextBuilder().loc("2", 1702, 1702).alleles("T","GCGCGC").make();
truthVC = new VariantContextBuilder().loc("2", 1701, 1702).alleles("AT","AGCGCGC").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
// complex + complex
thisVC = new VariantContextBuilder().loc("2", 1703, 1704).alleles("TC","AAA").make();
nextVC = new VariantContextBuilder().loc("2", 1706, 1707).alleles("GG","AC").make();
truthVC = new VariantContextBuilder().loc("2", 1703, 1707).alleles("TCCGG","AAACAC").source("merged").make();
mergedVC = GenotypingEngine.createMergedVariantContext(thisVC, nextVC, ref, refLoc);
logger.warn(truthVC + " == " + mergedVC);
Assert.assertTrue(truthVC.hasSameAllelesAs(mergedVC));
Assert.assertEquals(truthVC.getStart(), mergedVC.getStart());
Assert.assertEquals(truthVC.getEnd(), mergedVC.getEnd());
}
/**
* Private function to compare HashMap of VCs, it only checks the types and start locations of the VariantContext
*/
private boolean compareVCMaps(HashMap<Integer, VariantContext> calc, HashMap<Integer, Byte> expected) {
if( !calc.keySet().equals(expected.keySet()) ) { return false; } // sanity check
for( Integer loc : expected.keySet() ) {
Byte type = expected.get(loc);
switch( type ) {
case 'I':
if( !calc.get(loc).isSimpleInsertion() ) { return false; }
break;
case 'D':
if( !calc.get(loc).isSimpleDeletion() ) { return false; }
break;
case 'M':
if( !(calc.get(loc).isMNP() || calc.get(loc).isSNP()) ) { return false; }
break;
default:
return false;
}
}
return true;
}
}

View File

@ -0,0 +1,47 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
import org.broadinstitute.sting.WalkerTest;
import org.testng.annotations.Test;
import java.util.Arrays;
public class HaplotypeCallerIntegrationTest extends WalkerTest {
final static String REF = b37KGReference;
final String NA12878_BAM = validationDataLocation + "NA12878.HiSeq.b37.chr20.10_11mb.bam";
final String CEUTRIO_BAM = validationDataLocation + "CEUTrio.HiSeq.b37.chr20.10_11mb.bam";
final String INTERVALS_FILE = validationDataLocation + "NA12878.HiSeq.b37.chr20.10_11mb.test.intervals";
//final String RECAL_FILE = validationDataLocation + "NA12878.kmer.8.subset.recal_data.bqsr";
private void HCTest(String bam, String args, String md5) {
final String base = String.format("-T HaplotypeCaller -R %s -I %s -L %s", REF, bam, INTERVALS_FILE) + " --no_cmdline_in_header -o %s -minPruning 3";
final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5));
executeTest("testHaplotypeCaller: args=" + args, spec);
}
@Test
public void testHaplotypeCallerMultiSample() {
HCTest(CEUTRIO_BAM, "", "29ebfabcd4a42d4c5c2a576219cffb3d");
}
@Test
public void testHaplotypeCallerSingleSample() {
HCTest(NA12878_BAM, "", "9732313b8a12faa347f6ebe96518c5df");
}
@Test
public void testHaplotypeCallerMultiSampleGGA() {
HCTest(CEUTRIO_BAM, "-gt_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "combined.phase1.chr20.raw.indels.sites.vcf", "5e1d49d4110cd96c2e25f8e1da217e9e");
}
private void HCTestComplexVariants(String bam, String args, String md5) {
final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, bam) + " -L 20:10431524-10431924 -L 20:10723661-10724061 -L 20:10903555-10903955 --no_cmdline_in_header -o %s -minPruning 3";
final WalkerTestSpec spec = new WalkerTestSpec(base + " " + args, Arrays.asList(md5));
executeTest("testHaplotypeCallerComplexVariants: args=" + args, spec);
}
@Test
public void testHaplotypeCallerMultiSampleComplex() {
HCTestComplexVariants(CEUTRIO_BAM, "", "53df51e6071664725f6e7497f5ee5adf");
}
}

View File

@ -0,0 +1,174 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 3/14/12
*/
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.MathUtils;
import org.testng.Assert;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
import java.util.*;
/**
* Unit tests for LikelihoodCalculationEngine
*/
public class LikelihoodCalculationEngineUnitTest extends BaseTest {
@Test
public void testNormalizeDiploidLikelihoodMatrixFromLog10() {
double[][] likelihoodMatrix = {
{-90.2, 0, 0},
{-190.1, -2.1, 0},
{-7.0, -17.5, -35.9}
};
double[][] normalizedMatrix = {
{-88.1, 0, 0},
{-188.0, 0.0, 0},
{-4.9, -15.4, -33.8}
};
Assert.assertTrue(compareDoubleArrays(LikelihoodCalculationEngine.normalizeDiploidLikelihoodMatrixFromLog10(likelihoodMatrix), normalizedMatrix));
double[][] likelihoodMatrix2 = {
{-90.2, 0, 0, 0},
{-190.1, -2.1, 0, 0},
{-7.0, -17.5, -35.9, 0},
{-7.0, -17.5, -35.9, -1000.0},
};
double[][] normalizedMatrix2 = {
{-88.1, 0, 0, 0},
{-188.0, 0.0, 0, 0},
{-4.9, -15.4, -33.8, 0},
{-4.9, -15.4, -33.8, -997.9},
};
Assert.assertTrue(compareDoubleArrays(LikelihoodCalculationEngine.normalizeDiploidLikelihoodMatrixFromLog10(likelihoodMatrix2), normalizedMatrix2));
}
private class BasicLikelihoodTestProvider extends TestDataProvider {
public Double readLikelihoodForHaplotype1;
public Double readLikelihoodForHaplotype2;
public Double readLikelihoodForHaplotype3;
public BasicLikelihoodTestProvider(double a, double b) {
super(BasicLikelihoodTestProvider.class, String.format("Diploid haplotype likelihoods for reads %f / %f",a,b));
readLikelihoodForHaplotype1 = a;
readLikelihoodForHaplotype2 = b;
readLikelihoodForHaplotype3 = null;
}
public BasicLikelihoodTestProvider(double a, double b, double c) {
super(BasicLikelihoodTestProvider.class, String.format("Diploid haplotype likelihoods for reads %f / %f / %f",a,b,c));
readLikelihoodForHaplotype1 = a;
readLikelihoodForHaplotype2 = b;
readLikelihoodForHaplotype3 = c;
}
public double[][] expectedDiploidHaplotypeMatrix() {
if( readLikelihoodForHaplotype3 == null ) {
double maxValue = Math.max(readLikelihoodForHaplotype1,readLikelihoodForHaplotype2);
double[][] normalizedMatrix = {
{readLikelihoodForHaplotype1 - maxValue, Double.NEGATIVE_INFINITY},
{Math.log10(0.5*Math.pow(10,readLikelihoodForHaplotype1) + 0.5*Math.pow(10,readLikelihoodForHaplotype2)) - maxValue, readLikelihoodForHaplotype2 - maxValue}
};
return normalizedMatrix;
} else {
double maxValue = MathUtils.max(readLikelihoodForHaplotype1,readLikelihoodForHaplotype2,readLikelihoodForHaplotype3);
double[][] normalizedMatrix = {
{readLikelihoodForHaplotype1 - maxValue, Double.NEGATIVE_INFINITY, Double.NEGATIVE_INFINITY},
{Math.log10(0.5*Math.pow(10,readLikelihoodForHaplotype1) + 0.5*Math.pow(10,readLikelihoodForHaplotype2)) - maxValue, readLikelihoodForHaplotype2 - maxValue, Double.NEGATIVE_INFINITY},
{Math.log10(0.5*Math.pow(10,readLikelihoodForHaplotype1) + 0.5*Math.pow(10,readLikelihoodForHaplotype3)) - maxValue,
Math.log10(0.5*Math.pow(10,readLikelihoodForHaplotype2) + 0.5*Math.pow(10,readLikelihoodForHaplotype3)) - maxValue, readLikelihoodForHaplotype3 - maxValue}
};
return normalizedMatrix;
}
}
public double[][] calcDiploidHaplotypeMatrix() {
ArrayList<Haplotype> haplotypes = new ArrayList<Haplotype>();
for( int iii = 1; iii <= 3; iii++) {
Double readLikelihood = ( iii == 1 ? readLikelihoodForHaplotype1 : ( iii == 2 ? readLikelihoodForHaplotype2 : readLikelihoodForHaplotype3) );
int readCount = 1;
if( readLikelihood != null ) {
Haplotype haplotype = new Haplotype( (iii == 1 ? "AAAA" : (iii == 2 ? "CCCC" : "TTTT")).getBytes() );
haplotype.addReadLikelihoods("myTestSample", new double[]{readLikelihood}, new int[]{readCount});
haplotypes.add(haplotype);
}
}
return LikelihoodCalculationEngine.computeDiploidHaplotypeLikelihoods(haplotypes, "myTestSample");
}
}
@DataProvider(name = "BasicLikelihoodTestProvider")
public Object[][] makeBasicLikelihoodTests() {
new BasicLikelihoodTestProvider(-1.1, -2.2);
new BasicLikelihoodTestProvider(-2.2, -1.1);
new BasicLikelihoodTestProvider(-1.1, -1.1);
new BasicLikelihoodTestProvider(-9.7, -15.0);
new BasicLikelihoodTestProvider(-1.1, -2000.2);
new BasicLikelihoodTestProvider(-1000.1, -2.2);
new BasicLikelihoodTestProvider(0, 0);
new BasicLikelihoodTestProvider(-1.1, 0);
new BasicLikelihoodTestProvider(0, -2.2);
new BasicLikelihoodTestProvider(-100.1, -200.2);
new BasicLikelihoodTestProvider(-1.1, -2.2, 0);
new BasicLikelihoodTestProvider(-2.2, -1.1, 0);
new BasicLikelihoodTestProvider(-1.1, -1.1, 0);
new BasicLikelihoodTestProvider(-9.7, -15.0, 0);
new BasicLikelihoodTestProvider(-1.1, -2000.2, 0);
new BasicLikelihoodTestProvider(-1000.1, -2.2, 0);
new BasicLikelihoodTestProvider(0, 0, 0);
new BasicLikelihoodTestProvider(-1.1, 0, 0);
new BasicLikelihoodTestProvider(0, -2.2, 0);
new BasicLikelihoodTestProvider(-100.1, -200.2, 0);
new BasicLikelihoodTestProvider(-1.1, -2.2, -12.121);
new BasicLikelihoodTestProvider(-2.2, -1.1, -12.121);
new BasicLikelihoodTestProvider(-1.1, -1.1, -12.121);
new BasicLikelihoodTestProvider(-9.7, -15.0, -12.121);
new BasicLikelihoodTestProvider(-1.1, -2000.2, -12.121);
new BasicLikelihoodTestProvider(-1000.1, -2.2, -12.121);
new BasicLikelihoodTestProvider(0, 0, -12.121);
new BasicLikelihoodTestProvider(-1.1, 0, -12.121);
new BasicLikelihoodTestProvider(0, -2.2, -12.121);
new BasicLikelihoodTestProvider(-100.1, -200.2, -12.121);
return BasicLikelihoodTestProvider.getTests(BasicLikelihoodTestProvider.class);
}
@Test(dataProvider = "BasicLikelihoodTestProvider", enabled = true)
public void testOneReadWithTwoOrThreeHaplotypes(BasicLikelihoodTestProvider cfg) {
double[][] calculatedMatrix = cfg.calcDiploidHaplotypeMatrix();
double[][] expectedMatrix = cfg.expectedDiploidHaplotypeMatrix();
logger.warn(String.format("Test: %s", cfg.toString()));
Assert.assertTrue(compareDoubleArrays(calculatedMatrix, expectedMatrix));
}
/**
* Private function to compare 2d arrays
*/
private boolean compareDoubleArrays(double[][] b1, double[][] b2) {
if( b1.length != b2.length ) {
return false; // sanity check
}
for( int i=0; i < b1.length; i++ ){
if( b1[i].length != b2[i].length) {
return false; // sanity check
}
for( int j=0; j < b1.length; j++ ){
if ( MathUtils.compareDoubles(b1[i][j], b2[i][j]) != 0 && !Double.isInfinite(b1[i][j]) && !Double.isInfinite(b2[i][j]))
return false;
}
}
return true;
}
}

View File

@ -0,0 +1,298 @@
package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 3/27/12
*/
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.walkers.genotyper.ArtificialReadPileupTestProvider;
import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.jgrapht.graph.DefaultDirectedGraph;
import org.testng.Assert;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
import java.io.File;
import java.io.FileNotFoundException;
import java.io.PrintStream;
import java.util.*;
public class SimpleDeBruijnAssemblerUnitTest extends BaseTest {
private class MergeNodesWithNoVariationTestProvider extends TestDataProvider {
public byte[] sequence;
public int KMER_LENGTH;
public MergeNodesWithNoVariationTestProvider(String seq, int kmer) {
super(MergeNodesWithNoVariationTestProvider.class, String.format("Merge nodes with no variation test. kmer = %d, seq = %s", kmer, seq));
sequence = seq.getBytes();
KMER_LENGTH = kmer;
}
public DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> expectedGraph() {
DeBruijnVertex v = new DeBruijnVertex(sequence, 0);
DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
graph.addVertex(v);
return graph;
}
public DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> calcGraph() {
DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
final int kmersInSequence = sequence.length - KMER_LENGTH + 1;
for (int i = 0; i < kmersInSequence - 1; i++) {
// get the kmers
final byte[] kmer1 = new byte[KMER_LENGTH];
System.arraycopy(sequence, i, kmer1, 0, KMER_LENGTH);
final byte[] kmer2 = new byte[KMER_LENGTH];
System.arraycopy(sequence, i+1, kmer2, 0, KMER_LENGTH);
SimpleDeBruijnAssembler.addKmersToGraph(graph, kmer1, kmer2, false);
}
SimpleDeBruijnAssembler.mergeNodes(graph);
return graph;
}
}
@DataProvider(name = "MergeNodesWithNoVariationTestProvider")
public Object[][] makeMergeNodesWithNoVariationTests() {
new MergeNodesWithNoVariationTestProvider("GGTTAACC", 3);
new MergeNodesWithNoVariationTestProvider("GGTTAACC", 4);
new MergeNodesWithNoVariationTestProvider("GGTTAACC", 5);
new MergeNodesWithNoVariationTestProvider("GGTTAACC", 6);
new MergeNodesWithNoVariationTestProvider("GGTTAACC", 7);
new MergeNodesWithNoVariationTestProvider("GGTTAACCATGCAGACGGGAGGCTGAGCGAGAGTTTT", 6);
new MergeNodesWithNoVariationTestProvider("AATACCATTGGAGTTTTTTTCCAGGTTAAGATGGTGCATTGAATCCACCCATCTACTTTTGCTCCTCCCAAAACTCACTAAAACTATTATAAAGGGATTTTGTTTAAAGACACAAACTCATGAGGACAGAGAGAACAGAGTAGACAATAGTGGGGGAAAAATAAGTTGGAAGATAGAAAACAGATGGGTGAGTGGTAATCGACTCAGCAGCCCCAAGAAAGCTGAAACCCAGGGAAAGTTAAGAGTAGCCCTATTTTCATGGCAAAATCCAAGGGGGGGTGGGGAAAGAAAGAAAAACAGAAAAAAAAATGGGAATTGGCAGTCCTAGATATCTCTGGTACTGGGCAAGCCAAAGAATCAGGATAACTGGGTGAAAGGTGATTGGGAAGCAGTTAAAATCTTAGTTCCCCTCTTCCACTCTCCGAGCAGCAGGTTTCTCTCTCTCATCAGGCAGAGGGCTGGAGAT", 66);
new MergeNodesWithNoVariationTestProvider("AATACCATTGGAGTTTTTTTCCAGGTTAAGATGGTGCATTGAATCCACCCATCTACTTTTGCTCCTCCCAAAACTCACTAAAACTATTATAAAGGGATTTTGTTTAAAGACACAAACTCATGAGGACAGAGAGAACAGAGTAGACAATAGTGGGGGAAAAATAAGTTGGAAGATAGAAAACAGATGGGTGAGTGGTAATCGACTCAGCAGCCCCAAGAAAGCTGAAACCCAGGGAAAGTTAAGAGTAGCCCTATTTTCATGGCAAAATCCAAGGGGGGGTGGGGAAAGAAAGAAAAACAGAAAAAAAAATGGGAATTGGCAGTCCTAGATATCTCTGGTACTGGGCAAGCCAAAGAATCAGGATAACTGGGTGAAAGGTGATTGGGAAGCAGTTAAAATCTTAGTTCCCCTCTTCCACTCTCCGAGCAGCAGGTTTCTCTCTCTCATCAGGCAGAGGGCTGGAGAT", 76);
return MergeNodesWithNoVariationTestProvider.getTests(MergeNodesWithNoVariationTestProvider.class);
}
@Test(dataProvider = "MergeNodesWithNoVariationTestProvider", enabled = true)
public void testMergeNodesWithNoVariation(MergeNodesWithNoVariationTestProvider cfg) {
logger.warn(String.format("Test: %s", cfg.toString()));
Assert.assertTrue(graphEquals(cfg.calcGraph(), cfg.expectedGraph()));
}
@Test(enabled = true)
public void testPruneGraph() {
DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> expectedGraph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
DeBruijnVertex v = new DeBruijnVertex("ATGG".getBytes(), 0);
DeBruijnVertex v2 = new DeBruijnVertex("ATGGA".getBytes(), 0);
DeBruijnVertex v3 = new DeBruijnVertex("ATGGT".getBytes(), 0);
DeBruijnVertex v4 = new DeBruijnVertex("ATGGG".getBytes(), 0);
DeBruijnVertex v5 = new DeBruijnVertex("ATGGC".getBytes(), 0);
DeBruijnVertex v6 = new DeBruijnVertex("ATGGCCCCCC".getBytes(), 0);
graph.addVertex(v);
graph.addVertex(v2);
graph.addVertex(v3);
graph.addVertex(v4);
graph.addVertex(v5);
graph.addVertex(v6);
graph.addEdge(v, v2, new DeBruijnEdge(false, 1));
graph.addEdge(v2, v3, new DeBruijnEdge(false, 3));
graph.addEdge(v3, v4, new DeBruijnEdge(false, 5));
graph.addEdge(v4, v5, new DeBruijnEdge(false, 3));
graph.addEdge(v5, v6, new DeBruijnEdge(false, 2));
expectedGraph.addVertex(v2);
expectedGraph.addVertex(v3);
expectedGraph.addVertex(v4);
expectedGraph.addVertex(v5);
expectedGraph.addEdge(v2, v3, new DeBruijnEdge(false, 3));
expectedGraph.addEdge(v3, v4, new DeBruijnEdge(false, 5));
expectedGraph.addEdge(v4, v5, new DeBruijnEdge(false, 3));
SimpleDeBruijnAssembler.pruneGraph(graph, 2);
Assert.assertTrue(graphEquals(graph, expectedGraph));
graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
expectedGraph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
graph.addVertex(v);
graph.addVertex(v2);
graph.addVertex(v3);
graph.addVertex(v4);
graph.addVertex(v5);
graph.addVertex(v6);
graph.addEdge(v, v2, new DeBruijnEdge(true, 1));
graph.addEdge(v2, v3, new DeBruijnEdge(false, 3));
graph.addEdge(v3, v4, new DeBruijnEdge(false, 5));
graph.addEdge(v4, v5, new DeBruijnEdge(false, 3));
expectedGraph.addVertex(v);
expectedGraph.addVertex(v2);
expectedGraph.addVertex(v3);
expectedGraph.addVertex(v4);
expectedGraph.addVertex(v5);
expectedGraph.addEdge(v, v2, new DeBruijnEdge(true, 1));
expectedGraph.addEdge(v2, v3, new DeBruijnEdge(false, 3));
expectedGraph.addEdge(v3, v4, new DeBruijnEdge(false, 5));
expectedGraph.addEdge(v4, v5, new DeBruijnEdge(false, 3));
SimpleDeBruijnAssembler.pruneGraph(graph, 2);
Assert.assertTrue(graphEquals(graph, expectedGraph));
}
@Test(enabled=false)
// not ready yet
public void testBasicGraphCreation() {
final ArtificialReadPileupTestProvider refPileupTestProvider = new ArtificialReadPileupTestProvider(1,"ref");
final byte refBase = refPileupTestProvider.getReferenceContext().getBase();
final String altBase = (refBase==(byte)'A'?"C":"A");
final int matches = 50;
final int mismatches = 50;
Map<String,AlignmentContext> refContext = refPileupTestProvider.getAlignmentContextFromAlleles(0, altBase, new int[]{matches, mismatches}, false, 30);
PrintStream graphWriter = null;
try{
graphWriter = new PrintStream("du.txt");
} catch (Exception e) {}
SimpleDeBruijnAssembler assembler = new SimpleDeBruijnAssembler(true,graphWriter);
final Haplotype refHaplotype = new Haplotype(refPileupTestProvider.getReferenceContext().getBases());
refHaplotype.setIsReference(true);
assembler.createDeBruijnGraphs(refContext.get(refPileupTestProvider.getSampleNames().get(0)).getBasePileup().getReads(), refHaplotype);
/* // clean up the graphs by pruning and merging
for( final DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge> graph : graphs ) {
SimpleDeBruijnAssembler.pruneGraph( graph, PRUNE_FACTOR );
//eliminateNonRefPaths( graph );
SimpleDeBruijnAssembler.mergeNodes( graph );
}
*/
if( graphWriter != null ) {
assembler.printGraphs();
}
int k=2;
// find the best paths in the graphs
// return findBestPaths( refHaplotype, fullReferenceWithPadding, refLoc, activeAllelesToGenotype, activeRegion.getExtendedLoc() );
}
@Test(enabled = true)
public void testEliminateNonRefPaths() {
DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> expectedGraph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
DeBruijnVertex v = new DeBruijnVertex("ATGG".getBytes(), 0);
DeBruijnVertex v2 = new DeBruijnVertex("ATGGA".getBytes(), 0);
DeBruijnVertex v3 = new DeBruijnVertex("ATGGT".getBytes(), 0);
DeBruijnVertex v4 = new DeBruijnVertex("ATGGG".getBytes(), 0);
DeBruijnVertex v5 = new DeBruijnVertex("ATGGC".getBytes(), 0);
DeBruijnVertex v6 = new DeBruijnVertex("ATGGCCCCCC".getBytes(), 0);
graph.addVertex(v);
graph.addVertex(v2);
graph.addVertex(v3);
graph.addVertex(v4);
graph.addVertex(v5);
graph.addVertex(v6);
graph.addEdge(v, v2, new DeBruijnEdge(false));
graph.addEdge(v2, v3, new DeBruijnEdge(true));
graph.addEdge(v3, v4, new DeBruijnEdge(true));
graph.addEdge(v4, v5, new DeBruijnEdge(true));
graph.addEdge(v5, v6, new DeBruijnEdge(false));
expectedGraph.addVertex(v2);
expectedGraph.addVertex(v3);
expectedGraph.addVertex(v4);
expectedGraph.addVertex(v5);
expectedGraph.addEdge(v2, v3, new DeBruijnEdge());
expectedGraph.addEdge(v3, v4, new DeBruijnEdge());
expectedGraph.addEdge(v4, v5, new DeBruijnEdge());
SimpleDeBruijnAssembler.eliminateNonRefPaths(graph);
Assert.assertTrue(graphEquals(graph, expectedGraph));
graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
expectedGraph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
graph.addVertex(v);
graph.addVertex(v2);
graph.addVertex(v3);
graph.addVertex(v4);
graph.addVertex(v5);
graph.addVertex(v6);
graph.addEdge(v, v2, new DeBruijnEdge(true));
graph.addEdge(v2, v3, new DeBruijnEdge(true));
graph.addEdge(v4, v5, new DeBruijnEdge(false));
graph.addEdge(v5, v6, new DeBruijnEdge(false));
expectedGraph.addVertex(v);
expectedGraph.addVertex(v2);
expectedGraph.addVertex(v3);
expectedGraph.addEdge(v, v2, new DeBruijnEdge());
expectedGraph.addEdge(v2, v3, new DeBruijnEdge());
SimpleDeBruijnAssembler.eliminateNonRefPaths(graph);
Assert.assertTrue(graphEquals(graph, expectedGraph));
graph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
expectedGraph = new DefaultDirectedGraph<DeBruijnVertex, DeBruijnEdge>(DeBruijnEdge.class);
graph.addVertex(v);
graph.addVertex(v2);
graph.addVertex(v3);
graph.addVertex(v4);
graph.addVertex(v5);
graph.addVertex(v6);
graph.addEdge(v, v2, new DeBruijnEdge(true));
graph.addEdge(v2, v3, new DeBruijnEdge(true));
graph.addEdge(v4, v5, new DeBruijnEdge(false));
graph.addEdge(v5, v6, new DeBruijnEdge(false));
graph.addEdge(v4, v2, new DeBruijnEdge(false));
expectedGraph.addVertex(v);
expectedGraph.addVertex(v2);
expectedGraph.addVertex(v3);
expectedGraph.addEdge(v, v2, new DeBruijnEdge());
expectedGraph.addEdge(v2, v3, new DeBruijnEdge());
SimpleDeBruijnAssembler.eliminateNonRefPaths(graph);
Assert.assertTrue(graphEquals(graph, expectedGraph));
}
private boolean graphEquals(DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> g1, DefaultDirectedGraph<DeBruijnVertex,DeBruijnEdge> g2) {
if( !(g1.vertexSet().containsAll(g2.vertexSet()) && g2.vertexSet().containsAll(g1.vertexSet())) ) {
return false;
}
for( DeBruijnEdge e1 : g1.edgeSet() ) {
boolean found = false;
for( DeBruijnEdge e2 : g2.edgeSet() ) {
if( e1.equals(g1, e2, g2) ) { found = true; break; }
}
if( !found ) { return false; }
}
for( DeBruijnEdge e2 : g2.edgeSet() ) {
boolean found = false;
for( DeBruijnEdge e1 : g1.edgeSet() ) {
if( e2.equals(g2, e1, g1) ) { found = true; break; }
}
if( !found ) { return false; }
}
return true;
}
}

View File

@ -1,121 +0,0 @@
#!/bin/env Rscript
library(tools)
args <- commandArgs(TRUE)
verbose = TRUE
input = args[1]
covariateName = args[2]
outfile = paste(input, ".qual_diff_v_", covariateName, ".pdf", sep="")
pdf(outfile, height=7, width=7)
par(cex=1.1)
c <- read.table(input, header=T)
c <- c[sort.list(c[,1]),]
#
# Plot residual error as a function of the covariate
#
d.good <- c[c$nBases >= 1000,]
d.1000 <- c[c$nBases < 1000,]
rmseGood = sqrt( sum(as.numeric((d.good$Qempirical-d.good$Qreported)^2 * d.good$nBases)) / sum(as.numeric(d.good$nBases)) ) # prevent integer overflow with as.numeric, ugh
rmseAll = sqrt( sum(as.numeric((c$Qempirical-c$Qreported)^2 * c$nBases)) / sum(as.numeric(c$nBases)) )
theTitle = paste("RMSE_good =", round(rmseGood,digits=3), ", RMSE_all =", round(rmseAll,digits=3))
if( length(d.good$nBases) == length(c$nBases) ) {
theTitle = paste("RMSE =", round(rmseAll,digits=3))
}
# Don't let residual error go off the edge of the plot
d.good$residualError = d.good$Qempirical-d.good$Qreported
d.good$residualError[which(d.good$residualError > 10)] = 10
d.good$residualError[which(d.good$residualError < -10)] = -10
d.1000$residualError = d.1000$Qempirical-d.1000$Qreported
d.1000$residualError[which(d.1000$residualError > 10)] = 10
d.1000$residualError[which(d.1000$residualError < -10)] = -10
c$residualError = c$Qempirical-c$Qreported
c$residualError[which(c$residualError > 10)] = 10
c$residualError[which(c$residualError < -10)] = -10
pointType = "p"
if( length(c$Covariate) <= 20 ) {
pointType = "o"
}
if( is.numeric(c$Covariate) ) {
plot(d.good$Covariate, d.good$residualError, type=pointType, main=theTitle, ylab="Empirical - Reported Quality", xlab=covariateName, col="blue", pch=20, ylim=c(-10, 10), xlim=c(min(c$Covariate),max(c$Covariate)))
points(d.1000$Covariate, d.1000$residualError, type=pointType, col="cornflowerblue", pch=20)
} else { # Dinuc (and other non-numeric covariates) are different to make their plots look nice
plot(c$Covariate, c$residualError, type="l", main=theTitle, ylab="Empirical - Reported Quality", xlab=covariateName, col="blue", ylim=c(-10, 10))
points(d.1000$Covariate, d.1000$residualError, type="l", col="cornflowerblue")
}
dev.off()
if (exists('compactPDF')) {
compactPDF(outfile)
}
#
# Plot mean quality versus the covariate
#
outfile = paste(input, ".reported_qual_v_", covariateName, ".pdf", sep="")
pdf(outfile, height=7, width=7)
par(cex=1.1)
pointType = "p"
if( length(c$Covariate) <= 20 ) {
pointType = "o"
}
theTitle = paste("Quality By", covariateName);
if( is.numeric(c$Covariate) ) {
plot(d.good$Covariate, d.good$Qreported, type=pointType, main=theTitle, ylab="Mean Reported Quality", xlab=covariateName, col="blue", pch=20, ylim=c(0, 40), xlim=c(min(c$Covariate),max(c$Covariate)))
points(d.1000$Covariate, d.1000$Qreported, type=pointType, col="cornflowerblue", pch=20)
} else { # Dinuc (and other non-numeric covariates) are different to make their plots look nice
plot(c$Covariate, c$Qreported, type="l", main=theTitle, ylab="Mean Reported Quality", xlab=covariateName, col="blue", ylim=c(0, 40))
points(d.1000$Covariate, d.1000$Qreported, type="l", col="cornflowerblue")
}
dev.off()
if (exists('compactPDF')) {
compactPDF(outfile)
}
#
# Plot histogram of the covariate
#
e = d.good
f = d.1000
outfile = paste(input, ".", covariateName,"_hist.pdf", sep="")
pdf(outfile, height=7, width=7)
hst=subset(data.frame(e$Covariate, e$nBases), e.nBases != 0)
hst2=subset(data.frame(f$Covariate, f$nBases), f.nBases != 0)
lwdSize=2
if( length(c$Covariate) <= 20 ) {
lwdSize=7
} else if( length(c$Covariate) <= 70 ) {
lwdSize=4
}
if( is.numeric(c$Covariate) ) {
if( length(hst$e.Covariate) == 0 ) {
plot(hst2$f.Covariate, hst2$f.nBases, type="h", lwd=lwdSize, col="cornflowerblue", main=paste(covariateName,"histogram"), ylim=c(0, max(hst2$f.nBases)), xlab=covariateName, ylab="Count",yaxt="n",xlim=c(min(c$Covariate),max(c$Covariate)))
} else {
plot(hst$e.Covariate, hst$e.nBases, type="h", lwd=lwdSize, main=paste(covariateName,"histogram"), xlab=covariateName, ylim=c(0, max(hst$e.nBases)),ylab="Number of Bases",yaxt="n",xlim=c(min(c$Covariate),max(c$Covariate)))
points(hst2$f.Covariate, hst2$f.nBases, type="h", lwd=lwdSize, col="cornflowerblue")
}
axis(2,axTicks(2), format(axTicks(2), scientific=F))
} else { # Dinuc (and other non-numeric covariates) are different to make their plots look nice
hst=subset(data.frame(c$Covariate, c$nBases), c.nBases != 0)
plot(1:length(hst$c.Covariate), hst$c.nBases, type="h", lwd=lwdSize, main=paste(covariateName,"histogram"), ylim=c(0, max(hst$c.nBases)),xlab=covariateName, ylab="Number of Bases",yaxt="n",xaxt="n")
if( length(hst$c.Covariate) > 9 ) {
axis(1, at=seq(1,length(hst$c.Covariate),2), labels = hst$c.Covariate[seq(1,length(hst$c.Covariate),2)])
} else {
axis(1, at=seq(1,length(hst$c.Covariate),1), labels = hst$c.Covariate)
}
axis(2,axTicks(2), format(axTicks(2), scientific=F))
}
dev.off()
if (exists('compactPDF')) {
compactPDF(outfile)
}

View File

@ -1,84 +0,0 @@
#!/bin/env Rscript
library(tools)
args <- commandArgs(TRUE)
input = args[1]
Qcutoff = as.numeric(args[2])
maxQ = as.numeric(args[3])
maxHist = as.numeric(args[4])
t=read.table(input, header=T)
#
# Plot of reported quality versus empirical quality
#
outfile = paste(input, ".quality_emp_v_stated.pdf", sep="")
pdf(outfile, height=7, width=7)
d.good <- t[t$nBases >= 10000 & t$Qreported >= Qcutoff,]
d.1000 <- t[t$nBases < 1000 & t$Qreported >= Qcutoff,]
d.10000 <- t[t$nBases < 10000 & t$nBases >= 1000 & t$Qreported >= Qcutoff,]
f <- t[t$Qreported < Qcutoff,]
e <- rbind(d.good, d.1000, d.10000)
rmseGood = sqrt( sum(as.numeric((d.good$Qempirical-d.good$Qreported)^2 * d.good$nBases)) / sum(as.numeric(d.good$nBases)) ) # prevent integer overflow with as.numeric, ugh
rmseAll = sqrt( sum(as.numeric((e$Qempirical-e$Qreported)^2 * e$nBases)) / sum(as.numeric(e$nBases)) )
theTitle = paste("RMSE_good =", round(rmseGood,digits=3), ", RMSE_all =", round(rmseAll,digits=3))
if( length(t$nBases) - length(f$nBases) == length(d.good$nBases) ) {
theTitle = paste("RMSE =", round(rmseAll,digits=3));
}
plot(d.good$Qreported, d.good$Qempirical, type="p", col="blue", main=theTitle, xlim=c(0,maxQ), ylim=c(0,maxQ), pch=16, xlab="Reported quality score", ylab="Empirical quality score")
points(d.1000$Qreported, d.1000$Qempirical, type="p", col="lightblue", pch=16)
points(d.10000$Qreported, d.10000$Qempirical, type="p", col="cornflowerblue", pch=16)
points(f$Qreported, f$Qempirical, type="p", col="maroon1", pch=16)
abline(0,1, lty=2)
dev.off()
if (exists('compactPDF')) {
compactPDF(outfile)
}
#
# Plot Q empirical histogram
#
outfile = paste(input, ".quality_emp_hist.pdf", sep="")
pdf(outfile, height=7, width=7)
hst=subset(data.frame(e$Qempirical, e$nBases), e.nBases != 0)
hst2=subset(data.frame(f$Qempirical, f$nBases), f.nBases != 0)
percentBases=hst$e.nBases / sum(as.numeric(hst$e.nBases))
entropy = -sum(log2(percentBases)*percentBases)
yMax = max(hst$e.nBases)
if(maxHist != 0) {
yMax = maxHist
}
plot(hst$e.Qempirical, hst$e.nBases, type="h", lwd=4, xlim=c(0,maxQ), ylim=c(0,yMax), main=paste("Empirical quality score histogram, entropy = ",round(entropy,digits=3)), xlab="Empirical quality score", ylab="Number of Bases",yaxt="n")
points(hst2$f.Qempirical, hst2$f.nBases, type="h", lwd=4, col="maroon1")
axis(2,axTicks(2), format(axTicks(2), scientific=F))
dev.off()
if (exists('compactPDF')) {
compactPDF(outfile)
}
#
# Plot Q reported histogram
#
outfile = paste(input, ".quality_rep_hist.pdf", sep="")
pdf(outfile, height=7, width=7)
hst=subset(data.frame(e$Qreported, e$nBases), e.nBases != 0)
hst2=subset(data.frame(f$Qreported, f$nBases), f.nBases != 0)
yMax = max(hst$e.nBases)
if(maxHist != 0) {
yMax = maxHist
}
plot(hst$e.Qreported, hst$e.nBases, type="h", lwd=4, xlim=c(0,maxQ), ylim=c(0,yMax), main=paste("Reported quality score histogram, entropy = ",round(entropy,digits=3)), xlab="Reported quality score", ylab="Number of Bases",yaxt="n")
points(hst2$f.Qreported, hst2$f.nBases, type="h", lwd=4, col="maroon1")
axis(2,axTicks(2), format(axTicks(2), scientific=F))
dev.off()
if (exists('compactPDF')) {
compactPDF(outfile)
}

View File

@ -0,0 +1,101 @@
library("ggplot2")
library("tools") #For compactPDF in R 2.13+
args <- commandArgs(TRUE)
data <- read.csv(args[1])
data <- within(data, EventType <- factor(EventType, levels = rev(levels(EventType))))
numRG = length(unique(data$ReadGroup))
blankTheme = opts(panel.grid.major = theme_blank(), panel.grid.minor = theme_blank(), panel.background = theme_blank(), axis.ticks = theme_blank())
# Viewport (layout 2 graphs top to bottom)
distributeGraphRows <- function(graphs, heights = c()) {
if (length(heights) == 0) {
heights <- rep.int(1, length(graphs))
}
heights <- heights[!is.na(graphs)]
graphs <- graphs[!is.na(graphs)]
numGraphs <- length(graphs)
Layout <- grid.layout(nrow = numGraphs, ncol = 1, heights=heights)
grid.newpage()
pushViewport(viewport(layout = Layout))
subplot <- function(x) viewport(layout.pos.row = x, layout.pos.col = 1)
for (i in 1:numGraphs) {
print(graphs[[i]], vp = subplot(i))
}
}
for(cov in levels(data$CovariateName)) { # for each covariate in turn
d = data[data$CovariateName==cov,] # pull out just the data for this covariate so we can treat the non-numeric values appropriately
if( cov == "Context" ) {
d$CovariateValue = as.character(d$CovariateValue)
d$CovariateValue = substring(d$CovariateValue,nchar(d$CovariateValue)-2,nchar(d$CovariateValue))
} else {
d$CovariateValue = as.numeric(levels(d$CovariateValue))[as.integer(d$CovariateValue)] # efficient way to convert factors back to their real values
}
#d=subset(d,Observations>2000) # only show bins which have enough data to actually estimate the quality
dSub=subset(d,EventType=="Base Substitution")
dIns=subset(d,EventType=="Base Insertion")
dDel=subset(d,EventType=="Base Deletion")
dSub=dSub[sample.int(length(dSub[,1]),min(length(dSub[,1]),2000)),] # don't plot too many values because it makes the PDFs too massive
dIns=dIns[sample.int(length(dIns[,1]),min(length(dIns[,1]),2000)),] # don't plot too many values because it makes the PDFs too massive
dDel=dDel[sample.int(length(dDel[,1]),min(length(dDel[,1]),2000)),] # don't plot too many values because it makes the PDFs too massive
d=rbind(dSub, dIns, dDel)
if( cov != "QualityScore" ) {
p <- ggplot(d, aes(x=CovariateValue,y=Accuracy,alpha=log10(Observations))) +
geom_abline(intercept=0, slope=0, linetype=2) +
xlab(paste(cov,"Covariate")) +
ylab("Quality Score Accuracy") +
blankTheme
if(cov == "Cycle") {
b <- p + geom_point(aes(color=Recalibration)) + scale_color_manual(values=c("maroon1","blue")) + facet_grid(.~EventType) +
opts(axis.text.x=theme_text(angle=90, hjust=0))
p <- ggplot(d, aes(x=CovariateValue,y=AverageReportedQuality,alpha=log10(Observations))) +
xlab(paste(cov,"Covariate")) +
ylab("Mean Quality Score") +
blankTheme
e <- p + geom_point(aes(color=Recalibration)) + scale_color_manual(values=c("maroon1","blue")) + facet_grid(.~EventType) +
opts(axis.text.x=theme_text(angle=90, hjust=0))
} else {
c <- p + geom_point(aes(color=Recalibration)) + scale_color_manual(values=c("maroon1","blue")) + facet_grid(.~EventType) +
opts(axis.text.x=theme_text(angle=90, hjust=0)) + xlab(paste(cov,"Covariate (3 base suffix)"))
p <- ggplot(d, aes(x=CovariateValue,y=AverageReportedQuality,alpha=log10(Observations))) +
xlab(paste(cov,"Covariate (3 base suffix)")) +
ylab("Mean Quality Score") +
blankTheme
f <- p + geom_point(aes(color=Recalibration)) + scale_color_manual(values=c("maroon1","blue")) + facet_grid(.~EventType) +
opts(axis.text.x=theme_text(angle=90, hjust=0))
}
} else {
p <- ggplot(d, aes(x=AverageReportedQuality,y=EmpiricalQuality,alpha=log10(Observations))) +
geom_abline(intercept=0, slope=1, linetype=2) +
xlab("Reported Quality Score") +
ylab("Empirical Quality Score") +
blankTheme
a <- p + geom_point(aes(color=Recalibration)) + scale_color_manual(values=c("maroon1","blue")) + facet_grid(.~EventType)
p <- ggplot(d, aes(x=CovariateValue)) +
xlab(paste(cov,"Covariate")) +
ylab("Number of Observations") +
blankTheme
d <- p + geom_histogram(aes(fill=Recalibration,weight=Observations),alpha=0.6,binwidth=1,position="identity") + scale_fill_manual(values=c("maroon1","blue")) + facet_grid(.~EventType) +
scale_y_continuous(formatter="comma")
}
}
pdf(args[2],height=9,width=15)
distributeGraphRows(list(a,b,c), c(1,1,1))
distributeGraphRows(list(d,e,f), c(1,1,1))
dev.off()
if (exists('compactPDF')) {
compactPDF(args[2])
}

View File

@ -19,9 +19,9 @@ Medical and Population Genetics Program
Maintainer: Kiran Garimella Maintainer: Kiran Garimella
} }
\references{ \references{
GSA wiki page: http://www.broadinstitute.org/gsa/wiki GSA wiki page: http://www.broadinstitute.org/gatk
GATK help forum: http://www.getsatisfaction.com/gsa GATK help forum: http://www.broadinstitute.org/gatk
} }
\examples{ \examples{
## get script arguments in interactive and non-interactive mode ## get script arguments in interactive and non-interactive mode

View File

@ -29,11 +29,13 @@ import org.broadinstitute.sting.alignment.bwa.BWAConfiguration;
import org.broadinstitute.sting.alignment.bwa.BWTFiles; import org.broadinstitute.sting.alignment.bwa.BWTFiles;
import org.broadinstitute.sting.alignment.bwa.c.BWACAligner; import org.broadinstitute.sting.alignment.bwa.c.BWACAligner;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.ReadWalker; import org.broadinstitute.sting.gatk.walkers.ReadWalker;
import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Iterator; import java.util.Iterator;
@ -46,7 +48,8 @@ import java.util.Iterator;
* @author mhanna * @author mhanna
* @version 0.1 * @version 0.1
*/ */
public class AlignmentValidationWalker extends ReadWalker<Integer,Integer> { @DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
public class AlignmentValidation extends ReadWalker<Integer,Integer> {
/** /**
* The supporting BWT index generated using BWT. * The supporting BWT index generated using BWT.
*/ */

View File

@ -34,11 +34,13 @@ import org.broadinstitute.sting.alignment.bwa.BWTFiles;
import org.broadinstitute.sting.alignment.bwa.c.BWACAligner; import org.broadinstitute.sting.alignment.bwa.c.BWACAligner;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.io.StingSAMFileWriter; import org.broadinstitute.sting.gatk.io.StingSAMFileWriter;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.ReadWalker; import org.broadinstitute.sting.gatk.walkers.ReadWalker;
import org.broadinstitute.sting.gatk.walkers.WalkerName; import org.broadinstitute.sting.gatk.walkers.WalkerName;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.File; import java.io.File;
@ -50,6 +52,7 @@ import java.io.File;
* @author mhanna * @author mhanna
* @version 0.1 * @version 0.1
*/ */
@DocumentedGATKFeature( groupName = "BAM Processing and Analysis Tools", extraDocs = {CommandLineGATK.class} )
@WalkerName("Align") @WalkerName("Align")
public class AlignmentWalker extends ReadWalker<Integer,Integer> { public class AlignmentWalker extends ReadWalker<Integer,Integer> {
@Argument(fullName="target_reference",shortName="target_ref",doc="The reference to which reads in the source file should be aligned. Alongside this reference should sit index files " + @Argument(fullName="target_reference",shortName="target_ref",doc="The reference to which reads in the source file should be aligned. Alongside this reference should sit index files " +

View File

@ -30,9 +30,11 @@ import org.broadinstitute.sting.alignment.bwa.BWTFiles;
import org.broadinstitute.sting.alignment.bwa.c.BWACAligner; import org.broadinstitute.sting.alignment.bwa.c.BWACAligner;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.ReadWalker; import org.broadinstitute.sting.gatk.walkers.ReadWalker;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.PrintStream; import java.io.PrintStream;
@ -48,7 +50,8 @@ import java.util.TreeMap;
* @author mhanna * @author mhanna
* @version 0.1 * @version 0.1
*/ */
public class CountBestAlignmentsWalker extends ReadWalker<Integer,Integer> { @DocumentedGATKFeature( groupName = "BAM Processing and Analysis Tools", extraDocs = {CommandLineGATK.class} )
public class CountBestAlignments extends ReadWalker<Integer,Integer> {
/** /**
* The supporting BWT index generated using BWT. * The supporting BWT index generated using BWT.
*/ */

View File

@ -1,113 +0,0 @@
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.analyzecovariates;
import org.broadinstitute.sting.gatk.walkers.recalibration.RecalDatum;
import org.broadinstitute.sting.utils.collections.NestedHashMap;
import java.util.ArrayList;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Dec 1, 2009
*
* The difference between this AnalysisDataManager and the RecalDataManager used by the Recalibration walkers is that here the collapsed data tables are indexed
* by only read group and the given covariate, while in the recalibrator the collapsed tables are indexed by read group, reported quality, and the given covariate.
*/
public class AnalysisDataManager {
private NestedHashMap dataCollapsedReadGroup; // Table where everything except read group has been collapsed
private ArrayList<NestedHashMap> dataCollapsedByCovariate; // Tables where everything except read group and given covariate has been collapsed
AnalysisDataManager() {
}
AnalysisDataManager( final int numCovariates ) {
dataCollapsedReadGroup = new NestedHashMap();
dataCollapsedByCovariate = new ArrayList<NestedHashMap>();
for( int iii = 0; iii < numCovariates - 1; iii++ ) { // readGroup isn't counted here, its table is separate
dataCollapsedByCovariate.add( new NestedHashMap() );
}
}
/**
* Add the given mapping to all of the collapsed hash tables
* @param key The list of comparables that is the key for this mapping
* @param fullDatum The RecalDatum which is the data for this mapping
* @param IGNORE_QSCORES_LESS_THAN The threshold in report quality for adding to the aggregate collapsed table
*/
public final void addToAllTables( final Object[] key, final RecalDatum fullDatum, final int IGNORE_QSCORES_LESS_THAN ) {
final int qscore = Integer.parseInt( key[1].toString() );
RecalDatum collapsedDatum;
final Object[] readGroupCollapsedKey = new Object[1];
final Object[] covariateCollapsedKey = new Object[2];
if( !(qscore < IGNORE_QSCORES_LESS_THAN) ) {
// Create dataCollapsedReadGroup, the table where everything except read group has been collapsed
readGroupCollapsedKey[0] = key[0]; // Make a new key with just the read group
collapsedDatum = (RecalDatum)dataCollapsedReadGroup.get( readGroupCollapsedKey );
if( collapsedDatum == null ) {
dataCollapsedReadGroup.put( new RecalDatum(fullDatum), readGroupCollapsedKey );
} else {
collapsedDatum.combine( fullDatum ); // using combine instead of increment in order to calculate overall aggregateQReported
}
}
// Create dataCollapsedByCovariate's, the tables where everything except read group and given covariate has been collapsed
for( int iii = 0; iii < dataCollapsedByCovariate.size(); iii++ ) {
if( iii == 0 || !(qscore < IGNORE_QSCORES_LESS_THAN) ) { // use all data for the plot versus reported quality, but not for the other plots versus cycle and etc.
covariateCollapsedKey[0] = key[0]; // Make a new key with the read group ...
Object theCovariateElement = key[iii + 1]; // and the given covariate
if( theCovariateElement != null ) {
covariateCollapsedKey[1] = theCovariateElement;
collapsedDatum = (RecalDatum)dataCollapsedByCovariate.get(iii).get( covariateCollapsedKey );
if( collapsedDatum == null ) {
dataCollapsedByCovariate.get(iii).put( new RecalDatum(fullDatum), covariateCollapsedKey );
} else {
collapsedDatum.combine( fullDatum );
}
}
}
}
}
/**
* Get the appropriate collapsed table out of the set of all the tables held by this Object
* @param covariate Which covariate indexes the desired collapsed HashMap
* @return The desired collapsed HashMap
*/
public final NestedHashMap getCollapsedTable( final int covariate ) {
if( covariate == 0) {
return dataCollapsedReadGroup; // Table where everything except read group has been collapsed
} else {
return dataCollapsedByCovariate.get( covariate - 1 ); // Table where everything except read group, quality score, and given covariate has been collapsed
}
}
}

View File

@ -1,383 +0,0 @@
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.analyzecovariates;
import org.apache.commons.io.FileUtils;
import org.apache.commons.io.IOUtils;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Hidden;
import org.broadinstitute.sting.commandline.CommandLineProgram;
import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.gatk.walkers.recalibration.Covariate;
import org.broadinstitute.sting.gatk.walkers.recalibration.RecalDatum;
import org.broadinstitute.sting.gatk.walkers.recalibration.RecalibrationArgumentCollection;
import org.broadinstitute.sting.utils.R.RScriptExecutor;
import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.classloader.PluginManager;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.io.Resource;
import org.broadinstitute.sting.utils.text.XReadLines;
import java.io.*;
import java.util.ArrayList;
import java.util.Collection;
import java.util.Map;
import java.util.regex.Pattern;
/**
* Call R scripts to plot residual error versus the various covariates.
*
* <p>
* After counting covariates in either the initial BAM File or again in the recalibrated BAM File, an analysis tool is available which
* reads the .csv file and outputs several PDF (and .dat) files for each read group in the given BAM. These PDF files graphically
* show the various metrics and characteristics of the reported quality scores (often in relation to the empirical qualities).
* In order to show that any biases in the reported quality scores have been generally fixed through recalibration one should run
* CountCovariates again on a bam file produced by TableRecalibration. In this way users can compare the analysis plots generated
* by pre-recalibration and post-recalibration .csv files. Our usual chain of commands that we use to generate plots of residual
* error is: CountCovariates, TableRecalibrate, samtools index on the recalibrated bam file, CountCovariates again on the recalibrated
* bam file, and then AnalyzeCovariates on both the before and after recal_data.csv files to see the improvement in recalibration.
*
* <p>
* The color coding along with the RMSE is included in the plots to give some indication of the number of observations that went into
* each of the quality score estimates. It is defined as follows for N, the number of observations:
*
* <ul>
* <li>light blue means N < 1,000</li>
* <li>cornflower blue means 1,000 <= N < 10,000</li>
* <li>dark blue means N >= 10,000</li>
* <li>The pink dots indicate points whose quality scores are special codes used by the aligner and which are mathematically
* meaningless and so aren't included in any of the numerical calculations.</li>
* </ul>
*
* <p>
* NOTE: Rscript needs to be in your environment PATH (this is the scripting version of R, not the interactive version).
* See <a target="r-project" href="http://www.r-project.org">http://www.r-project.org</a> for more info on how to download and install R.
*
* <p>
* See the GATK wiki for a tutorial and example recalibration accuracy plots.
* <a target="gatkwiki" href="http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration"
* >http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration</a>
*
* <h2>Input</h2>
* <p>
* The recalibration table file in CSV format that was generated by the CountCovariates walker.
* </p>
*
* <h2>Examples</h2>
* <pre>
* java -Xmx4g -jar AnalyzeCovariates.jar \
* -recalFile /path/to/recal.table.csv \
* -outputDir /path/to/output_dir/ \
* -ignoreQ 5
* </pre>
*
*/
@DocumentedGATKFeature(
groupName = "AnalyzeCovariates",
summary = "Package to plot residual accuracy versus error covariates for the base quality score recalibrator")
public class AnalyzeCovariates extends CommandLineProgram {
final private static Logger logger = Logger.getLogger(AnalyzeCovariates.class);
private static final String PLOT_RESDIUAL_ERROR_QUALITY_SCORE_COVARIATE = "plot_residualError_QualityScoreCovariate.R";
private static final String PLOT_RESDIUAL_ERROR_OTHER_COVARIATE = "plot_residualError_OtherCovariate.R";
private static final String PLOT_INDEL_QUALITY_RSCRIPT = "plot_indelQuality.R";
/////////////////////////////
// Command Line Arguments
/////////////////////////////
/**
* After the header, data records occur one per line until the end of the file. The first several items on a line are the
* values of the individual covariates and will change depending on which covariates were specified at runtime. The last
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/
@Input(fullName = "recal_file", shortName = "recalFile", doc = "The input recal csv file to analyze", required = false)
private String RECAL_FILE = "output.recal_data.csv";
@Argument(fullName = "output_dir", shortName = "outputDir", doc = "The directory in which to output all the plots and intermediate data files", required = false)
private File OUTPUT_DIR = new File("analyzeCovariates");
@Argument(fullName = "ignoreQ", shortName = "ignoreQ", doc = "Ignore bases with reported quality less than this number.", required = false)
private int IGNORE_QSCORES_LESS_THAN = 5;
@Argument(fullName = "numRG", shortName = "numRG", doc = "Only process N read groups. Default value: -1 (process all read groups)", required = false)
private int NUM_READ_GROUPS_TO_PROCESS = -1; // -1 means process all read groups
/**
* Combinations of covariates in which there are zero mismatches technically have infinite quality. We get around this situation
* by capping at the specified value. We've found that Q40 is too low when using a more completely database of known variation like dbSNP build 132 or later.
*/
@Argument(fullName="max_quality_score", shortName="maxQ", required = false, doc="The integer value at which to cap the quality scores, default is 50")
private int MAX_QUALITY_SCORE = 50;
/**
* This argument is useful for comparing before/after plots and you want the axes to match each other.
*/
@Argument(fullName="max_histogram_value", shortName="maxHist", required = false, doc="If supplied, this value will be the max value of the histogram plots")
private int MAX_HISTOGRAM_VALUE = 0;
@Hidden
@Argument(fullName="do_indel_quality", shortName="indels", required = false, doc="If supplied, do indel quality plotting")
private boolean DO_INDEL_QUALITY = false;
/////////////////////////////
// Private Member Variables
/////////////////////////////
private AnalysisDataManager dataManager; // Holds the data HashMap, mostly used by TableRecalibrationWalker to create collapsed data hashmaps
private ArrayList<Covariate> requestedCovariates; // List of covariates to be used in this calculation
private final Pattern COMMENT_PATTERN = Pattern.compile("^#.*");
private final Pattern OLD_RECALIBRATOR_HEADER = Pattern.compile("^rg,.*");
private final Pattern COVARIATE_PATTERN = Pattern.compile("^ReadGroup,QualityScore,.*");
protected static final String EOF_MARKER = "EOF";
protected int execute() {
// create the output directory where all the data tables and plots will go
if (!OUTPUT_DIR.exists() && !OUTPUT_DIR.mkdirs())
throw new UserException.BadArgumentValue("--output_dir/-outDir", "Unable to create output directory: " + OUTPUT_DIR);
if (!RScriptExecutor.RSCRIPT_EXISTS)
Utils.warnUser(logger, "Rscript not found in environment path. Plots will not be generated.");
// initialize all the data from the csv file and allocate the list of covariates
logger.info("Reading in input csv file...");
initializeData();
logger.info("...Done!");
// output data tables for Rscript to read in
logger.info("Writing out intermediate tables for R...");
writeDataTables();
logger.info("...Done!");
// perform the analysis using Rscript and output the plots
logger.info("Calling analysis R scripts and writing out figures...");
callRScripts();
logger.info("...Done!");
return 0;
}
private void initializeData() {
// Get a list of all available covariates
Collection<Class<? extends Covariate>> classes = new PluginManager<Covariate>(Covariate.class).getPlugins();
int lineNumber = 0;
boolean foundAllCovariates = false;
// Read in the covariates that were used from the input file
requestedCovariates = new ArrayList<Covariate>();
try {
for ( final String line : new XReadLines(new File( RECAL_FILE )) ) {
lineNumber++;
if( COMMENT_PATTERN.matcher(line).matches() || OLD_RECALIBRATOR_HEADER.matcher(line).matches() || line.equals(EOF_MARKER) ) {
; // Skip over the comment lines, (which start with '#')
}
else if( COVARIATE_PATTERN.matcher(line).matches() ) { // The line string is either specifying a covariate or is giving csv data
if( foundAllCovariates ) {
throw new RuntimeException( "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE );
} else { // Found the covariate list in input file, loop through all of them and instantiate them
String[] vals = line.split(",");
for( int iii = 0; iii < vals.length - 3; iii++ ) { // There are n-3 covariates. The last three items are nObservations, nMismatch, and Qempirical
boolean foundClass = false;
for( Class<?> covClass : classes ) {
if( (vals[iii] + "Covariate").equalsIgnoreCase( covClass.getSimpleName() ) ) {
foundClass = true;
try {
Covariate covariate = (Covariate)covClass.newInstance();
requestedCovariates.add( covariate );
} catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e);
}
}
}
if( !foundClass ) {
throw new RuntimeException( "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option." );
}
}
}
} else { // Found a line of data
if( !foundAllCovariates ) {
foundAllCovariates = true;
// At this point all the covariates should have been found and initialized
if( requestedCovariates.size() < 2 ) {
throw new RuntimeException( "Malformed input recalibration file. Covariate names can't be found in file: " + RECAL_FILE );
}
// Initialize any covariate member variables using the shared argument collection
for( Covariate cov : requestedCovariates ) {
cov.initialize( new RecalibrationArgumentCollection() );
}
// Initialize the data hashMaps
dataManager = new AnalysisDataManager( requestedCovariates.size() );
}
addCSVData(line); // Parse the line and add the data to the HashMap
}
}
} catch ( FileNotFoundException e ) {
throw new RuntimeException("Can not find input file: " + RECAL_FILE);
} catch ( NumberFormatException e ) {
throw new RuntimeException("Error parsing recalibration data at line " + lineNumber + ". Perhaps your table was generated by an older version of CovariateCounterWalker.");
}
}
private void addCSVData(String line) {
String[] vals = line.split(",");
// Check if the data line is malformed, for example if the read group string contains a comma then it won't be parsed correctly
if( vals.length != requestedCovariates.size() + 3 ) { // +3 because of nObservations, nMismatch, and Qempirical
throw new RuntimeException("Malformed input recalibration file. Found data line with too many fields: " + line +
" --Perhaps the read group string contains a comma and isn't being parsed correctly.");
}
Object[] key = new Object[requestedCovariates.size()];
Covariate cov;
int iii;
for( iii = 0; iii < requestedCovariates.size(); iii++ ) {
cov = requestedCovariates.get( iii );
key[iii] = cov.getValue( vals[iii] );
}
// Create a new datum using the number of observations, number of mismatches, and reported quality score
final RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 );
// Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, IGNORE_QSCORES_LESS_THAN );
}
private void writeDataTables() {
int numReadGroups = 0;
// for each read group
for( final Object readGroupKey : dataManager.getCollapsedTable(0).data.keySet() ) {
if( NUM_READ_GROUPS_TO_PROCESS == -1 || ++numReadGroups <= NUM_READ_GROUPS_TO_PROCESS ) {
final String readGroup = readGroupKey.toString();
final RecalDatum readGroupDatum = (RecalDatum) dataManager.getCollapsedTable(0).data.get(readGroupKey);
logger.info(String.format(
"Writing out data tables for read group: %s\twith %s observations\tand aggregate residual error = %.3f",
readGroup, readGroupDatum.getNumObservations(),
readGroupDatum.empiricalQualDouble(0, MAX_QUALITY_SCORE) - readGroupDatum.getEstimatedQReported()));
// for each covariate
for( int iii = 1; iii < requestedCovariates.size(); iii++ ) {
Covariate cov = requestedCovariates.get(iii);
// Create a PrintStream
File outputFile = new File(OUTPUT_DIR, readGroup + "." + cov.getClass().getSimpleName()+ ".dat");
PrintStream output;
try {
output = new PrintStream(FileUtils.openOutputStream(outputFile));
} catch (IOException e) {
throw new UserException.CouldNotCreateOutputFile(outputFile, e);
}
try {
// Output the header
output.println("Covariate\tQreported\tQempirical\tnMismatches\tnBases");
for( final Object covariateKey : ((Map)dataManager.getCollapsedTable(iii).data.get(readGroupKey)).keySet() ) {
output.print( covariateKey.toString() + "\t" ); // Covariate
final RecalDatum thisDatum = (RecalDatum)((Map)dataManager.getCollapsedTable(iii).data.get(readGroupKey)).get(covariateKey);
output.print( String.format("%.3f", thisDatum.getEstimatedQReported()) + "\t" ); // Qreported
output.print( String.format("%.3f", thisDatum.empiricalQualDouble(0, MAX_QUALITY_SCORE)) + "\t" ); // Qempirical
output.print( thisDatum.getNumMismatches() + "\t" ); // nMismatches
output.println( thisDatum.getNumObservations() ); // nBases
}
} finally {
// Close the PrintStream
IOUtils.closeQuietly(output);
}
}
} else {
break;
}
}
}
private void callRScripts() {
int numReadGroups = 0;
// for each read group
for( Object readGroupKey : dataManager.getCollapsedTable(0).data.keySet() ) {
if(++numReadGroups <= NUM_READ_GROUPS_TO_PROCESS || NUM_READ_GROUPS_TO_PROCESS == -1) {
String readGroup = readGroupKey.toString();
logger.info("Analyzing read group: " + readGroup);
// for each covariate
for( int iii = 1; iii < requestedCovariates.size(); iii++ ) {
final Covariate cov = requestedCovariates.get(iii);
final File outputFile = new File(OUTPUT_DIR, readGroup + "." + cov.getClass().getSimpleName()+ ".dat");
if (DO_INDEL_QUALITY) {
RScriptExecutor executor = new RScriptExecutor();
executor.addScript(new Resource(PLOT_INDEL_QUALITY_RSCRIPT, AnalyzeCovariates.class));
// The second argument is the name of the covariate in order to make the plots look nice
executor.addArgs(outputFile, cov.getClass().getSimpleName().split("Covariate")[0]);
executor.exec();
} else {
if( iii == 1 ) {
// Analyze reported quality
RScriptExecutor executor = new RScriptExecutor();
executor.addScript(new Resource(PLOT_RESDIUAL_ERROR_QUALITY_SCORE_COVARIATE, AnalyzeCovariates.class));
// The second argument is the Q scores that should be turned pink in the plot because they were ignored
executor.addArgs(outputFile, IGNORE_QSCORES_LESS_THAN, MAX_QUALITY_SCORE, MAX_HISTOGRAM_VALUE);
executor.exec();
} else { // Analyze all other covariates
RScriptExecutor executor = new RScriptExecutor();
executor.addScript(new Resource(PLOT_RESDIUAL_ERROR_OTHER_COVARIATE, AnalyzeCovariates.class));
// The second argument is the name of the covariate in order to make the plots look nice
executor.addArgs(outputFile, cov.getClass().getSimpleName().split("Covariate")[0]);
executor.exec();
}
}
}
} else { // at the maximum number of read groups so break out
break;
}
}
}
public static void main(String args[]) {
try {
AnalyzeCovariates clp = new AnalyzeCovariates();
start(clp, args);
System.exit(CommandLineProgram.result);
} catch (Exception e) {
exitSystemWithError(e);
}
}
}

View File

@ -1,4 +0,0 @@
/**
* Package to plot residual accuracy versus error covariates for the base quality score recalibrator.
*/
package org.broadinstitute.sting.analyzecovariates;

View File

@ -287,8 +287,8 @@ public abstract class CommandLineProgram {
* a function used to indicate an error occurred in the command line tool * a function used to indicate an error occurred in the command line tool
*/ */
private static void printDocumentationReference() { private static void printDocumentationReference() {
errorPrintf("Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki%n"); errorPrintf("Visit our website and forum for extensive documentation and answers to %n");
errorPrintf("Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa%n"); errorPrintf("commonly asked questions http://www.broadinstitute.org/gatk%n");
} }
@ -369,9 +369,9 @@ public abstract class CommandLineProgram {
System.exit(1); System.exit(1);
} }
public static void exitSystemWithSamError(final Exception e) { public static void exitSystemWithSamError(final Throwable t) {
if ( e.getMessage() == null ) if ( t.getMessage() == null )
throw new ReviewedStingException("SamException found with no message!", e); throw new ReviewedStingException("SamException found with no message!", t);
errorPrintf("------------------------------------------------------------------------------------------%n"); errorPrintf("------------------------------------------------------------------------------------------%n");
errorPrintf("A BAM ERROR has occurred (version %s): %n", CommandLineGATK.getVersionNumber()); errorPrintf("A BAM ERROR has occurred (version %s): %n", CommandLineGATK.getVersionNumber());
@ -383,7 +383,7 @@ public abstract class CommandLineProgram {
errorPrintf("Also, please ensure that your BAM index is not corrupted: delete the current one and regenerate it with 'samtools index'%n"); errorPrintf("Also, please ensure that your BAM index is not corrupted: delete the current one and regenerate it with 'samtools index'%n");
printDocumentationReference(); printDocumentationReference();
errorPrintf("%n"); errorPrintf("%n");
errorPrintf("MESSAGE: %s%n", e.getMessage().trim()); errorPrintf("MESSAGE: %s%n", t.getMessage().trim());
errorPrintf("------------------------------------------------------------------------------------------%n"); errorPrintf("------------------------------------------------------------------------------------------%n");
System.exit(1); System.exit(1);
} }

View File

@ -130,8 +130,8 @@ public abstract class CommandLineExecutable extends CommandLineProgram {
getArgumentCollection().phoneHomeType == GATKRunReport.PhoneHomeOption.STDOUT ) { getArgumentCollection().phoneHomeType == GATKRunReport.PhoneHomeOption.STDOUT ) {
if ( getArgumentCollection().gatkKeyFile == null ) { if ( getArgumentCollection().gatkKeyFile == null ) {
throw new UserException("Running with the -et NO_ET or -et STDOUT option requires a GATK Key file. " + throw new UserException("Running with the -et NO_ET or -et STDOUT option requires a GATK Key file. " +
"Please see http://www.broadinstitute.org/gsa/wiki/index.php/Phone_home " + "Please see " + GATKRunReport.PHONE_HOME_DOCS_URL +
"for more information and instructions on how to obtain a key."); " for more information and instructions on how to obtain a key.");
} }
else { else {
PublicKey gatkPublicKey = CryptUtils.loadGATKDistributedPublicKey(); PublicKey gatkPublicKey = CryptUtils.loadGATKDistributedPublicKey();

View File

@ -36,22 +36,23 @@ import org.broadinstitute.sting.gatk.refdata.tracks.FeatureManager;
import org.broadinstitute.sting.gatk.walkers.Attribution; import org.broadinstitute.sting.gatk.walkers.Attribution;
import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.help.*; import org.broadinstitute.sting.utils.help.ApplicationDetails;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.help.GATKDocUtils;
import org.broadinstitute.sting.utils.text.TextFormattingUtils; import org.broadinstitute.sting.utils.text.TextFormattingUtils;
import java.util.*; import java.util.*;
/** /**
* All command line parameters accepted by all tools in the GATK.
*
* The GATK engine itself. Manages map/reduce data access and runs walkers. * The GATK engine itself. Manages map/reduce data access and runs walkers.
* *
* We run command line GATK programs using this class. It gets the command line args, parses them, and hands the * We run command line GATK programs using this class. It gets the command line args, parses them, and hands the
* gatk all the parsed out information. Pretty much anything dealing with the underlying system should go here, * gatk all the parsed out information. Pretty much anything dealing with the underlying system should go here,
* the gatk engine should deal with any data related information. * the gatk engine should deal with any data related information.
*/ */
@DocumentedGATKFeature( @DocumentedGATKFeature(groupName = "GATK Engine")
groupName = "GATK Engine",
summary = "Features and arguments for the GATK engine itself, available to all walkers.",
extraDocs = { UserException.class })
public class CommandLineGATK extends CommandLineExecutable { public class CommandLineGATK extends CommandLineExecutable {
@Argument(fullName = "analysis_type", shortName = "T", doc = "Type of analysis to run") @Argument(fullName = "analysis_type", shortName = "T", doc = "Type of analysis to run")
private String analysisName = null; private String analysisName = null;
@ -101,20 +102,41 @@ public class CommandLineGATK extends CommandLineExecutable {
// TODO: Should Picard exceptions be, in general, UserExceptions or ReviewedStingExceptions? // TODO: Should Picard exceptions be, in general, UserExceptions or ReviewedStingExceptions?
exitSystemWithError(e); exitSystemWithError(e);
} catch (SAMException e) { } catch (SAMException e) {
checkForTooManyOpenFilesProblem(e.getMessage()); checkForMaskedUserErrors(e);
exitSystemWithSamError(e); exitSystemWithSamError(e);
} catch (OutOfMemoryError e) { } catch (OutOfMemoryError e) {
exitSystemWithUserError(new UserException.NotEnoughMemory()); exitSystemWithUserError(new UserException.NotEnoughMemory());
} catch (Throwable t) { } catch (Throwable t) {
checkForTooManyOpenFilesProblem(t.getMessage()); checkForMaskedUserErrors(t);
exitSystemWithError(t); exitSystemWithError(t);
} }
} }
private static void checkForTooManyOpenFilesProblem(String message) { protected static final String PICARD_TEXT_SAM_FILE_ERROR_1 = "Cannot use index file with textual SAM file";
// Special case the "Too many open files" error because it's a common User Error for which we know what to do protected static final String PICARD_TEXT_SAM_FILE_ERROR_2 = "Cannot retrieve file pointers within SAM text files";
if ( message != null && message.indexOf("Too many open files") != -1 ) private static void checkForMaskedUserErrors(final Throwable t) {
final String message = t.getMessage();
if ( message == null )
return;
// we know what to do about the common "Too many open files" error
if ( message.indexOf("Too many open files") != -1 )
exitSystemWithUserError(new UserException.TooManyOpenFiles()); exitSystemWithUserError(new UserException.TooManyOpenFiles());
// malformed BAM looks like a SAM file
if ( message.indexOf(PICARD_TEXT_SAM_FILE_ERROR_1) != -1 ||
message.indexOf(PICARD_TEXT_SAM_FILE_ERROR_2) != -1 )
exitSystemWithSamError(t);
// can't close tribble index when writing
if ( message.indexOf("Unable to close index for") != -1 )
exitSystemWithUserError(new UserException(t.getCause() == null ? message : t.getCause().getMessage()));
// disk is full
if ( message.indexOf("No space left on device") != -1 )
exitSystemWithUserError(new UserException(t.getMessage()));
if ( t.getCause() != null && t.getCause().getMessage().indexOf("No space left on device") != -1 )
exitSystemWithUserError(new UserException(t.getCause().getMessage()));
} }
/** /**
@ -126,8 +148,7 @@ public class CommandLineGATK extends CommandLineExecutable {
List<String> header = new ArrayList<String>(); List<String> header = new ArrayList<String>();
header.add(String.format("The Genome Analysis Toolkit (GATK) v%s, Compiled %s",getVersionNumber(), getBuildTime())); header.add(String.format("The Genome Analysis Toolkit (GATK) v%s, Compiled %s",getVersionNumber(), getBuildTime()));
header.add("Copyright (c) 2010 The Broad Institute"); header.add("Copyright (c) 2010 The Broad Institute");
header.add("Please view our documentation at http://www.broadinstitute.org/gsa/wiki"); header.add("For support and documentation go to http://www.broadinstitute.org/gatk");
header.add("For support, please view our support site at http://getsatisfaction.com/gsa");
return header; return header;
} }

View File

@ -51,6 +51,7 @@ import org.broadinstitute.sting.gatk.samples.SampleDBBuilder;
import org.broadinstitute.sting.gatk.walkers.*; import org.broadinstitute.sting.gatk.walkers.*;
import org.broadinstitute.sting.utils.*; import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.classloader.GATKLiteUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFCodec; import org.broadinstitute.sting.utils.codecs.vcf.VCFCodec;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeader; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeader;
import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.collections.Pair;
@ -197,7 +198,16 @@ public class GenomeAnalysisEngine {
private BaseRecalibration baseRecalibration = null; private BaseRecalibration baseRecalibration = null;
public BaseRecalibration getBaseRecalibration() { return baseRecalibration; } public BaseRecalibration getBaseRecalibration() { return baseRecalibration; }
public boolean hasBaseRecalibration() { return baseRecalibration != null; } public boolean hasBaseRecalibration() { return baseRecalibration != null; }
public void setBaseRecalibration(final File recalFile, final int quantizationLevels, final boolean noIndelQuals) { baseRecalibration = new BaseRecalibration(recalFile, quantizationLevels, noIndelQuals); } public void setBaseRecalibration(final File recalFile, final int quantizationLevels, final boolean disableIndelQuals, final int preserveQLessThan, final boolean emitOriginalQuals) {
baseRecalibration = new BaseRecalibration(recalFile, quantizationLevels, disableIndelQuals, preserveQLessThan, emitOriginalQuals);
}
/**
* Utility method to determine whether this is the lite version of the GATK
*/
public boolean isGATKLite() {
return GATKLiteUtils.isGATKLite();
}
/** /**
* Actually run the GATK with the specified walker. * Actually run the GATK with the specified walker.
@ -209,8 +219,10 @@ public class GenomeAnalysisEngine {
//monitor.start(); //monitor.start();
setStartTime(new java.util.Date()); setStartTime(new java.util.Date());
final GATKArgumentCollection args = this.getArguments();
// validate our parameters // validate our parameters
if (this.getArguments() == null) { if (args == null) {
throw new ReviewedStingException("The GATKArgumentCollection passed to GenomeAnalysisEngine can not be null."); throw new ReviewedStingException("The GATKArgumentCollection passed to GenomeAnalysisEngine can not be null.");
} }
@ -218,16 +230,16 @@ public class GenomeAnalysisEngine {
if (this.walker == null) if (this.walker == null)
throw new ReviewedStingException("The walker passed to GenomeAnalysisEngine can not be null."); throw new ReviewedStingException("The walker passed to GenomeAnalysisEngine can not be null.");
if (this.getArguments().nonDeterministicRandomSeed) if (args.nonDeterministicRandomSeed)
resetRandomGenerator(System.currentTimeMillis()); resetRandomGenerator(System.currentTimeMillis());
// TODO -- REMOVE ME WHEN WE STOP BCF testing // TODO -- REMOVE ME WHEN WE STOP BCF testing
if ( this.getArguments().USE_SLOW_GENOTYPES ) if ( args.USE_SLOW_GENOTYPES )
GenotypeBuilder.MAKE_FAST_BY_DEFAULT = false; GenotypeBuilder.MAKE_FAST_BY_DEFAULT = false;
// if the use specified an input BQSR recalibration table then enable on the fly recalibration // if the use specified an input BQSR recalibration table then enable on the fly recalibration
if (this.getArguments().BQSR_RECAL_FILE != null) if (args.BQSR_RECAL_FILE != null)
setBaseRecalibration(this.getArguments().BQSR_RECAL_FILE, this.getArguments().quantizationLevels, this.getArguments().noIndelQuals); setBaseRecalibration(args.BQSR_RECAL_FILE, args.quantizationLevels, args.disableIndelQuals, args.PRESERVE_QSCORES_LESS_THAN, args.emitOriginalQuals);
// Determine how the threads should be divided between CPU vs. IO. // Determine how the threads should be divided between CPU vs. IO.
determineThreadAllocation(); determineThreadAllocation();
@ -262,6 +274,38 @@ public class GenomeAnalysisEngine {
//return result; //return result;
} }
// TODO -- Let's move this to a utility class in unstable - but which one?
// **************************************************************************************
// * Handle Deprecated Walkers *
// **************************************************************************************
// Mapping from walker name to major version number where the walker first disappeared
private static Map<String, String> deprecatedGATKWalkers = new HashMap<String, String>();
static {
deprecatedGATKWalkers.put("CountCovariates", "2.0");
deprecatedGATKWalkers.put("TableRecalibration", "2.0");
}
/**
* Utility method to check whether a given walker has been deprecated in a previous GATK release
*
* @param walkerName the walker class name (not the full package) to check
*/
public static boolean isDeprecatedWalker(final String walkerName) {
return deprecatedGATKWalkers.containsKey(walkerName);
}
/**
* Utility method to check whether a given walker has been deprecated in a previous GATK release
*
* @param walkerName the walker class name (not the full package) to check
*/
public static String getDeprecatedMajorVersionNumber(final String walkerName) {
return deprecatedGATKWalkers.get(walkerName);
}
// **************************************************************************************
/** /**
* Retrieves an instance of the walker based on the walker name. * Retrieves an instance of the walker based on the walker name.
* *
@ -269,7 +313,17 @@ public class GenomeAnalysisEngine {
* @return An instance of the walker. * @return An instance of the walker.
*/ */
public Walker<?, ?> getWalkerByName(String walkerName) { public Walker<?, ?> getWalkerByName(String walkerName) {
return walkerManager.createByName(walkerName); try {
return walkerManager.createByName(walkerName);
} catch ( UserException e ) {
if ( isGATKLite() && GATKLiteUtils.isAvailableOnlyInFullGATK(walkerName) ) {
e = new UserException.NotSupportedInGATKLite("the " + walkerName + " walker is available only in the full version of the GATK");
}
else if ( isDeprecatedWalker(walkerName) ) {
e = new UserException.DeprecatedWalker(walkerName, getDeprecatedMajorVersionNumber(walkerName));
}
throw e;
}
} }
/** /**
@ -743,6 +797,14 @@ public class GenomeAnalysisEngine {
if ( getWalkerBAQApplicationTime() == BAQ.ApplicationTime.FORBIDDEN && argCollection.BAQMode != BAQ.CalculationMode.OFF) if ( getWalkerBAQApplicationTime() == BAQ.ApplicationTime.FORBIDDEN && argCollection.BAQMode != BAQ.CalculationMode.OFF)
throw new UserException.BadArgumentValue("baq", "Walker cannot accept BAQ'd base qualities, and yet BAQ mode " + argCollection.BAQMode + " was requested."); throw new UserException.BadArgumentValue("baq", "Walker cannot accept BAQ'd base qualities, and yet BAQ mode " + argCollection.BAQMode + " was requested.");
if (argCollection.removeProgramRecords && argCollection.keepProgramRecords)
throw new UserException.BadArgumentValue("rpr / kpr", "Cannot enable both options");
boolean removeProgramRecords = argCollection.removeProgramRecords || walker.getClass().isAnnotationPresent(RemoveProgramRecords.class);
if (argCollection.keepProgramRecords)
removeProgramRecords = false;
return new SAMDataSource( return new SAMDataSource(
samReaderIDs, samReaderIDs,
threadAllocation, threadAllocation,
@ -759,7 +821,8 @@ public class GenomeAnalysisEngine {
getWalkerBAQQualityMode(), getWalkerBAQQualityMode(),
refReader, refReader,
getBaseRecalibration(), getBaseRecalibration(),
argCollection.defaultBaseQualities); argCollection.defaultBaseQualities,
removeProgramRecords);
} }
/** /**

View File

@ -49,7 +49,7 @@ public class WalkerManager extends PluginManager<Walker> {
private ResourceBundle helpText; private ResourceBundle helpText;
public WalkerManager() { public WalkerManager() {
super(Walker.class,"walker","Walker"); super(Walker.class,"walker","");
helpText = TextFormattingUtils.loadResourceBundle("StingText"); helpText = TextFormattingUtils.loadResourceBundle("StingText");
} }

View File

@ -35,6 +35,7 @@ import org.broadinstitute.sting.gatk.DownsampleType;
import org.broadinstitute.sting.gatk.DownsamplingMethod; import org.broadinstitute.sting.gatk.DownsamplingMethod;
import org.broadinstitute.sting.gatk.phonehome.GATKRunReport; import org.broadinstitute.sting.gatk.phonehome.GATKRunReport;
import org.broadinstitute.sting.gatk.samples.PedigreeValidationType; import org.broadinstitute.sting.gatk.samples.PedigreeValidationType;
import org.broadinstitute.sting.utils.QualityUtils;
import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.interval.IntervalMergingRule; import org.broadinstitute.sting.utils.interval.IntervalMergingRule;
import org.broadinstitute.sting.utils.interval.IntervalSetRule; import org.broadinstitute.sting.utils.interval.IntervalSetRule;
@ -65,10 +66,10 @@ public class GATKArgumentCollection {
@Argument(fullName = "read_buffer_size", shortName = "rbs", doc="Number of reads per SAM file to buffer in memory", required = false) @Argument(fullName = "read_buffer_size", shortName = "rbs", doc="Number of reads per SAM file to buffer in memory", required = false)
public Integer readBufferSize = null; public Integer readBufferSize = null;
@Argument(fullName = "phone_home", shortName = "et", doc="What kind of GATK run report should we generate? STANDARD is the default, can be NO_ET so nothing is posted to the run repository. Please see http://www.broadinstitute.org/gsa/wiki/index.php/Phone_home for details.", required = false) @Argument(fullName = "phone_home", shortName = "et", doc="What kind of GATK run report should we generate? STANDARD is the default, can be NO_ET so nothing is posted to the run repository. Please see " + GATKRunReport.PHONE_HOME_DOCS_URL + " for details.", required = false)
public GATKRunReport.PhoneHomeOption phoneHomeType = GATKRunReport.PhoneHomeOption.STANDARD; public GATKRunReport.PhoneHomeOption phoneHomeType = GATKRunReport.PhoneHomeOption.STANDARD;
@Argument(fullName = "gatk_key", shortName = "K", doc="GATK Key file. Required if running with -et NO_ET. Please see http://www.broadinstitute.org/gsa/wiki/index.php/Phone_home for details.", required = false) @Argument(fullName = "gatk_key", shortName = "K", doc="GATK Key file. Required if running with -et NO_ET. Please see " + GATKRunReport.PHONE_HOME_DOCS_URL + " for details.", required = false)
public File gatkKeyFile = null; public File gatkKeyFile = null;
@Argument(fullName = "read_filter", shortName = "rf", doc = "Specify filtration criteria to apply to each read individually", required = false) @Argument(fullName = "read_filter", shortName = "rf", doc = "Specify filtration criteria to apply to each read individually", required = false)
@ -190,37 +191,70 @@ public class GATKArgumentCollection {
@Argument(fullName="useOriginalQualities", shortName = "OQ", doc = "If set, use the original base quality scores from the OQ tag when present instead of the standard scores", required=false) @Argument(fullName="useOriginalQualities", shortName = "OQ", doc = "If set, use the original base quality scores from the OQ tag when present instead of the standard scores", required=false)
public Boolean useOriginalBaseQualities = false; public Boolean useOriginalBaseQualities = false;
// --------------------------------------------------------------------------------------------------------------
//
// BQSR arguments
//
// --------------------------------------------------------------------------------------------------------------
/** /**
* After the header, data records occur one per line until the end of the file. The first several items on a line are the * Enables on-the-fly recalibrate of base qualities. The covariates tables are produced by the BaseQualityScoreRecalibrator tool.
* values of the individual covariates and will change depending on which covariates were specified at runtime. The last * Please be aware that one should only run recalibration with the covariates file created on the same input bam(s).
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/ */
@Input(fullName="BQSR", shortName="BQSR", required=false, doc="Filename for the input covariates table recalibration .csv file which enables on the fly base quality score recalibration") @Input(fullName="BQSR", shortName="BQSR", required=false, doc="The input covariates table file which enables on-the-fly base quality score recalibration")
public File BQSR_RECAL_FILE = null; // BUGBUG: need a better argument name once we decide how BQSRs v1 and v2 will live in the code base simultaneously public File BQSR_RECAL_FILE = null;
/** /**
* Turns on the base quantization module. It requires a recalibration report (-BQSR). * Turns on the base quantization module. It requires a recalibration report (-BQSR).
* *
* A value of 0 here means "do not quantize". * A value of 0 here means "do not quantize".
* Any value greater than zero will be used to recalculate the quantization using this many levels. * Any value greater than zero will be used to recalculate the quantization using that many levels.
* Negative values do nothing (i.e. quantize using the recalibration report's quantization level -- same as not providing this parameter at all) * Negative values mean that we should quantize using the recalibration report's quantization level.
*/ */
@Argument(fullName="quantize_quals", shortName = "qq", doc = "Quantize quality scores to a given number of levels.", required=false) @Hidden
public int quantizationLevels = -1; @Argument(fullName="quantize_quals", shortName = "qq", doc = "Quantize quality scores to a given number of levels (with -BQSR)", required=false)
public int quantizationLevels = 0;
/** /**
* Turns off printing of the base insertion and base deletion tags when using the -BQSR argument. Only the base substitution qualities will be produced. * Turns off printing of the base insertion and base deletion tags when using the -BQSR argument and only the base substitution qualities will be produced.
*/ */
@Argument(fullName="no_indel_quals", shortName = "NIQ", doc = "If true, inhibits printing of base insertion and base deletion tags.", required=false) @Argument(fullName="disable_indel_quals", shortName = "DIQ", doc = "If true, disables printing of base insertion and base deletion tags (with -BQSR)", required=false)
public boolean noIndelQuals = false; public boolean disableIndelQuals = false;
/**
* By default, the OQ tag in not emitted when using the -BQSR argument.
*/
@Argument(fullName="emit_original_quals", shortName = "EOQ", doc = "If true, enables printing of the OQ tag with the original base qualities (with -BQSR)", required=false)
public boolean emitOriginalQuals = false;
/**
* Do not modify quality scores less than this value but rather just write them out unmodified in the recalibrated BAM file.
* In general it's unsafe to change qualities scores below < 6, since base callers use these values to indicate random or bad bases.
* For example, Illumina writes Q2 bases when the machine has really gone wrong. This would be fine in and of itself,
* but when you select a subset of these reads based on their ability to align to the reference and their dinucleotide effect,
* your Q2 bin can be elevated to Q8 or Q10, leading to issues downstream.
*/
@Argument(fullName = "preserve_qscores_less_than", shortName = "preserveQ", doc = "Bases with quality scores less than this threshold won't be recalibrated (with -BQSR)", required = false)
public int PRESERVE_QSCORES_LESS_THAN = QualityUtils.MIN_USABLE_Q_SCORE;
@Argument(fullName="defaultBaseQualities", shortName = "DBQ", doc = "If reads are missing some or all base quality scores, this value will be used for all base quality scores", required=false) @Argument(fullName="defaultBaseQualities", shortName = "DBQ", doc = "If reads are missing some or all base quality scores, this value will be used for all base quality scores", required=false)
public byte defaultBaseQualities = -1; public byte defaultBaseQualities = -1;
// --------------------------------------------------------------------------------------------------------------
//
// Other utility arguments
//
// --------------------------------------------------------------------------------------------------------------
@Argument(fullName = "validation_strictness", shortName = "S", doc = "How strict should we be with validation", required = false) @Argument(fullName = "validation_strictness", shortName = "S", doc = "How strict should we be with validation", required = false)
public SAMFileReader.ValidationStringency strictnessLevel = SAMFileReader.ValidationStringency.SILENT; public SAMFileReader.ValidationStringency strictnessLevel = SAMFileReader.ValidationStringency.SILENT;
@Argument(fullName = "remove_program_records", shortName = "rpr", doc = "Should we override the Walker's default and remove program records from the SAM header", required = false)
public boolean removeProgramRecords = false;
@Argument(fullName = "keep_program_records", shortName = "kpr", doc = "Should we override the Walker's default and keep program records from the SAM header", required = false)
public boolean keepProgramRecords = false;
@Argument(fullName = "unsafe", shortName = "U", doc = "If set, enables unsafe operations: nothing will be checked at runtime. For expert users only who know what they are doing. We do not support usage of this argument.", required = false) @Argument(fullName = "unsafe", shortName = "U", doc = "If set, enables unsafe operations: nothing will be checked at runtime. For expert users only who know what they are doing. We do not support usage of this argument.", required = false)
public ValidationExclusion.TYPE unsafe; public ValidationExclusion.TYPE unsafe;

View File

@ -24,6 +24,7 @@
package org.broadinstitute.sting.gatk.datasources.reads; package org.broadinstitute.sting.gatk.datasources.reads;
import net.sf.samtools.*; import net.sf.samtools.*;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
@ -300,7 +301,7 @@ public class GATKBAMIndex {
fileChannel = fileStream.getChannel(); fileChannel = fileStream.getChannel();
} }
catch (IOException exc) { catch (IOException exc) {
throw new ReviewedStingException("Unable to open index file " + mFile, exc); throw new ReviewedStingException("Unable to open index file (" + exc.getMessage() +")" + mFile, exc);
} }
} }

View File

@ -89,6 +89,11 @@ public class SAMDataSource {
*/ */
private final SAMFileReader.ValidationStringency validationStringency; private final SAMFileReader.ValidationStringency validationStringency;
/**
* Do we want to remove the program records from this data source?
*/
private final boolean removeProgramRecords;
/** /**
* Store BAM indices for each reader present. * Store BAM indices for each reader present.
*/ */
@ -200,7 +205,8 @@ public class SAMDataSource {
BAQ.QualityMode.DONT_MODIFY, BAQ.QualityMode.DONT_MODIFY,
null, // no BAQ null, // no BAQ
null, // no BQSR null, // no BQSR
(byte) -1); (byte) -1,
false);
} }
/** /**
@ -233,7 +239,8 @@ public class SAMDataSource {
BAQ.QualityMode qmode, BAQ.QualityMode qmode,
IndexedFastaSequenceFile refReader, IndexedFastaSequenceFile refReader,
BaseRecalibration bqsrApplier, BaseRecalibration bqsrApplier,
byte defaultBaseQualities) { byte defaultBaseQualities,
boolean removeProgramRecords) {
this.readMetrics = new ReadMetrics(); this.readMetrics = new ReadMetrics();
this.genomeLocParser = genomeLocParser; this.genomeLocParser = genomeLocParser;
@ -249,6 +256,7 @@ public class SAMDataSource {
dispatcher = null; dispatcher = null;
validationStringency = strictness; validationStringency = strictness;
this.removeProgramRecords = removeProgramRecords;
if(readBufferSize != null) if(readBufferSize != null)
ReadShard.setReadBufferSize(readBufferSize); ReadShard.setReadBufferSize(readBufferSize);
else { else {
@ -748,7 +756,7 @@ public class SAMDataSource {
private synchronized void createNewResource() { private synchronized void createNewResource() {
if(allResources.size() > maxEntries) if(allResources.size() > maxEntries)
throw new ReviewedStingException("Cannot create a new resource pool. All resources are in use."); throw new ReviewedStingException("Cannot create a new resource pool. All resources are in use.");
SAMReaders readers = new SAMReaders(readerIDs, validationStringency); SAMReaders readers = new SAMReaders(readerIDs, validationStringency, removeProgramRecords);
allResources.add(readers); allResources.add(readers);
availableResources.add(readers); availableResources.add(readers);
} }
@ -777,9 +785,11 @@ public class SAMDataSource {
/** /**
* Derive a new set of readers from the Reads metadata. * Derive a new set of readers from the Reads metadata.
* @param readerIDs reads to load. * @param readerIDs reads to load.
* TODO: validationStringency is not used here
* @param validationStringency validation stringency. * @param validationStringency validation stringency.
* @param removeProgramRecords indicate whether to clear program records from the readers
*/ */
public SAMReaders(Collection<SAMReaderID> readerIDs, SAMFileReader.ValidationStringency validationStringency) { public SAMReaders(Collection<SAMReaderID> readerIDs, SAMFileReader.ValidationStringency validationStringency, boolean removeProgramRecords) {
final int totalNumberOfFiles = readerIDs.size(); final int totalNumberOfFiles = readerIDs.size();
int readerNumber = 1; int readerNumber = 1;
final SimpleTimer timer = new SimpleTimer().start(); final SimpleTimer timer = new SimpleTimer().start();
@ -790,6 +800,9 @@ public class SAMDataSource {
long lastTick = timer.currentTime(); long lastTick = timer.currentTime();
for(final SAMReaderID readerID: readerIDs) { for(final SAMReaderID readerID: readerIDs) {
final ReaderInitializer init = new ReaderInitializer(readerID).call(); final ReaderInitializer init = new ReaderInitializer(readerID).call();
if (removeProgramRecords) {
init.reader.getFileHeader().setProgramRecords(new ArrayList<SAMProgramRecord>());
}
if (threadAllocation.getNumIOThreads() > 0) { if (threadAllocation.getNumIOThreads() > 0) {
inputStreams.put(init.readerID, init.blockInputStream); // get from initializer inputStreams.put(init.readerID, init.blockInputStream); // get from initializer
} }

View File

@ -3,10 +3,12 @@ package org.broadinstitute.sting.gatk.examples;
import net.sf.samtools.SAMReadGroupRecord; import net.sf.samtools.SAMReadGroupRecord;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.LocusWalker; import org.broadinstitute.sting.gatk.walkers.LocusWalker;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
@ -17,8 +19,9 @@ import java.util.List;
import java.util.Map; import java.util.Map;
/** /**
* Computes the coverage per sample. * Computes the coverage per sample for every position (use with -L argument!).
*/ */
@DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
public class CoverageBySample extends LocusWalker<Integer, Integer> { public class CoverageBySample extends LocusWalker<Integer, Integer> {
@Output @Output
protected PrintStream out; protected PrintStream out;

View File

@ -27,6 +27,7 @@ package org.broadinstitute.sting.gatk.examples;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
@ -35,6 +36,7 @@ import org.broadinstitute.sting.gatk.walkers.TreeReducible;
import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine; import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine;
import org.broadinstitute.sting.gatk.walkers.genotyper.DiploidGenotype; import org.broadinstitute.sting.gatk.walkers.genotyper.DiploidGenotype;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import java.io.PrintStream; import java.io.PrintStream;
@ -46,6 +48,7 @@ import java.io.PrintStream;
* *
* @author aaron * @author aaron
*/ */
@DocumentedGATKFeature( groupName = "Variant Discovery Tools", extraDocs = {CommandLineGATK.class} )
public class GATKPaperGenotyper extends LocusWalker<Integer,Long> implements TreeReducible<Long> { public class GATKPaperGenotyper extends LocusWalker<Integer,Long> implements TreeReducible<Long> {
// the possible diploid genotype strings // the possible diploid genotype strings
private static enum GENOTYPE { AA, AC, AG, AT, CC, CG, CT, GG, GT, TT } private static enum GENOTYPE { AA, AC, AG, AT, CC, CG, CT, GG, GT, TT }

View File

@ -11,7 +11,6 @@ import org.broadinstitute.sting.gatk.io.ThreadLocalOutputTracker;
import org.broadinstitute.sting.gatk.walkers.TreeReducible; import org.broadinstitute.sting.gatk.walkers.TreeReducible;
import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.StingException;
import org.broadinstitute.sting.utils.threading.ThreadPoolMonitor; import org.broadinstitute.sting.utils.threading.ThreadPoolMonitor;
import java.util.Collection; import java.util.Collection;
@ -41,6 +40,11 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
private final Queue<TreeReduceTask> reduceTasks = new LinkedList<TreeReduceTask>(); private final Queue<TreeReduceTask> reduceTasks = new LinkedList<TreeReduceTask>();
/**
* An exception that's occurred in this traversal. If null, no exception has occurred.
*/
private RuntimeException error = null;
/** /**
* Queue of incoming shards. * Queue of incoming shards.
*/ */
@ -91,13 +95,11 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
ReduceTree reduceTree = new ReduceTree(this); ReduceTree reduceTree = new ReduceTree(this);
initializeWalker(walker); initializeWalker(walker);
//
// exception handling here is a bit complex. We used to catch and rethrow exceptions all over
// the place, but that just didn't work well. Now we have a specific execution exception (inner class)
// to use for multi-threading specific exceptions. All RuntimeExceptions that occur within the threads are rethrown
// up the stack as their underlying causes
//
while (isShardTraversePending() || isTreeReducePending()) { while (isShardTraversePending() || isTreeReducePending()) {
// Check for errors during execution.
if(hasTraversalErrorOccurred())
throw getTraversalError();
// Too many files sitting around taking up space? Merge them. // Too many files sitting around taking up space? Merge them.
if (isMergeLimitExceeded()) if (isMergeLimitExceeded())
mergeExistingOutput(false); mergeExistingOutput(false);
@ -113,6 +115,9 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
queueNextShardTraverse(walker, reduceTree); queueNextShardTraverse(walker, reduceTree);
} }
if(hasTraversalErrorOccurred())
throw getTraversalError();
threadPool.shutdown(); threadPool.shutdown();
// Merge any lingering output files. If these files aren't ready, // Merge any lingering output files. If these files aren't ready,
@ -123,9 +128,14 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
try { try {
result = reduceTree.getResult().get(); result = reduceTree.getResult().get();
notifyTraversalDone(walker,result); notifyTraversalDone(walker,result);
} catch (ReviewedStingException ex) {
throw ex;
} catch ( ExecutionException ex ) {
// the thread died and we are failing to get the result, rethrow it as a runtime exception
throw toRuntimeException(ex.getCause());
} catch (Exception ex) {
throw new ReviewedStingException("Unable to retrieve result", ex);
} }
catch( InterruptedException ex ) { handleException(ex); }
catch( ExecutionException ex ) { handleException(ex); }
// do final cleanup operations // do final cleanup operations
outputTracker.close(); outputTracker.close();
@ -328,39 +338,35 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
} }
/** /**
* Handle an exception that occurred in a worker thread as needed by this scheduler. * Detects whether an execution error has occurred.
* * @return True if an error has occurred. False otherwise.
* The way to use this function in a worker is:
*
* try { doSomeWork();
* catch ( InterruptedException ex ) { hms.handleException(ex); }
* catch ( ExecutionException ex ) { hms.handleException(ex); }
*
* @param ex the exception that occurred in the worker thread
*/ */
protected final void handleException(InterruptedException ex) { private synchronized boolean hasTraversalErrorOccurred() {
throw new HierarchicalMicroScheduler.ExecutionFailure("Hierarchical reduce interrupted", ex); return error != null;
}
private synchronized RuntimeException getTraversalError() {
if(!hasTraversalErrorOccurred())
throw new ReviewedStingException("User has attempted to retrieve a traversal error when none exists");
return error;
} }
/** /**
* Handle an exception that occurred in a worker thread as needed by this scheduler. * Allows other threads to notify of an error during traversal.
*
* The way to use this function in a worker is:
*
* try { doSomeWork();
* catch ( InterruptedException ex ) { hms.handleException(ex); }
* catch ( ExecutionException ex ) { hms.handleException(ex); }
*
* @param ex the exception that occurred in the worker thread
*/ */
protected final void handleException(ExecutionException ex) { protected synchronized RuntimeException notifyOfTraversalError(Throwable error) {
if ( ex.getCause() instanceof RuntimeException ) // If the error is already a Runtime, pass it along as is. Otherwise, wrap it.
// if the cause was a runtime exception that's what we want to send up the stack this.error = toRuntimeException(error);
throw (RuntimeException )ex.getCause(); return this.error;
else
throw new HierarchicalMicroScheduler.ExecutionFailure("Hierarchical reduce failed", ex);
} }
private final RuntimeException toRuntimeException(final Throwable error) {
// If the error is already a Runtime, pass it along as is. Otherwise, wrap it.
if (error instanceof RuntimeException)
return (RuntimeException)error;
else
return new ReviewedStingException("An error occurred during the traversal. Message=" + error.getMessage(), error);
}
/** A small wrapper class that provides the TreeReducer interface along with the FutureTask semantics. */ /** A small wrapper class that provides the TreeReducer interface along with the FutureTask semantics. */
@ -381,17 +387,6 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
} }
} }
/**
* A specific exception class for HMS-specific failures such as
* Interrupted or ExecutionFailures that aren't clearly the fault
* of the underlying walker code
*/
public static class ExecutionFailure extends ReviewedStingException {
public ExecutionFailure(final String s, final Throwable throwable) {
super(s, throwable);
}
}
/** /**
* Used by the ShardTraverser to report time consumed traversing a given shard. * Used by the ShardTraverser to report time consumed traversing a given shard.
* *

View File

@ -11,7 +11,6 @@ import org.broadinstitute.sting.gatk.datasources.rmd.ReferenceOrderedDataSource;
import org.broadinstitute.sting.gatk.io.DirectOutputTracker; import org.broadinstitute.sting.gatk.io.DirectOutputTracker;
import org.broadinstitute.sting.gatk.io.OutputTracker; import org.broadinstitute.sting.gatk.io.OutputTracker;
import org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions; import org.broadinstitute.sting.gatk.traversals.TraverseActiveRegions;
import org.broadinstitute.sting.gatk.walkers.LocusWalker;
import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.SampleUtils;

View File

@ -6,11 +6,11 @@ import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
import org.broadinstitute.sting.gatk.datasources.reads.Shard; import org.broadinstitute.sting.gatk.datasources.reads.Shard;
import org.broadinstitute.sting.gatk.io.ThreadLocalOutputTracker; import org.broadinstitute.sting.gatk.io.ThreadLocalOutputTracker;
import org.broadinstitute.sting.gatk.traversals.TraversalEngine; import org.broadinstitute.sting.gatk.traversals.TraversalEngine;
import org.broadinstitute.sting.gatk.walkers.LocusWalker;
import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.concurrent.Callable; import java.util.concurrent.Callable;
import java.util.concurrent.ExecutionException;
/** /**
* User: hanna * User: hanna
* Date: Apr 29, 2009 * Date: Apr 29, 2009
@ -79,6 +79,9 @@ public class ShardTraverser implements Callable {
microScheduler.reportShardTraverseTime(endTime-startTime); microScheduler.reportShardTraverseTime(endTime-startTime);
return accumulator; return accumulator;
} catch(Throwable t) {
// Notify that an exception has occurred and rethrow it.
throw microScheduler.notifyOfTraversalError(t);
} finally { } finally {
synchronized(this) { synchronized(this) {
complete = true; complete = true;

View File

@ -79,8 +79,14 @@ public class TreeReducer implements Callable {
else else
result = walker.treeReduce( lhs.get(), rhs.get() ); result = walker.treeReduce( lhs.get(), rhs.get() );
} }
catch( InterruptedException ex ) { microScheduler.handleException(ex); } catch( InterruptedException ex ) {
catch( ExecutionException ex ) { microScheduler.handleException(ex); } microScheduler.notifyOfTraversalError(ex);
throw new ReviewedStingException("Hierarchical reduce interrupted", ex);
}
catch( ExecutionException ex ) {
microScheduler.notifyOfTraversalError(ex);
throw new ReviewedStingException("Hierarchical reduce failed", ex);
}
final long endTime = System.currentTimeMillis(); final long endTime = System.currentTimeMillis();

View File

@ -28,11 +28,10 @@ import net.sf.samtools.SAMRecord;
*/ */
/** /**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Dec 9, 2009
*
* Filter out duplicate reads. * Filter out duplicate reads.
*
* @author rpoplin
* @since Dec 9, 2009
*/ */
public class DuplicateReadFilter extends ReadFilter { public class DuplicateReadFilter extends ReadFilter {

View File

@ -27,11 +27,10 @@ package org.broadinstitute.sting.gatk.filters;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
/** /**
* Created by IntelliJ IDEA. * Filter out reads that fail the vendor quality check.
* User: rpoplin
* Date: Jul 19, 2010
* *
* Filter out FailsVendorQualityCheck reads. * @author rpoplin
* @since Jul 19, 2010
*/ */
public class FailsVendorQualityCheckFilter extends ReadFilter { public class FailsVendorQualityCheckFilter extends ReadFilter {

View File

@ -3,11 +3,10 @@ package org.broadinstitute.sting.gatk.filters;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
/** /**
* Created by IntelliJ IDEA. * Filter out reads that are not paired, have their mate unmapped, are duplicates, fail vendor quality check or both mate and read are in the same strand.
* User: chartl *
* Date: 5/18/11 * @author chartl
* Time: 4:25 PM * @since 5/18/11
* To change this template use File | Settings | File Templates.
*/ */
public class MateSameStrandFilter extends ReadFilter { public class MateSameStrandFilter extends ReadFilter {

View File

@ -4,11 +4,10 @@ import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
/** /**
* Created by IntelliJ IDEA. * Filter out reads that exceed a given max insert size
* User: chartl *
* Date: 5/2/11 * @author chartl
* Time: 12:20 PM * @since 5/2/11
* To change this template use File | Settings | File Templates.
*/ */
public class MaxInsertSizeFilter extends ReadFilter { public class MaxInsertSizeFilter extends ReadFilter {
@Argument(fullName = "maxInsertSize", shortName = "maxInsert", doc="Discard reads with insert size greater than the specified value, defaults to 1000000", required=false) @Argument(fullName = "maxInsertSize", shortName = "maxInsert", doc="Discard reads with insert size greater than the specified value, defaults to 1000000", required=false)

View File

@ -28,11 +28,10 @@ import net.sf.samtools.SAMRecord;
*/ */
/** /**
* Created by IntelliJ IDEA. * Filter out reads that don't have base an original quality quality score tag (usually added by BQSR)
* User: rpoplin
* Date: Nov 19, 2009
* *
* Filter out reads that don't have Original Quality scores inside. * @author rpoplin
* @since Nov 19, 2009
*/ */
public class NoOriginalQualityScoresFilter extends ReadFilter { public class NoOriginalQualityScoresFilter extends ReadFilter {
public boolean filterOut( final SAMRecord read ) { public boolean filterOut( final SAMRecord read ) {

View File

@ -27,11 +27,10 @@ package org.broadinstitute.sting.gatk.filters;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
/** /**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Dec 9, 2009
*
* Filter out duplicate reads. * Filter out duplicate reads.
*
* @author rpoplin
* @since Dec 9, 2009
*/ */
public class NotPrimaryAlignmentFilter extends ReadFilter { public class NotPrimaryAlignmentFilter extends ReadFilter {

View File

@ -8,11 +8,10 @@ import java.util.HashSet;
import java.util.Set; import java.util.Set;
/** /**
* Created by IntelliJ IDEA. * Filter out reads that have blacklisted platform unit tags. (See code documentation for how to create the blacklist).
* User: asivache *
* Date: Sep 21, 2009 * @author asivache
* Time: 2:54:23 PM * @since Sep 21, 2009
* To change this template use File | Settings | File Templates.
*/ */
public class PlatformUnitFilter extends ReadFilter { public class PlatformUnitFilter extends ReadFilter {
// a hack: use static in order to be able to fill it with the data from command line at runtime // a hack: use static in order to be able to fill it with the data from command line at runtime

View File

@ -1,17 +1,13 @@
package org.broadinstitute.sting.gatk.filters; package org.broadinstitute.sting.gatk.filters;
import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement;
import net.sf.samtools.CigarOperator;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
/** /**
* Created by IntelliJ IDEA. * Filter out all reads except those with this read name
* User: chartl *
* Date: 9/19/11 * @author chartl
* Time: 4:09 PM * @since 9/19/11
* To change this template use File | Settings | File Templates.
*/ */
public class ReadNameFilter extends ReadFilter { public class ReadNameFilter extends ReadFilter {
@Argument(fullName = "readName", shortName = "rn", doc="Filter out all reads except those with this read name", required=true) @Argument(fullName = "readName", shortName = "rn", doc="Filter out all reads except those with this read name", required=true)

View File

@ -31,6 +31,9 @@ import org.broadinstitute.sting.commandline.Argument;
import java.util.Set; import java.util.Set;
/**
* Filter out all reads except those with this sample
*/
public class SampleFilter extends ReadFilter { public class SampleFilter extends ReadFilter {
@Argument(fullName = "sample_to_keep", shortName = "goodSM", doc="The name of the sample(s) to keep, filtering out all others", required=true) @Argument(fullName = "sample_to_keep", shortName = "goodSM", doc="The name of the sample(s) to keep, filtering out all others", required=true)
private Set SAMPLES_TO_KEEP = null; private Set SAMPLES_TO_KEEP = null;

View File

@ -30,11 +30,11 @@ import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
/** /**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Nov 27, 2009
*
* Only use reads from the specified read group. * Only use reads from the specified read group.
*
* @author rpoplin
* @since Nov 27, 2009
*
*/ */
public class SingleReadGroupFilter extends ReadFilter { public class SingleReadGroupFilter extends ReadFilter {

View File

@ -27,11 +27,10 @@ package org.broadinstitute.sting.gatk.filters;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
/** /**
* Created by IntelliJ IDEA. * Filter out unmapped reads.
* User: rpoplin
* Date: Dec 9, 2009
* *
* Filter out duplicate reads. * @author rpoplin
* @since Dec 9, 2009
*/ */
public class UnmappedReadFilter extends ReadFilter { public class UnmappedReadFilter extends ReadFilter {

View File

@ -62,6 +62,7 @@ public class SAMFileWriterStorage implements SAMFileWriter, Storage<SAMFileWrite
if (stub.getGenerateMD5()) if (stub.getGenerateMD5())
factory.setCreateMd5File(true); factory.setCreateMd5File(true);
// Adjust max records in RAM. // Adjust max records in RAM.
// TODO -- this doesn't actually work because of a bug in Picard; do not use until fixed
if(stub.getMaxRecordsInRam() != null) if(stub.getMaxRecordsInRam() != null)
factory.setMaxRecordsInRam(stub.getMaxRecordsInRam()); factory.setMaxRecordsInRam(stub.getMaxRecordsInRam());

View File

@ -279,7 +279,6 @@ public class LocusIteratorByState extends LocusIterator {
*/ */
private void lazyLoadNextAlignmentContext() { private void lazyLoadNextAlignmentContext() {
while (nextAlignmentContext == null && readStates.hasNext()) { while (nextAlignmentContext == null && readStates.hasNext()) {
// this call will set hasExtendedEvents to true if it picks up a read with indel right before the current position on the ref:
readStates.collectPendingReads(); readStates.collectPendingReads();
final GenomeLoc location = getLocation(); final GenomeLoc location = getLocation();
@ -378,7 +377,7 @@ public class LocusIteratorByState extends LocusIterator {
CigarOperator op = state.stepForwardOnGenome(); CigarOperator op = state.stepForwardOnGenome();
if (op == null) { if (op == null) {
// we discard the read only when we are past its end AND indel at the end of the read (if any) was // we discard the read only when we are past its end AND indel at the end of the read (if any) was
// already processed. Keeping the read state that retunred null upon stepForwardOnGenome() is safe // already processed. Keeping the read state that returned null upon stepForwardOnGenome() is safe
// as the next call to stepForwardOnGenome() will return null again AND will clear hadIndel() flag. // as the next call to stepForwardOnGenome() will return null again AND will clear hadIndel() flag.
it.remove(); // we've stepped off the end of the object it.remove(); // we've stepped off the end of the object
} }

View File

@ -52,6 +52,7 @@ import java.util.ArrayList;
import java.util.Arrays; import java.util.Arrays;
import java.util.Date; import java.util.Date;
import java.util.List; import java.util.List;
import java.util.concurrent.atomic.AtomicBoolean;
import java.util.zip.GZIPOutputStream; import java.util.zip.GZIPOutputStream;
@ -84,6 +85,11 @@ public class GATKRunReport {
*/ */
private static File REPORT_SENTINEL = new File(REPORT_DIR.getAbsolutePath() + "/ENABLE"); private static File REPORT_SENTINEL = new File(REPORT_DIR.getAbsolutePath() + "/ENABLE");
// number of milliseconds before the S3 put operation is timed-out:
private static final long S3PutTimeOut = 10 * 1000;
public static final String PHONE_HOME_DOCS_URL = "http://gatkforums.broadinstitute.org/discussion/1250/what-is-phone-home-and-how-does-it-affect-me#latest";
/** /**
* our log * our log
*/ */
@ -263,6 +269,58 @@ public class GATKRunReport {
} }
} }
private class S3PutRunnable implements Runnable {
public AtomicBoolean isSuccess;
private final String key;
private final byte[] report;
public S3Object s3Object;
public String errorMsg;
public Throwable errorThrow;
public S3PutRunnable(String key, byte[] report){
isSuccess = new AtomicBoolean();
this.key = key;
this.report = report;
}
public void run() {
try {
// Your Amazon Web Services (AWS) login credentials are required to manage S3 accounts. These credentials
// are stored in an AWSCredentials object:
// IAM GATK user credentials -- only right is to PutObject into GATK_Run_Report bucket
String awsAccessKey = "AKIAJXU7VIHBPDW4TDSQ"; // GATK AWS user
String awsSecretKey = "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"; // GATK AWS user
AWSCredentials awsCredentials = new AWSCredentials(awsAccessKey, awsSecretKey);
// To communicate with S3, create a class that implements an S3Service. We will use the REST/HTTP
// implementation based on HttpClient, as this is the most robust implementation provided with JetS3t.
S3Service s3Service = new RestS3Service(awsCredentials);
// Create an S3Object based on a file, with Content-Length set automatically and
// Content-Type set based on the file's extension (using the Mimetypes utility class)
S3Object fileObject = new S3Object(key, report);
//logger.info("Created S3Object" + fileObject);
//logger.info("Uploading " + localFile + " to AWS bucket");
s3Object = s3Service.putObject(REPORT_BUCKET_NAME, fileObject);
isSuccess.set(true);
} catch ( S3ServiceException e ) {
setException("S3 exception occurred", e);
} catch ( NoSuchAlgorithmException e ) {
setException("Couldn't calculate MD5", e);
} catch ( IOException e ) {
setException("Couldn't read report file", e);
}
}
private void setException(String msg, Throwable e){
errorMsg=msg;
errorThrow=e;
}
}
private void postReportToAWSS3() { private void postReportToAWSS3() {
// modifying example code from http://jets3t.s3.amazonaws.com/toolkit/code-samples.html // modifying example code from http://jets3t.s3.amazonaws.com/toolkit/code-samples.html
this.hostName = Utils.resolveHostname(); // we want to fill in the host name this.hostName = Utils.resolveHostname(); // we want to fill in the host name
@ -280,32 +338,32 @@ public class GATKRunReport {
Logger mimeTypeLogger = Logger.getLogger(org.jets3t.service.utils.Mimetypes.class); Logger mimeTypeLogger = Logger.getLogger(org.jets3t.service.utils.Mimetypes.class);
mimeTypeLogger.setLevel(Level.FATAL); mimeTypeLogger.setLevel(Level.FATAL);
// Your Amazon Web Services (AWS) login credentials are required to manage S3 accounts. These credentials // Set the S3 upload on its own thread with timeout:
// are stored in an AWSCredentials object: S3PutRunnable s3run = new S3PutRunnable(key,report);
Thread s3thread = new Thread(s3run);
s3thread.setDaemon(true);
s3thread.setName("S3Put-Thread");
s3thread.start();
// IAM GATK user credentials -- only right is to PutObject into GATK_Run_Report bucket s3thread.join(S3PutTimeOut);
String awsAccessKey = "AKIAJXU7VIHBPDW4TDSQ"; // GATK AWS user
String awsSecretKey = "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"; // GATK AWS user
AWSCredentials awsCredentials = new AWSCredentials(awsAccessKey, awsSecretKey);
// To communicate with S3, create a class that implements an S3Service. We will use the REST/HTTP if(s3thread.isAlive()){
// implementation based on HttpClient, as this is the most robust implementation provided with JetS3t. s3thread.interrupt();
S3Service s3Service = new RestS3Service(awsCredentials); exceptDuringRunReport("Run statistics report upload to AWS S3 timed-out");
} else if(s3run.isSuccess.get()) {
// Create an S3Object based on a file, with Content-Length set automatically and logger.info("Uploaded run statistics report to AWS S3");
// Content-Type set based on the file's extension (using the Mimetypes utility class) logger.debug("Uploaded to AWS: " + s3run.s3Object);
S3Object fileObject = new S3Object(key, report); } else {
//logger.info("Created S3Object" + fileObject); if((s3run.errorMsg != null) && (s3run.errorThrow != null)){
//logger.info("Uploading " + localFile + " to AWS bucket"); exceptDuringRunReport(s3run.errorMsg,s3run.errorThrow);
S3Object s3Object = s3Service.putObject(REPORT_BUCKET_NAME, fileObject); } else {
logger.debug("Uploaded to AWS: " + s3Object); exceptDuringRunReport("Run statistics report upload to AWS S3 failed");
logger.info("Uploaded run statistics report to AWS S3"); }
} catch ( S3ServiceException e ) { }
exceptDuringRunReport("S3 exception occurred", e);
} catch ( NoSuchAlgorithmException e ) {
exceptDuringRunReport("Couldn't calculate MD5", e);
} catch ( IOException e ) { } catch ( IOException e ) {
exceptDuringRunReport("Couldn't read report file", e); exceptDuringRunReport("Couldn't read report file", e);
} catch ( InterruptedException e) {
exceptDuringRunReport("Run statistics report upload interrupted", e);
} }
} }

View File

@ -163,43 +163,58 @@ public class VariantContextAdaptors {
@Override @Override
public VariantContext convert(String name, Object input, ReferenceContext ref) { public VariantContext convert(String name, Object input, ReferenceContext ref) {
OldDbSNPFeature dbsnp = (OldDbSNPFeature)input; OldDbSNPFeature dbsnp = (OldDbSNPFeature)input;
if ( ! Allele.acceptableAlleleBases(dbsnp.getNCBIRefBase()) )
return null;
Allele refAllele = Allele.create(dbsnp.getNCBIRefBase(), true);
if ( isSNP(dbsnp) || isIndel(dbsnp) || isMNP(dbsnp) || dbsnp.getVariantType().contains("mixed") ) { int index = dbsnp.getStart() - ref.getWindow().getStart() - 1;
// add the reference allele if ( index < 0 )
List<Allele> alleles = new ArrayList<Allele>(); return null; // we weren't given enough reference context to create the VariantContext
alleles.add(refAllele);
// add all of the alt alleles final byte refBaseForIndel = ref.getBases()[index];
boolean sawNullAllele = refAllele.isNull();
for ( String alt : getAlternateAlleleList(dbsnp) ) {
if ( ! Allele.acceptableAlleleBases(alt) ) {
//System.out.printf("Excluding dbsnp record %s%n", dbsnp);
return null;
}
Allele altAllele = Allele.create(alt, false);
alleles.add(altAllele);
if ( altAllele.isNull() )
sawNullAllele = true;
}
Map<String, Object> attributes = new HashMap<String, Object>(); boolean addPaddingBase;
if ( isSNP(dbsnp) || isMNP(dbsnp) )
int index = dbsnp.getStart() - ref.getWindow().getStart() - 1; addPaddingBase = false;
if ( index < 0 ) else if ( isIndel(dbsnp) || dbsnp.getVariantType().contains("mixed") )
return null; // we weren't given enough reference context to create the VariantContext addPaddingBase = VariantContextUtils.requiresPaddingBase(stripNullDashes(getAlleleList(dbsnp)));
Byte refBaseForIndel = new Byte(ref.getBases()[index]); else
final VariantContextBuilder builder = new VariantContextBuilder();
builder.source(name).id(dbsnp.getRsID());
builder.loc(dbsnp.getChr(), dbsnp.getStart() - (sawNullAllele ? 1 : 0), dbsnp.getEnd() - (refAllele.isNull() ? 1 : 0));
builder.alleles(alleles);
builder.referenceBaseForIndel(refBaseForIndel);
return builder.make();
} else
return null; // can't handle anything else return null; // can't handle anything else
Allele refAllele;
if ( dbsnp.getNCBIRefBase().equals("-") )
refAllele = Allele.create(refBaseForIndel, true);
else if ( ! Allele.acceptableAlleleBases(dbsnp.getNCBIRefBase()) )
return null;
else
refAllele = Allele.create((addPaddingBase ? (char)refBaseForIndel : "") + dbsnp.getNCBIRefBase(), true);
final List<Allele> alleles = new ArrayList<Allele>();
alleles.add(refAllele);
// add all of the alt alleles
for ( String alt : getAlternateAlleleList(dbsnp) ) {
if ( Allele.wouldBeNullAllele(alt.getBytes()))
alt = "";
else if ( ! Allele.acceptableAlleleBases(alt) )
return null;
alleles.add(Allele.create((addPaddingBase ? (char)refBaseForIndel : "") + alt, false));
}
final VariantContextBuilder builder = new VariantContextBuilder();
builder.source(name).id(dbsnp.getRsID());
builder.loc(dbsnp.getChr(), dbsnp.getStart() - (addPaddingBase ? 1 : 0), dbsnp.getEnd() - (addPaddingBase && refAllele.length() == 1 ? 1 : 0));
builder.alleles(alleles);
return builder.make();
}
private static List<String> stripNullDashes(final List<String> alleles) {
final List<String> newAlleles = new ArrayList<String>(alleles.size());
for ( final String allele : alleles ) {
if ( allele.equals("-") )
newAlleles.add("");
else
newAlleles.add(allele);
}
return newAlleles;
} }
} }
@ -294,7 +309,6 @@ public class VariantContextAdaptors {
int index = hapmap.getStart() - ref.getWindow().getStart(); int index = hapmap.getStart() - ref.getWindow().getStart();
if ( index < 0 ) if ( index < 0 )
return null; // we weren't given enough reference context to create the VariantContext return null; // we weren't given enough reference context to create the VariantContext
Byte refBaseForIndel = new Byte(ref.getBases()[index]);
HashSet<Allele> alleles = new HashSet<Allele>(); HashSet<Allele> alleles = new HashSet<Allele>();
Allele refSNPAllele = Allele.create(ref.getBase(), true); Allele refSNPAllele = Allele.create(ref.getBase(), true);
@ -351,7 +365,7 @@ public class VariantContextAdaptors {
long end = hapmap.getEnd(); long end = hapmap.getEnd();
if ( deletionLength > 0 ) if ( deletionLength > 0 )
end += deletionLength; end += deletionLength;
VariantContext vc = new VariantContextBuilder(name, hapmap.getChr(), hapmap.getStart(), end, alleles).id(hapmap.getName()).genotypes(genotypes).referenceBaseForIndel(refBaseForIndel).make(); VariantContext vc = new VariantContextBuilder(name, hapmap.getChr(), hapmap.getStart(), end, alleles).id(hapmap.getName()).genotypes(genotypes).make();
return vc; return vc;
} }
} }

View File

@ -89,9 +89,9 @@ public class GATKReport {
reader = new BufferedReader(new FileReader(file)); reader = new BufferedReader(new FileReader(file));
reportHeader = reader.readLine(); reportHeader = reader.readLine();
} catch (FileNotFoundException e) { } catch (FileNotFoundException e) {
throw new ReviewedStingException("Could not open file : " + file); throw new UserException.CouldNotReadInputFile(file, "it does not exist");
} catch (IOException e) { } catch (IOException e) {
throw new ReviewedStingException("Could not read file : " + file); throw new UserException.CouldNotReadInputFile(file, e);
} }

View File

@ -208,11 +208,23 @@ public class GATKReportTable {
} }
/** /**
* Verifies that a table or column name has only alphanumeric characters - no spaces or special characters allowed * Create a new GATKReportTable with the same structure
* * @param tableToCopy
* @param name the name of the table or column
* @return true if the name is valid, false if otherwise
*/ */
public GATKReportTable(final GATKReportTable tableToCopy, final boolean copyData) {
this(tableToCopy.getTableName(), tableToCopy.getTableDescription(), tableToCopy.getNumColumns(), tableToCopy.sortByRowID);
for ( final GATKReportColumn column : tableToCopy.getColumnInfo() )
addColumn(column.getColumnName(), column.getFormat());
if ( copyData )
throw new IllegalArgumentException("sorry, copying data in GATKReportTable isn't supported");
}
/**
* Verifies that a table or column name has only alphanumeric characters - no spaces or special characters allowed
*
* @param name the name of the table or column
* @return true if the name is valid, false if otherwise
*/
private boolean isValidName(String name) { private boolean isValidName(String name) {
Pattern p = Pattern.compile(INVALID_TABLE_NAME_REGEX); Pattern p = Pattern.compile(INVALID_TABLE_NAME_REGEX);
Matcher m = p.matcher(name); Matcher m = p.matcher(name);
@ -490,6 +502,17 @@ public class GATKReportTable {
return get(rowIdToIndex.get(rowID), columnNameToIndex.get(columnName)); return get(rowIdToIndex.get(rowID), columnNameToIndex.get(columnName));
} }
/**
* Get a value from the given position in the table
*
* @param rowIndex the row ID
* @param columnName the name of the column
* @return the value stored at the specified position in the table
*/
public Object get(final int rowIndex, final String columnName) {
return get(rowIndex, columnNameToIndex.get(columnName));
}
/** /**
* Get a value from the given position in the table * Get a value from the given position in the table
* *

View File

@ -6,11 +6,14 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.datasources.providers.*; import org.broadinstitute.sting.gatk.datasources.providers.*;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.*; import org.broadinstitute.sting.gatk.walkers.ActiveRegionExtension;
import org.broadinstitute.sting.gatk.walkers.ActiveRegionWalker;
import org.broadinstitute.sting.gatk.walkers.DataSource;
import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocSortedSet; import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.broadinstitute.sting.utils.activeregion.ActiveRegion;
import org.broadinstitute.sting.utils.activeregion.ActivityProfile; import org.broadinstitute.sting.utils.activeregion.ActivityProfile;
import org.broadinstitute.sting.utils.activeregion.ActivityProfileResult;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
@ -26,9 +29,9 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
/** /**
* our log, which we want to capture anything from this class * our log, which we want to capture anything from this class
*/ */
protected static Logger logger = Logger.getLogger(TraversalEngine.class); protected final static Logger logger = Logger.getLogger(TraversalEngine.class);
private final LinkedList<ActiveRegion> workQueue = new LinkedList<ActiveRegion>(); private final LinkedList<org.broadinstitute.sting.utils.activeregion.ActiveRegion> workQueue = new LinkedList<org.broadinstitute.sting.utils.activeregion.ActiveRegion>();
private final LinkedHashSet<GATKSAMRecord> myReads = new LinkedHashSet<GATKSAMRecord>(); private final LinkedHashSet<GATKSAMRecord> myReads = new LinkedHashSet<GATKSAMRecord>();
@Override @Override
@ -67,8 +70,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
for(int iii = prevLoc.getStop() + 1; iii < location.getStart(); iii++ ) { for(int iii = prevLoc.getStop() + 1; iii < location.getStart(); iii++ ) {
final GenomeLoc fakeLoc = engine.getGenomeLocParser().createGenomeLoc(prevLoc.getContig(), iii, iii); final GenomeLoc fakeLoc = engine.getGenomeLocParser().createGenomeLoc(prevLoc.getContig(), iii, iii);
if( initialIntervals == null || initialIntervals.overlaps( fakeLoc ) ) { if( initialIntervals == null || initialIntervals.overlaps( fakeLoc ) ) {
final double isActiveProb = ( walker.hasPresetActiveRegions() && walker.presetActiveRegions.overlaps(fakeLoc) ? 1.0 : 0.0 ); profile.add(fakeLoc, new ActivityProfileResult( walker.hasPresetActiveRegions() && walker.presetActiveRegions.overlaps(fakeLoc) ? 1.0 : 0.0 ));
profile.add(fakeLoc, isActiveProb);
} }
} }
} }
@ -84,8 +86,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// Call the walkers isActive function for this locus and add them to the list to be integrated later // Call the walkers isActive function for this locus and add them to the list to be integrated later
if( initialIntervals == null || initialIntervals.overlaps( location ) ) { if( initialIntervals == null || initialIntervals.overlaps( location ) ) {
final double isActiveProb = walkerActiveProb(walker, tracker, refContext, locus, location); profile.add(location, walkerActiveProb(walker, tracker, refContext, locus, location));
profile.add(location, isActiveProb);
} }
// Grab all the previously unseen reads from this pileup and add them to the massive read list // Grab all the previously unseen reads from this pileup and add them to the massive read list
@ -109,18 +110,18 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// add these blocks of work to the work queue // add these blocks of work to the work queue
// band-pass filter the list of isActive probabilities and turn into active regions // band-pass filter the list of isActive probabilities and turn into active regions
final ActivityProfile bandPassFiltered = profile.bandPassFilter(); final ActivityProfile bandPassFiltered = profile.bandPassFilter();
final List<ActiveRegion> activeRegions = bandPassFiltered.createActiveRegions( activeRegionExtension, maxRegionSize ); final List<org.broadinstitute.sting.utils.activeregion.ActiveRegion> activeRegions = bandPassFiltered.createActiveRegions( activeRegionExtension, maxRegionSize );
// add active regions to queue of regions to process // add active regions to queue of regions to process
// first check if can merge active regions over shard boundaries // first check if can merge active regions over shard boundaries
if( !activeRegions.isEmpty() ) { if( !activeRegions.isEmpty() ) {
if( !workQueue.isEmpty() ) { if( !workQueue.isEmpty() ) {
final ActiveRegion last = workQueue.getLast(); final org.broadinstitute.sting.utils.activeregion.ActiveRegion last = workQueue.getLast();
final ActiveRegion first = activeRegions.get(0); final org.broadinstitute.sting.utils.activeregion.ActiveRegion first = activeRegions.get(0);
if( last.isActive == first.isActive && last.getLocation().contiguousP(first.getLocation()) && last.getLocation().size() + first.getLocation().size() <= maxRegionSize ) { if( last.isActive == first.isActive && last.getLocation().contiguousP(first.getLocation()) && last.getLocation().size() + first.getLocation().size() <= maxRegionSize ) {
workQueue.removeLast(); workQueue.removeLast();
activeRegions.remove(first); activeRegions.remove(first);
workQueue.add( new ActiveRegion(last.getLocation().union(first.getLocation()), first.isActive, this.engine.getGenomeLocParser(), activeRegionExtension) ); workQueue.add( new org.broadinstitute.sting.utils.activeregion.ActiveRegion(last.getLocation().union(first.getLocation()), first.isActive, this.engine.getGenomeLocParser(), activeRegionExtension) );
} }
} }
workQueue.addAll( activeRegions ); workQueue.addAll( activeRegions );
@ -142,11 +143,11 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// //
// -------------------------------------------------------------------------------- // --------------------------------------------------------------------------------
private final double walkerActiveProb(final ActiveRegionWalker<M,T> walker, private final ActivityProfileResult walkerActiveProb(final ActiveRegionWalker<M,T> walker,
final RefMetaDataTracker tracker, final ReferenceContext refContext, final RefMetaDataTracker tracker, final ReferenceContext refContext,
final AlignmentContext locus, final GenomeLoc location) { final AlignmentContext locus, final GenomeLoc location) {
if ( walker.hasPresetActiveRegions() ) { if ( walker.hasPresetActiveRegions() ) {
return walker.presetActiveRegions.overlaps(location) ? 1.0 : 0.0; return new ActivityProfileResult(walker.presetActiveRegions.overlaps(location) ? 1.0 : 0.0);
} else { } else {
return walker.isActive( tracker, refContext, locus ); return walker.isActive( tracker, refContext, locus );
} }
@ -183,7 +184,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
*/ */
private void writeActiveRegionsToStream( final ActiveRegionWalker<M,T> walker ) { private void writeActiveRegionsToStream( final ActiveRegionWalker<M,T> walker ) {
// Just want to output the active regions to a file, not actually process them // Just want to output the active regions to a file, not actually process them
for( final ActiveRegion activeRegion : workQueue ) { for( final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion : workQueue ) {
if( activeRegion.isActive ) { if( activeRegion.isActive ) {
walker.activeRegionOutStream.println( activeRegion.getLocation() ); walker.activeRegionOutStream.println( activeRegion.getLocation() );
} }
@ -196,7 +197,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
while( workQueue.peek() != null ) { while( workQueue.peek() != null ) {
final GenomeLoc extendedLoc = workQueue.peek().getExtendedLoc(); final GenomeLoc extendedLoc = workQueue.peek().getExtendedLoc();
if ( extendedLoc.getStop() < minStart || (currentContig != null && !workQueue.peek().getExtendedLoc().getContig().equals(currentContig))) { if ( extendedLoc.getStop() < minStart || (currentContig != null && !workQueue.peek().getExtendedLoc().getContig().equals(currentContig))) {
final ActiveRegion activeRegion = workQueue.remove(); final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion = workQueue.remove();
sum = processActiveRegion( activeRegion, myReads, workQueue, sum, walker ); sum = processActiveRegion( activeRegion, myReads, workQueue, sum, walker );
} else { } else {
break; break;
@ -206,15 +207,15 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
return sum; return sum;
} }
private T processActiveRegion( final ActiveRegion activeRegion, final LinkedHashSet<GATKSAMRecord> reads, final Queue<ActiveRegion> workQueue, final T sum, final ActiveRegionWalker<M,T> walker ) { private T processActiveRegion( final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion, final LinkedHashSet<GATKSAMRecord> reads, final Queue<org.broadinstitute.sting.utils.activeregion.ActiveRegion> workQueue, final T sum, final ActiveRegionWalker<M,T> walker ) {
final ArrayList<GATKSAMRecord> placedReads = new ArrayList<GATKSAMRecord>(); final ArrayList<GATKSAMRecord> placedReads = new ArrayList<GATKSAMRecord>();
for( final GATKSAMRecord read : reads ) { for( final GATKSAMRecord read : reads ) {
final GenomeLoc readLoc = this.engine.getGenomeLocParser().createGenomeLoc( read ); final GenomeLoc readLoc = this.engine.getGenomeLocParser().createGenomeLoc( read );
if( activeRegion.getLocation().overlapsP( readLoc ) ) { if( activeRegion.getLocation().overlapsP( readLoc ) ) {
// The region which the highest amount of overlap is chosen as the primary region for the read (tie breaking is done as right most region) // The region which the highest amount of overlap is chosen as the primary region for the read (tie breaking is done as right most region)
long maxOverlap = activeRegion.getLocation().sizeOfOverlap( readLoc ); long maxOverlap = activeRegion.getLocation().sizeOfOverlap( readLoc );
ActiveRegion bestRegion = activeRegion; org.broadinstitute.sting.utils.activeregion.ActiveRegion bestRegion = activeRegion;
for( final ActiveRegion otherRegionToTest : workQueue ) { for( final org.broadinstitute.sting.utils.activeregion.ActiveRegion otherRegionToTest : workQueue ) {
if( otherRegionToTest.getLocation().sizeOfOverlap(readLoc) >= maxOverlap ) { if( otherRegionToTest.getLocation().sizeOfOverlap(readLoc) >= maxOverlap ) {
maxOverlap = otherRegionToTest.getLocation().sizeOfOverlap( readLoc ); maxOverlap = otherRegionToTest.getLocation().sizeOfOverlap( readLoc );
bestRegion = otherRegionToTest; bestRegion = otherRegionToTest;
@ -227,7 +228,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
if( !bestRegion.equals(activeRegion) ) { if( !bestRegion.equals(activeRegion) ) {
activeRegion.add( read ); activeRegion.add( read );
} }
for( final ActiveRegion otherRegionToTest : workQueue ) { for( final org.broadinstitute.sting.utils.activeregion.ActiveRegion otherRegionToTest : workQueue ) {
if( !bestRegion.equals(otherRegionToTest) && otherRegionToTest.getExtendedLoc().overlapsP( readLoc ) ) { if( !bestRegion.equals(otherRegionToTest) && otherRegionToTest.getExtendedLoc().overlapsP( readLoc ) ) {
otherRegionToTest.add( read ); otherRegionToTest.add( read );
} }

View File

@ -12,7 +12,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.GenomeLocSortedSet; import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.broadinstitute.sting.utils.activeregion.ActiveRegion; import org.broadinstitute.sting.utils.activeregion.ActivityProfileResult;
import org.broadinstitute.sting.utils.interval.IntervalMergingRule; import org.broadinstitute.sting.utils.interval.IntervalMergingRule;
import org.broadinstitute.sting.utils.interval.IntervalSetRule; import org.broadinstitute.sting.utils.interval.IntervalSetRule;
import org.broadinstitute.sting.utils.interval.IntervalUtils; import org.broadinstitute.sting.utils.interval.IntervalUtils;
@ -32,6 +32,7 @@ import java.util.List;
@PartitionBy(PartitionType.READ) @PartitionBy(PartitionType.READ)
@ActiveRegionExtension(extension=50,maxRegion=1500) @ActiveRegionExtension(extension=50,maxRegion=1500)
@ReadFilters({UnmappedReadFilter.class, NotPrimaryAlignmentFilter.class, DuplicateReadFilter.class, FailsVendorQualityCheckFilter.class, MappingQualityUnavailableFilter.class}) @ReadFilters({UnmappedReadFilter.class, NotPrimaryAlignmentFilter.class, DuplicateReadFilter.class, FailsVendorQualityCheckFilter.class, MappingQualityUnavailableFilter.class})
@RemoveProgramRecords
public abstract class ActiveRegionWalker<MapType, ReduceType> extends Walker<MapType, ReduceType> { public abstract class ActiveRegionWalker<MapType, ReduceType> extends Walker<MapType, ReduceType> {
@Output(fullName="activeRegionOut", shortName="ARO", doc="Output the active region to this interval list file", required = false) @Output(fullName="activeRegionOut", shortName="ARO", doc="Output the active region to this interval list file", required = false)
@ -73,10 +74,10 @@ public abstract class ActiveRegionWalker<MapType, ReduceType> extends Walker<Map
} }
// Determine probability of active status over the AlignmentContext // Determine probability of active status over the AlignmentContext
public abstract double isActive(final RefMetaDataTracker tracker, final ReferenceContext ref, final AlignmentContext context); public abstract ActivityProfileResult isActive(final RefMetaDataTracker tracker, final ReferenceContext ref, final AlignmentContext context);
// Map over the ActiveRegion // Map over the ActiveRegion
public abstract MapType map(final ActiveRegion activeRegion, final RefMetaDataTracker metaDataTracker); public abstract MapType map(final org.broadinstitute.sting.utils.activeregion.ActiveRegion activeRegion, final RefMetaDataTracker metaDataTracker);
public final GenomeLocSortedSet extendIntervals( final GenomeLocSortedSet intervals, final GenomeLocParser genomeLocParser, IndexedFastaSequenceFile reference ) { public final GenomeLocSortedSet extendIntervals( final GenomeLocSortedSet intervals, final GenomeLocParser genomeLocParser, IndexedFastaSequenceFile reference ) {
final int activeRegionExtension = this.getClass().getAnnotation(ActiveRegionExtension.class).extension(); final int activeRegionExtension = this.getClass().getAnnotation(ActiveRegionExtension.class).extension();

View File

@ -33,6 +33,7 @@ import org.broadinstitute.sting.commandline.Advanced;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Hidden; import org.broadinstitute.sting.commandline.Hidden;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.io.StingSAMFileWriter; import org.broadinstitute.sting.gatk.io.StingSAMFileWriter;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
@ -42,6 +43,7 @@ import org.broadinstitute.sting.utils.clipping.ClippingOp;
import org.broadinstitute.sting.utils.clipping.ClippingRepresentation; import org.broadinstitute.sting.utils.clipping.ClippingRepresentation;
import org.broadinstitute.sting.utils.clipping.ReadClipper; import org.broadinstitute.sting.utils.clipping.ReadClipper;
import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.File; import java.io.File;
@ -148,8 +150,9 @@ import java.util.regex.Pattern;
* @author Mark DePristo * @author Mark DePristo
* @since 2010 * @since 2010
*/ */
@DocumentedGATKFeature( groupName = "BAM Processing and Analysis Tools", extraDocs = {CommandLineGATK.class} )
@Requires({DataSource.READS}) @Requires({DataSource.READS})
public class ClipReadsWalker extends ReadWalker<ClipReadsWalker.ReadClipperWithData, ClipReadsWalker.ClippingData> { public class ClipReads extends ReadWalker<ClipReads.ReadClipperWithData, ClipReads.ClippingData> {
/** /**
* If provided, ClipReads will write summary statistics about the clipping operations applied * If provided, ClipReads will write summary statistics about the clipping operations applied
* to the reads to this file. * to the reads to this file.
@ -571,7 +574,7 @@ public class ClipReadsWalker extends ReadWalker<ClipReadsWalker.ReadClipperWithD
} }
} }
public class ReadClipperWithData extends ReadClipper { public static class ReadClipperWithData extends ReadClipper {
private ClippingData data; private ClippingData data;
public ReadClipperWithData(GATKSAMRecord read, List<SeqToClip> clipSeqs) { public ReadClipperWithData(GATKSAMRecord read, List<SeqToClip> clipSeqs) {

View File

@ -1,115 +0,0 @@
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers;
import net.sf.samtools.SAMFileWriter;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.text.XReadLines;
import java.io.File;
import java.io.FileNotFoundException;
import java.util.HashSet;
import java.util.Set;
/**
* Renders, in SAM/BAM format, all reads from the input data set in the order in which they appear
* in the input file. It can dynamically merge the contents of multiple input BAM files, resulting
* in merged output sorted in coordinate order. Can also optionally filter reads based on the --read-filter
* command line argument.
*/
@BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_OUTPUT)
@Requires({DataSource.READS, DataSource.REFERENCE})
public class FindReadsWithNamesWalker extends ReadWalker<SAMRecord, SAMFileWriter> {
/** an optional argument to dump the reads out to a BAM file */
@Output(doc="Write output to this BAM filename instead of STDOUT")
SAMFileWriter out;
@Argument(fullName = "readNamesToKeep", shortName = "rn", doc="names to keep", required = true)
File readNamesFile = null;
Set<String> namesToKeep;
/**
* The initialize function.
*/
public void initialize() {
try {
namesToKeep = new HashSet<String>(new XReadLines(readNamesFile).readLines());
} catch (FileNotFoundException e) {
throw new UserException.CouldNotReadInputFile(readNamesFile, e);
}
}
/**
* The reads filter function.
*
* @param ref the reference bases that correspond to our read, if a reference was provided
* @param read the read itself, as a SAMRecord
* @return true if the read passes the filter, false if it doesn't
*/
public boolean filter(ReferenceContext ref, GATKSAMRecord read) {
return namesToKeep.contains(read.getReadName());
}
/**
* The reads map function.
*
* @param ref the reference bases that correspond to our read, if a reference was provided
* @param read the read itself, as a SAMRecord
* @return the read itself
*/
public SAMRecord map( ReferenceContext ref, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker ) {
return read;
}
/**
* reduceInit is called once before any calls to the map function. We use it here to setup the output
* bam file, if it was specified on the command line
* @return SAMFileWriter, set to the BAM output file if the command line option was set, null otherwise
*/
public SAMFileWriter reduceInit() {
return out;
}
/**
* given a read and a output location, reduce by emitting the read
* @param read the read itself
* @param output the output source
* @return the SAMFileWriter, so that the next reduce can emit to the same source
*/
public SAMFileWriter reduce( SAMRecord read, SAMFileWriter output ) {
output.addAlignment(read);
return output;
}
}

View File

@ -1,8 +1,10 @@
package org.broadinstitute.sting.gatk.walkers; package org.broadinstitute.sting.gatk.walkers;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.PrintStream; import java.io.PrintStream;
@ -41,13 +43,14 @@ import java.text.NumberFormat;
* reads with QC failure flag set, number of duplicates, percentage mapped, etc. * reads with QC failure flag set, number of duplicates, percentage mapped, etc.
* @author aaron * @author aaron
*/ */
@DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
@Requires({DataSource.READS}) @Requires({DataSource.READS})
public class FlagStatWalker extends ReadWalker<Integer, Integer> { public class FlagStat extends ReadWalker<Integer, Integer> {
@Output @Output
PrintStream out; PrintStream out;
// what comes out of the flagstat // what comes out of the flagstat
static class FlagStat { static class FlagStatus {
long readCount = 0L; long readCount = 0L;
long QC_failure = 0L; long QC_failure = 0L;
long duplicates = 0L; long duplicates = 0L;
@ -117,7 +120,7 @@ public class FlagStatWalker extends ReadWalker<Integer, Integer> {
} }
private FlagStat myStat = new FlagStat(); private FlagStatus myStat = new FlagStatus();
public Integer map( ReferenceContext ref, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker ) { public Integer map( ReferenceContext ref, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker ) {
myStat.readCount++; myStat.readCount++;

View File

@ -19,6 +19,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
@Requires({DataSource.READS,DataSource.REFERENCE, DataSource.REFERENCE_BASES}) @Requires({DataSource.READS,DataSource.REFERENCE, DataSource.REFERENCE_BASES})
@PartitionBy(PartitionType.LOCUS) @PartitionBy(PartitionType.LOCUS)
@ReadFilters({UnmappedReadFilter.class,NotPrimaryAlignmentFilter.class,DuplicateReadFilter.class,FailsVendorQualityCheckFilter.class}) @ReadFilters({UnmappedReadFilter.class,NotPrimaryAlignmentFilter.class,DuplicateReadFilter.class,FailsVendorQualityCheckFilter.class})
@RemoveProgramRecords
public abstract class LocusWalker<MapType, ReduceType> extends Walker<MapType, ReduceType> { public abstract class LocusWalker<MapType, ReduceType> extends Walker<MapType, ReduceType> {
// Do we actually want to operate on the context? // Do we actually want to operate on the context?
public boolean filter(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) { public boolean filter(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {

View File

@ -30,10 +30,12 @@ import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Input; import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.commandline.RodBinding; import org.broadinstitute.sting.commandline.RodBinding;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
@ -60,7 +62,8 @@ import java.util.List;
* Associated command: * Associated command:
* samtools pileup [-f in.ref.fasta] [-t in.ref_list] [-l in.site_list] [-iscg] [-T theta] [-N nHap] [-r pairDiffRate] <in.alignment> * samtools pileup [-f in.ref.fasta] [-t in.ref_list] [-l in.site_list] [-iscg] [-T theta] [-N nHap] [-r pairDiffRate] <in.alignment>
*/ */
public class PileupWalker extends LocusWalker<Integer, Integer> implements TreeReducible<Integer> { @DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
public class Pileup extends LocusWalker<Integer, Integer> implements TreeReducible<Integer> {
@Output @Output
PrintStream out; PrintStream out;

View File

@ -29,9 +29,11 @@ import org.broad.tribble.Feature;
import org.broadinstitute.sting.commandline.Input; import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.commandline.RodBinding; import org.broadinstitute.sting.commandline.RodBinding;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import java.io.PrintStream; import java.io.PrintStream;
@ -39,7 +41,8 @@ import java.io.PrintStream;
* Prints out all of the RODs in the input data set. Data is rendered using the toString() method * Prints out all of the RODs in the input data set. Data is rendered using the toString() method
* of the given ROD. * of the given ROD.
*/ */
public class PrintRODsWalker extends RodWalker<Integer, Integer> { @DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
public class PrintRODs extends RodWalker<Integer, Integer> {
@Input(fullName="input", shortName = "input", doc="The input ROD which should be printed out.", required=true) @Input(fullName="input", shortName = "input", doc="The input ROD which should be printed out.", required=true)
public RodBinding<Feature> input; public RodBinding<Feature> input;

View File

@ -29,11 +29,13 @@ import net.sf.samtools.SAMFileWriter;
import net.sf.samtools.SAMReadGroupRecord; import net.sf.samtools.SAMReadGroupRecord;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.SampleUtils;
import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.File; import java.io.File;
@ -88,9 +90,10 @@ import java.util.TreeSet;
* </pre> * </pre>
* *
*/ */
@DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
@BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_OUTPUT) @BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_OUTPUT)
@Requires({DataSource.READS, DataSource.REFERENCE}) @Requires({DataSource.READS, DataSource.REFERENCE})
public class PrintReadsWalker extends ReadWalker<GATKSAMRecord, SAMFileWriter> { public class PrintReads extends ReadWalker<GATKSAMRecord, SAMFileWriter> {
@Output(doc="Write output to this BAM filename instead of STDOUT", required = true) @Output(doc="Write output to this BAM filename instead of STDOUT", required = true)
SAMFileWriter out; SAMFileWriter out;

View File

@ -0,0 +1,21 @@
package org.broadinstitute.sting.gatk.walkers;
/**
* Created with IntelliJ IDEA.
* User: thibault
* Date: 8/2/12
* Time: 1:58 PM
* To change this template use File | Settings | File Templates.
*/
import java.lang.annotation.*;
/**
* Indicates that program records should be removed from SAM headers by default for this walker
*/
@Documented
@Inherited
@Retention(RetentionPolicy.RUNTIME)
@Target(ElementType.TYPE)
public @interface RemoveProgramRecords {
}

View File

@ -31,8 +31,10 @@ import net.sf.samtools.SAMReadGroupRecord;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.apache.log4j.Logger; import org.apache.log4j.Logger;
import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.gatk.CommandLineGATK;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils; import org.broadinstitute.sting.utils.sam.ReadUtils;
@ -45,16 +47,17 @@ import java.util.Map;
* Divides the input data set into separate BAM files, one for each sample in the input data set. The split * Divides the input data set into separate BAM files, one for each sample in the input data set. The split
* files are named concatenating the sample name to the end of the provided outputRoot command-line argument. * files are named concatenating the sample name to the end of the provided outputRoot command-line argument.
*/ */
@DocumentedGATKFeature( groupName = "Quality Control and Simple Analysis Tools", extraDocs = {CommandLineGATK.class} )
@WalkerName("SplitSamFile") @WalkerName("SplitSamFile")
@Requires({DataSource.READS}) @Requires({DataSource.READS})
public class SplitSamFileWalker extends ReadWalker<SAMRecord, Map<String, SAMFileWriter>> { public class SplitSamFile extends ReadWalker<SAMRecord, Map<String, SAMFileWriter>> {
@Argument(fullName="outputRoot", doc="output BAM file", required=false) @Argument(fullName="outputRoot", doc="output BAM file", required=false)
public String outputRoot = null; public String outputRoot = null;
@Argument(fullName = "bam_compression", shortName = "compress", doc = "Compression level to use for writing BAM files", required = false) @Argument(fullName = "bam_compression", shortName = "compress", doc = "Compression level to use for writing BAM files", required = false)
public Integer BAMcompression = 5; public Integer BAMcompression = 5;
private static Logger logger = Logger.getLogger(SplitSamFileWalker.class); private static Logger logger = Logger.getLogger(SplitSamFile.class);
private static String VERSION = "0.0.1"; private static String VERSION = "0.0.1";
public void initialize() { public void initialize() {

View File

@ -49,10 +49,7 @@ import java.util.List;
@ReadFilters(MalformedReadFilter.class) @ReadFilters(MalformedReadFilter.class)
@PartitionBy(PartitionType.NONE) @PartitionBy(PartitionType.NONE)
@BAQMode(QualityMode = BAQ.QualityMode.OVERWRITE_QUALS, ApplicationTime = BAQ.ApplicationTime.ON_INPUT) @BAQMode(QualityMode = BAQ.QualityMode.OVERWRITE_QUALS, ApplicationTime = BAQ.ApplicationTime.ON_INPUT)
@DocumentedGATKFeature( @DocumentedGATKFeature(groupName = "Uncategorized", extraDocs = {CommandLineGATK.class})
groupName = "GATK walkers",
summary = "General tools available for running on the command line as part of the GATK package",
extraDocs = {CommandLineGATK.class})
public abstract class Walker<MapType, ReduceType> { public abstract class Walker<MapType, ReduceType> {
final protected static Logger logger = Logger.getLogger(Walker.class); final protected static Logger logger = Logger.getLogger(Walker.class);
private GenomeAnalysisEngine toolkit; private GenomeAnalysisEngine toolkit;

View File

@ -28,7 +28,7 @@ package org.broadinstitute.sting.gatk.walkers.annotator;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
@ -51,7 +51,7 @@ public class AlleleBalance extends InfoFieldAnnotation {
char[] BASES = {'A','C','G','T'}; char[] BASES = {'A','C','G','T'};
public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) { public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatible walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) {
if ( stratifiedContexts.size() == 0 ) if ( stratifiedContexts.size() == 0 )
return null; return null;

View File

@ -3,7 +3,7 @@ package org.broadinstitute.sting.gatk.walkers.annotator;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ExperimentalAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ExperimentalAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.GenotypeAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.GenotypeAnnotation;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
@ -14,7 +14,9 @@ import org.broadinstitute.sting.utils.variantcontext.Genotype;
import org.broadinstitute.sting.utils.variantcontext.GenotypeBuilder; import org.broadinstitute.sting.utils.variantcontext.GenotypeBuilder;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.util.*; import java.util.Arrays;
import java.util.Collection;
import java.util.List;
/** /**
@ -22,7 +24,7 @@ import java.util.*;
*/ */
public class AlleleBalanceBySample extends GenotypeAnnotation implements ExperimentalAnnotation { public class AlleleBalanceBySample extends GenotypeAnnotation implements ExperimentalAnnotation {
public void annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, AlignmentContext stratifiedContext, VariantContext vc, Genotype g, final GenotypeBuilder gb) { public void annotate(RefMetaDataTracker tracker, AnnotatorCompatible walker, ReferenceContext ref, AlignmentContext stratifiedContext, VariantContext vc, Genotype g, final GenotypeBuilder gb) {
Double ratio = annotateSNP(stratifiedContext, vc, g); Double ratio = annotateSNP(stratifiedContext, vc, g);
if (ratio == null) if (ratio == null)
return; return;

View File

@ -34,7 +34,7 @@ package org.broadinstitute.sting.gatk.walkers.annotator;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation;
import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
@ -52,7 +52,7 @@ import java.util.Map;
*/ */
public class BaseCounts extends InfoFieldAnnotation { public class BaseCounts extends InfoFieldAnnotation {
public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) { public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatible walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) {
if ( stratifiedContexts.size() == 0 ) if ( stratifiedContexts.size() == 0 )
return null; return null;

View File

@ -1,5 +1,6 @@
package org.broadinstitute.sting.gatk.walkers.annotator; package org.broadinstitute.sting.gatk.walkers.annotator;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation;
import org.broadinstitute.sting.gatk.walkers.genotyper.IndelGenotypeLikelihoodsCalculationModel; import org.broadinstitute.sting.gatk.walkers.genotyper.IndelGenotypeLikelihoodsCalculationModel;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine; import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine;
@ -15,7 +16,7 @@ import java.util.*;
* The u-based z-approximation from the Mann-Whitney Rank Sum Test for base qualities (ref bases vs. bases of the alternate allele). * The u-based z-approximation from the Mann-Whitney Rank Sum Test for base qualities (ref bases vs. bases of the alternate allele).
* Note that the base quality rank sum test can not be calculated for homozygous sites. * Note that the base quality rank sum test can not be calculated for homozygous sites.
*/ */
public class BaseQualityRankSumTest extends RankSumTest { public class BaseQualityRankSumTest extends RankSumTest implements StandardAnnotation {
public List<String> getKeyNames() { return Arrays.asList("BaseQRankSum"); } public List<String> getKeyNames() { return Arrays.asList("BaseQRankSum"); }
public List<VCFInfoHeaderLine> getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("BaseQRankSum", 1, VCFHeaderLineType.Float, "Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities")); } public List<VCFInfoHeaderLine> getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("BaseQRankSum", 1, VCFHeaderLineType.Float, "Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities")); }
@ -64,12 +65,12 @@ public class BaseQualityRankSumTest extends RankSumTest {
// by design, first element in LinkedHashMap was ref allele // by design, first element in LinkedHashMap was ref allele
double refLikelihood=0.0, altLikelihood=Double.NEGATIVE_INFINITY; double refLikelihood=0.0, altLikelihood=Double.NEGATIVE_INFINITY;
for (Allele a : el.keySet()) { for (Map.Entry<Allele, Double> entry : el.entrySet()) {
if (a.isReference()) if (entry.getKey().isReference())
refLikelihood =el.get(a); refLikelihood = entry.getValue();
else { else {
double like = el.get(a); double like = entry.getValue();
if (like >= altLikelihood) if (like >= altLikelihood)
altLikelihood = like; altLikelihood = like;
} }

View File

@ -29,18 +29,17 @@ import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ActiveRegionBasedAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ActiveRegionBasedAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineCount; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLine;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine; import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine;
import org.broadinstitute.sting.utils.codecs.vcf.VCFStandardHeaderLines;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.gatk.walkers.Walker;
import org.broadinstitute.sting.utils.codecs.vcf.*;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils;
@ -62,14 +61,14 @@ public class ChromosomeCounts extends InfoFieldAnnotation implements StandardAnn
private Set<String> founderIds = new HashSet<String>(); private Set<String> founderIds = new HashSet<String>();
public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) { public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatible walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) {
if ( ! vc.hasGenotypes() ) if ( ! vc.hasGenotypes() )
return null; return null;
return VariantContextUtils.calculateChromosomeCounts(vc, new HashMap<String, Object>(), true,founderIds); return VariantContextUtils.calculateChromosomeCounts(vc, new HashMap<String, Object>(), true,founderIds);
} }
public void initialize ( AnnotatorCompatibleWalker walker, GenomeAnalysisEngine toolkit, Set<VCFHeaderLine> headerLines ){ public void initialize ( AnnotatorCompatible walker, GenomeAnalysisEngine toolkit, Set<VCFHeaderLine> headerLines ){
//If families were given, get the founders ids //If families were given, get the founders ids
founderIds = ((Walker)walker).getSampleDB().getFounderIds(); founderIds = ((Walker)walker).getSampleDB().getFounderIds();
} }

View File

@ -18,7 +18,7 @@ import java.util.*;
* Date: 6/28/12 * Date: 6/28/12
*/ */
public class ClippingRankSumTest /*extends RankSumTest*/ { public class ClippingRankSumTest extends RankSumTest {
public List<String> getKeyNames() { return Arrays.asList("ClippingRankSum"); } public List<String> getKeyNames() { return Arrays.asList("ClippingRankSum"); }

View File

@ -4,7 +4,7 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ActiveRegionBasedAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ActiveRegionBasedAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
@ -38,7 +38,7 @@ import java.util.Map;
*/ */
public class DepthOfCoverage extends InfoFieldAnnotation implements StandardAnnotation, ActiveRegionBasedAnnotation { public class DepthOfCoverage extends InfoFieldAnnotation implements StandardAnnotation, ActiveRegionBasedAnnotation {
public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) { public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatible walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) {
if ( stratifiedContexts.size() == 0 ) if ( stratifiedContexts.size() == 0 )
return null; return null;

View File

@ -3,10 +3,12 @@ package org.broadinstitute.sting.gatk.walkers.annotator;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.GenotypeAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.GenotypeAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation;
import org.broadinstitute.sting.utils.codecs.vcf.*; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.codecs.vcf.VCFFormatHeaderLine;
import org.broadinstitute.sting.utils.codecs.vcf.VCFStandardHeaderLines;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
@ -14,7 +16,9 @@ import org.broadinstitute.sting.utils.variantcontext.Genotype;
import org.broadinstitute.sting.utils.variantcontext.GenotypeBuilder; import org.broadinstitute.sting.utils.variantcontext.GenotypeBuilder;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.util.*; import java.util.Arrays;
import java.util.HashMap;
import java.util.List;
/** /**
@ -38,21 +42,17 @@ import java.util.*;
*/ */
public class DepthPerAlleleBySample extends GenotypeAnnotation implements StandardAnnotation { public class DepthPerAlleleBySample extends GenotypeAnnotation implements StandardAnnotation {
private static final String REF_ALLELE = "REF"; public void annotate(RefMetaDataTracker tracker, AnnotatorCompatible walker, ReferenceContext ref, AlignmentContext stratifiedContext, VariantContext vc, Genotype g, GenotypeBuilder gb) {
private static final String DEL = "DEL"; // constant, for speed: no need to create a key string for deletion allele every time
public void annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, AlignmentContext stratifiedContext, VariantContext vc, Genotype g, GenotypeBuilder gb) {
if ( g == null || !g.isCalled() ) if ( g == null || !g.isCalled() )
return; return;
if ( vc.isSNP() ) if ( vc.isSNP() )
annotateSNP(stratifiedContext, vc, gb); annotateSNP(stratifiedContext, vc, gb);
else if ( vc.isIndel() ) else if ( vc.isIndel() )
annotateIndel(stratifiedContext, vc, gb); annotateIndel(stratifiedContext, ref.getBase(), vc, gb);
} }
private void annotateSNP(AlignmentContext stratifiedContext, VariantContext vc, GenotypeBuilder gb) { private void annotateSNP(final AlignmentContext stratifiedContext, final VariantContext vc, final GenotypeBuilder gb) {
HashMap<Byte, Integer> alleleCounts = new HashMap<Byte, Integer>(); HashMap<Byte, Integer> alleleCounts = new HashMap<Byte, Integer>();
for ( Allele allele : vc.getAlleles() ) for ( Allele allele : vc.getAlleles() )
@ -73,62 +73,47 @@ public class DepthPerAlleleBySample extends GenotypeAnnotation implements Standa
gb.AD(counts); gb.AD(counts);
} }
private void annotateIndel(AlignmentContext stratifiedContext, VariantContext vc, GenotypeBuilder gb) { private void annotateIndel(final AlignmentContext stratifiedContext, final byte refBase, final VariantContext vc, final GenotypeBuilder gb) {
ReadBackedPileup pileup = stratifiedContext.getBasePileup(); ReadBackedPileup pileup = stratifiedContext.getBasePileup();
if ( pileup == null ) if ( pileup == null )
return; return;
final HashMap<String, Integer> alleleCounts = new HashMap<String, Integer>(); final HashMap<Allele, Integer> alleleCounts = new HashMap<Allele, Integer>();
alleleCounts.put(REF_ALLELE, 0);
final Allele refAllele = vc.getReference(); final Allele refAllele = vc.getReference();
for ( Allele allele : vc.getAlternateAlleles() ) { for ( final Allele allele : vc.getAlleles() ) {
alleleCounts.put(allele, 0);
if ( allele.isNoCall() ) {
continue; // this does not look so good, should we die???
}
alleleCounts.put(getAlleleRepresentation(allele), 0);
} }
for ( PileupElement p : pileup ) { for ( PileupElement p : pileup ) {
if ( p.isBeforeInsertion() ) { if ( p.isBeforeInsertion() ) {
final String b = p.getEventBases(); final Allele insertion = Allele.create((char)refBase + p.getEventBases(), false);
if ( alleleCounts.containsKey(b) ) { if ( alleleCounts.containsKey(insertion) ) {
alleleCounts.put(b, alleleCounts.get(b)+1); alleleCounts.put(insertion, alleleCounts.get(insertion)+1);
} }
} else if ( p.isBeforeDeletionStart() ) { } else if ( p.isBeforeDeletionStart() ) {
if ( p.getEventLength() == refAllele.length() ) { if ( p.getEventLength() == refAllele.length() - 1 ) {
// this is indeed the deletion allele recorded in VC // this is indeed the deletion allele recorded in VC
final String b = DEL; final Allele deletion = Allele.create(refBase);
if ( alleleCounts.containsKey(b) ) { if ( alleleCounts.containsKey(deletion) ) {
alleleCounts.put(b, alleleCounts.get(b)+1); alleleCounts.put(deletion, alleleCounts.get(deletion)+1);
}
} }
}
} else if ( p.getRead().getAlignmentEnd() > vc.getStart() ) { } else if ( p.getRead().getAlignmentEnd() > vc.getStart() ) {
alleleCounts.put(REF_ALLELE, alleleCounts.get(REF_ALLELE)+1); alleleCounts.put(refAllele, alleleCounts.get(refAllele)+1);
} }
} }
int[] counts = new int[alleleCounts.size()]; final int[] counts = new int[alleleCounts.size()];
counts[0] = alleleCounts.get(REF_ALLELE); counts[0] = alleleCounts.get(refAllele);
for (int i = 0; i < vc.getAlternateAlleles().size(); i++) for (int i = 0; i < vc.getAlternateAlleles().size(); i++)
counts[i+1] = alleleCounts.get( getAlleleRepresentation(vc.getAlternateAllele(i)) ); counts[i+1] = alleleCounts.get( vc.getAlternateAllele(i) );
gb.AD(counts); gb.AD(counts);
} }
private String getAlleleRepresentation(Allele allele) {
if ( allele.isNull() ) { // deletion wrt the ref
return DEL;
} else { // insertion, pass actual bases
return allele.getBaseString();
}
}
// public String getIndelBases() // public String getIndelBases()
public List<String> getKeyNames() { return Arrays.asList(VCFConstants.GENOTYPE_ALLELE_DEPTHS); } public List<String> getKeyNames() { return Arrays.asList(VCFConstants.GENOTYPE_ALLELE_DEPTHS); }

Some files were not shown because too many files have changed in this diff Show More