Merge branch 'master' of ssh://ni.broadinstitute.org/humgen/gsa-scr1/chartl/dev/unstable

This commit is contained in:
Christopher Hartl 2012-02-21 13:53:37 -05:00
commit 685bcaced2
99 changed files with 5002 additions and 3103 deletions

View File

@ -1,762 +0,0 @@
/*
* Copyright (c) 2011, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package net.sf.samtools;
import net.sf.samtools.util.*;
import net.sf.samtools.SAMFileReader.ValidationStringency;
import java.io.*;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
import java.util.NoSuchElementException;
/**
* Internal class for reading and querying BAM files.
*/
class BAMFileReader extends SAMFileReader.ReaderImplementation {
// True if reading from a File rather than an InputStream
private boolean mIsSeekable = false;
// For converting bytes into other primitive types
private BinaryCodec mStream = null;
// Underlying compressed data stream.
private final BAMInputStream mInputStream;
private SAMFileHeader mFileHeader = null;
// Populated if the file is seekable and an index exists
private File mIndexFile;
private BAMIndex mIndex = null;
private long mFirstRecordPointer = 0;
private CloseableIterator<SAMRecord> mCurrentIterator = null;
// If true, all SAMRecords are fully decoded as they are read.
private final boolean eagerDecode;
// For error-checking.
private ValidationStringency mValidationStringency;
// For creating BAMRecords
private SAMRecordFactory samRecordFactory;
/**
* Use the caching index reader implementation rather than the disk-hit-per-file model.
*/
private boolean mEnableIndexCaching = false;
/**
* Use the traditional memory-mapped implementation for BAM file indexes rather than regular I/O.
*/
private boolean mEnableIndexMemoryMapping = true;
/**
* Add information about the origin (reader and position) to SAM records.
*/
private SAMFileReader mFileReader = null;
/**
* Prepare to read BAM from a stream (not seekable)
* @param stream source of bytes.
* @param eagerDecode if true, decode all BAM fields as reading rather than lazily.
* @param validationStringency Controls how to handle invalidate reads or header lines.
*/
BAMFileReader(final InputStream stream,
final File indexFile,
final boolean eagerDecode,
final ValidationStringency validationStringency,
final SAMRecordFactory factory)
throws IOException {
mIndexFile = indexFile;
mIsSeekable = false;
mInputStream = stream instanceof BAMInputStream ? (BAMInputStream)stream : new BlockCompressedInputStream(stream);
mStream = new BinaryCodec(new DataInputStream((InputStream)mInputStream));
this.eagerDecode = eagerDecode;
this.mValidationStringency = validationStringency;
this.samRecordFactory = factory;
readHeader(null);
}
/**
* Prepare to read BAM from a file (seekable)
* @param file source of bytes.
* @param eagerDecode if true, decode all BAM fields as reading rather than lazily.
* @param validationStringency Controls how to handle invalidate reads or header lines.
*/
BAMFileReader(final File file,
final File indexFile,
final boolean eagerDecode,
final ValidationStringency validationStringency,
final SAMRecordFactory factory)
throws IOException {
this(new BlockCompressedInputStream(file), indexFile!=null ? indexFile : findIndexFile(file), eagerDecode, file.getAbsolutePath(), validationStringency, factory);
if (mIndexFile != null && mIndexFile.lastModified() < file.lastModified()) {
System.err.println("WARNING: BAM index file " + mIndexFile.getAbsolutePath() +
" is older than BAM " + file.getAbsolutePath());
}
}
BAMFileReader(final SeekableStream strm,
final File indexFile,
final boolean eagerDecode,
final ValidationStringency validationStringency,
final SAMRecordFactory factory)
throws IOException {
this(strm instanceof BAMInputStream ? (BAMInputStream)strm : new BlockCompressedInputStream(strm),
indexFile,
eagerDecode,
strm.getSource(),
validationStringency,
factory);
}
private BAMFileReader(final BAMInputStream inputStream,
final File indexFile,
final boolean eagerDecode,
final String source,
final ValidationStringency validationStringency,
final SAMRecordFactory factory)
throws IOException {
mIndexFile = indexFile;
mIsSeekable = true;
mInputStream = inputStream;
mStream = new BinaryCodec(new DataInputStream((InputStream)inputStream));
this.eagerDecode = eagerDecode;
this.mValidationStringency = validationStringency;
this.samRecordFactory = factory;
readHeader(source);
mFirstRecordPointer = inputStream.getFilePointer();
}
/**
* If true, writes the source of every read into the source SAMRecords.
* @param enabled true to write source information into each SAMRecord.
*/
void enableFileSource(final SAMFileReader reader, final boolean enabled) {
this.mFileReader = enabled ? reader : null;
}
/**
* If true, uses the caching version of the index reader.
* @param enabled true to write source information into each SAMRecord.
*/
public void enableIndexCaching(final boolean enabled) {
if(mIndex != null)
throw new SAMException("Unable to turn on index caching; index file has already been loaded.");
this.mEnableIndexCaching = enabled;
}
/**
* If false, disable the use of memory mapping for accessing index files (default behavior is to use memory mapping).
* This is slower but more scalable when accessing large numbers of BAM files sequentially.
* @param enabled True to use memory mapping, false to use regular I/O.
*/
public void enableIndexMemoryMapping(final boolean enabled) {
if (mIndex != null) {
throw new SAMException("Unable to change index memory mapping; index file has already been loaded.");
}
this.mEnableIndexMemoryMapping = enabled;
}
@Override void enableCrcChecking(final boolean enabled) {
this.mInputStream.setCheckCrcs(enabled);
}
@Override void setSAMRecordFactory(final SAMRecordFactory factory) { this.samRecordFactory = factory; }
/**
* @return true if ths is a BAM file, and has an index
*/
public boolean hasIndex() {
return (mIndexFile != null);
}
/**
* Retrieves the index for the given file type. Ensure that the index is of the specified type.
* @return An index of the given type.
*/
public BAMIndex getIndex() {
if(mIndexFile == null)
throw new SAMException("No index is available for this BAM file.");
if(mIndex == null)
mIndex = mEnableIndexCaching ? new CachingBAMFileIndex(mIndexFile, getFileHeader().getSequenceDictionary(), mEnableIndexMemoryMapping)
: new DiskBasedBAMFileIndex(mIndexFile, getFileHeader().getSequenceDictionary(), mEnableIndexMemoryMapping);
return mIndex;
}
void close() {
if (mStream != null) {
mStream.close();
}
if (mIndex != null) {
mIndex.close();
}
mStream = null;
mFileHeader = null;
mIndex = null;
}
SAMFileHeader getFileHeader() {
return mFileHeader;
}
/**
* Set error-checking level for subsequent SAMRecord reads.
*/
void setValidationStringency(final SAMFileReader.ValidationStringency validationStringency) {
this.mValidationStringency = validationStringency;
}
SAMFileReader.ValidationStringency getValidationStringency() {
return this.mValidationStringency;
}
/**
* Prepare to iterate through the SAMRecords in file order.
* Only a single iterator on a BAM file can be extant at a time. If getIterator() or a query method has been called once,
* that iterator must be closed before getIterator() can be called again.
* A somewhat peculiar aspect of this method is that if the file is not seekable, a second call to
* getIterator() begins its iteration where the last one left off. That is the best that can be
* done in that situation.
*/
CloseableIterator<SAMRecord> getIterator() {
if (mStream == null) {
throw new IllegalStateException("File reader is closed");
}
if (mCurrentIterator != null) {
throw new IllegalStateException("Iteration in progress");
}
if (mIsSeekable) {
try {
mInputStream.seek(mFirstRecordPointer);
} catch (IOException exc) {
throw new RuntimeException(exc.getMessage(), exc);
}
}
mCurrentIterator = new BAMFileIterator();
return mCurrentIterator;
}
@Override
CloseableIterator<SAMRecord> getIterator(final SAMFileSpan chunks) {
if (mStream == null) {
throw new IllegalStateException("File reader is closed");
}
if (mCurrentIterator != null) {
throw new IllegalStateException("Iteration in progress");
}
if (!(chunks instanceof BAMFileSpan)) {
throw new IllegalStateException("BAMFileReader cannot handle this type of file span.");
}
// Create an iterator over the given chunk boundaries.
mCurrentIterator = new BAMFileIndexIterator(((BAMFileSpan)chunks).toCoordinateArray());
return mCurrentIterator;
}
/**
* Gets an unbounded pointer to the first record in the BAM file. Because the reader doesn't necessarily know
* when the file ends, the rightmost bound of the file pointer will not end exactly where the file ends. However,
* the rightmost bound is guaranteed to be after the last read in the file.
* @return An unbounded pointer to the first record in the BAM file.
*/
@Override
SAMFileSpan getFilePointerSpanningReads() {
return new BAMFileSpan(new Chunk(mFirstRecordPointer,Long.MAX_VALUE));
}
/**
* Prepare to iterate through the SAMRecords that match the given interval.
* Only a single iterator on a BAMFile can be extant at a time. The previous one must be closed
* before calling any of the methods that return an iterator.
*
* Note that an unmapped SAMRecord may still have a reference name and an alignment start for sorting
* purposes (typically this is the coordinate of its mate), and will be found by this method if the coordinate
* matches the specified interval.
*
* Note that this method is not necessarily efficient in terms of disk I/O. The index does not have perfect
* resolution, so some SAMRecords may be read and then discarded because they do not match the specified interval.
*
* @param sequence Reference sequence sought.
* @param start Desired SAMRecords must overlap or be contained in the interval specified by start and end.
* A value of zero implies the start of the reference sequence.
* @param end A value of zero implies the end of the reference sequence.
* @param contained If true, the alignments for the SAMRecords must be completely contained in the interval
* specified by start and end. If false, the SAMRecords need only overlap the interval.
* @return Iterator for the matching SAMRecords
*/
CloseableIterator<SAMRecord> query(final String sequence, final int start, final int end, final boolean contained) {
if (mStream == null) {
throw new IllegalStateException("File reader is closed");
}
if (mCurrentIterator != null) {
throw new IllegalStateException("Iteration in progress");
}
if (!mIsSeekable) {
throw new UnsupportedOperationException("Cannot query stream-based BAM file");
}
mCurrentIterator = createIndexIterator(sequence, start, end, contained? QueryType.CONTAINED: QueryType.OVERLAPPING);
return mCurrentIterator;
}
/**
* Prepare to iterate through the SAMRecords with the given alignment start.
* Only a single iterator on a BAMFile can be extant at a time. The previous one must be closed
* before calling any of the methods that return an iterator.
*
* Note that an unmapped SAMRecord may still have a reference name and an alignment start for sorting
* purposes (typically this is the coordinate of its mate), and will be found by this method if the coordinate
* matches the specified interval.
*
* Note that this method is not necessarily efficient in terms of disk I/O. The index does not have perfect
* resolution, so some SAMRecords may be read and then discarded because they do not match the specified interval.
*
* @param sequence Reference sequence sought.
* @param start Alignment start sought.
* @return Iterator for the matching SAMRecords.
*/
CloseableIterator<SAMRecord> queryAlignmentStart(final String sequence, final int start) {
if (mStream == null) {
throw new IllegalStateException("File reader is closed");
}
if (mCurrentIterator != null) {
throw new IllegalStateException("Iteration in progress");
}
if (!mIsSeekable) {
throw new UnsupportedOperationException("Cannot query stream-based BAM file");
}
mCurrentIterator = createIndexIterator(sequence, start, -1, QueryType.STARTING_AT);
return mCurrentIterator;
}
public CloseableIterator<SAMRecord> queryUnmapped() {
if (mStream == null) {
throw new IllegalStateException("File reader is closed");
}
if (mCurrentIterator != null) {
throw new IllegalStateException("Iteration in progress");
}
if (!mIsSeekable) {
throw new UnsupportedOperationException("Cannot query stream-based BAM file");
}
try {
final long startOfLastLinearBin = getIndex().getStartOfLastLinearBin();
if (startOfLastLinearBin != -1) {
mInputStream.seek(startOfLastLinearBin);
} else {
// No mapped reads in file, just start at the first read in file.
mInputStream.seek(mFirstRecordPointer);
}
mCurrentIterator = new BAMFileIndexUnmappedIterator();
return mCurrentIterator;
} catch (IOException e) {
throw new RuntimeException("IOException seeking to unmapped reads", e);
}
}
/**
* Reads the header from the file or stream
* @param source Note that this is used only for reporting errors.
*/
private void readHeader(final String source)
throws IOException {
final byte[] buffer = new byte[4];
mStream.readBytes(buffer);
if (!Arrays.equals(buffer, BAMFileConstants.BAM_MAGIC)) {
throw new IOException("Invalid BAM file header");
}
final int headerTextLength = mStream.readInt();
final String textHeader = mStream.readString(headerTextLength);
final SAMTextHeaderCodec headerCodec = new SAMTextHeaderCodec();
headerCodec.setValidationStringency(mValidationStringency);
mFileHeader = headerCodec.decode(new StringLineReader(textHeader),
source);
final int sequenceCount = mStream.readInt();
if (mFileHeader.getSequenceDictionary().size() > 0) {
// It is allowed to have binary sequences but no text sequences, so only validate if both are present
if (sequenceCount != mFileHeader.getSequenceDictionary().size()) {
throw new SAMFormatException("Number of sequences in text header (" +
mFileHeader.getSequenceDictionary().size() +
") != number of sequences in binary header (" + sequenceCount + ") for file " + source);
}
for (int i = 0; i < sequenceCount; i++) {
final SAMSequenceRecord binarySequenceRecord = readSequenceRecord(source);
final SAMSequenceRecord sequenceRecord = mFileHeader.getSequence(i);
if (!sequenceRecord.getSequenceName().equals(binarySequenceRecord.getSequenceName())) {
throw new SAMFormatException("For sequence " + i + ", text and binary have different names in file " +
source);
}
if (sequenceRecord.getSequenceLength() != binarySequenceRecord.getSequenceLength()) {
throw new SAMFormatException("For sequence " + i + ", text and binary have different lengths in file " +
source);
}
}
} else {
// If only binary sequences are present, copy them into mFileHeader
final List<SAMSequenceRecord> sequences = new ArrayList<SAMSequenceRecord>(sequenceCount);
for (int i = 0; i < sequenceCount; i++) {
sequences.add(readSequenceRecord(source));
}
mFileHeader.setSequenceDictionary(new SAMSequenceDictionary(sequences));
}
}
/**
* Reads a single binary sequence record from the file or stream
* @param source Note that this is used only for reporting errors.
*/
private SAMSequenceRecord readSequenceRecord(final String source) {
final int nameLength = mStream.readInt();
if (nameLength <= 1) {
throw new SAMFormatException("Invalid BAM file header: missing sequence name in file " + source);
}
final String sequenceName = mStream.readString(nameLength - 1);
// Skip the null terminator
mStream.readByte();
final int sequenceLength = mStream.readInt();
return new SAMSequenceRecord(SAMSequenceRecord.truncateSequenceName(sequenceName), sequenceLength);
}
/**
* Iterator for non-indexed sequential iteration through all SAMRecords in file.
* Starting point of iteration is wherever current file position is when the iterator is constructed.
*/
private class BAMFileIterator implements CloseableIterator<SAMRecord> {
private SAMRecord mNextRecord = null;
private final BAMRecordCodec bamRecordCodec;
private long samRecordIndex = 0; // Records at what position (counted in records) we are at in the file
BAMFileIterator() {
this(true);
}
/**
* @param advance Trick to enable subclass to do more setup before advancing
*/
BAMFileIterator(final boolean advance) {
this.bamRecordCodec = new BAMRecordCodec(getFileHeader(), samRecordFactory);
this.bamRecordCodec.setInputStream(BAMFileReader.this.mStream.getInputStream());
if (advance) {
advance();
}
}
public void close() {
if (mCurrentIterator != null && this != mCurrentIterator) {
throw new IllegalStateException("Attempt to close non-current iterator");
}
mCurrentIterator = null;
}
public boolean hasNext() {
return (mNextRecord != null);
}
public SAMRecord next() {
final SAMRecord result = mNextRecord;
advance();
return result;
}
public void remove() {
throw new UnsupportedOperationException("Not supported: remove");
}
void advance() {
try {
mNextRecord = getNextRecord();
if (mNextRecord != null) {
++this.samRecordIndex;
// Because some decoding is done lazily, the record needs to remember the validation stringency.
mNextRecord.setValidationStringency(mValidationStringency);
if (mValidationStringency != ValidationStringency.SILENT) {
final List<SAMValidationError> validationErrors = mNextRecord.isValid();
SAMUtils.processValidationErrors(validationErrors,
this.samRecordIndex, BAMFileReader.this.getValidationStringency());
}
}
if (eagerDecode && mNextRecord != null) {
mNextRecord.eagerDecode();
}
} catch (IOException exc) {
throw new RuntimeException(exc.getMessage(), exc);
}
}
/**
* Read the next record from the input stream.
*/
SAMRecord getNextRecord() throws IOException {
final long startCoordinate = mInputStream.getFilePointer();
final SAMRecord next = bamRecordCodec.decode();
final long stopCoordinate = mInputStream.getFilePointer();
if(mFileReader != null && next != null)
next.setFileSource(new SAMFileSource(mFileReader,new BAMFileSpan(new Chunk(startCoordinate,stopCoordinate))));
return next;
}
/**
* @return The record that will be return by the next call to next()
*/
protected SAMRecord peek() {
return mNextRecord;
}
}
/**
* Prepare to iterate through SAMRecords matching the target interval.
* @param sequence Desired reference sequence.
* @param start 1-based start of target interval, inclusive.
* @param end 1-based end of target interval, inclusive.
* @param queryType contained, overlapping, or starting-at query.
*/
private CloseableIterator<SAMRecord> createIndexIterator(final String sequence,
final int start,
final int end,
final QueryType queryType) {
long[] filePointers = null;
// Hit the index to determine the chunk boundaries for the required data.
final SAMFileHeader fileHeader = getFileHeader();
final int referenceIndex = fileHeader.getSequenceIndex(sequence);
if (referenceIndex != -1) {
final BAMIndex fileIndex = getIndex();
final BAMFileSpan fileSpan = fileIndex.getSpanOverlapping(referenceIndex, start, end);
filePointers = fileSpan != null ? fileSpan.toCoordinateArray() : null;
}
// Create an iterator over the above chunk boundaries.
final BAMFileIndexIterator iterator = new BAMFileIndexIterator(filePointers);
// Add some preprocessing filters for edge-case reads that don't fit into this
// query type.
return new BAMQueryFilteringIterator(iterator,sequence,start,end,queryType);
}
enum QueryType {CONTAINED, OVERLAPPING, STARTING_AT}
/**
* Look for BAM index file according to standard naming convention.
*
* @param dataFile BAM file name.
* @return Index file name, or null if not found.
*/
private static File findIndexFile(final File dataFile) {
// If input is foo.bam, look for foo.bai
final String bamExtension = ".bam";
File indexFile;
final String fileName = dataFile.getName();
if (fileName.endsWith(bamExtension)) {
final String bai = fileName.substring(0, fileName.length() - bamExtension.length()) + BAMIndex.BAMIndexSuffix;
indexFile = new File(dataFile.getParent(), bai);
if (indexFile.exists()) {
return indexFile;
}
}
// If foo.bai doesn't exist look for foo.bam.bai
indexFile = new File(dataFile.getParent(), dataFile.getName() + ".bai");
if (indexFile.exists()) {
return indexFile;
} else {
return null;
}
}
private class BAMFileIndexIterator extends BAMFileIterator {
private long[] mFilePointers = null;
private int mFilePointerIndex = 0;
private long mFilePointerLimit = -1;
/**
* Prepare to iterate through SAMRecords stored in the specified compressed blocks at the given offset.
* @param filePointers the block / offset combination, stored in chunk format.
*/
BAMFileIndexIterator(final long[] filePointers) {
super(false); // delay advance() until after construction
mFilePointers = filePointers;
advance();
}
SAMRecord getNextRecord()
throws IOException {
// Advance to next file block if necessary
while (mInputStream.getFilePointer() >= mFilePointerLimit) {
if (mFilePointers == null ||
mFilePointerIndex >= mFilePointers.length) {
return null;
}
final long startOffset = mFilePointers[mFilePointerIndex++];
final long endOffset = mFilePointers[mFilePointerIndex++];
mInputStream.seek(startOffset);
mFilePointerLimit = endOffset;
}
// Pull next record from stream
return super.getNextRecord();
}
}
/**
* A decorating iterator that filters out records that are outside the bounds of the
* given query parameters.
*/
private class BAMQueryFilteringIterator implements CloseableIterator<SAMRecord> {
/**
* The wrapped iterator.
*/
private final CloseableIterator<SAMRecord> wrappedIterator;
/**
* The next record to be returned. Will be null if no such record exists.
*/
private SAMRecord mNextRecord;
private final int mReferenceIndex;
private final int mRegionStart;
private final int mRegionEnd;
private final QueryType mQueryType;
public BAMQueryFilteringIterator(final CloseableIterator<SAMRecord> iterator,final String sequence, final int start, final int end, final QueryType queryType) {
this.wrappedIterator = iterator;
final SAMFileHeader fileHeader = getFileHeader();
mReferenceIndex = fileHeader.getSequenceIndex(sequence);
mRegionStart = start;
if (queryType == QueryType.STARTING_AT) {
mRegionEnd = mRegionStart;
} else {
mRegionEnd = (end <= 0) ? Integer.MAX_VALUE : end;
}
mQueryType = queryType;
mNextRecord = advance();
}
/**
* Returns true if a next element exists; false otherwise.
*/
public boolean hasNext() {
return mNextRecord != null;
}
/**
* Gets the next record from the given iterator.
* @return The next SAM record in the iterator.
*/
public SAMRecord next() {
if(!hasNext())
throw new NoSuchElementException("BAMQueryFilteringIterator: no next element available");
final SAMRecord currentRead = mNextRecord;
mNextRecord = advance();
return currentRead;
}
/**
* Closes down the existing iterator.
*/
public void close() {
if (this != mCurrentIterator) {
throw new IllegalStateException("Attempt to close non-current iterator");
}
mCurrentIterator = null;
}
/**
* @throws UnsupportedOperationException always.
*/
public void remove() {
throw new UnsupportedOperationException("Not supported: remove");
}
SAMRecord advance() {
while (true) {
// Pull next record from stream
if(!wrappedIterator.hasNext())
return null;
final SAMRecord record = wrappedIterator.next();
// If beyond the end of this reference sequence, end iteration
final int referenceIndex = record.getReferenceIndex();
if (referenceIndex != mReferenceIndex) {
if (referenceIndex < 0 ||
referenceIndex > mReferenceIndex) {
return null;
}
// If before this reference sequence, continue
continue;
}
if (mRegionStart == 0 && mRegionEnd == Integer.MAX_VALUE) {
// Quick exit to avoid expensive alignment end calculation
return record;
}
final int alignmentStart = record.getAlignmentStart();
// If read is unmapped but has a coordinate, return it if the coordinate is within
// the query region, regardless of whether the mapped mate will be returned.
final int alignmentEnd;
if (mQueryType == QueryType.STARTING_AT) {
alignmentEnd = -1;
} else {
alignmentEnd = (record.getAlignmentEnd() != SAMRecord.NO_ALIGNMENT_START?
record.getAlignmentEnd(): alignmentStart);
}
if (alignmentStart > mRegionEnd) {
// If scanned beyond target region, end iteration
return null;
}
// Filter for overlap with region
if (mQueryType == QueryType.CONTAINED) {
if (alignmentStart >= mRegionStart && alignmentEnd <= mRegionEnd) {
return record;
}
} else if (mQueryType == QueryType.OVERLAPPING) {
if (alignmentEnd >= mRegionStart && alignmentStart <= mRegionEnd) {
return record;
}
} else {
if (alignmentStart == mRegionStart) {
return record;
}
}
}
}
}
private class BAMFileIndexUnmappedIterator extends BAMFileIterator {
private BAMFileIndexUnmappedIterator() {
while (this.hasNext() && peek().getReferenceIndex() != SAMRecord.NO_ALIGNMENT_REFERENCE_INDEX) {
advance();
}
}
}
}

View File

@ -143,10 +143,14 @@ public class GATKBAMFileSpan extends BAMFileSpan {
List<GATKChunk> mergedUnion = new ArrayList<GATKChunk>(); List<GATKChunk> mergedUnion = new ArrayList<GATKChunk>();
GATKChunk currentChunk = unmergedUnion.remove(); GATKChunk currentChunk = unmergedUnion.remove();
while(!unmergedUnion.isEmpty()) { while(!unmergedUnion.isEmpty()) {
// Find the end of this range of chunks.
while(!unmergedUnion.isEmpty() && currentChunk.getChunkEnd() >= unmergedUnion.peek().getChunkStart()) { // While the current chunk can be merged with the next chunk:
while( ! unmergedUnion.isEmpty() &&
(currentChunk.overlaps(unmergedUnion.peek()) || currentChunk.isAdjacentTo(unmergedUnion.peek())) ) {
// Merge the current chunk with the next chunk:
GATKChunk nextChunk = unmergedUnion.remove(); GATKChunk nextChunk = unmergedUnion.remove();
currentChunk = new GATKChunk(currentChunk.getChunkStart(),nextChunk.getChunkEnd()); currentChunk = currentChunk.merge(nextChunk);
} }
// Add the accumulated range. // Add the accumulated range.
mergedUnion.add(currentChunk); mergedUnion.add(currentChunk);

View File

@ -40,6 +40,10 @@ public class GATKChunk extends Chunk {
super(start,stop); super(start,stop);
} }
public GATKChunk(final long blockStart, final int blockOffsetStart, final long blockEnd, final int blockOffsetEnd) {
super(blockStart << 16 | blockOffsetStart,blockEnd << 16 | blockOffsetEnd);
}
public GATKChunk(final Chunk chunk) { public GATKChunk(final Chunk chunk) {
super(chunk.getChunkStart(),chunk.getChunkEnd()); super(chunk.getChunkStart(),chunk.getChunkEnd());
} }
@ -96,4 +100,16 @@ public class GATKChunk extends Chunk {
final int offsetSpan = (int)((getChunkEnd()&0xFFFF)-(getChunkStart()&0xFFFF)); final int offsetSpan = (int)((getChunkEnd()&0xFFFF)-(getChunkStart()&0xFFFF));
return chunkSpan + offsetSpan; return chunkSpan + offsetSpan;
} }
/**
* Merges two chunks together. The caller is responsible for testing whether the
* chunks overlap/are adjacent before calling this method!
*
* @param other the chunk to merge with this chunk
* @return a new chunk representing the union of the two chunks (provided the chunks were
* overlapping/adjacent)
*/
public GATKChunk merge ( GATKChunk other ) {
return new GATKChunk(Math.min(getChunkStart(), other.getChunkStart()), Math.max(getChunkEnd(), other.getChunkEnd()));
}
} }

View File

@ -0,0 +1,39 @@
/*
* Copyright (c) 2012, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package net.sf.samtools;
/**
* Utils that insist on being in the same package as Picard.
*/
public class PicardNamespaceUtils {
/**
* Private constructor only. Do not instantiate.
*/
private PicardNamespaceUtils() {}
public static void setFileSource(final SAMRecord read, final SAMFileSource fileSource) {
read.setFileSource(fileSource);
}
}

View File

@ -1,72 +0,0 @@
/*
* Copyright (c) 2011, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package net.sf.samtools.util;
import java.io.IOException;
/**
* An input stream formulated for use reading BAM files. Supports
*/
public interface BAMInputStream {
/**
* Seek to the given position in the file. Note that pos is a special virtual file pointer,
* not an actual byte offset.
*
* @param pos virtual file pointer
*/
public void seek(final long pos) throws IOException;
/**
* @return virtual file pointer that can be passed to seek() to return to the current position. This is
* not an actual byte offset, so arithmetic on file pointers cannot be done to determine the distance between
* the two.
*/
public long getFilePointer();
/**
* Determines whether or not the inflater will re-calculated the CRC on the decompressed data
* and check it against the value stored in the GZIP header. CRC checking is an expensive
* operation and should be used accordingly.
*/
public void setCheckCrcs(final boolean check);
public int read() throws java.io.IOException;
public int read(byte[] bytes) throws java.io.IOException;
public int read(byte[] bytes, int i, int i1) throws java.io.IOException;
public long skip(long l) throws java.io.IOException;
public int available() throws java.io.IOException;
public void close() throws java.io.IOException;
public void mark(int i);
public void reset() throws java.io.IOException;
public boolean markSupported();
}

View File

@ -1,483 +0,0 @@
/*
* The MIT License
*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files (the "Software"), to deal
* in the Software without restriction, including without limitation the rights
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in
* all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
* THE SOFTWARE.
*/
package net.sf.samtools.util;
import java.io.ByteArrayOutputStream;
import java.io.File;
import java.io.IOException;
import java.io.InputStream;
import java.io.RandomAccessFile;
import java.net.URL;
import java.nio.ByteBuffer;
import java.nio.ByteOrder;
import java.util.Arrays;
import net.sf.samtools.FileTruncatedException;
/*
* Utility class for reading BGZF block compressed files. The caller can treat this file like any other InputStream.
* It probably is not necessary to wrap this stream in a buffering stream, because there is internal buffering.
* The advantage of BGZF over conventional GZip format is that BGZF allows for seeking without having to read the
* entire file up to the location being sought. Note that seeking is only possible if the ctor(File) is used.
*
* c.f. http://samtools.sourceforge.net/SAM1.pdf for details of BGZF format
*/
public class BlockCompressedInputStream extends InputStream implements BAMInputStream {
private InputStream mStream = null;
private SeekableStream mFile = null;
private byte[] mFileBuffer = null;
private byte[] mCurrentBlock = null;
private int mCurrentOffset = 0;
private long mBlockAddress = 0;
private int mLastBlockLength = 0;
private final BlockGunzipper blockGunzipper = new BlockGunzipper();
/**
* Note that seek() is not supported if this ctor is used.
*/
public BlockCompressedInputStream(final InputStream stream) {
mStream = IOUtil.toBufferedStream(stream);
mFile = null;
}
/**
* Use this ctor if you wish to call seek()
*/
public BlockCompressedInputStream(final File file)
throws IOException {
mFile = new SeekableFileStream(file);
mStream = null;
}
public BlockCompressedInputStream(final URL url) {
mFile = new SeekableBufferedStream(new SeekableHTTPStream(url));
mStream = null;
}
/**
* For providing some arbitrary data source. No additional buffering is
* provided, so if the underlying source is not buffered, wrap it in a
* SeekableBufferedStream before passing to this ctor.
*/
public BlockCompressedInputStream(final SeekableStream strm) {
mFile = strm;
mStream = null;
}
/**
* Determines whether or not the inflater will re-calculated the CRC on the decompressed data
* and check it against the value stored in the GZIP header. CRC checking is an expensive
* operation and should be used accordingly.
*/
public void setCheckCrcs(final boolean check) {
this.blockGunzipper.setCheckCrcs(check);
}
/**
* @return the number of bytes that can be read (or skipped over) from this input stream without blocking by the
* next caller of a method for this input stream. The next caller might be the same thread or another thread.
* Note that although the next caller can read this many bytes without blocking, the available() method call itself
* may block in order to fill an internal buffer if it has been exhausted.
*/
public int available()
throws IOException {
if (mCurrentBlock == null || mCurrentOffset == mCurrentBlock.length) {
readBlock();
}
if (mCurrentBlock == null) {
return 0;
}
return mCurrentBlock.length - mCurrentOffset;
}
/**
* Closes the underlying InputStream or RandomAccessFile
*/
public void close()
throws IOException {
if (mFile != null) {
mFile.close();
mFile = null;
} else if (mStream != null) {
mStream.close();
mStream = null;
}
// Encourage garbage collection
mFileBuffer = null;
mCurrentBlock = null;
}
/**
* Reads the next byte of data from the input stream. The value byte is returned as an int in the range 0 to 255.
* If no byte is available because the end of the stream has been reached, the value -1 is returned.
* This method blocks until input data is available, the end of the stream is detected, or an exception is thrown.
* @return the next byte of data, or -1 if the end of the stream is reached.
*/
public int read()
throws IOException {
return (available() > 0) ? mCurrentBlock[mCurrentOffset++] : -1;
}
/**
* Reads some number of bytes from the input stream and stores them into the buffer array b. The number of bytes
* actually read is returned as an integer. This method blocks until input data is available, end of file is detected,
* or an exception is thrown.
*
* read(buf) has the same effect as read(buf, 0, buf.length).
*
* @param buffer the buffer into which the data is read.
* @return the total number of bytes read into the buffer, or -1 is there is no more data because the end of
* the stream has been reached.
*/
public int read(final byte[] buffer)
throws IOException {
return read(buffer, 0, buffer.length);
}
private volatile ByteArrayOutputStream buf = null;
private static final byte eol = '\n';
private static final byte eolCr = '\r';
/**
* Reads a whole line. A line is considered to be terminated by either a line feed ('\n'),
* carriage return ('\r') or carriage return followed by a line feed ("\r\n").
*
* @return A String containing the contents of the line, excluding the line terminating
* character, or null if the end of the stream has been reached
*
* @exception IOException If an I/O error occurs
* @
*/
public String readLine() throws IOException {
int available = available();
if (available == 0) {
return null;
}
if(null == buf){ // lazy initialisation
buf = new ByteArrayOutputStream(8192);
}
buf.reset();
boolean done = false;
boolean foundCr = false; // \r found flag
while (!done) {
int linetmpPos = mCurrentOffset;
int bCnt = 0;
while((available-- > 0)){
final byte c = mCurrentBlock[linetmpPos++];
if(c == eol){ // found \n
done = true;
break;
} else if(foundCr){ // previous char was \r
--linetmpPos; // current char is not \n so put it back
done = true;
break;
} else if(c == eolCr){ // found \r
foundCr = true;
continue; // no ++bCnt
}
++bCnt;
}
if(mCurrentOffset < linetmpPos){
buf.write(mCurrentBlock, mCurrentOffset, bCnt);
mCurrentOffset = linetmpPos;
}
available = available();
if(available == 0){
// EOF
done = true;
}
}
return buf.toString();
}
/**
* Reads up to len bytes of data from the input stream into an array of bytes. An attempt is made to read
* as many as len bytes, but a smaller number may be read. The number of bytes actually read is returned as an integer.
*
* This method blocks until input data is available, end of file is detected, or an exception is thrown.
*
* @param buffer buffer into which data is read.
* @param offset the start offset in array b at which the data is written.
* @param length the maximum number of bytes to read.
* @return the total number of bytes read into the buffer, or -1 if there is no more data because the end of
* the stream has been reached.
*/
public int read(final byte[] buffer, int offset, int length)
throws IOException {
final int originalLength = length;
while (length > 0) {
final int available = available();
if (available == 0) {
// Signal EOF to caller
if (originalLength == length) {
return -1;
}
break;
}
final int copyLength = Math.min(length, available);
System.arraycopy(mCurrentBlock, mCurrentOffset, buffer, offset, copyLength);
mCurrentOffset += copyLength;
offset += copyLength;
length -= copyLength;
}
return originalLength - length;
}
/**
* Seek to the given position in the file. Note that pos is a special virtual file pointer,
* not an actual byte offset.
*
* @param pos virtual file pointer
*/
public void seek(final long pos)
throws IOException {
if (mFile == null) {
throw new IOException("Cannot seek on stream based file");
}
// Decode virtual file pointer
// Upper 48 bits is the byte offset into the compressed stream of a block.
// Lower 16 bits is the byte offset into the uncompressed stream inside the block.
final long compressedOffset = BlockCompressedFilePointerUtil.getBlockAddress(pos);
final int uncompressedOffset = BlockCompressedFilePointerUtil.getBlockOffset(pos);
final int available;
if (mBlockAddress == compressedOffset && mCurrentBlock != null) {
available = mCurrentBlock.length;
} else {
mFile.seek(compressedOffset);
mBlockAddress = compressedOffset;
mLastBlockLength = 0;
readBlock();
available = available();
}
if (uncompressedOffset > available ||
(uncompressedOffset == available && !eof())) {
throw new IOException("Invalid file pointer: " + pos);
}
mCurrentOffset = uncompressedOffset;
}
private boolean eof() throws IOException {
if (mFile.eof()) {
return true;
}
// If the last remaining block is the size of the EMPTY_GZIP_BLOCK, this is the same as being at EOF.
return (mFile.length() - (mBlockAddress + mLastBlockLength) == BlockCompressedStreamConstants.EMPTY_GZIP_BLOCK.length);
}
/**
* @return virtual file pointer that can be passed to seek() to return to the current position. This is
* not an actual byte offset, so arithmetic on file pointers cannot be done to determine the distance between
* the two.
*/
public long getFilePointer() {
if (mCurrentOffset == mCurrentBlock.length) {
// If current offset is at the end of the current block, file pointer should point
// to the beginning of the next block.
return BlockCompressedFilePointerUtil.makeFilePointer(mBlockAddress + mLastBlockLength, 0);
}
return BlockCompressedFilePointerUtil.makeFilePointer(mBlockAddress, mCurrentOffset);
}
public static long getFileBlock(final long bgzfOffset) {
return BlockCompressedFilePointerUtil.getBlockAddress(bgzfOffset);
}
/**
* @param stream Must be at start of file. Throws RuntimeException if !stream.markSupported().
* @return true if the given file looks like a valid BGZF file.
*/
public static boolean isValidFile(final InputStream stream)
throws IOException {
if (!stream.markSupported()) {
throw new RuntimeException("Cannot test non-buffered stream");
}
stream.mark(BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH);
final byte[] buffer = new byte[BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH];
final int count = readBytes(stream, buffer, 0, BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH);
stream.reset();
return count == BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH && isValidBlockHeader(buffer);
}
private static boolean isValidBlockHeader(final byte[] buffer) {
return (buffer[0] == BlockCompressedStreamConstants.GZIP_ID1 &&
(buffer[1] & 0xFF) == BlockCompressedStreamConstants.GZIP_ID2 &&
(buffer[3] & BlockCompressedStreamConstants.GZIP_FLG) != 0 &&
buffer[10] == BlockCompressedStreamConstants.GZIP_XLEN &&
buffer[12] == BlockCompressedStreamConstants.BGZF_ID1 &&
buffer[13] == BlockCompressedStreamConstants.BGZF_ID2);
}
private void readBlock()
throws IOException {
if (mFileBuffer == null) {
mFileBuffer = new byte[BlockCompressedStreamConstants.MAX_COMPRESSED_BLOCK_SIZE];
}
int count = readBytes(mFileBuffer, 0, BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH);
if (count == 0) {
// Handle case where there is no empty gzip block at end.
mCurrentOffset = 0;
mBlockAddress += mLastBlockLength;
mCurrentBlock = new byte[0];
return;
}
if (count != BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH) {
throw new IOException("Premature end of file");
}
final int blockLength = unpackInt16(mFileBuffer, BlockCompressedStreamConstants.BLOCK_LENGTH_OFFSET) + 1;
if (blockLength < BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH || blockLength > mFileBuffer.length) {
throw new IOException("Unexpected compressed block length: " + blockLength);
}
final int remaining = blockLength - BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH;
count = readBytes(mFileBuffer, BlockCompressedStreamConstants.BLOCK_HEADER_LENGTH, remaining);
if (count != remaining) {
throw new FileTruncatedException("Premature end of file");
}
inflateBlock(mFileBuffer, blockLength);
mCurrentOffset = 0;
mBlockAddress += mLastBlockLength;
mLastBlockLength = blockLength;
}
private void inflateBlock(final byte[] compressedBlock, final int compressedLength)
throws IOException {
final int uncompressedLength = unpackInt32(compressedBlock, compressedLength-4);
byte[] buffer = mCurrentBlock;
mCurrentBlock = null;
if (buffer == null || buffer.length != uncompressedLength) {
try {
buffer = new byte[uncompressedLength];
} catch (NegativeArraySizeException e) {
throw new RuntimeException("BGZF file has invalid uncompressedLength: " + uncompressedLength, e);
}
}
blockGunzipper.unzipBlock(buffer, compressedBlock, compressedLength);
mCurrentBlock = buffer;
}
private int readBytes(final byte[] buffer, final int offset, final int length)
throws IOException {
if (mFile != null) {
return readBytes(mFile, buffer, offset, length);
} else if (mStream != null) {
return readBytes(mStream, buffer, offset, length);
} else {
return 0;
}
}
private static int readBytes(final SeekableStream file, final byte[] buffer, final int offset, final int length)
throws IOException {
int bytesRead = 0;
while (bytesRead < length) {
final int count = file.read(buffer, offset + bytesRead, length - bytesRead);
if (count <= 0) {
break;
}
bytesRead += count;
}
return bytesRead;
}
private static int readBytes(final InputStream stream, final byte[] buffer, final int offset, final int length)
throws IOException {
int bytesRead = 0;
while (bytesRead < length) {
final int count = stream.read(buffer, offset + bytesRead, length - bytesRead);
if (count <= 0) {
break;
}
bytesRead += count;
}
return bytesRead;
}
private int unpackInt16(final byte[] buffer, final int offset) {
return ((buffer[offset] & 0xFF) |
((buffer[offset+1] & 0xFF) << 8));
}
private int unpackInt32(final byte[] buffer, final int offset) {
return ((buffer[offset] & 0xFF) |
((buffer[offset+1] & 0xFF) << 8) |
((buffer[offset+2] & 0xFF) << 16) |
((buffer[offset+3] & 0xFF) << 24));
}
public enum FileTermination {HAS_TERMINATOR_BLOCK, HAS_HEALTHY_LAST_BLOCK, DEFECTIVE}
public static FileTermination checkTermination(final File file)
throws IOException {
final long fileSize = file.length();
if (fileSize < BlockCompressedStreamConstants.EMPTY_GZIP_BLOCK.length) {
return FileTermination.DEFECTIVE;
}
final RandomAccessFile raFile = new RandomAccessFile(file, "r");
try {
raFile.seek(fileSize - BlockCompressedStreamConstants.EMPTY_GZIP_BLOCK.length);
byte[] buf = new byte[BlockCompressedStreamConstants.EMPTY_GZIP_BLOCK.length];
raFile.readFully(buf);
if (Arrays.equals(buf, BlockCompressedStreamConstants.EMPTY_GZIP_BLOCK)) {
return FileTermination.HAS_TERMINATOR_BLOCK;
}
final int bufsize = (int)Math.min(fileSize, BlockCompressedStreamConstants.MAX_COMPRESSED_BLOCK_SIZE);
buf = new byte[bufsize];
raFile.seek(fileSize - bufsize);
raFile.read(buf);
for (int i = buf.length - BlockCompressedStreamConstants.EMPTY_GZIP_BLOCK.length;
i >= 0; --i) {
if (!preambleEqual(BlockCompressedStreamConstants.GZIP_BLOCK_PREAMBLE,
buf, i, BlockCompressedStreamConstants.GZIP_BLOCK_PREAMBLE.length)) {
continue;
}
final ByteBuffer byteBuffer = ByteBuffer.wrap(buf, i + BlockCompressedStreamConstants.GZIP_BLOCK_PREAMBLE.length, 4);
byteBuffer.order(ByteOrder.LITTLE_ENDIAN);
final int totalBlockSizeMinusOne = byteBuffer.getShort() & 0xFFFF;
if (buf.length - i == totalBlockSizeMinusOne + 1) {
return FileTermination.HAS_HEALTHY_LAST_BLOCK;
} else {
return FileTermination.DEFECTIVE;
}
}
return FileTermination.DEFECTIVE;
} finally {
raFile.close();
}
}
private static boolean preambleEqual(final byte[] preamble, final byte[] buf, final int startOffset, final int length) {
for (int i = 0; i < length; ++i) {
if (preamble[i] != buf[i + startOffset]) {
return false;
}
}
return true;
}
}

View File

@ -139,11 +139,11 @@ public class AnalyzeCovariates extends CommandLineProgram {
*/ */
@Argument(fullName="max_histogram_value", shortName="maxHist", required = false, doc="If supplied, this value will be the max value of the histogram plots") @Argument(fullName="max_histogram_value", shortName="maxHist", required = false, doc="If supplied, this value will be the max value of the histogram plots")
private int MAX_HISTOGRAM_VALUE = 0; private int MAX_HISTOGRAM_VALUE = 0;
@Hidden @Hidden
@Argument(fullName="do_indel_quality", shortName="indels", required = false, doc="If supplied, do indel quality plotting") @Argument(fullName="do_indel_quality", shortName="indels", required = false, doc="If supplied, do indel quality plotting")
private boolean DO_INDEL_QUALITY = false; private boolean DO_INDEL_QUALITY = false;
///////////////////////////// /////////////////////////////
// Private Member Variables // Private Member Variables
///////////////////////////// /////////////////////////////
@ -274,7 +274,6 @@ public class AnalyzeCovariates extends CommandLineProgram {
RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 ); RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 );
// Add that datum to all the collapsed tables which will be used in the sequential calculation // Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, IGNORE_QSCORES_LESS_THAN ); dataManager.addToAllTables( key, datum, IGNORE_QSCORES_LESS_THAN );
} }
private void writeDataTables() { private void writeDataTables() {
@ -341,7 +340,7 @@ public class AnalyzeCovariates extends CommandLineProgram {
// for each covariate // for each covariate
for( int iii = 1; iii < requestedCovariates.size(); iii++ ) { for( int iii = 1; iii < requestedCovariates.size(); iii++ ) {
Covariate cov = requestedCovariates.get(iii); final Covariate cov = requestedCovariates.get(iii);
final File outputFile = new File(OUTPUT_DIR, readGroup + "." + cov.getClass().getSimpleName()+ ".dat"); final File outputFile = new File(OUTPUT_DIR, readGroup + "." + cov.getClass().getSimpleName()+ ".dat");
if (DO_INDEL_QUALITY) { if (DO_INDEL_QUALITY) {
RScriptExecutor executor = new RScriptExecutor(); RScriptExecutor executor = new RScriptExecutor();
@ -349,7 +348,7 @@ public class AnalyzeCovariates extends CommandLineProgram {
// The second argument is the name of the covariate in order to make the plots look nice // The second argument is the name of the covariate in order to make the plots look nice
executor.addArgs(outputFile, cov.getClass().getSimpleName().split("Covariate")[0]); executor.addArgs(outputFile, cov.getClass().getSimpleName().split("Covariate")[0]);
executor.exec(); executor.exec();
} else { } else {
if( iii == 1 ) { if( iii == 1 ) {
// Analyze reported quality // Analyze reported quality
RScriptExecutor executor = new RScriptExecutor(); RScriptExecutor executor = new RScriptExecutor();

View File

@ -53,6 +53,7 @@ import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.interval.IntervalSetRule; import org.broadinstitute.sting.utils.interval.IntervalSetRule;
import org.broadinstitute.sting.utils.interval.IntervalUtils; import org.broadinstitute.sting.utils.interval.IntervalUtils;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import java.io.File; import java.io.File;
import java.util.*; import java.util.*;
@ -179,10 +180,18 @@ public class GenomeAnalysisEngine {
*/ */
private static final long GATK_RANDOM_SEED = 47382911L; private static final long GATK_RANDOM_SEED = 47382911L;
private static Random randomGenerator = new Random(GATK_RANDOM_SEED); private static Random randomGenerator = new Random(GATK_RANDOM_SEED);
public static Random getRandomGenerator() { return randomGenerator; } public static Random getRandomGenerator() { return randomGenerator; }
public static void resetRandomGenerator() { randomGenerator.setSeed(GATK_RANDOM_SEED); } public static void resetRandomGenerator() { randomGenerator.setSeed(GATK_RANDOM_SEED); }
public static void resetRandomGenerator(long seed) { randomGenerator.setSeed(seed); } public static void resetRandomGenerator(long seed) { randomGenerator.setSeed(seed); }
/**
* Base Quality Score Recalibration helper object
*/
private BaseRecalibration baseRecalibration = null;
public BaseRecalibration getBaseRecalibration() { return baseRecalibration; }
public boolean hasBaseRecalibration() { return baseRecalibration != null; }
public void setBaseRecalibration(File recalFile) { baseRecalibration = new BaseRecalibration(recalFile); }
/** /**
* Actually run the GATK with the specified walker. * Actually run the GATK with the specified walker.
* *
@ -205,6 +214,10 @@ public class GenomeAnalysisEngine {
if (this.getArguments().nonDeterministicRandomSeed) if (this.getArguments().nonDeterministicRandomSeed)
resetRandomGenerator(System.currentTimeMillis()); resetRandomGenerator(System.currentTimeMillis());
// if the use specified an input BQSR recalibration table then enable on the fly recalibration
if (this.getArguments().BQSR_RECAL_FILE != null)
setBaseRecalibration(this.getArguments().BQSR_RECAL_FILE);
// Determine how the threads should be divided between CPU vs. IO. // Determine how the threads should be divided between CPU vs. IO.
determineThreadAllocation(); determineThreadAllocation();
@ -224,7 +237,7 @@ public class GenomeAnalysisEngine {
// create temp directories as necessary // create temp directories as necessary
initializeTempDirectory(); initializeTempDirectory();
// create the output streams " // create the output streams
initializeOutputStreams(microScheduler.getOutputTracker()); initializeOutputStreams(microScheduler.getOutputTracker());
Iterable<Shard> shardStrategy = getShardStrategy(readsDataSource,microScheduler.getReference(),intervals); Iterable<Shard> shardStrategy = getShardStrategy(readsDataSource,microScheduler.getReference(),intervals);
@ -757,6 +770,7 @@ public class GenomeAnalysisEngine {
getWalkerBAQApplicationTime() == BAQ.ApplicationTime.ON_INPUT ? argCollection.BAQMode : BAQ.CalculationMode.OFF, getWalkerBAQApplicationTime() == BAQ.ApplicationTime.ON_INPUT ? argCollection.BAQMode : BAQ.CalculationMode.OFF,
getWalkerBAQQualityMode(), getWalkerBAQQualityMode(),
refReader, refReader,
getBaseRecalibration(),
argCollection.defaultBaseQualities); argCollection.defaultBaseQualities);
} }

View File

@ -7,6 +7,7 @@ import org.broadinstitute.sting.gatk.arguments.ValidationExclusion;
import org.broadinstitute.sting.gatk.datasources.reads.SAMReaderID; import org.broadinstitute.sting.gatk.datasources.reads.SAMReaderID;
import org.broadinstitute.sting.gatk.filters.ReadFilter; import org.broadinstitute.sting.gatk.filters.ReadFilter;
import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import java.util.Collection; import java.util.Collection;
/** /**
@ -27,23 +28,20 @@ import java.util.Collection;
* information about how they should be downsampled, sorted, and filtered. * information about how they should be downsampled, sorted, and filtered.
*/ */
public class ReadProperties { public class ReadProperties {
private Collection<SAMReaderID> readers = null; private final Collection<SAMReaderID> readers;
private SAMFileHeader header = null; private final SAMFileHeader header;
private SAMFileReader.ValidationStringency validationStringency = SAMFileReader.ValidationStringency.STRICT; private final SAMFileReader.ValidationStringency validationStringency;
private DownsamplingMethod downsamplingMethod = null; private final DownsamplingMethod downsamplingMethod;
private ValidationExclusion exclusionList = null; private final ValidationExclusion exclusionList;
private Collection<ReadFilter> supplementalFilters = null; private final Collection<ReadFilter> supplementalFilters;
private boolean includeReadsWithDeletionAtLoci = false; private final boolean includeReadsWithDeletionAtLoci;
private boolean useOriginalBaseQualities = false; private final boolean useOriginalBaseQualities;
private boolean generateExtendedEvents = false; private final boolean generateExtendedEvents;
private BAQ.CalculationMode cmode = BAQ.CalculationMode.OFF; private final BAQ.CalculationMode cmode;
private BAQ.QualityMode qmode = BAQ.QualityMode.DONT_MODIFY; private final BAQ.QualityMode qmode;
IndexedFastaSequenceFile refReader = null; // read for BAQ, if desired private final IndexedFastaSequenceFile refReader; // read for BAQ, if desired
private byte defaultBaseQualities; private final BaseRecalibration bqsrApplier;
private final byte defaultBaseQualities;
// do we want to generate additional piles of "extended" events (indels)
// immediately after the reference base such event is associated with?
/** /**
* Return true if the walker wants to see reads that contain deletions when looking at locus pileups * Return true if the walker wants to see reads that contain deletions when looking at locus pileups
@ -126,6 +124,8 @@ public class ReadProperties {
return refReader; return refReader;
} }
public BaseRecalibration getBQSRApplier() { return bqsrApplier; }
/** /**
* @return Default base quality value to fill reads missing base quality information. * @return Default base quality value to fill reads missing base quality information.
*/ */
@ -165,8 +165,9 @@ public class ReadProperties {
boolean includeReadsWithDeletionAtLoci, boolean includeReadsWithDeletionAtLoci,
boolean generateExtendedEvents, boolean generateExtendedEvents,
BAQ.CalculationMode cmode, BAQ.CalculationMode cmode,
BAQ.QualityMode qmode, BAQ.QualityMode qmode,
IndexedFastaSequenceFile refReader, IndexedFastaSequenceFile refReader,
BaseRecalibration bqsrApplier,
byte defaultBaseQualities) { byte defaultBaseQualities) {
this.readers = samFiles; this.readers = samFiles;
this.header = header; this.header = header;
@ -180,6 +181,7 @@ public class ReadProperties {
this.cmode = cmode; this.cmode = cmode;
this.qmode = qmode; this.qmode = qmode;
this.refReader = refReader; this.refReader = refReader;
this.bqsrApplier = bqsrApplier;
this.defaultBaseQualities = defaultBaseQualities; this.defaultBaseQualities = defaultBaseQualities;
} }
} }

View File

@ -75,6 +75,7 @@ public class GATKArgumentCollection {
* Using this option one can instruct the GATK engine to traverse over only part of the genome. This argument can be specified multiple times. * Using this option one can instruct the GATK engine to traverse over only part of the genome. This argument can be specified multiple times.
* One may use samtools-style intervals either explicitly (e.g. -L chr1 or -L chr1:100-200) or listed in a file (e.g. -L myFile.intervals). * One may use samtools-style intervals either explicitly (e.g. -L chr1 or -L chr1:100-200) or listed in a file (e.g. -L myFile.intervals).
* Additionally, one may specify a rod file to traverse over the positions for which there is a record in the file (e.g. -L file.vcf). * Additionally, one may specify a rod file to traverse over the positions for which there is a record in the file (e.g. -L file.vcf).
* To specify the completely unmapped reads in the BAM file (i.e. those without a reference contig) use -L unmapped.
*/ */
@Input(fullName = "intervals", shortName = "L", doc = "One or more genomic intervals over which to operate. Can be explicitly specified on the command line or in a file (including a rod file)", required = false) @Input(fullName = "intervals", shortName = "L", doc = "One or more genomic intervals over which to operate. Can be explicitly specified on the command line or in a file (including a rod file)", required = false)
public List<IntervalBinding<Feature>> intervals = null; public List<IntervalBinding<Feature>> intervals = null;
@ -185,6 +186,15 @@ public class GATKArgumentCollection {
@Argument(fullName="useOriginalQualities", shortName = "OQ", doc = "If set, use the original base quality scores from the OQ tag when present instead of the standard scores", required=false) @Argument(fullName="useOriginalQualities", shortName = "OQ", doc = "If set, use the original base quality scores from the OQ tag when present instead of the standard scores", required=false)
public Boolean useOriginalBaseQualities = false; public Boolean useOriginalBaseQualities = false;
/**
* After the header, data records occur one per line until the end of the file. The first several items on a line are the
* values of the individual covariates and will change depending on which covariates were specified at runtime. The last
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/
@Input(fullName="BQSR", shortName="BQSR", required=false, doc="Filename for the input covariates table recalibration .csv file which enables on the fly base quality score recalibration")
public File BQSR_RECAL_FILE = null; // BUGBUG: need a better argument name once we decide how BQSRs v1 and v2 will live in the code base simultaneously
@Argument(fullName="defaultBaseQualities", shortName = "DBQ", doc = "If reads are missing some or all base quality scores, this value will be used for all base quality scores", required=false) @Argument(fullName="defaultBaseQualities", shortName = "DBQ", doc = "If reads are missing some or all base quality scores, this value will be used for all base quality scores", required=false)
public byte defaultBaseQualities = -1; public byte defaultBaseQualities = -1;

View File

@ -25,9 +25,14 @@ import java.util.NoSuchElementException;
*/ */
/** /**
* A queue of locus context entries. * The two goals of the LocusView are as follows:
* 1) To provide a 'trigger track' iteration interface so that TraverseLoci can easily switch
* between iterating over all bases in a region, only covered bases in a region covered by
* reads, only bases in a region covered by RODs, or any other sort of trigger track
* implementation one can think of.
* 2) To manage the copious number of iterators that have to be jointly pulled through the
* genome to make a locus traversal function.
*/ */
public abstract class LocusView extends LocusIterator implements View { public abstract class LocusView extends LocusIterator implements View {
/** /**
* The locus bounding this view. * The locus bounding this view.

View File

@ -27,8 +27,10 @@ package org.broadinstitute.sting.gatk.datasources.reads;
import net.sf.picard.util.PeekableIterator; import net.sf.picard.util.PeekableIterator;
import net.sf.samtools.GATKBAMFileSpan; import net.sf.samtools.GATKBAMFileSpan;
import net.sf.samtools.GATKChunk; import net.sf.samtools.GATKChunk;
import net.sf.samtools.util.BlockCompressedFilePointerUtil;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.LinkedList;
import java.util.List; import java.util.List;
/** /**
@ -38,7 +40,7 @@ import java.util.List;
* Time: 10:47 PM * Time: 10:47 PM
* To change this template use File | Settings | File Templates. * To change this template use File | Settings | File Templates.
*/ */
class SAMReaderPosition { class BAMAccessPlan {
private final SAMReaderID reader; private final SAMReaderID reader;
private final BlockInputStream inputStream; private final BlockInputStream inputStream;
@ -51,7 +53,7 @@ class SAMReaderPosition {
private long nextBlockAddress; private long nextBlockAddress;
SAMReaderPosition(final SAMReaderID reader, final BlockInputStream inputStream, GATKBAMFileSpan fileSpan) { BAMAccessPlan(final SAMReaderID reader, final BlockInputStream inputStream, GATKBAMFileSpan fileSpan) {
this.reader = reader; this.reader = reader;
this.inputStream = inputStream; this.inputStream = inputStream;
@ -84,11 +86,45 @@ class SAMReaderPosition {
} }
/** /**
* Retrieves the last offset of interest in the block returned by getBlockAddress(). * Gets the spans overlapping the given block; used to copy the contents of the block into the circular buffer.
* @return First block of interest in this segment. * @param blockAddress Block address for which to search.
* @param filePosition Block address at which to terminate the last chunk if the last chunk goes beyond this span.
* @return list of chunks containing that block.
*/ */
public int getLastOffsetInBlock() { public List<GATKChunk> getSpansOverlappingBlock(long blockAddress, long filePosition) {
return (nextBlockAddress == positionIterator.peek().getBlockEnd()) ? positionIterator.peek().getBlockOffsetEnd() : 65536; List<GATKChunk> spansOverlapping = new LinkedList<GATKChunk>();
// While the position iterator overlaps the given block, pull out spans to report.
while(positionIterator.hasNext() && positionIterator.peek().getBlockStart() <= blockAddress) {
// Create a span over as much of the block as is covered by this chunk.
int blockOffsetStart = (blockAddress == positionIterator.peek().getBlockStart()) ? positionIterator.peek().getBlockOffsetStart() : 0;
// Calculate the end of this span. If the span extends past this block, cap it using the current file position.
long blockEnd;
int blockOffsetEnd;
if(blockAddress < positionIterator.peek().getBlockEnd()) {
blockEnd = filePosition;
blockOffsetEnd = 0;
}
else {
blockEnd = positionIterator.peek().getBlockEnd();
blockOffsetEnd = positionIterator.peek().getBlockOffsetEnd();
}
GATKChunk newChunk = new GATKChunk(blockAddress,blockOffsetStart,blockEnd,blockOffsetEnd);
if(newChunk.getChunkStart() <= newChunk.getChunkEnd())
spansOverlapping.add(new GATKChunk(blockAddress,blockOffsetStart,blockEnd,blockOffsetEnd));
// If the value currently stored in the position iterator ends past the current block, we must be done. Abort.
if(!positionIterator.hasNext() || positionIterator.peek().getBlockEnd() > blockAddress)
break;
// If the position iterator ends before the block ends, pull the position iterator forward.
if(positionIterator.peek().getBlockEnd() <= blockAddress)
positionIterator.next();
}
return spansOverlapping;
} }
public void reset() { public void reset() {
@ -111,20 +147,16 @@ class SAMReaderPosition {
* @param filePosition The current position within the file. * @param filePosition The current position within the file.
*/ */
void advancePosition(final long filePosition) { void advancePosition(final long filePosition) {
nextBlockAddress = filePosition >> 16; nextBlockAddress = BlockCompressedFilePointerUtil.getBlockAddress(filePosition);
// Check the current file position against the iterator; if the iterator is before the current file position, // Check the current file position against the iterator; if the iterator is before the current file position,
// draw the iterator forward. Remember when performing the check that coordinates are half-open! // draw the iterator forward. Remember when performing the check that coordinates are half-open!
while(positionIterator.hasNext() && isFilePositionPastEndOfChunk(filePosition,positionIterator.peek())) { while(positionIterator.hasNext() && isFilePositionPastEndOfChunk(filePosition,positionIterator.peek()))
positionIterator.next(); positionIterator.next();
// If the block iterator has shot past the file pointer, bring the file pointer flush with the start of the current block. // If the block iterator has shot past the file pointer, bring the file pointer flush with the start of the current block.
if(positionIterator.hasNext() && filePosition < positionIterator.peek().getChunkStart()) { if(positionIterator.hasNext() && filePosition < positionIterator.peek().getChunkStart())
nextBlockAddress = positionIterator.peek().getBlockStart(); nextBlockAddress = positionIterator.peek().getBlockStart();
//System.out.printf("SAMReaderPosition: next block address advanced to %d%n",nextBlockAddress);
break;
}
}
// If we've shot off the end of the block pointer, notify consumers that iteration is complete. // If we've shot off the end of the block pointer, notify consumers that iteration is complete.
if(!positionIterator.hasNext()) if(!positionIterator.hasNext())

View File

@ -44,12 +44,12 @@ public class BGZFBlockLoadingDispatcher {
private final ExecutorService threadPool; private final ExecutorService threadPool;
private final Queue<SAMReaderPosition> inputQueue; private final Queue<BAMAccessPlan> inputQueue;
public BGZFBlockLoadingDispatcher(final int numThreads, final int numFileHandles) { public BGZFBlockLoadingDispatcher(final int numThreads, final int numFileHandles) {
threadPool = Executors.newFixedThreadPool(numThreads); threadPool = Executors.newFixedThreadPool(numThreads);
fileHandleCache = new FileHandleCache(numFileHandles); fileHandleCache = new FileHandleCache(numFileHandles);
inputQueue = new LinkedList<SAMReaderPosition>(); inputQueue = new LinkedList<BAMAccessPlan>();
threadPool.execute(new BlockLoader(this,fileHandleCache,true)); threadPool.execute(new BlockLoader(this,fileHandleCache,true));
} }
@ -58,7 +58,7 @@ public class BGZFBlockLoadingDispatcher {
* Initiates a request for a new block load. * Initiates a request for a new block load.
* @param readerPosition Position at which to load. * @param readerPosition Position at which to load.
*/ */
void queueBlockLoad(final SAMReaderPosition readerPosition) { void queueBlockLoad(final BAMAccessPlan readerPosition) {
synchronized(inputQueue) { synchronized(inputQueue) {
inputQueue.add(readerPosition); inputQueue.add(readerPosition);
inputQueue.notify(); inputQueue.notify();
@ -69,7 +69,7 @@ public class BGZFBlockLoadingDispatcher {
* Claims the next work request from the queue. * Claims the next work request from the queue.
* @return The next work request, or null if none is available. * @return The next work request, or null if none is available.
*/ */
SAMReaderPosition claimNextWorkRequest() { BAMAccessPlan claimNextWorkRequest() {
synchronized(inputQueue) { synchronized(inputQueue) {
while(inputQueue.isEmpty()) { while(inputQueue.isEmpty()) {
try { try {

View File

@ -26,24 +26,21 @@ package org.broadinstitute.sting.gatk.datasources.reads;
import net.sf.samtools.GATKBAMFileSpan; import net.sf.samtools.GATKBAMFileSpan;
import net.sf.samtools.GATKChunk; import net.sf.samtools.GATKChunk;
import net.sf.samtools.util.BAMInputStream;
import net.sf.samtools.util.BlockCompressedFilePointerUtil;
import net.sf.samtools.util.BlockCompressedInputStream; import net.sf.samtools.util.BlockCompressedInputStream;
import net.sf.samtools.util.RuntimeEOFException;
import net.sf.samtools.util.SeekableStream;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.io.IOException; import java.io.IOException;
import java.io.InputStream;
import java.nio.ByteBuffer; import java.nio.ByteBuffer;
import java.nio.ByteOrder; import java.nio.ByteOrder;
import java.util.Arrays; import java.util.Arrays;
import java.util.Iterator;
import java.util.LinkedList; import java.util.LinkedList;
import java.util.List;
/** /**
* Presents decompressed blocks to the SAMFileReader. * Presents decompressed blocks to the SAMFileReader.
*/ */
public class BlockInputStream extends SeekableStream implements BAMInputStream { public class BlockInputStream extends InputStream {
/** /**
* Mechanism for triggering block loads. * Mechanism for triggering block loads.
*/ */
@ -65,9 +62,9 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
private Throwable error; private Throwable error;
/** /**
* Current position. * Current accessPlan.
*/ */
private SAMReaderPosition position; private BAMAccessPlan accessPlan;
/** /**
* A stream of compressed data blocks. * A stream of compressed data blocks.
@ -94,11 +91,6 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
*/ */
private final BlockCompressedInputStream validatingInputStream; private final BlockCompressedInputStream validatingInputStream;
/**
* Has the buffer been filled since last request?
*/
private boolean bufferFilled = false;
/** /**
* Create a new block presenting input stream with a dedicated buffer. * Create a new block presenting input stream with a dedicated buffer.
* @param dispatcher the block loading messenger. * @param dispatcher the block loading messenger.
@ -118,7 +110,7 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
this.dispatcher = dispatcher; this.dispatcher = dispatcher;
// TODO: Kill the region when all we want to do is start at the beginning of the stream and run to the end of the stream. // TODO: Kill the region when all we want to do is start at the beginning of the stream and run to the end of the stream.
this.position = new SAMReaderPosition(reader,this,new GATKBAMFileSpan(new GATKChunk(0,Long.MAX_VALUE))); this.accessPlan = new BAMAccessPlan(reader,this,new GATKBAMFileSpan(new GATKChunk(0,Long.MAX_VALUE)));
// The block offsets / block positions guarantee that the ending offset/position in the data structure maps to // The block offsets / block positions guarantee that the ending offset/position in the data structure maps to
// the point in the file just following the last read. These two arrays should never be empty; initializing // the point in the file just following the last read. These two arrays should never be empty; initializing
@ -151,7 +143,7 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
synchronized(lock) { synchronized(lock) {
// Find the current block within the input stream. // Find the current block within the input stream.
int blockIndex; int blockIndex;
for(blockIndex = 0; blockIndex+1 < blockOffsets.size() && buffer.position() >= blockOffsets.get(blockIndex + 1); blockIndex++) for(blockIndex = 0; blockIndex+1 < blockOffsets.size() && buffer.position() > blockOffsets.get(blockIndex+1); blockIndex++)
; ;
filePointer = blockPositions.get(blockIndex) + (buffer.position()-blockOffsets.get(blockIndex)); filePointer = blockPositions.get(blockIndex) + (buffer.position()-blockOffsets.get(blockIndex));
} }
@ -164,51 +156,8 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
return filePointer; return filePointer;
} }
public void seek(long target) {
//System.out.printf("Thread %s, BlockInputStream %s: seeking to block %d, offset %d%n",Thread.currentThread().getId(),this,BlockCompressedFilePointerUtil.getBlockAddress(target),BlockCompressedFilePointerUtil.getBlockOffset(target));
synchronized(lock) {
clearBuffers();
// Ensure that the position filled in by submitAccessPlan() is in sync with the seek target just specified.
position.advancePosition(target);
// If the position advances past the end of the target, that must mean that we seeked to a point at the end
// of one of the chunk list's subregions. Make a note of our current position and punt on loading any data.
if(target < position.getBlockAddress() << 16) {
blockOffsets.clear();
blockOffsets.add(0);
blockPositions.clear();
blockPositions.add(target);
}
else {
waitForBufferFill();
// A buffer fill will load the relevant data from the shard, but the buffer position still needs to be
// advanced as appropriate.
Iterator<Integer> blockOffsetIterator = blockOffsets.descendingIterator();
Iterator<Long> blockPositionIterator = blockPositions.descendingIterator();
while(blockOffsetIterator.hasNext() && blockPositionIterator.hasNext()) {
final int blockOffset = blockOffsetIterator.next();
final long blockPosition = blockPositionIterator.next();
if((blockPosition >> 16) == (target >> 16) && (blockPosition&0xFFFF) < (target&0xFFFF)) {
buffer.position(blockOffset + (int)(target&0xFFFF)-(int)(blockPosition&0xFFFF));
break;
}
}
}
if(validatingInputStream != null) {
try {
validatingInputStream.seek(target);
}
catch(IOException ex) {
throw new ReviewedStingException("Unable to validate against Picard input stream",ex);
}
}
}
}
private void clearBuffers() { private void clearBuffers() {
this.position.reset(); this.accessPlan.reset();
// Buffer semantics say that outside of a lock, buffer should always be prepared for reading. // Buffer semantics say that outside of a lock, buffer should always be prepared for reading.
// Indicate no data to be read. // Indicate no data to be read.
@ -225,29 +174,41 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
public boolean eof() { public boolean eof() {
synchronized(lock) { synchronized(lock) {
// TODO: Handle multiple empty BGZF blocks at end of the file. // TODO: Handle multiple empty BGZF blocks at end of the file.
return position != null && (position.getBlockAddress() < 0 || position.getBlockAddress() >= length); return accessPlan != null && (accessPlan.getBlockAddress() < 0 || accessPlan.getBlockAddress() >= length);
} }
} }
public void setCheckCrcs(final boolean check) {
// TODO: Implement
}
/** /**
* Submits a new access plan for the given dataset. * Submits a new access plan for the given dataset and seeks to the given point.
* @param position The next seek point for BAM data in this reader. * @param accessPlan The next seek point for BAM data in this reader.
*/ */
public void submitAccessPlan(final SAMReaderPosition position) { public void submitAccessPlan(final BAMAccessPlan accessPlan) {
//System.out.printf("Thread %s: submitting access plan for block at position: %d%n",Thread.currentThread().getId(),position.getBlockAddress()); //System.out.printf("Thread %s: submitting access plan for block at position: %d%n",Thread.currentThread().getId(),position.getBlockAddress());
synchronized(lock) { this.accessPlan = accessPlan;
// Assume that the access plan is going to tell us to start where we are and move forward. accessPlan.reset();
// If this isn't the case, we'll soon receive a seek request and the buffer will be forced to reset.
if(this.position != null && position.getBlockAddress() < this.position.getBlockAddress()) clearBuffers();
position.advancePosition(this.position.getBlockAddress() << 16);
// Pull the iterator past any oddball chunks at the beginning of the shard (chunkEnd < chunkStart, empty chunks, etc).
// TODO: Don't pass these empty chunks in.
accessPlan.advancePosition(makeFilePointer(accessPlan.getBlockAddress(),0));
if(accessPlan.getBlockAddress() >= 0) {
waitForBufferFill();
} }
this.position = position;
if(validatingInputStream != null) {
try {
validatingInputStream.seek(makeFilePointer(accessPlan.getBlockAddress(),0));
}
catch(IOException ex) {
throw new ReviewedStingException("Unable to validate against Picard input stream",ex);
}
}
} }
private void compactBuffer() { private void compactBuffer() {
// Compact buffer to maximize storage space. // Compact buffer to maximize storage space.
int bytesToRemove = 0; int bytesToRemove = 0;
@ -286,27 +247,14 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
* Push contents of incomingBuffer into the end of this buffer. * Push contents of incomingBuffer into the end of this buffer.
* MUST be called from a thread that is NOT the reader thread. * MUST be called from a thread that is NOT the reader thread.
* @param incomingBuffer The data being pushed into this input stream. * @param incomingBuffer The data being pushed into this input stream.
* @param position target position for the data. * @param accessPlan target access plan for the data.
* @param filePosition the current position of the file pointer * @param filePosition the current position of the file pointer
*/ */
public void copyIntoBuffer(final ByteBuffer incomingBuffer, final SAMReaderPosition position, final long filePosition) { public void copyIntoBuffer(final ByteBuffer incomingBuffer, final BAMAccessPlan accessPlan, final long filePosition) {
synchronized(lock) { synchronized(lock) {
try { try {
compactBuffer();
// Open up the buffer for more reading.
buffer.limit(buffer.capacity());
// Advance the position to take the most recent read into account.
final long lastBlockAddress = position.getBlockAddress();
final int blockOffsetStart = position.getFirstOffsetInBlock();
final int blockOffsetEnd = position.getLastOffsetInBlock();
// Where did this read end? It either ended in the middle of a block (for a bounding chunk) or it ended at the start of the next block.
final long endOfRead = (blockOffsetEnd < incomingBuffer.remaining()) ? (lastBlockAddress << 16) | blockOffsetEnd : filePosition << 16;
byte[] validBytes = null;
if(validatingInputStream != null) { if(validatingInputStream != null) {
validBytes = new byte[incomingBuffer.remaining()]; byte[] validBytes = new byte[incomingBuffer.remaining()];
byte[] currentBytes = new byte[incomingBuffer.remaining()]; byte[] currentBytes = new byte[incomingBuffer.remaining()];
int pos = incomingBuffer.position(); int pos = incomingBuffer.position();
@ -317,7 +265,7 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
incomingBuffer.position(pos); incomingBuffer.position(pos);
long currentFilePointer = validatingInputStream.getFilePointer(); long currentFilePointer = validatingInputStream.getFilePointer();
validatingInputStream.seek(lastBlockAddress << 16); validatingInputStream.seek(makeFilePointer(accessPlan.getBlockAddress(), 0));
validatingInputStream.read(validBytes); validatingInputStream.read(validBytes);
validatingInputStream.seek(currentFilePointer); validatingInputStream.seek(currentFilePointer);
@ -325,33 +273,41 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
throw new ReviewedStingException(String.format("Bytes being inserted into BlockInputStream %s are incorrect",this)); throw new ReviewedStingException(String.format("Bytes being inserted into BlockInputStream %s are incorrect",this));
} }
this.position = position; compactBuffer();
position.advancePosition(filePosition << 16); // Open up the buffer for more reading.
buffer.limit(buffer.capacity());
if(buffer.remaining() < incomingBuffer.remaining()) { // Get the spans overlapping this particular block...
//System.out.printf("Thread %s: waiting for available space in buffer; buffer remaining = %d, incoming buffer remaining = %d%n",Thread.currentThread().getId(),buffer.remaining(),incomingBuffer.remaining()); List<GATKChunk> spansOverlapping = accessPlan.getSpansOverlappingBlock(accessPlan.getBlockAddress(),filePosition);
// ...and advance the block
this.accessPlan = accessPlan;
accessPlan.advancePosition(makeFilePointer(filePosition, 0));
if(buffer.remaining() < incomingBuffer.remaining())
lock.wait(); lock.wait();
//System.out.printf("Thread %s: waited for available space in buffer; buffer remaining = %d, incoming buffer remaining = %d%n", Thread.currentThread().getId(), buffer.remaining(), incomingBuffer.remaining());
final int bytesInIncomingBuffer = incomingBuffer.limit();
for(GATKChunk spanOverlapping: spansOverlapping) {
// Clear out the endcap tracking state and add in the starting position for this transfer.
blockOffsets.removeLast();
blockOffsets.add(buffer.position());
blockPositions.removeLast();
blockPositions.add(spanOverlapping.getChunkStart());
// Stream the buffer into the data stream.
incomingBuffer.limit((spanOverlapping.getBlockEnd() > spanOverlapping.getBlockStart()) ? bytesInIncomingBuffer : spanOverlapping.getBlockOffsetEnd());
incomingBuffer.position(spanOverlapping.getBlockOffsetStart());
buffer.put(incomingBuffer);
// Add the endcap for this transfer.
blockOffsets.add(buffer.position());
blockPositions.add(spanOverlapping.getChunkEnd());
} }
// Remove the last position in the list and add in the last read position, in case the two are different.
blockOffsets.removeLast();
blockOffsets.add(buffer.position());
blockPositions.removeLast();
blockPositions.add(lastBlockAddress << 16 | blockOffsetStart);
// Stream the buffer into the data stream.
incomingBuffer.position(blockOffsetStart);
incomingBuffer.limit(Math.min(incomingBuffer.limit(),blockOffsetEnd));
buffer.put(incomingBuffer);
// Then, add the last position read to the very end of the list, just past the end of the last buffer.
blockOffsets.add(buffer.position());
blockPositions.add(endOfRead);
// Set up the buffer for reading. // Set up the buffer for reading.
buffer.flip(); buffer.flip();
bufferFilled = true;
lock.notify(); lock.notify();
} }
@ -447,12 +403,8 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
if(remaining < length) if(remaining < length)
return length - remaining; return length - remaining;
// Otherwise, if at eof(), return -1. // Otherwise, return -1.
else if(eof()) return -1;
return -1;
// Otherwise, we must've hit a bug in the system.
throw new ReviewedStingException("BUG: read returned no data, but eof() reports false.");
} }
public void close() { public void close() {
@ -472,20 +424,26 @@ public class BlockInputStream extends SeekableStream implements BAMInputStream {
private void waitForBufferFill() { private void waitForBufferFill() {
synchronized(lock) { synchronized(lock) {
bufferFilled = false;
if(buffer.remaining() == 0 && !eof()) { if(buffer.remaining() == 0 && !eof()) {
//System.out.printf("Thread %s is waiting for a buffer fill from position %d to buffer %s%n",Thread.currentThread().getId(),position.getBlockAddress(),this); //System.out.printf("Thread %s is waiting for a buffer fill from position %d to buffer %s%n",Thread.currentThread().getId(),position.getBlockAddress(),this);
dispatcher.queueBlockLoad(position); dispatcher.queueBlockLoad(accessPlan);
try { try {
lock.wait(); lock.wait();
} }
catch(InterruptedException ex) { catch(InterruptedException ex) {
throw new ReviewedStingException("Interrupt occurred waiting for buffer to fill",ex); throw new ReviewedStingException("Interrupt occurred waiting for buffer to fill",ex);
} }
if(bufferFilled && buffer.remaining() == 0)
throw new RuntimeEOFException("No more data left in InputStream");
} }
} }
} }
/**
* Create an encoded BAM file pointer given the address of a BGZF block and an offset.
* @param blockAddress Physical address on disk of a BGZF block.
* @param blockOffset Offset into the uncompressed data stored in the BGZF block.
* @return 64-bit pointer encoded according to the BAM spec.
*/
public static long makeFilePointer(final long blockAddress, final int blockOffset) {
return blockAddress << 16 | blockOffset;
}
} }

View File

@ -1,5 +1,5 @@
/* /*
* Copyright (c) 2011, The Broad Institute * Copyright (c) 2012, The Broad Institute
* *
* Permission is hereby granted, free of charge, to any person * Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation * obtaining a copy of this software and associated documentation
@ -70,29 +70,29 @@ class BlockLoader implements Runnable {
public void run() { public void run() {
for(;;) { for(;;) {
SAMReaderPosition readerPosition = null; BAMAccessPlan accessPlan = null;
try { try {
readerPosition = dispatcher.claimNextWorkRequest(); accessPlan = dispatcher.claimNextWorkRequest();
FileInputStream inputStream = fileHandleCache.claimFileInputStream(readerPosition.getReader()); FileInputStream inputStream = fileHandleCache.claimFileInputStream(accessPlan.getReader());
long blockAddress = readerPosition.getBlockAddress(); //long blockAddress = readerPosition.getBlockAddress();
//System.out.printf("Thread %s: BlockLoader: copying bytes from %s at position %d into %s%n",Thread.currentThread().getId(),inputStream,blockAddress,readerPosition.getInputStream()); //System.out.printf("Thread %s: BlockLoader: copying bytes from %s at position %d into %s%n",Thread.currentThread().getId(),inputStream,blockAddress,readerPosition.getInputStream());
ByteBuffer compressedBlock = readBGZFBlock(inputStream,readerPosition.getBlockAddress()); ByteBuffer compressedBlock = readBGZFBlock(inputStream,accessPlan.getBlockAddress());
long nextBlockAddress = position(inputStream); long nextBlockAddress = position(inputStream);
fileHandleCache.releaseFileInputStream(readerPosition.getReader(),inputStream); fileHandleCache.releaseFileInputStream(accessPlan.getReader(),inputStream);
ByteBuffer block = decompress ? decompressBGZFBlock(compressedBlock) : compressedBlock; ByteBuffer block = decompress ? decompressBGZFBlock(compressedBlock) : compressedBlock;
int bytesCopied = block.remaining(); int bytesCopied = block.remaining();
BlockInputStream bamInputStream = readerPosition.getInputStream(); BlockInputStream bamInputStream = accessPlan.getInputStream();
bamInputStream.copyIntoBuffer(block,readerPosition,nextBlockAddress); bamInputStream.copyIntoBuffer(block,accessPlan,nextBlockAddress);
//System.out.printf("Thread %s: BlockLoader: copied %d bytes from %s at position %d into %s%n",Thread.currentThread().getId(),bytesCopied,inputStream,blockAddress,readerPosition.getInputStream()); //System.out.printf("Thread %s: BlockLoader: copied %d bytes from %s at position %d into %s%n",Thread.currentThread().getId(),bytesCopied,inputStream,blockAddress,readerPosition.getInputStream());
} }
catch(Throwable error) { catch(Throwable error) {
if(readerPosition != null && readerPosition.getInputStream() != null) if(accessPlan != null && accessPlan.getInputStream() != null)
readerPosition.getInputStream().reportException(error); accessPlan.getInputStream().reportException(error);
} }
} }

View File

@ -0,0 +1,203 @@
/*
* Copyright (c) 2012, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.datasources.reads;
import net.sf.samtools.SAMRecord;
import net.sf.samtools.util.CloseableIterator;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.List;
import java.util.NoSuchElementException;
/**
* High efficiency filtering iterator designed to filter out reads only included
* in the query results due to the granularity of the BAM index.
*
* Built into the BAM index is a notion of 16kbase granularity -- an index query for
* two regions contained within a 16kbase chunk (say, chr1:5-10 and chr1:11-20) will
* return exactly the same regions within the BAM file. This iterator is optimized
* to subtract out reads which do not at all overlap the interval list passed to the
* constructor.
*
* Example:
* interval list: chr20:6-10
* Reads that would pass through the filter: chr20:6-10, chr20:1-15, chr20:1-7, chr20:8-15.
* Reads that would be discarded by the filter: chr20:1-5, chr20:11-15.
*/
class IntervalOverlapFilteringIterator implements CloseableIterator<SAMRecord> {
/**
* The wrapped iterator.
*/
private CloseableIterator<SAMRecord> iterator;
/**
* The next read, queued up and ready to go.
*/
private SAMRecord nextRead;
/**
* Rather than using the straight genomic bounds, use filter out only mapped reads.
*/
private boolean keepOnlyUnmappedReads;
/**
* Custom representation of interval bounds.
* Makes it simpler to track current position.
*/
private int[] intervalContigIndices;
private int[] intervalStarts;
private int[] intervalEnds;
/**
* Position within the interval list.
*/
private int currentBound = 0;
public IntervalOverlapFilteringIterator(CloseableIterator<SAMRecord> iterator, List<GenomeLoc> intervals) {
this.iterator = iterator;
// Look at the interval list to detect whether we should worry about unmapped reads.
// If we find a mix of mapped/unmapped intervals, throw an exception.
boolean foundMappedIntervals = false;
for(GenomeLoc location: intervals) {
if(! GenomeLoc.isUnmapped(location))
foundMappedIntervals = true;
keepOnlyUnmappedReads |= GenomeLoc.isUnmapped(location);
}
if(foundMappedIntervals) {
if(keepOnlyUnmappedReads)
throw new ReviewedStingException("Tried to apply IntervalOverlapFilteringIterator to a mixed of mapped and unmapped intervals. Please apply this filter to only mapped or only unmapped reads");
this.intervalContigIndices = new int[intervals.size()];
this.intervalStarts = new int[intervals.size()];
this.intervalEnds = new int[intervals.size()];
int i = 0;
for(GenomeLoc interval: intervals) {
intervalContigIndices[i] = interval.getContigIndex();
intervalStarts[i] = interval.getStart();
intervalEnds[i] = interval.getStop();
i++;
}
}
advance();
}
public boolean hasNext() {
return nextRead != null;
}
public SAMRecord next() {
if(nextRead == null)
throw new NoSuchElementException("No more reads left in this iterator.");
SAMRecord currentRead = nextRead;
advance();
return currentRead;
}
public void remove() {
throw new UnsupportedOperationException("Cannot remove from an IntervalOverlapFilteringIterator");
}
public void close() {
iterator.close();
}
private void advance() {
nextRead = null;
if(!iterator.hasNext())
return;
SAMRecord candidateRead = iterator.next();
while(nextRead == null && (keepOnlyUnmappedReads || currentBound < intervalStarts.length)) {
if(!keepOnlyUnmappedReads) {
// Mapped read filter; check against GenomeLoc-derived bounds.
if(readEndsOnOrAfterStartingBound(candidateRead)) {
// This read ends after the current interval begins.
// Promising, but this read must be checked against the ending bound.
if(readStartsOnOrBeforeEndingBound(candidateRead)) {
// Yes, this read is within both bounds. This must be our next read.
nextRead = candidateRead;
break;
}
else {
// Oops, we're past the end bound. Increment the current bound and try again.
currentBound++;
continue;
}
}
}
else {
// Found an unmapped read. We're done.
if(candidateRead.getReadUnmappedFlag()) {
nextRead = candidateRead;
break;
}
}
// No more reads available. Stop the search.
if(!iterator.hasNext())
break;
// No reasonable read found; advance the iterator.
candidateRead = iterator.next();
}
}
/**
* Check whether the read lies after the start of the current bound. If the read is unmapped but placed, its
* end will be distorted, so rely only on the alignment start.
* @param read The read to position-check.
* @return True if the read starts after the current bounds. False otherwise.
*/
private boolean readEndsOnOrAfterStartingBound(final SAMRecord read) {
return
// Read ends on a later contig, or...
read.getReferenceIndex() > intervalContigIndices[currentBound] ||
// Read ends of this contig...
(read.getReferenceIndex() == intervalContigIndices[currentBound] &&
// either after this location, or...
(read.getAlignmentEnd() >= intervalStarts[currentBound] ||
// read is unmapped but positioned and alignment start is on or after this start point.
(read.getReadUnmappedFlag() && read.getAlignmentStart() >= intervalStarts[currentBound])));
}
/**
* Check whether the read lies before the end of the current bound.
* @param read The read to position-check.
* @return True if the read starts after the current bounds. False otherwise.
*/
private boolean readStartsOnOrBeforeEndingBound(final SAMRecord read) {
return
// Read starts on a prior contig, or...
read.getReferenceIndex() < intervalContigIndices[currentBound] ||
// Read starts on this contig and the alignment start is registered before this end point.
(read.getReferenceIndex() == intervalContigIndices[currentBound] && read.getAlignmentStart() <= intervalEnds[currentBound]);
}
}

View File

@ -36,7 +36,7 @@ import java.util.Map;
*/ */
public class ReadShard extends Shard { public class ReadShard extends Shard {
/** /**
* What is the maximum number of reads which should go into a read shard. * What is the maximum number of reads per BAM file which should go into a read shard.
*/ */
public static int MAX_READS = 10000; public static int MAX_READS = 10000;

View File

@ -39,7 +39,6 @@ import org.broadinstitute.sting.gatk.filters.CountingFilteringIterator;
import org.broadinstitute.sting.gatk.filters.ReadFilter; import org.broadinstitute.sting.gatk.filters.ReadFilter;
import org.broadinstitute.sting.gatk.iterators.*; import org.broadinstitute.sting.gatk.iterators.*;
import org.broadinstitute.sting.gatk.resourcemanagement.ThreadAllocation; import org.broadinstitute.sting.gatk.resourcemanagement.ThreadAllocation;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.GenomeLocSortedSet; import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.broadinstitute.sting.utils.SimpleTimer; import org.broadinstitute.sting.utils.SimpleTimer;
@ -47,6 +46,8 @@ import org.broadinstitute.sting.utils.baq.BAQ;
import org.broadinstitute.sting.utils.baq.BAQSamIterator; import org.broadinstitute.sting.utils.baq.BAQSamIterator;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BQSRSamIterator;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSamRecordFactory; import org.broadinstitute.sting.utils.sam.GATKSamRecordFactory;
import java.io.File; import java.io.File;
@ -202,6 +203,7 @@ public class SAMDataSource {
BAQ.CalculationMode.OFF, BAQ.CalculationMode.OFF,
BAQ.QualityMode.DONT_MODIFY, BAQ.QualityMode.DONT_MODIFY,
null, // no BAQ null, // no BAQ
null, // no BQSR
(byte) -1); (byte) -1);
} }
@ -238,6 +240,7 @@ public class SAMDataSource {
BAQ.CalculationMode cmode, BAQ.CalculationMode cmode,
BAQ.QualityMode qmode, BAQ.QualityMode qmode,
IndexedFastaSequenceFile refReader, IndexedFastaSequenceFile refReader,
BaseRecalibration bqsrApplier,
byte defaultBaseQualities) { byte defaultBaseQualities) {
this.readMetrics = new ReadMetrics(); this.readMetrics = new ReadMetrics();
this.genomeLocParser = genomeLocParser; this.genomeLocParser = genomeLocParser;
@ -310,6 +313,7 @@ public class SAMDataSource {
cmode, cmode,
qmode, qmode,
refReader, refReader,
bqsrApplier,
defaultBaseQualities); defaultBaseQualities);
// cache the read group id (original) -> read group id (merged) // cache the read group id (original) -> read group id (merged)
@ -567,9 +571,14 @@ public class SAMDataSource {
if(threadAllocation.getNumIOThreads() > 0) { if(threadAllocation.getNumIOThreads() > 0) {
BlockInputStream inputStream = readers.getInputStream(id); BlockInputStream inputStream = readers.getInputStream(id);
inputStream.submitAccessPlan(new SAMReaderPosition(id,inputStream,(GATKBAMFileSpan)shard.getFileSpans().get(id))); inputStream.submitAccessPlan(new BAMAccessPlan(id, inputStream, (GATKBAMFileSpan) shard.getFileSpans().get(id)));
BAMRecordCodec codec = new BAMRecordCodec(getHeader(id),factory);
codec.setInputStream(inputStream);
iterator = new BAMCodecIterator(inputStream,readers.getReader(id),codec);
}
else {
iterator = readers.getReader(id).iterator(shard.getFileSpans().get(id));
} }
iterator = readers.getReader(id).iterator(shard.getFileSpans().get(id));
if(shard.getGenomeLocs().size() > 0) if(shard.getGenomeLocs().size() > 0)
iterator = new IntervalOverlapFilteringIterator(iterator,shard.getGenomeLocs()); iterator = new IntervalOverlapFilteringIterator(iterator,shard.getGenomeLocs());
iteratorMap.put(readers.getReader(id), iterator); iteratorMap.put(readers.getReader(id), iterator);
@ -577,8 +586,6 @@ public class SAMDataSource {
MergingSamRecordIterator mergingIterator = readers.createMergingIterator(iteratorMap); MergingSamRecordIterator mergingIterator = readers.createMergingIterator(iteratorMap);
return applyDecoratingIterators(shard.getReadMetrics(), return applyDecoratingIterators(shard.getReadMetrics(),
enableVerification, enableVerification,
readProperties.useOriginalBaseQualities(), readProperties.useOriginalBaseQualities(),
@ -589,9 +596,53 @@ public class SAMDataSource {
readProperties.getBAQCalculationMode(), readProperties.getBAQCalculationMode(),
readProperties.getBAQQualityMode(), readProperties.getBAQQualityMode(),
readProperties.getRefReader(), readProperties.getRefReader(),
readProperties.getBQSRApplier(),
readProperties.defaultBaseQualities()); readProperties.defaultBaseQualities());
} }
private class BAMCodecIterator implements CloseableIterator<SAMRecord> {
private final BlockInputStream inputStream;
private final SAMFileReader reader;
private final BAMRecordCodec codec;
private SAMRecord nextRead;
private BAMCodecIterator(final BlockInputStream inputStream, final SAMFileReader reader, final BAMRecordCodec codec) {
this.inputStream = inputStream;
this.reader = reader;
this.codec = codec;
advance();
}
public boolean hasNext() {
return nextRead != null;
}
public SAMRecord next() {
if(!hasNext())
throw new NoSuchElementException("Unable to retrieve next record from BAMCodecIterator; input stream is empty");
SAMRecord currentRead = nextRead;
advance();
return currentRead;
}
public void close() {
// NO-OP.
}
public void remove() {
throw new UnsupportedOperationException("Unable to remove from BAMCodecIterator");
}
private void advance() {
final long startCoordinate = inputStream.getFilePointer();
nextRead = codec.decode();
final long stopCoordinate = inputStream.getFilePointer();
if(reader != null && nextRead != null)
PicardNamespaceUtils.setFileSource(nextRead,new SAMFileSource(reader,new GATKBAMFileSpan(new GATKChunk(startCoordinate,stopCoordinate))));
}
}
/** /**
* Filter reads based on user-specified criteria. * Filter reads based on user-specified criteria.
* *
@ -615,9 +666,10 @@ public class SAMDataSource {
BAQ.CalculationMode cmode, BAQ.CalculationMode cmode,
BAQ.QualityMode qmode, BAQ.QualityMode qmode,
IndexedFastaSequenceFile refReader, IndexedFastaSequenceFile refReader,
BaseRecalibration bqsrApplier,
byte defaultBaseQualities) { byte defaultBaseQualities) {
if ( useOriginalBaseQualities || defaultBaseQualities >= 0 ) if (useOriginalBaseQualities || defaultBaseQualities >= 0)
// only wrap if we are replacing the original qualitiies or using a default base quality // only wrap if we are replacing the original qualities or using a default base quality
wrappedIterator = new ReadFormattingIterator(wrappedIterator, useOriginalBaseQualities, defaultBaseQualities); wrappedIterator = new ReadFormattingIterator(wrappedIterator, useOriginalBaseQualities, defaultBaseQualities);
// NOTE: this (and other filtering) should be done before on-the-fly sorting // NOTE: this (and other filtering) should be done before on-the-fly sorting
@ -630,6 +682,9 @@ public class SAMDataSource {
if (!noValidationOfReadOrder && enableVerification) if (!noValidationOfReadOrder && enableVerification)
wrappedIterator = new VerifyingSamIterator(genomeLocParser,wrappedIterator); wrappedIterator = new VerifyingSamIterator(genomeLocParser,wrappedIterator);
if (bqsrApplier != null)
wrappedIterator = new BQSRSamIterator(wrappedIterator, bqsrApplier);
if (cmode != BAQ.CalculationMode.OFF) if (cmode != BAQ.CalculationMode.OFF)
wrappedIterator = new BAQSamIterator(refReader, wrappedIterator, cmode, qmode); wrappedIterator = new BAQSamIterator(refReader, wrappedIterator, cmode, qmode);
@ -871,12 +926,9 @@ public class SAMDataSource {
public ReaderInitializer call() { public ReaderInitializer call() {
final File indexFile = findIndexFile(readerID.samFile); final File indexFile = findIndexFile(readerID.samFile);
try { try {
if (threadAllocation.getNumIOThreads() > 0) { if (threadAllocation.getNumIOThreads() > 0)
blockInputStream = new BlockInputStream(dispatcher,readerID,false); blockInputStream = new BlockInputStream(dispatcher,readerID,false);
reader = new SAMFileReader(blockInputStream,indexFile,false); reader = new SAMFileReader(readerID.samFile,indexFile,false);
}
else
reader = new SAMFileReader(readerID.samFile,indexFile,false);
} catch ( RuntimeIOException e ) { } catch ( RuntimeIOException e ) {
if ( e.getCause() != null && e.getCause() instanceof FileNotFoundException ) if ( e.getCause() != null && e.getCause() instanceof FileNotFoundException )
throw new UserException.CouldNotReadInputFile(readerID.samFile, e); throw new UserException.CouldNotReadInputFile(readerID.samFile, e);
@ -933,167 +985,6 @@ public class SAMDataSource {
*/ */
private class ReadGroupMapping extends HashMap<String,String> {} private class ReadGroupMapping extends HashMap<String,String> {}
/**
* Filters out reads that do not overlap the current GenomeLoc.
* Note the custom implementation: BAM index querying returns all reads that could
* possibly overlap the given region (and quite a few extras). In order not to drag
* down performance, this implementation is highly customized to its task.
*/
private class IntervalOverlapFilteringIterator implements CloseableIterator<SAMRecord> {
/**
* The wrapped iterator.
*/
private CloseableIterator<SAMRecord> iterator;
/**
* The next read, queued up and ready to go.
*/
private SAMRecord nextRead;
/**
* Rather than using the straight genomic bounds, use filter out only mapped reads.
*/
private boolean keepOnlyUnmappedReads;
/**
* Custom representation of interval bounds.
* Makes it simpler to track current position.
*/
private int[] intervalContigIndices;
private int[] intervalStarts;
private int[] intervalEnds;
/**
* Position within the interval list.
*/
private int currentBound = 0;
public IntervalOverlapFilteringIterator(CloseableIterator<SAMRecord> iterator, List<GenomeLoc> intervals) {
this.iterator = iterator;
// Look at the interval list to detect whether we should worry about unmapped reads.
// If we find a mix of mapped/unmapped intervals, throw an exception.
boolean foundMappedIntervals = false;
for(GenomeLoc location: intervals) {
if(! GenomeLoc.isUnmapped(location))
foundMappedIntervals = true;
keepOnlyUnmappedReads |= GenomeLoc.isUnmapped(location);
}
if(foundMappedIntervals) {
if(keepOnlyUnmappedReads)
throw new ReviewedStingException("Tried to apply IntervalOverlapFilteringIterator to a mixed of mapped and unmapped intervals. Please apply this filter to only mapped or only unmapped reads");
this.intervalContigIndices = new int[intervals.size()];
this.intervalStarts = new int[intervals.size()];
this.intervalEnds = new int[intervals.size()];
int i = 0;
for(GenomeLoc interval: intervals) {
intervalContigIndices[i] = interval.getContigIndex();
intervalStarts[i] = interval.getStart();
intervalEnds[i] = interval.getStop();
i++;
}
}
advance();
}
public boolean hasNext() {
return nextRead != null;
}
public SAMRecord next() {
if(nextRead == null)
throw new NoSuchElementException("No more reads left in this iterator.");
SAMRecord currentRead = nextRead;
advance();
return currentRead;
}
public void remove() {
throw new UnsupportedOperationException("Cannot remove from an IntervalOverlapFilteringIterator");
}
public void close() {
iterator.close();
}
private void advance() {
nextRead = null;
if(!iterator.hasNext())
return;
SAMRecord candidateRead = iterator.next();
while(nextRead == null && (keepOnlyUnmappedReads || currentBound < intervalStarts.length)) {
if(!keepOnlyUnmappedReads) {
// Mapped read filter; check against GenomeLoc-derived bounds.
if(readEndsOnOrAfterStartingBound(candidateRead)) {
// This read ends after the current interval begins.
// Promising, but this read must be checked against the ending bound.
if(readStartsOnOrBeforeEndingBound(candidateRead)) {
// Yes, this read is within both bounds. This must be our next read.
nextRead = candidateRead;
break;
}
else {
// Oops, we're past the end bound. Increment the current bound and try again.
currentBound++;
continue;
}
}
}
else {
// Found an unmapped read. We're done.
if(candidateRead.getReadUnmappedFlag()) {
nextRead = candidateRead;
break;
}
}
// No more reads available. Stop the search.
if(!iterator.hasNext())
break;
// No reasonable read found; advance the iterator.
candidateRead = iterator.next();
}
}
/**
* Check whether the read lies after the start of the current bound. If the read is unmapped but placed, its
* end will be distorted, so rely only on the alignment start.
* @param read The read to position-check.
* @return True if the read starts after the current bounds. False otherwise.
*/
private boolean readEndsOnOrAfterStartingBound(final SAMRecord read) {
return
// Read ends on a later contig, or...
read.getReferenceIndex() > intervalContigIndices[currentBound] ||
// Read ends of this contig...
(read.getReferenceIndex() == intervalContigIndices[currentBound] &&
// either after this location, or...
(read.getAlignmentEnd() >= intervalStarts[currentBound] ||
// read is unmapped but positioned and alignment start is on or after this start point.
(read.getReadUnmappedFlag() && read.getAlignmentStart() >= intervalStarts[currentBound])));
}
/**
* Check whether the read lies before the end of the current bound.
* @param read The read to position-check.
* @return True if the read starts after the current bounds. False otherwise.
*/
private boolean readStartsOnOrBeforeEndingBound(final SAMRecord read) {
return
// Read starts on a prior contig, or...
read.getReferenceIndex() < intervalContigIndices[currentBound] ||
// Read starts on this contig and the alignment start is registered before this end point.
(read.getReferenceIndex() == intervalContigIndices[currentBound] && read.getAlignmentStart() <= intervalEnds[currentBound]);
}
}
/** /**
* Locates the index file alongside the given BAM, if present. * Locates the index file alongside the given BAM, if present.
* TODO: This is currently a hachetjob that reaches into Picard and pulls out its index file locator. Replace with something more permanent. * TODO: This is currently a hachetjob that reaches into Picard and pulls out its index file locator. Replace with something more permanent.

View File

@ -17,9 +17,21 @@ import java.util.List;
import java.util.NoSuchElementException; import java.util.NoSuchElementException;
/** /**
* Buffer shards of data which may or may not contain multiple loci into * Transforms an iterator of reads which overlap the given interval list into an iterator of covered single-base loci
* iterators of all data which cover an interval. Its existence is an homage * completely contained within the interval list. To do this, it creates a LocusIteratorByState which will emit a single-bp
* to Mark's stillborn WindowMaker, RIP 2009. * locus for every base covered by the read iterator, then uses the WindowMakerIterator.advance() to filter down that stream of
* loci to only those covered by the given interval list.
*
* Example:
* Incoming stream of reads: A:chr20:1-5, B:chr20:2-6, C:chr20:2-7, D:chr20:3-8, E:chr20:5-10
* Incoming intervals: chr20:3-7
*
* Locus iterator by state will produce the following stream of data:
* chr1:1 {A}, chr1:2 {A,B,C}, chr1:3 {A,B,C,D}, chr1:4 {A,B,C,D}, chr1:5 {A,B,C,D,E},
* chr1:6 {B,C,D,E}, chr1:7 {C,D,E}, chr1:8 {D,E}, chr1:9 {E}, chr1:10 {E}
*
* WindowMakerIterator will then filter the incoming stream, emitting the following stream:
* chr1:3 {A,B,C,D}, chr1:4 {A,B,C,D}, chr1:5 {A,B,C,D,E}, chr1:6 {B,C,D,E}, chr1:7 {C,D,E}
* *
* @author mhanna * @author mhanna
* @version 0.1 * @version 0.1

View File

@ -470,7 +470,7 @@ public class LocusIteratorByState extends LocusIterator {
if (op == CigarOperator.D) { if (op == CigarOperator.D) {
if (readInfo.includeReadsWithDeletionAtLoci()) { // only add deletions to the pileup if we are authorized to do so if (readInfo.includeReadsWithDeletionAtLoci()) { // only add deletions to the pileup if we are authorized to do so
pile.add(new PileupElement(read, readOffset, true, nextOp == CigarOperator.I, nextOp == CigarOperator.S || (state.getGenomeOffset() == 0 && read.getSoftStart() != read.getAlignmentStart()))); pile.add(new PileupElement(read, readOffset, true, nextOp == CigarOperator.D, nextOp == CigarOperator.I, nextOp == CigarOperator.S || (state.getGenomeOffset() == 0 && read.getSoftStart() != read.getAlignmentStart())));
size++; size++;
nDeletions++; nDeletions++;
if (read.getMappingQuality() == 0) if (read.getMappingQuality() == 0)
@ -479,7 +479,7 @@ public class LocusIteratorByState extends LocusIterator {
} }
else { else {
if (!filterBaseInRead(read, location.getStart())) { if (!filterBaseInRead(read, location.getStart())) {
pile.add(new PileupElement(read, readOffset, false, nextOp == CigarOperator.I, nextOp == CigarOperator.S || (state.getGenomeOffset() == 0 && read.getSoftStart() != read.getAlignmentStart()))); pile.add(new PileupElement(read, readOffset, false, nextOp == CigarOperator.D, nextOp == CigarOperator.I, nextOp == CigarOperator.S || (state.getGenomeOffset() == 0 && read.getSoftStart() != read.getAlignmentStart())));
size++; size++;
if (read.getMappingQuality() == 0) if (read.getMappingQuality() == 0)
nMQ0Reads++; nMQ0Reads++;

View File

@ -1,6 +1,5 @@
package org.broadinstitute.sting.gatk.traversals; package org.broadinstitute.sting.gatk.traversals;
import net.sf.samtools.SAMRecord;
import org.apache.log4j.Logger; import org.apache.log4j.Logger;
import org.broadinstitute.sting.gatk.WalkerManager; import org.broadinstitute.sting.gatk.WalkerManager;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
@ -29,7 +28,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
protected static Logger logger = Logger.getLogger(TraversalEngine.class); protected static Logger logger = Logger.getLogger(TraversalEngine.class);
private final Queue<ActiveRegion> workQueue = new LinkedList<ActiveRegion>(); private final Queue<ActiveRegion> workQueue = new LinkedList<ActiveRegion>();
private final LinkedHashSet<SAMRecord> myReads = new LinkedHashSet<SAMRecord>(); private final LinkedHashSet<GATKSAMRecord> myReads = new LinkedHashSet<GATKSAMRecord>();
@Override @Override
protected String getTraversalType() { protected String getTraversalType() {
@ -69,9 +68,8 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
if(prevLoc != null) { if(prevLoc != null) {
for(int iii = prevLoc.getStart() + 1; iii < location.getStart(); iii++ ) { for(int iii = prevLoc.getStart() + 1; iii < location.getStart(); iii++ ) {
final GenomeLoc fakeLoc = engine.getGenomeLocParser().createGenomeLoc(prevLoc.getContig(), iii, iii); final GenomeLoc fakeLoc = engine.getGenomeLocParser().createGenomeLoc(prevLoc.getContig(), iii, iii);
if( initialIntervals.overlaps( fakeLoc ) ) { if( initialIntervals == null || initialIntervals.overlaps( fakeLoc ) ) {
final double isActiveProb = ( walker.presetActiveRegions == null ? walker.isActive( null, null, null ) final double isActiveProb = ( walker.presetActiveRegions == null ? 0.0 : ( walker.presetActiveRegions.overlaps(fakeLoc) ? 1.0 : 0.0 ) );
: ( walker.presetActiveRegions.overlaps(fakeLoc) ? 1.0 : 0.0 ) );
isActiveList.add( isActiveProb ); isActiveList.add( isActiveProb );
if( firstIsActiveStart == null ) { if( firstIsActiveStart == null ) {
firstIsActiveStart = fakeLoc; firstIsActiveStart = fakeLoc;
@ -90,7 +88,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
final RefMetaDataTracker tracker = referenceOrderedDataView.getReferenceOrderedDataAtLocus(locus.getLocation(), refContext); final RefMetaDataTracker tracker = referenceOrderedDataView.getReferenceOrderedDataAtLocus(locus.getLocation(), refContext);
// Call the walkers isActive function for this locus and add them to the list to be integrated later // Call the walkers isActive function for this locus and add them to the list to be integrated later
if( initialIntervals.overlaps( location ) ) { if( initialIntervals == null || initialIntervals.overlaps( location ) ) {
final double isActiveProb = ( walker.presetActiveRegions == null ? walker.isActive( tracker, refContext, locus ) final double isActiveProb = ( walker.presetActiveRegions == null ? walker.isActive( tracker, refContext, locus )
: ( walker.presetActiveRegions.overlaps(location) ? 1.0 : 0.0 ) ); : ( walker.presetActiveRegions.overlaps(location) ? 1.0 : 0.0 ) );
isActiveList.add( isActiveProb ); isActiveList.add( isActiveProb );
@ -101,17 +99,17 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// Grab all the previously unseen reads from this pileup and add them to the massive read list // Grab all the previously unseen reads from this pileup and add them to the massive read list
for( final PileupElement p : locus.getBasePileup() ) { for( final PileupElement p : locus.getBasePileup() ) {
final SAMRecord read = p.getRead(); final GATKSAMRecord read = p.getRead();
if( !myReads.contains(read) ) { if( !myReads.contains(read) ) {
myReads.add(read); myReads.add(read);
} }
} }
// If this is the last pileup for this shard calculate the minimum alignment start so that we know // If this is the last pileup for this shard calculate the minimum alignment start so that we know
// which active regions in the work queue are now safe to process // which active regions in the work queue are now safe to process
if( !locusView.hasNext() ) { if( !locusView.hasNext() ) {
for( final PileupElement p : locus.getBasePileup() ) { for( final PileupElement p : locus.getBasePileup() ) {
final SAMRecord read = p.getRead(); final GATKSAMRecord read = p.getRead();
if( !myReads.contains(read) ) { if( !myReads.contains(read) ) {
myReads.add(read); myReads.add(read);
} }
@ -124,7 +122,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// Take the individual isActive calls and integrate them into contiguous active regions and // Take the individual isActive calls and integrate them into contiguous active regions and
// add these blocks of work to the work queue // add these blocks of work to the work queue
final ArrayList<ActiveRegion> activeRegions = integrateActiveList( isActiveList, firstIsActiveStart, activeRegionExtension ); final ArrayList<ActiveRegion> activeRegions = integrateActiveList( isActiveList, firstIsActiveStart, activeRegionExtension, walker.presetActiveRegions != null );
logger.debug("Integrated " + isActiveList.size() + " isActive calls into " + activeRegions.size() + " regions." ); logger.debug("Integrated " + isActiveList.size() + " isActive calls into " + activeRegions.size() + " regions." );
if( walker.activeRegionOutStream == null ) { if( walker.activeRegionOutStream == null ) {
workQueue.addAll( activeRegions ); workQueue.addAll( activeRegions );
@ -136,7 +134,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
} }
} }
// Since we've sufficiently past this point (or this contig!) in the workQueue we can unload those regions and process them // Since we've traversed sufficiently past this point (or this contig!) in the workQueue we can unload those regions and process them
while( workQueue.peek() != null && (workQueue.peek().getExtendedLoc().getStop() < minStart || !workQueue.peek().getExtendedLoc().getContig().equals(dataProvider.getLocus().getContig())) ) { while( workQueue.peek() != null && (workQueue.peek().getExtendedLoc().getStop() < minStart || !workQueue.peek().getExtendedLoc().getContig().equals(dataProvider.getLocus().getContig())) ) {
final ActiveRegion activeRegion = workQueue.remove(); final ActiveRegion activeRegion = workQueue.remove();
sum = processActiveRegion( activeRegion, myReads, workQueue, sum, walker ); sum = processActiveRegion( activeRegion, myReads, workQueue, sum, walker );
@ -156,9 +154,9 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
return sum; return sum;
} }
private T processActiveRegion( final ActiveRegion activeRegion, final LinkedHashSet<SAMRecord> reads, final Queue<ActiveRegion> workQueue, final T sum, final ActiveRegionWalker<M,T> walker ) { private T processActiveRegion( final ActiveRegion activeRegion, final LinkedHashSet<GATKSAMRecord> reads, final Queue<ActiveRegion> workQueue, final T sum, final ActiveRegionWalker<M,T> walker ) {
final ArrayList<SAMRecord> placedReads = new ArrayList<SAMRecord>(); final ArrayList<GATKSAMRecord> placedReads = new ArrayList<GATKSAMRecord>();
for( final SAMRecord read : reads ) { for( final GATKSAMRecord read : reads ) {
final GenomeLoc readLoc = this.engine.getGenomeLocParser().createGenomeLoc( read ); final GenomeLoc readLoc = this.engine.getGenomeLocParser().createGenomeLoc( read );
if( activeRegion.getLocation().overlapsP( readLoc ) ) { if( activeRegion.getLocation().overlapsP( readLoc ) ) {
// The region which the highest amount of overlap is chosen as the primary region for the read (tie breaking is done as right most region) // The region which the highest amount of overlap is chosen as the primary region for the read (tie breaking is done as right most region)
@ -170,28 +168,28 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
bestRegion = otherRegionToTest; bestRegion = otherRegionToTest;
} }
} }
bestRegion.add( (GATKSAMRecord) read ); bestRegion.add( read );
// The read is also added to all other regions in which it overlaps but marked as non-primary // The read is also added to all other regions in which it overlaps but marked as non-primary
if( walker.wantsNonPrimaryReads() ) { if( walker.wantsNonPrimaryReads() ) {
if( !bestRegion.equals(activeRegion) ) { if( !bestRegion.equals(activeRegion) ) {
activeRegion.add( (GATKSAMRecord) read ); activeRegion.add( read );
} }
for( final ActiveRegion otherRegionToTest : workQueue ) { for( final ActiveRegion otherRegionToTest : workQueue ) {
if( !bestRegion.equals(otherRegionToTest) && otherRegionToTest.getExtendedLoc().overlapsP( readLoc ) ) { if( !bestRegion.equals(otherRegionToTest) && otherRegionToTest.getExtendedLoc().overlapsP( readLoc ) ) {
otherRegionToTest.add( (GATKSAMRecord) read ); otherRegionToTest.add( read );
} }
} }
} }
placedReads.add( read ); placedReads.add( read );
} else if( activeRegion.getExtendedLoc().overlapsP( readLoc ) && walker.wantsNonPrimaryReads() ) { } else if( activeRegion.getExtendedLoc().overlapsP( readLoc ) && walker.wantsNonPrimaryReads() ) {
activeRegion.add( (GATKSAMRecord) read ); activeRegion.add( read );
} }
} }
reads.removeAll( placedReads ); // remove all the reads which have been placed into their active region reads.removeAll( placedReads ); // remove all the reads which have been placed into their active region
logger.debug(">> Map call with " + activeRegion.getReads().size() + " " + (activeRegion.isActive ? "active" : "inactive") + " reads @ " + activeRegion.getLocation() + " with full extent: " + activeRegion.getReferenceLoc()); logger.debug(">> Map call with " + activeRegion.getReads().size() + " " + (activeRegion.isActive ? "active" : "inactive") + " reads @ " + activeRegion.getLocation() + " with full extent: " + activeRegion.getReferenceLoc());
final M x = walker.map( activeRegion, null ); // BUGBUG: tracker needs to be filled in and passed to the walker final M x = walker.map( activeRegion, null );
return walker.reduce( x, sum ); return walker.reduce( x, sum );
} }
@ -214,7 +212,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
} }
// band-pass filter the list of isActive probabilities and turn into active regions // band-pass filter the list of isActive probabilities and turn into active regions
private ArrayList<ActiveRegion> integrateActiveList( final ArrayList<Double> activeList, final GenomeLoc firstIsActiveStart, final int activeRegionExtension ) { private ArrayList<ActiveRegion> integrateActiveList( final ArrayList<Double> activeList, final GenomeLoc firstIsActiveStart, final int activeRegionExtension, final boolean presetRegions ) {
final double ACTIVE_PROB_THRESHOLD = 0.2; // BUGBUG: needs to be set-able by the walker author final double ACTIVE_PROB_THRESHOLD = 0.2; // BUGBUG: needs to be set-able by the walker author
final ArrayList<ActiveRegion> returnList = new ArrayList<ActiveRegion>(); final ArrayList<ActiveRegion> returnList = new ArrayList<ActiveRegion>();
@ -227,11 +225,11 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
} else { } else {
final Double[] activeProbArray = activeList.toArray(new Double[activeList.size()]); final Double[] activeProbArray = activeList.toArray(new Double[activeList.size()]);
final double[] filteredProbArray = new double[activeProbArray.length]; final double[] filteredProbArray = new double[activeProbArray.length];
final int FILTER_SIZE = 50; // BUGBUG: needs to be set-able by the walker author final int FILTER_SIZE = ( presetRegions ? 0 : 50 ); // BUGBUG: needs to be set-able by the walker author
final int MAX_ACTIVE_REGION = 425; // BUGBUG: needs to be set-able by the walker author final int MAX_ACTIVE_REGION = ( presetRegions ? 16001 : 425 ); // BUGBUG: needs to be set-able by the walker author
for( int iii = 0; iii < activeProbArray.length; iii++ ) { for( int iii = 0; iii < activeProbArray.length; iii++ ) {
double maxVal = 0; double maxVal = 0;
for( int jjj = Math.max(0, iii-FILTER_SIZE); jjj < Math.min(activeList.size(), iii+FILTER_SIZE); jjj++ ) { for( int jjj = Math.max(0, iii-FILTER_SIZE); jjj < Math.min(activeList.size(), iii+FILTER_SIZE+1); jjj++ ) {
if( activeProbArray[jjj] > maxVal ) { maxVal = activeProbArray[jjj]; } if( activeProbArray[jjj] > maxVal ) { maxVal = activeProbArray[jjj]; }
} }
filteredProbArray[iii] = maxVal; filteredProbArray[iii] = maxVal;

View File

@ -102,7 +102,9 @@ public class TraverseLoci<M,T> extends TraversalEngine<M,T,LocusWalker<M,T>,Locu
} }
/** /**
* Gets the best view of loci for this walker given the available data. * Gets the best view of loci for this walker given the available data. The view will function as a 'trigger track'
* of sorts, providing a consistent interface so that TraverseLoci doesn't need to be reimplemented for any new datatype
* that comes along.
* @param walker walker to interrogate. * @param walker walker to interrogate.
* @param dataProvider Data which which to drive the locus view. * @param dataProvider Data which which to drive the locus view.
* @return A view of the locus data, where one iteration of the locus view maps to one iteration of the traversal. * @return A view of the locus data, where one iteration of the locus view maps to one iteration of the traversal.

View File

@ -5,14 +5,12 @@ import org.broad.tribble.Feature;
import org.broadinstitute.sting.commandline.Input; import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.commandline.IntervalBinding; import org.broadinstitute.sting.commandline.IntervalBinding;
import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.commandline.RodBinding;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.filters.DuplicateReadFilter; import org.broadinstitute.sting.gatk.filters.DuplicateReadFilter;
import org.broadinstitute.sting.gatk.filters.FailsVendorQualityCheckFilter; import org.broadinstitute.sting.gatk.filters.FailsVendorQualityCheckFilter;
import org.broadinstitute.sting.gatk.filters.NotPrimaryAlignmentFilter; import org.broadinstitute.sting.gatk.filters.NotPrimaryAlignmentFilter;
import org.broadinstitute.sting.gatk.filters.UnmappedReadFilter; import org.broadinstitute.sting.gatk.filters.UnmappedReadFilter;
import org.broadinstitute.sting.gatk.refdata.ReadMetaDataTracker;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLocParser;
@ -77,7 +75,7 @@ public abstract class ActiveRegionWalker<MapType, ReduceType> extends Walker<Map
public abstract double isActive(final RefMetaDataTracker tracker, final ReferenceContext ref, final AlignmentContext context); public abstract double isActive(final RefMetaDataTracker tracker, final ReferenceContext ref, final AlignmentContext context);
// Map over the ActiveRegion // Map over the ActiveRegion
public abstract MapType map(final ActiveRegion activeRegion, final ReadMetaDataTracker metaDataTracker); public abstract MapType map(final ActiveRegion activeRegion, final RefMetaDataTracker metaDataTracker);
public final GenomeLocSortedSet extendIntervals( final GenomeLocSortedSet intervals, final GenomeLocParser genomeLocParser, IndexedFastaSequenceFile reference ) { public final GenomeLocSortedSet extendIntervals( final GenomeLocSortedSet intervals, final GenomeLocParser genomeLocParser, IndexedFastaSequenceFile reference ) {
final int activeRegionExtension = this.getClass().getAnnotation(ActiveRegionExtension.class).extension(); final int activeRegionExtension = this.getClass().getAnnotation(ActiveRegionExtension.class).extension();

View File

@ -22,8 +22,8 @@ import java.util.*;
* User: chartl * User: chartl
* Date: 9/14/11 * Date: 9/14/11
* Time: 12:24 PM * Time: 12:24 PM
* To change this template use File | Settings | File Templates.
*/ */
public class MVLikelihoodRatio extends InfoFieldAnnotation implements ExperimentalAnnotation, RodRequiringAnnotation { public class MVLikelihoodRatio extends InfoFieldAnnotation implements ExperimentalAnnotation, RodRequiringAnnotation {
private MendelianViolation mendelianViolation = null; private MendelianViolation mendelianViolation = null;

View File

@ -9,6 +9,7 @@ import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ExperimentalAn
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.RodRequiringAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.RodRequiringAnnotation;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineCount;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine; import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
@ -58,40 +59,33 @@ public class TransmissionDisequilibriumTest extends InfoFieldAnnotation implemen
// return the descriptions used for the VCF INFO meta field // return the descriptions used for the VCF INFO meta field
public List<String> getKeyNames() { return Arrays.asList("TDT"); } public List<String> getKeyNames() { return Arrays.asList("TDT"); }
public List<VCFInfoHeaderLine> getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("TDT", 1, VCFHeaderLineType.Float, "Test statistic from Wittkowski transmission disequilibrium test.")); } public List<VCFInfoHeaderLine> getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("TDT", VCFHeaderLineCount.A, VCFHeaderLineType.Float, "Test statistic from Wittkowski transmission disequilibrium test.")); }
// Following derivation in http://en.wikipedia.org/wiki/Transmission_disequilibrium_test#A_modified_version_of_the_TDT // Following derivation in http://en.wikipedia.org/wiki/Transmission_disequilibrium_test#A_modified_version_of_the_TDT
private double calculateTDT( final VariantContext vc, final Set<Sample> triosToTest ) { private List<Double> calculateTDT( final VariantContext vc, final Set<Sample> triosToTest ) {
double nABGivenABandBB = 0.0; List<Double> pairwiseTDTs = new ArrayList<Double>(10);
double nBBGivenABandBB = 0.0; final int HomRefIndex = 0;
double nAAGivenABandAB = 0.0;
double nBBGivenABandAB = 0.0;
double nAAGivenAAandAB = 0.0;
double nABGivenAAandAB = 0.0;
// for each pair of alleles, add the likelihoods // for each pair of alleles, add the likelihoods
int numAlleles = vc.getNAlleles(); int numAltAlleles = vc.getAlternateAlleles().size();
for ( int allele1 = 0; allele1 < numAlleles; allele1++ ) { for ( int alt = 1; alt <= numAltAlleles; alt++ ) {
for ( int allele2 = allele1 + 1; allele2 < numAlleles; allele2++ ) { final int HetIndex = alt;
final int HomVarIndex = determineHomIndex(alt, numAltAlleles+1);
// TODO -- cache these for better performance final double nABGivenABandBB = calculateNChildren(vc, triosToTest, HetIndex, HetIndex, HomVarIndex) + calculateNChildren(vc, triosToTest, HetIndex, HomVarIndex, HetIndex);
final int HOM1index = determineHomIndex(allele1, numAlleles); final double nBBGivenABandBB = calculateNChildren(vc, triosToTest, HomVarIndex, HetIndex, HomVarIndex) + calculateNChildren(vc, triosToTest, HomVarIndex, HomVarIndex, HetIndex);
final int HETindex = HOM1index + (allele2 - allele1); final double nAAGivenABandAB = calculateNChildren(vc, triosToTest, HomRefIndex, HetIndex, HetIndex);
final int HOM2index = determineHomIndex(allele2, numAlleles); final double nBBGivenABandAB = calculateNChildren(vc, triosToTest, HomVarIndex, HetIndex, HetIndex);
final double nAAGivenAAandAB = calculateNChildren(vc, triosToTest, HomRefIndex, HomRefIndex, HetIndex) + calculateNChildren(vc, triosToTest, HomRefIndex, HetIndex, HomRefIndex);
final double nABGivenAAandAB = calculateNChildren(vc, triosToTest, HetIndex, HomRefIndex, HetIndex) + calculateNChildren(vc, triosToTest, HetIndex, HetIndex, HomRefIndex);
nABGivenABandBB += calculateNChildren(vc, triosToTest, HETindex, HETindex, HOM2index) + calculateNChildren(vc, triosToTest, HETindex, HOM2index, HETindex); final double numer = (nABGivenABandBB - nBBGivenABandBB) + 2.0 * (nAAGivenABandAB - nBBGivenABandAB) + (nAAGivenAAandAB - nABGivenAAandAB);
nBBGivenABandBB += calculateNChildren(vc, triosToTest, HOM2index, HETindex, HOM2index) + calculateNChildren(vc, triosToTest, HOM2index, HOM2index, HETindex); final double denom = (nABGivenABandBB + nBBGivenABandBB) + 4.0 * (nAAGivenABandAB + nBBGivenABandAB) + (nAAGivenAAandAB + nABGivenAAandAB);
nAAGivenABandAB += calculateNChildren(vc, triosToTest, HOM1index, HETindex, HETindex); pairwiseTDTs.add((numer * numer) / denom);
nBBGivenABandAB += calculateNChildren(vc, triosToTest, HOM2index, HETindex, HETindex);
nAAGivenAAandAB += calculateNChildren(vc, triosToTest, HOM1index, HOM1index, HETindex) + calculateNChildren(vc, triosToTest, HOM1index, HETindex, HOM1index);
nABGivenAAandAB += calculateNChildren(vc, triosToTest, HETindex, HOM1index, HETindex) + calculateNChildren(vc, triosToTest, HETindex, HETindex, HOM1index);
}
} }
final double numer = (nABGivenABandBB - nBBGivenABandBB) + 2.0 * (nAAGivenABandAB - nBBGivenABandAB) + (nAAGivenAAandAB - nABGivenAAandAB); return pairwiseTDTs;
final double denom = (nABGivenABandBB + nBBGivenABandBB) + 4.0 * (nAAGivenABandAB + nBBGivenABandAB) + (nAAGivenAAandAB + nABGivenAAandAB);
return (numer * numer) / denom;
} }
private double calculateNChildren( final VariantContext vc, final Set<Sample> triosToTest, final int childIdx, final int momIdx, final int dadIdx ) { private double calculateNChildren( final VariantContext vc, final Set<Sample> triosToTest, final int childIdx, final int momIdx, final int dadIdx ) {

View File

@ -0,0 +1,130 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 9/26/11
*/
public class ContextCovariate implements StandardCovariate {
private int mismatchesContextSize;
private int insertionsContextSize;
private int deletionsContextSize;
private String mismatchesNoContext = "";
private String insertionsNoContext = "";
private String deletionsNoContext = "";
// Initialize any member variables using the command-line arguments passed to the walkers
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
mismatchesContextSize = RAC.MISMATCHES_CONTEXT_SIZE;
insertionsContextSize = RAC.INSERTIONS_CONTEXT_SIZE;
deletionsContextSize = RAC.DELETIONS_CONTEXT_SIZE;
if (mismatchesContextSize <= 0 || insertionsContextSize <= 0 || deletionsContextSize <= 0)
throw new UserException(String.format("Context Size must be positive, if you don't want to use the context covariate, just turn it off instead. Mismatches: %d Insertions: %d Deletions:%d", mismatchesContextSize, insertionsContextSize, deletionsContextSize));
// initialize no context strings given the size of the context for each covariate type
mismatchesNoContext = makeAllNStringWithLength(mismatchesContextSize);
insertionsNoContext = makeAllNStringWithLength(insertionsContextSize);
deletionsNoContext = makeAllNStringWithLength( deletionsContextSize);
}
@Override
public CovariateValues getValues(final GATKSAMRecord read) {
int l = read.getReadLength();
String[] mismatches = new String [l];
String[] insertions = new String [l];
String[] deletions = new String [l];
final boolean negativeStrand = read.getReadNegativeStrandFlag();
byte[] bases = read.getReadBases();
if (negativeStrand) {
bases = BaseUtils.simpleReverseComplement(bases); //this is NOT in-place
}
for (int i = 0; i < read.getReadLength(); i++) {
mismatches[i] = contextWith(bases, i, mismatchesContextSize, mismatchesNoContext);
insertions[i] = contextWith(bases, i, insertionsContextSize, insertionsNoContext);
deletions[i] = contextWith(bases, i, deletionsContextSize, deletionsNoContext);
}
if (negativeStrand) {
reverse(mismatches);
reverse(insertions);
reverse(deletions);
}
return new CovariateValues(mismatches, insertions, deletions);
}
// Used to get the covariate's value from input csv file during on-the-fly recalibration
@Override
public final Comparable getValue(final String str) {
return str;
}
/**
* calculates the context of a base independent of the covariate mode
*
* @param bases the bases in the read to build the context from
* @param offset the position in the read to calculate the context for
* @param contextSize context size to use building the context
* @param noContextString string to return if the position is not far enough in the read to have a full context before.
* @return
*/
private String contextWith(byte [] bases, int offset, int contextSize, String noContextString) {
return (offset < contextSize) ? noContextString : new String(Arrays.copyOfRange(bases, offset - contextSize, offset));
}
private String makeAllNStringWithLength(int length) {
String s = "";
for (int i=0; i<length; i++)
s += "N";
return s;
}
/**
* Reverses the given array in place.
*
* @param array any array
*/
private static void reverse(final Comparable[] array) {
final int arrayLength = array.length;
for (int l = 0, r = arrayLength - 1; l < r; l++, r--) {
final Comparable temp = array[l];
array[l] = array[r];
array[r] = temp;
}
}
}

View File

@ -0,0 +1,63 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Oct 30, 2009
*
* The Covariate interface. A Covariate is a feature used in the recalibration that can be picked out of the read.
* In general most error checking and adjustments to the data are done before the call to the covariates getValue methods in order to speed up the code.
* This unfortunately muddies the code, but most of these corrections can be done per read while the covariates get called per base, resulting in a big speed up.
*/
public interface Covariate {
/**
* Initialize any member variables using the command-line arguments passed to the walker
*
* @param RAC the recalibration argument collection
*/
public void initialize(RecalibrationArgumentCollection RAC);
/**
* Calculates covariate values for all positions in the read.
*
* @param read the read to calculate the covariates on.
* @return all the covariate values for every base in the read.
*/
public CovariateValues getValues(GATKSAMRecord read);
public Comparable getValue(String str); // Used to get the covariate's value from input csv file during on-the-fly recalibration
}
interface RequiredCovariate extends Covariate {}
interface StandardCovariate extends Covariate {}
interface ExperimentalCovariate extends Covariate {}

View File

@ -0,0 +1,88 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
/**
* The object temporarily held by a read that describes all of it's covariates.
*
* In essence, this is an array of CovariateValues, but it also has some functionality to deal with the optimizations of the NestedHashMap
*
* @author Mauricio Carneiro
* @since 2/8/12
*/
public class CovariateKeySet {
private Object[][] mismatchesKeySet;
private Object[][] insertionsKeySet;
private Object[][] deletionsKeySet;
private int nextCovariateIndex;
private static String mismatchesCovariateName = "M";
private static String insertionsCovariateName = "I";
private static String deletionsCovariateName = "D";
public CovariateKeySet(int readLength, int numberOfCovariates) {
numberOfCovariates++; // +1 because we are adding the mismatch covariate (to comply with the molten table format)
this.mismatchesKeySet = new Object[readLength][numberOfCovariates];
this.insertionsKeySet = new Object[readLength][numberOfCovariates];
this.deletionsKeySet = new Object[readLength][numberOfCovariates];
initializeCovariateKeySet(this.mismatchesKeySet, mismatchesCovariateName);
initializeCovariateKeySet(this.insertionsKeySet, insertionsCovariateName);
initializeCovariateKeySet(this.deletionsKeySet, deletionsCovariateName);
this.nextCovariateIndex = 0;
}
public void addCovariate(CovariateValues covariate) {
transposeCovariateValues(mismatchesKeySet, covariate.getMismatches());
transposeCovariateValues(insertionsKeySet, covariate.getInsertions());
transposeCovariateValues(deletionsKeySet, covariate.getDeletions());
nextCovariateIndex++;
}
public static RecalDataManager.BaseRecalibrationType getErrorModelFromString(final String modelString) {
if (modelString.equals(mismatchesCovariateName))
return RecalDataManager.BaseRecalibrationType.BASE_SUBSTITUTION;
else if (modelString.equals(insertionsCovariateName))
return RecalDataManager.BaseRecalibrationType.BASE_INSERTION;
else if (modelString.equals(deletionsCovariateName))
return RecalDataManager.BaseRecalibrationType.BASE_DELETION;
throw new ReviewedStingException("Unrecognized Base Recalibration model string: " + modelString);
}
public Object[] getKeySet(final int readPosition, final RecalDataManager.BaseRecalibrationType errorModel) {
switch (errorModel) {
case BASE_SUBSTITUTION:
return getMismatchesKeySet(readPosition);
case BASE_INSERTION:
return getInsertionsKeySet(readPosition);
case BASE_DELETION:
return getDeletionsKeySet(readPosition);
default:
throw new ReviewedStingException("Unrecognized Base Recalibration type: " + errorModel );
}
}
public Object[] getMismatchesKeySet(int readPosition) {
return mismatchesKeySet[readPosition];
}
public Object[] getInsertionsKeySet(int readPosition) {
return insertionsKeySet[readPosition];
}
public Object[] getDeletionsKeySet(int readPosition) {
return deletionsKeySet[readPosition];
}
private void transposeCovariateValues (Object [][] keySet, Object [] covariateValues) {
for (int i=0; i<covariateValues.length; i++)
keySet[i][nextCovariateIndex] = covariateValues[i];
}
private void initializeCovariateKeySet (Object[][] keySet, String covariateName) {
int readLength = keySet.length;
int lastCovariateIndex = keySet[0].length - 1;
for (int i = 0; i < readLength; i++)
keySet[i][lastCovariateIndex] = covariateName;
}
}

View File

@ -0,0 +1,37 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
/**
* An object to hold the different covariate values for all bases in the read.
*
* Currently we have three different covariates for each read:
* - Mismatch
* - Insertion
* - Deletion
*
* @author Mauricio Carneiro
* @since 2/8/12
*/
public class CovariateValues {
private Comparable[] mismatches;
private Comparable[] insertions;
private Comparable[] deletions;
public CovariateValues(Comparable[] mismatch, Comparable[] insertion, Comparable[] deletion) {
this.mismatches = mismatch;
this.insertions = insertion;
this.deletions = deletion;
}
public Comparable[] getMismatches() {
return mismatches;
}
public Comparable[] getInsertions() {
return insertions;
}
public Comparable[] getDeletions() {
return deletions;
}
}

View File

@ -0,0 +1,204 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.NGSPlatform;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.EnumSet;
/*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Oct 30, 2009
*
* The Cycle covariate.
* For Solexa the cycle is simply the position in the read (counting backwards if it is a negative strand read)
* For 454 the cycle is the TACG flow cycle, that is, each flow grabs all the TACG's in order in a single cycle
* For example, for the read: AAACCCCGAAATTTTTACTG
* the cycle would be 11111111222333333344
* For SOLiD the cycle is a more complicated mixture of ligation cycle and primer round
*/
public class CycleCovariate implements StandardCovariate {
private final static EnumSet<NGSPlatform> DISCRETE_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.ILLUMINA, NGSPlatform.SOLID, NGSPlatform.PACBIO, NGSPlatform.COMPLETE_GENOMICS);
private final static EnumSet<NGSPlatform> FLOW_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.LS454, NGSPlatform.ION_TORRENT);
// Initialize any member variables using the command-line arguments passed to the walkers
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
if (RAC.DEFAULT_PLATFORM != null && !NGSPlatform.isKnown(RAC.DEFAULT_PLATFORM))
throw new UserException.CommandLineException("The requested default platform (" + RAC.DEFAULT_PLATFORM + ") is not a recognized platform.");
}
// Used to pick out the covariate's value from attributes of the read
@Override
public CovariateValues getValues(final GATKSAMRecord read) {
Integer [] cycles = new Integer[read.getReadLength()];
final NGSPlatform ngsPlatform = read.getNGSPlatform();
// Discrete cycle platforms
if (DISCRETE_CYCLE_PLATFORMS.contains(ngsPlatform)) {
final int init;
final int increment;
if (!read.getReadNegativeStrandFlag()) {
// Differentiate between first and second of pair.
// The sequencing machine cycle keeps incrementing for the second read in a pair. So it is possible for a read group
// to have an error affecting quality at a particular cycle on the first of pair which carries over to the second of pair.
// Therefore the cycle covariate must differentiate between first and second of pair reads.
// This effect can not be corrected by pulling out the first of pair and second of pair flags into a separate covariate because
// the current sequential model would consider the effects independently instead of jointly.
if (read.getReadPairedFlag() && read.getSecondOfPairFlag()) {
//second of pair, positive strand
init = -1;
increment = -1;
}
else {
//first of pair, positive strand
init = 1;
increment = 1;
}
}
else {
if (read.getReadPairedFlag() && read.getSecondOfPairFlag()) {
//second of pair, negative strand
init = -read.getReadLength();
increment = 1;
}
else {
//first of pair, negative strand
init = read.getReadLength();
increment = -1;
}
}
int cycle = init;
for (int i = 0; i < read.getReadLength(); i++) {
cycles[i] = cycle;
cycle += increment;
}
}
// Flow cycle platforms
else if (FLOW_CYCLE_PLATFORMS.contains(ngsPlatform)) {
final int readLength = read.getReadLength();
final byte[] bases = read.getReadBases();
// Differentiate between first and second of pair.
// The sequencing machine cycle keeps incrementing for the second read in a pair. So it is possible for a read group
// to have an error affecting quality at a particular cycle on the first of pair which carries over to the second of pair.
// Therefore the cycle covariate must differentiate between first and second of pair reads.
// This effect can not be corrected by pulling out the first of pair and second of pair flags into a separate covariate because
// the current sequential model would consider the effects independently instead of jointly.
final boolean multiplyByNegative1 = read.getReadPairedFlag() && read.getSecondOfPairFlag();
int cycle = multiplyByNegative1 ? -1 : 1;
// BUGBUG: Consider looking at degradation of base quality scores in homopolymer runs to detect when the cycle incremented even though the nucleotide didn't change
// For example, AAAAAAA was probably read in two flow cycles but here we count it as one
if (!read.getReadNegativeStrandFlag()) { // Forward direction
int iii = 0;
while (iii < readLength) {
while (iii < readLength && bases[iii] == (byte) 'T') {
cycles[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'A') {
cycles[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'C') {
cycles[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'G') {
cycles[iii] = cycle;
iii++;
}
if (iii < readLength) {
if (multiplyByNegative1)
cycle--;
else
cycle++;
}
if (iii < readLength && !BaseUtils.isRegularBase(bases[iii])) {
cycles[iii] = cycle;
iii++;
}
}
}
else { // Negative direction
int iii = readLength - 1;
while (iii >= 0) {
while (iii >= 0 && bases[iii] == (byte) 'T') {
cycles[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'A') {
cycles[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'C') {
cycles[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'G') {
cycles[iii] = cycle;
iii--;
}
if (iii >= 0) {
if (multiplyByNegative1)
cycle--;
else
cycle++;
}
if (iii >= 0 && !BaseUtils.isRegularBase(bases[iii])) {
cycles[iii] = cycle;
iii--;
}
}
}
}
// Unknown platforms
else {
throw new UserException("The platform (" + read.getReadGroup().getPlatform() + ") associated with read group " + read.getReadGroup() + " is not a recognized platform. Implemented options are e.g. illumina, 454, and solid");
}
return new CovariateValues(cycles, cycles, cycles);
}
// Used to get the covariate's value from input csv file during on-the-fly recalibration
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -0,0 +1,73 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Nov 3, 2009
*
* The Reported Quality Score covariate.
*/
public class QualityScoreCovariate implements RequiredCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
@Override
public CovariateValues getValues(final GATKSAMRecord read) {
int readLength = read.getReadLength();
Integer [] mismatches = new Integer[readLength];
Integer [] insertions = new Integer[readLength];
Integer [] deletions = new Integer[readLength];
byte [] baseQualities = read.getBaseQualities();
byte [] baseInsertionQualities = read.getBaseInsertionQualities();
byte [] baseDeletionQualities = read.getBaseDeletionQualities();
for (int i=0; i<baseQualities.length; i++) {
mismatches[i] = (int) baseQualities[i];
insertions[i] = (int) baseInsertionQualities[i];
deletions[i] = (int) baseDeletionQualities[i];
}
return new CovariateValues(mismatches, insertions, deletions);
}
// Used to get the covariate's value from input csv file during on-the-fly recalibration
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -0,0 +1,63 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Oct 30, 2009
*
* The Read Group covariate.
*/
public class ReadGroupCovariate implements RequiredCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
@Override
public CovariateValues getValues(final GATKSAMRecord read) {
final int l = read.getReadLength();
final String readGroupId = read.getReadGroup().getReadGroupId();
String [] readGroups = new String[l];
Arrays.fill(readGroups, readGroupId);
return new CovariateValues(readGroups, readGroups, readGroups);
}
// Used to get the covariate's value from input csv file during on-the-fly recalibration
@Override
public final Comparable getValue(final String str) {
return str;
}
}

View File

@ -0,0 +1,710 @@
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.bqsr;
import net.sf.samtools.SAMUtils;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.sam.AlignmentUtils;
import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils;
import java.util.ArrayList;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Nov 6, 2009
*
* This helper class holds the data HashMap as well as submaps that represent the marginal distributions collapsed over all needed dimensions.
* It also has static methods that are used to perform the various solid recalibration modes that attempt to correct the reference bias.
* This class holds the parsing methods that are shared between CountCovariates and TableRecalibration.
*/
public class RecalDataManager {
public final NestedHashMap nestedHashMap; // The full dataset
private final HashMap<BaseRecalibrationType, NestedHashMap> dataCollapsedReadGroup; // Table where everything except read group has been collapsed
private final HashMap<BaseRecalibrationType, NestedHashMap> dataCollapsedQualityScore; // Table where everything except read group and quality score has been collapsed
private final HashMap<BaseRecalibrationType, ArrayList<NestedHashMap>> dataCollapsedByCovariate; // Tables where everything except read group, quality score, and given covariate has been collapsed
public final static String ORIGINAL_QUAL_ATTRIBUTE_TAG = "OQ"; // The tag that holds the original quality scores
public final static String COLOR_SPACE_QUAL_ATTRIBUTE_TAG = "CQ"; // The tag that holds the color space quality scores for SOLID bams
public final static String COLOR_SPACE_ATTRIBUTE_TAG = "CS"; // The tag that holds the color space for SOLID bams
public final static String COLOR_SPACE_INCONSISTENCY_TAG = "ZC"; // A new tag made up for the recalibrator which will hold an array of ints which say if this base is inconsistent with its color
private static boolean warnUserNullPlatform = false;
private static final String COVARS_ATTRIBUTE = "COVARS"; // used to store covariates array as a temporary attribute inside GATKSAMRecord.\
public enum BaseRecalibrationType {
BASE_SUBSTITUTION,
BASE_INSERTION,
BASE_DELETION
}
public enum SOLID_RECAL_MODE {
/**
* Treat reference inserted bases as reference matching bases. Very unsafe!
*/
DO_NOTHING,
/**
* Set reference inserted bases and the previous base (because of color space alignment details) to Q0. This is the default option.
*/
SET_Q_ZERO,
/**
* In addition to setting the quality scores to zero, also set the base itself to 'N'. This is useful to visualize in IGV.
*/
SET_Q_ZERO_BASE_N,
/**
* Look at the color quality scores and probabilistically decide to change the reference inserted base to be the base which is implied by the original color space instead of the reference.
*/
REMOVE_REF_BIAS
}
public enum SOLID_NOCALL_STRATEGY {
/**
* When a no call is detected throw an exception to alert the user that recalibrating this SOLiD data is unsafe. This is the default option.
*/
THROW_EXCEPTION,
/**
* Leave the read in the output bam completely untouched. This mode is only okay if the no calls are very rare.
*/
LEAVE_READ_UNRECALIBRATED,
/**
* Mark these reads as failing vendor quality checks so they can be filtered out by downstream analyses.
*/
PURGE_READ
}
public RecalDataManager() {
nestedHashMap = new NestedHashMap();
dataCollapsedReadGroup = null;
dataCollapsedQualityScore = null;
dataCollapsedByCovariate = null;
}
public RecalDataManager(final boolean createCollapsedTables, final int numCovariates) {
if (createCollapsedTables) { // Initialize all the collapsed tables, only used by on-the-fly recalibration
nestedHashMap = null;
dataCollapsedReadGroup = new HashMap<BaseRecalibrationType, NestedHashMap>();
dataCollapsedQualityScore = new HashMap<BaseRecalibrationType, NestedHashMap>();
dataCollapsedByCovariate = new HashMap<BaseRecalibrationType, ArrayList<NestedHashMap>>();
for ( final BaseRecalibrationType errorModel : BaseRecalibrationType.values() ) {
dataCollapsedReadGroup.put(errorModel, new NestedHashMap());
dataCollapsedQualityScore.put(errorModel, new NestedHashMap());
dataCollapsedByCovariate.put(errorModel, new ArrayList<NestedHashMap>());
for (int iii = 0; iii < numCovariates - 2; iii++) { // readGroup and QualityScore aren't counted here, their tables are separate
dataCollapsedByCovariate.get(errorModel).add(new NestedHashMap());
}
}
}
else {
nestedHashMap = new NestedHashMap();
dataCollapsedReadGroup = null;
dataCollapsedQualityScore = null;
dataCollapsedByCovariate = null;
}
}
public static CovariateKeySet getAllCovariateValuesFor(GATKSAMRecord read) {
return (CovariateKeySet) read.getTemporaryAttribute(COVARS_ATTRIBUTE);
}
/**
* Add the given mapping to all of the collapsed hash tables
*
* @param key The list of comparables that is the key for this mapping
* @param fullDatum The RecalDatum which is the data for this mapping
* @param PRESERVE_QSCORES_LESS_THAN The threshold in report quality for adding to the aggregate collapsed table
*/
public final void addToAllTables(final Object[] key, final RecalDatum fullDatum, final int PRESERVE_QSCORES_LESS_THAN, final BaseRecalibrationType errorModel ) {
// The full dataset isn't actually ever used for anything because of the sequential calculation so no need to keep the full data HashMap around
//data.put(key, thisDatum); // add the mapping to the main table
final int qualityScore = Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3];
RecalDatum collapsedDatum;
// Create dataCollapsedReadGroup, the table where everything except read group has been collapsed
if (qualityScore >= PRESERVE_QSCORES_LESS_THAN) {
readGroupCollapsedKey[0] = key[0]; // Make a new key with just the read group
collapsedDatum = (RecalDatum) dataCollapsedReadGroup.get(errorModel).get(readGroupCollapsedKey);
if (collapsedDatum == null) {
dataCollapsedReadGroup.get(errorModel).put(new RecalDatum(fullDatum), readGroupCollapsedKey);
}
else {
collapsedDatum.combine(fullDatum); // using combine instead of increment in order to calculate overall aggregateQReported
}
}
// Create dataCollapsedQuality, the table where everything except read group and quality score has been collapsed
qualityScoreCollapsedKey[0] = key[0]; // Make a new key with the read group ...
qualityScoreCollapsedKey[1] = key[1]; // and quality score
collapsedDatum = (RecalDatum) dataCollapsedQualityScore.get(errorModel).get(qualityScoreCollapsedKey);
if (collapsedDatum == null) {
dataCollapsedQualityScore.get(errorModel).put(new RecalDatum(fullDatum), qualityScoreCollapsedKey);
}
else {
collapsedDatum.increment(fullDatum);
}
// Create dataCollapsedByCovariate's, the tables where everything except read group, quality score, and given covariate has been collapsed
for (int iii = 0; iii < dataCollapsedByCovariate.get(errorModel).size(); iii++) {
covariateCollapsedKey[0] = key[0]; // Make a new key with the read group ...
covariateCollapsedKey[1] = key[1]; // and quality score ...
final Object theCovariateElement = key[iii + 2]; // and the given covariate
if (theCovariateElement != null) {
covariateCollapsedKey[2] = theCovariateElement;
collapsedDatum = (RecalDatum) dataCollapsedByCovariate.get(errorModel).get(iii).get(covariateCollapsedKey);
if (collapsedDatum == null) {
dataCollapsedByCovariate.get(errorModel).get(iii).put(new RecalDatum(fullDatum), covariateCollapsedKey);
}
else {
collapsedDatum.increment(fullDatum);
}
}
}
}
/**
* Loop over all the collapsed tables and turn the recalDatums found there into an empirical quality score
* that will be used in the sequential calculation in TableRecalibrationWalker
*
* @param smoothing The smoothing parameter that goes into empirical quality score calculation
* @param maxQual At which value to cap the quality scores
*/
public final void generateEmpiricalQualities(final int smoothing, final int maxQual) {
for( final BaseRecalibrationType errorModel : BaseRecalibrationType.values() ) {
recursivelyGenerateEmpiricalQualities(dataCollapsedReadGroup.get(errorModel).data, smoothing, maxQual);
recursivelyGenerateEmpiricalQualities(dataCollapsedQualityScore.get(errorModel).data, smoothing, maxQual);
for (NestedHashMap map : dataCollapsedByCovariate.get(errorModel)) {
recursivelyGenerateEmpiricalQualities(map.data, smoothing, maxQual);
checkForSingletons(map.data);
}
}
}
private void recursivelyGenerateEmpiricalQualities(final Map data, final int smoothing, final int maxQual) {
for (Object comp : data.keySet()) {
final Object val = data.get(comp);
if (val instanceof RecalDatum) { // We are at the end of the nested hash maps
((RecalDatum) val).calcCombinedEmpiricalQuality(smoothing, maxQual);
}
else { // Another layer in the nested hash map
recursivelyGenerateEmpiricalQualities((Map) val, smoothing, maxQual);
}
}
}
private void checkForSingletons(final Map data) {
// todo -- this looks like it's better just as a data.valueSet() call?
for (Object comp : data.keySet()) {
final Object val = data.get(comp);
if (val instanceof RecalDatum) { // We are at the end of the nested hash maps
if (data.keySet().size() == 1) {
data.clear(); // don't TableRecalibrate a non-required covariate if it only has one element because that correction has already been done ...
// in a previous step of the sequential calculation model
}
}
else { // Another layer in the nested hash map
checkForSingletons((Map) val);
}
}
}
/**
* Get the appropriate collapsed table out of the set of all the tables held by this Object
*
* @param covariate Which covariate indexes the desired collapsed HashMap
* @return The desired collapsed HashMap
*/
public final NestedHashMap getCollapsedTable(final int covariate, final BaseRecalibrationType errorModel) {
if (covariate == 0) {
return dataCollapsedReadGroup.get(errorModel); // Table where everything except read group has been collapsed
}
else if (covariate == 1) {
return dataCollapsedQualityScore.get(errorModel); // Table where everything except read group and quality score has been collapsed
}
else {
return dataCollapsedByCovariate.get(errorModel).get(covariate - 2); // Table where everything except read group, quality score, and given covariate has been collapsed
}
}
/**
* Section of code shared between the two recalibration walkers which uses the command line arguments to adjust attributes of the read such as quals or platform string
*
* @param read The read to adjust
* @param RAC The list of shared command line arguments
*/
public static void parseSAMRecord(final GATKSAMRecord read, final RecalibrationArgumentCollection RAC) {
GATKSAMReadGroupRecord readGroup = read.getReadGroup();
if (RAC.FORCE_PLATFORM != null && (readGroup.getPlatform() == null || !readGroup.getPlatform().equals(RAC.FORCE_PLATFORM))) {
readGroup.setPlatform(RAC.FORCE_PLATFORM);
}
if (readGroup.getPlatform() == null) {
if (RAC.DEFAULT_PLATFORM != null) {
if (!warnUserNullPlatform) {
Utils.warnUser("The input .bam file contains reads with no platform information. " +
"Defaulting to platform = " + RAC.DEFAULT_PLATFORM + ". " +
"First observed at read with name = " + read.getReadName());
warnUserNullPlatform = true;
}
readGroup.setPlatform(RAC.DEFAULT_PLATFORM);
}
else {
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no platform information. First observed at read with name = " + read.getReadName());
}
}
}
/**
* Parse through the color space of the read and add a new tag to the SAMRecord that says which bases are inconsistent with the color space
*
* @param read The SAMRecord to parse
*/
public static void parseColorSpace(final GATKSAMRecord read) {
// If this is a SOLID read then we have to check if the color space is inconsistent. This is our only sign that SOLID has inserted the reference base
if (ReadUtils.isSOLiDRead(read)) {
if (read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG) == null) { // Haven't calculated the inconsistency array yet for this read
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if (attr != null) {
byte[] colorSpace;
if (attr instanceof String) {
colorSpace = ((String) attr).getBytes();
}
else {
throw new UserException.MalformedBAM(read, String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
}
// Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read
byte[] readBases = read.getReadBases();
if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement(read.getReadBases());
}
final byte[] inconsistency = new byte[readBases.length];
int iii;
byte prevBase = colorSpace[0]; // The sentinel
for (iii = 0; iii < readBases.length; iii++) {
final byte thisBase = getNextBaseFromColor(read, prevBase, colorSpace[iii + 1]);
inconsistency[iii] = (byte) (thisBase == readBases[iii] ? 0 : 1);
prevBase = readBases[iii];
}
read.setAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency);
}
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
}
}
}
}
/**
* Parse through the color space of the read and apply the desired --solid_recal_mode correction to the bases
* This method doesn't add the inconsistent tag to the read like parseColorSpace does
*
* @param read The SAMRecord to parse
* @param originalQualScores The array of original quality scores to modify during the correction
* @param solidRecalMode Which mode of solid recalibration to apply
* @param refBases The reference for this read
* @return A new array of quality scores that have been ref bias corrected
*/
public static byte[] calcColorSpace(final GATKSAMRecord read, byte[] originalQualScores, final SOLID_RECAL_MODE solidRecalMode, final byte[] refBases) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if (attr != null) {
byte[] colorSpace;
if (attr instanceof String) {
colorSpace = ((String) attr).getBytes();
}
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
}
// Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read
byte[] readBases = read.getReadBases();
final byte[] colorImpliedBases = readBases.clone();
byte[] refBasesDirRead = AlignmentUtils.alignmentToByteArray(read.getCigar(), read.getReadBases(), refBases); //BUGBUG: This needs to change when read walkers are changed to give the aligned refBases
if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement(read.getReadBases());
refBasesDirRead = BaseUtils.simpleReverseComplement(refBasesDirRead.clone());
}
final int[] inconsistency = new int[readBases.length];
byte prevBase = colorSpace[0]; // The sentinel
for (int iii = 0; iii < readBases.length; iii++) {
final byte thisBase = getNextBaseFromColor(read, prevBase, colorSpace[iii + 1]);
colorImpliedBases[iii] = thisBase;
inconsistency[iii] = (thisBase == readBases[iii] ? 0 : 1);
prevBase = readBases[iii];
}
// Now that we have the inconsistency array apply the desired correction to the inconsistent bases
if (solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO) { // Set inconsistent bases and the one before it to Q0
final boolean setBaseN = false;
originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN);
}
else if (solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO_BASE_N) {
final boolean setBaseN = true;
originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN);
}
else if (solidRecalMode == SOLID_RECAL_MODE.REMOVE_REF_BIAS) { // Use the color space quality to probabilistically remove ref bases at inconsistent color space bases
solidRecalRemoveRefBias(read, readBases, inconsistency, colorImpliedBases, refBasesDirRead);
}
}
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
}
return originalQualScores;
}
public static boolean checkNoCallColorSpace(final GATKSAMRecord read) {
if (ReadUtils.isSOLiDRead(read)) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if (attr != null) {
byte[] colorSpace;
if (attr instanceof String) {
colorSpace = ((String) attr).substring(1).getBytes(); // trim off the Sentinel
}
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
}
for (byte color : colorSpace) {
if (color != (byte) '0' && color != (byte) '1' && color != (byte) '2' && color != (byte) '3') {
return true; // There is a bad color in this SOLiD read and the user wants to skip over it
}
}
}
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
}
}
return false; // There aren't any color no calls in this SOLiD read
}
/**
* Perform the SET_Q_ZERO solid recalibration. Inconsistent color space bases and their previous base are set to quality zero
*
* @param read The SAMRecord to recalibrate
* @param readBases The bases in the read which have been RC'd if necessary
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color
* @param originalQualScores The array of original quality scores to set to zero if needed
* @param refBases The reference which has been RC'd if necessary
* @param setBaseN Should we also set the base to N as well as quality zero in order to visualize in IGV or something similar
* @return The byte array of original quality scores some of which might have been set to zero
*/
private static byte[] solidRecalSetToQZero(final GATKSAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] originalQualScores, final byte[] refBases, final boolean setBaseN) {
final boolean negStrand = read.getReadNegativeStrandFlag();
for (int iii = 1; iii < originalQualScores.length; iii++) {
if (inconsistency[iii] == 1) {
if (readBases[iii] == refBases[iii]) {
if (negStrand) {
originalQualScores[originalQualScores.length - (iii + 1)] = (byte) 0;
}
else {
originalQualScores[iii] = (byte) 0;
}
if (setBaseN) {
readBases[iii] = (byte) 'N';
}
}
// Set the prev base to Q0 as well
if (readBases[iii - 1] == refBases[iii - 1]) {
if (negStrand) {
originalQualScores[originalQualScores.length - iii] = (byte) 0;
}
else {
originalQualScores[iii - 1] = (byte) 0;
}
if (setBaseN) {
readBases[iii - 1] = (byte) 'N';
}
}
}
}
if (negStrand) {
readBases = BaseUtils.simpleReverseComplement(readBases.clone()); // Put the bases back in reverse order to stuff them back in the read
}
read.setReadBases(readBases);
return originalQualScores;
}
/**
* Peform the REMOVE_REF_BIAS solid recalibration. Look at the color space qualities and probabilistically decide if the base should be change to match the color or left as reference
*
* @param read The SAMRecord to recalibrate
* @param readBases The bases in the read which have been RC'd if necessary
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color
* @param colorImpliedBases The bases implied by the color space, RC'd if necessary
* @param refBases The reference which has been RC'd if necessary
*/
private static void solidRecalRemoveRefBias(final GATKSAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] colorImpliedBases, final byte[] refBases) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG);
if (attr != null) {
byte[] colorSpaceQuals;
if (attr instanceof String) {
String x = (String) attr;
colorSpaceQuals = x.getBytes();
SAMUtils.fastqToPhred(colorSpaceQuals);
}
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG, read.getReadName()));
}
for (int iii = 1; iii < inconsistency.length - 1; iii++) {
if (inconsistency[iii] == 1) {
for (int jjj = iii - 1; jjj <= iii; jjj++) { // Correct this base and the one before it along the direction of the read
if (jjj == iii || inconsistency[jjj] == 0) { // Don't want to correct the previous base a second time if it was already corrected in the previous step
if (readBases[jjj] == refBases[jjj]) {
if (colorSpaceQuals[jjj] == colorSpaceQuals[jjj + 1]) { // Equal evidence for the color implied base and the reference base, so flip a coin
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt(2);
if (rand == 0) { // The color implied base won the coin flip
readBases[jjj] = colorImpliedBases[jjj];
}
}
else {
final int maxQuality = Math.max((int) colorSpaceQuals[jjj], (int) colorSpaceQuals[jjj + 1]);
final int minQuality = Math.min((int) colorSpaceQuals[jjj], (int) colorSpaceQuals[jjj + 1]);
int diffInQuality = maxQuality - minQuality;
int numLow = minQuality;
if (numLow == 0) {
numLow++;
diffInQuality++;
}
final int numHigh = Math.round(numLow * (float) Math.pow(10.0f, (float) diffInQuality / 10.0f)); // The color with higher quality is exponentially more likely
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt(numLow + numHigh);
if (rand >= numLow) { // higher q score won
if (maxQuality == (int) colorSpaceQuals[jjj]) {
readBases[jjj] = colorImpliedBases[jjj];
} // else ref color had higher q score, and won out, so nothing to do here
}
else { // lower q score won
if (minQuality == (int) colorSpaceQuals[jjj]) {
readBases[jjj] = colorImpliedBases[jjj];
} // else ref color had lower q score, and won out, so nothing to do here
}
}
}
}
}
}
}
if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement(readBases.clone()); // Put the bases back in reverse order to stuff them back in the read
}
read.setReadBases(readBases);
}
else { // No color space quality tag in file
throw new UserException.MalformedBAM(read, "REMOVE_REF_BIAS recal mode requires color space qualities but they can't be found for read: " + read.getReadName());
}
}
/**
* Given the base and the color calculate the next base in the sequence
*
* @param prevBase The base
* @param color The color
* @return The next base in the sequence
*/
private static byte getNextBaseFromColor(GATKSAMRecord read, final byte prevBase, final byte color) {
switch (color) {
case '0':
return prevBase;
case '1':
return performColorOne(prevBase);
case '2':
return performColorTwo(prevBase);
case '3':
return performColorThree(prevBase);
default:
throw new UserException.MalformedBAM(read, "Unrecognized color space in SOLID read, color = " + (char) color +
" Unfortunately this bam file can not be recalibrated without full color space information because of potential reference bias.");
}
}
/**
* Check if this base is inconsistent with its color space. If it is then SOLID inserted the reference here and we should reduce the quality
*
* @param read The read which contains the color space to check against
* @param offset The offset in the read at which to check
* @return Returns true if the base was inconsistent with the color space
*/
public static boolean isInconsistentColorSpace(final GATKSAMRecord read, final int offset) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG);
if (attr != null) {
final byte[] inconsistency = (byte[]) attr;
// NOTE: The inconsistency array is in the direction of the read, not aligned to the reference!
if (read.getReadNegativeStrandFlag()) { // Negative direction
return inconsistency[inconsistency.length - offset - 1] != (byte) 0;
}
else { // Forward direction
return inconsistency[offset] != (byte) 0;
}
// This block of code is for if you want to check both the offset and the next base for color space inconsistency
//if( read.getReadNegativeStrandFlag() ) { // Negative direction
// if( offset == 0 ) {
// return inconsistency[0] != 0;
// } else {
// return (inconsistency[inconsistency.length - offset - 1] != 0) || (inconsistency[inconsistency.length - offset] != 0);
// }
//} else { // Forward direction
// if( offset == inconsistency.length - 1 ) {
// return inconsistency[inconsistency.length - 1] != 0;
// } else {
// return (inconsistency[offset] != 0) || (inconsistency[offset + 1] != 0);
// }
//}
}
else { // No inconsistency array, so nothing is inconsistent
return false;
}
}
/**
* Computes all requested covariates for every offset in the given read
* by calling covariate.getValues(..).
*
* @param read The read for which to compute covariate values.
* @param requestedCovariates The list of requested covariates.
* @return An array of covariate values where result[i][j] is the covariate
* value for the ith position in the read and the jth covariate in
* reqeustedCovariates list.
*/
public static void computeCovariates(final GATKSAMRecord read, final List<Covariate> requestedCovariates) {
final int numRequestedCovariates = requestedCovariates.size();
final int readLength = read.getReadLength();
final CovariateKeySet covariateKeySet = new CovariateKeySet(readLength, numRequestedCovariates);
// Loop through the list of requested covariates and compute the values of each covariate for all positions in this read
for (Covariate covariate : requestedCovariates)
covariateKeySet.addCovariate(covariate.getValues(read));
read.setTemporaryAttribute(COVARS_ATTRIBUTE, covariateKeySet);
}
/**
* Perform a certain transversion (A <-> C or G <-> T) on the base.
*
* @param base the base [AaCcGgTt]
* @return the transversion of the base, or the input base if it's not one of the understood ones
*/
private static byte performColorOne(byte base) {
switch (base) {
case 'A':
case 'a':
return 'C';
case 'C':
case 'c':
return 'A';
case 'G':
case 'g':
return 'T';
case 'T':
case 't':
return 'G';
default:
return base;
}
}
/**
* Perform a transition (A <-> G or C <-> T) on the base.
*
* @param base the base [AaCcGgTt]
* @return the transition of the base, or the input base if it's not one of the understood ones
*/
private static byte performColorTwo(byte base) {
switch (base) {
case 'A':
case 'a':
return 'G';
case 'C':
case 'c':
return 'T';
case 'G':
case 'g':
return 'A';
case 'T':
case 't':
return 'C';
default:
return base;
}
}
/**
* Return the complement (A <-> T or C <-> G) of a base.
*
* @param base the base [AaCcGgTt]
* @return the complementary base, or the input base if it's not one of the understood ones
*/
private static byte performColorThree(byte base) {
switch (base) {
case 'A':
case 'a':
return 'T';
case 'C':
case 'c':
return 'G';
case 'G':
case 'g':
return 'C';
case 'T':
case 't':
return 'A';
default:
return base;
}
}
}

View File

@ -0,0 +1,112 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
/*
* Copyright (c) 2009 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Nov 3, 2009
*
* An individual piece of recalibration data. Each bin counts up the number of observations and the number of reference mismatches seen for that combination of covariates.
*/
public class RecalDatum extends RecalDatumOptimized {
private double estimatedQReported; // estimated reported quality score based on combined data's individual q-reporteds and number of observations
private double empiricalQuality; // the empirical quality for datums that have been collapsed together (by read group and reported quality, for example)
//---------------------------------------------------------------------------------------------------------------
//
// constructors
//
//---------------------------------------------------------------------------------------------------------------
public RecalDatum() {
numObservations = 0L;
numMismatches = 0L;
estimatedQReported = 0.0;
empiricalQuality = 0.0;
}
public RecalDatum(final long _numObservations, final long _numMismatches, final double _estimatedQReported, final double _empiricalQuality) {
numObservations = _numObservations;
numMismatches = _numMismatches;
estimatedQReported = _estimatedQReported;
empiricalQuality = _empiricalQuality;
}
public RecalDatum(final RecalDatum copy) {
this.numObservations = copy.numObservations;
this.numMismatches = copy.numMismatches;
this.estimatedQReported = copy.estimatedQReported;
this.empiricalQuality = copy.empiricalQuality;
}
//---------------------------------------------------------------------------------------------------------------
//
// increment methods
//
//---------------------------------------------------------------------------------------------------------------
public final void combine(final RecalDatum other) {
final double sumErrors = this.calcExpectedErrors() + other.calcExpectedErrors();
this.increment(other.numObservations, other.numMismatches);
this.estimatedQReported = -10 * Math.log10(sumErrors / (double) this.numObservations);
//if( this.estimatedQReported > QualityUtils.MAX_REASONABLE_Q_SCORE ) { this.estimatedQReported = QualityUtils.MAX_REASONABLE_Q_SCORE; }
}
//---------------------------------------------------------------------------------------------------------------
//
// methods to derive empirical quality score
//
//---------------------------------------------------------------------------------------------------------------
public final void calcCombinedEmpiricalQuality(final int smoothing, final int maxQual) {
this.empiricalQuality = empiricalQualDouble(smoothing, maxQual); // cache the value so we don't call log over and over again
}
//---------------------------------------------------------------------------------------------------------------
//
// misc. methods
//
//---------------------------------------------------------------------------------------------------------------
public final double getEstimatedQReported() {
return estimatedQReported;
}
public final double getEmpiricalQuality() {
return empiricalQuality;
}
private double calcExpectedErrors() {
return (double) this.numObservations * qualToErrorProb(estimatedQReported);
}
private double qualToErrorProb(final double qual) {
return Math.pow(10.0, qual / -10.0);
}
}

View File

@ -0,0 +1,115 @@
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.utils.QualityUtils;
import java.util.List;
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Jan 6, 2010
*
* An individual piece of recalibration data. Optimized for CountCovariates. Extras added to make TableRecalibration fast have been removed.
* Each bin counts up the number of observations and the number of reference mismatches seen for that combination of covariates.
*/
public class RecalDatumOptimized {
protected long numObservations; // number of bases seen in total
protected long numMismatches; // number of bases seen that didn't match the reference
//---------------------------------------------------------------------------------------------------------------
//
// constructors
//
//---------------------------------------------------------------------------------------------------------------
public RecalDatumOptimized() {
numObservations = 0L;
numMismatches = 0L;
}
public RecalDatumOptimized(final long _numObservations, final long _numMismatches) {
numObservations = _numObservations;
numMismatches = _numMismatches;
}
public RecalDatumOptimized(final RecalDatumOptimized copy) {
this.numObservations = copy.numObservations;
this.numMismatches = copy.numMismatches;
}
//---------------------------------------------------------------------------------------------------------------
//
// increment methods
//
//---------------------------------------------------------------------------------------------------------------
public synchronized final void increment(final long incObservations, final long incMismatches) {
numObservations += incObservations;
numMismatches += incMismatches;
}
public synchronized final void increment(final RecalDatumOptimized other) {
increment(other.numObservations, other.numMismatches);
}
public synchronized final void increment(final List<RecalDatumOptimized> data) {
for (RecalDatumOptimized other : data) {
this.increment(other);
}
}
//---------------------------------------------------------------------------------------------------------------
//
// methods to derive empirical quality score
//
//---------------------------------------------------------------------------------------------------------------
public final double empiricalQualDouble(final int smoothing, final double maxQual) {
final double doubleMismatches = (double) (numMismatches + smoothing);
final double doubleObservations = (double) (numObservations + smoothing);
double empiricalQual = -10 * Math.log10(doubleMismatches / doubleObservations);
return Math.min(empiricalQual, maxQual);
}
public final byte empiricalQualByte(final int smoothing) {
final double doubleMismatches = (double) (numMismatches + smoothing);
final double doubleObservations = (double) (numObservations + smoothing);
return QualityUtils.probToQual(1.0 - doubleMismatches / doubleObservations); // This is capped at Q40
}
public final byte empiricalQualByte() {
return empiricalQualByte(0); // 'default' behavior is to use smoothing value of zero
}
public final String outputToCSV() {
return String.format("%d,%d,%d", numObservations, numMismatches, (int) empiricalQualByte());
}
}

View File

@ -0,0 +1,102 @@
/*
* Copyright (c) 2010 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.bqsr;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Hidden;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: Nov 27, 2009
*
* A collection of the arguments that are common to both CovariateCounterWalker and TableRecalibrationWalker.
* This set of arguments will also be passed to the constructor of every Covariate when it is instantiated.
*/
public class RecalibrationArgumentCollection {
/**
* CountCovariates and TableRecalibration accept a --solid_recal_mode <MODE> flag which governs how the recalibrator handles the
* reads which have had the reference inserted because of color space inconsistencies.
*/
@Argument(fullName = "solid_recal_mode", shortName = "sMode", required = false, doc = "How should we recalibrate solid bases in which the reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS")
public RecalDataManager.SOLID_RECAL_MODE SOLID_RECAL_MODE = RecalDataManager.SOLID_RECAL_MODE.SET_Q_ZERO;
/**
* CountCovariates and TableRecalibration accept a --solid_nocall_strategy <MODE> flag which governs how the recalibrator handles
* no calls in the color space tag. Unfortunately because of the reference inserted bases mentioned above, reads with no calls in
* their color space tag can not be recalibrated.
*/
@Argument(fullName = "solid_nocall_strategy", shortName = "solid_nocall_strategy", doc = "Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ", required = false)
public RecalDataManager.SOLID_NOCALL_STRATEGY SOLID_NOCALL_STRATEGY = RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION;
/**
* The context covariate will use a context of this size to calculate it's covariate value for base mismatches
*/
@Argument(fullName = "mismatches_context_size", shortName = "mcs", doc = "size of the k-mer context to be used for base mismatches", required = false)
public int MISMATCHES_CONTEXT_SIZE = 2;
/**
* The context covariate will use a context of this size to calculate it's covariate value for base insertions
*/
@Argument(fullName = "insertions_context_size", shortName = "ics", doc = "size of the k-mer context to be used for base insertions", required = false)
public int INSERTIONS_CONTEXT_SIZE = 8;
/**
* The context covariate will use a context of this size to calculate it's covariate value for base deletions
*/
@Argument(fullName = "deletions_context_size", shortName = "dcs", doc = "size of the k-mer context to be used for base deletions", required = false)
public int DELETIONS_CONTEXT_SIZE = 8;
/**
* A default base qualities to use as a prior (reported quality) in the mismatch covariate model. This value will replace all base qualities in the read for this default value. Negative value turns it off (default is off)
*/
@Argument(fullName = "mismatches_default_quality", shortName = "mdq", doc = "default quality for the base mismatches covariate", required = false)
public byte MISMATCHES_DEFAULT_QUALITY = -1;
/**
* A default base qualities to use as a prior (reported quality) in the insertion covariate model. This parameter is used for all reads without insertion quality scores for each base. (default is on)
*/
@Argument(fullName = "insertions_default_quality", shortName = "idq", doc = "default quality for the base insertions covariate", required = false)
public byte INSERTIONS_DEFAULT_QUALITY = 45;
/**
* A default base qualities to use as a prior (reported quality) in the mismatch covariate model. This value will replace all base qualities in the read for this default value. Negative value turns it off (default is off)
*/
@Argument(fullName = "deletions_default_quality", shortName = "ddq", doc = "default quality for the base deletions covariate", required = false)
public byte DELETIONS_DEFAULT_QUALITY = 45;
@Hidden
@Argument(fullName = "default_platform", shortName = "dP", required = false, doc = "If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.")
public String DEFAULT_PLATFORM = null;
@Hidden
@Argument(fullName = "force_platform", shortName = "fP", required = false, doc = "If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.")
public String FORCE_PLATFORM = null;
}

View File

@ -0,0 +1,22 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
/**
* Short one line description of the walker.
*
* @author Mauricio Carneiro
* @since 2/1/12
*/
public enum CallableStatus {
/** the reference base was an N, which is not considered callable the GATK */
REF_N,
/** the base satisfied the min. depth for calling but had less than maxDepth to avoid having EXCESSIVE_COVERAGE */
CALLABLE,
/** absolutely no reads were seen at this locus, regardless of the filtering parameters */
NO_COVERAGE,
/** there were less than min. depth bases at the locus, after applying filters */
LOW_COVERAGE,
/** more than -maxDepth read at the locus, indicating some sort of mapping problem */
EXCESSIVE_COVERAGE,
/** more than --maxFractionOfReadsWithLowMAPQ at the locus, indicating a poor mapping quality of the reads */
POOR_QUALITY
}

View File

@ -0,0 +1,172 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
import org.broad.tribble.Feature;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.commandline.IntervalBinding;
import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.By;
import org.broadinstitute.sting.gatk.walkers.DataSource;
import org.broadinstitute.sting.gatk.walkers.LocusWalker;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocComparator;
import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.exceptions.UserException;
import java.io.PrintStream;
import java.util.HashMap;
import java.util.Iterator;
import java.util.List;
import java.util.TreeSet;
/**
* Short one line description of the walker.
*
* <p>
* [Long description of the walker]
* </p>
*
*
* <h2>Input</h2>
* <p>
* [Description of the Input]
* </p>
*
* <h2>Output</h2>
* <p>
* [Description of the Output]
* </p>
*
* <h2>Examples</h2>
* <pre>
* java
* -jar GenomeAnalysisTK.jar
* -T [walker name]
* </pre>
*
* @author Mauricio Carneiro
* @since 2/1/12
*/
@By(value = DataSource.READS)
public class DiagnoseTargets extends LocusWalker<Long, Long> {
@Input(fullName = "interval_track", shortName = "int", doc = "", required = true)
private IntervalBinding<Feature> intervalTrack = null;
@Output
private PrintStream out = System.out;
@Argument(fullName = "expand_interval", shortName = "exp", doc = "", required = false)
private int expandInterval = 50;
@Argument(fullName = "minimum_base_quality", shortName = "mbq", doc = "", required = false)
private int minimumBaseQuality = 20;
@Argument(fullName = "minimum_mapping_quality", shortName = "mmq", doc = "", required = false)
private int minimumMappingQuality = 20;
@Argument(fullName = "minimum_coverage", shortName = "mincov", doc = "", required = false)
private int minimumCoverage = 5;
@Argument(fullName = "maximum_coverage", shortName = "maxcov", doc = "", required = false)
private int maximumCoverage = 700;
private TreeSet<GenomeLoc> intervalList = null; // The list of intervals of interest (plus expanded intervals if user wants them)
private HashMap<GenomeLoc, IntervalStatistics> intervalMap = null; // interval => statistics
private Iterator<GenomeLoc> intervalListIterator; // An iterator to go over all the intervals provided as we traverse the genome
private GenomeLoc currentInterval = null; // The "current" interval loaded and being filled with statistics
private IntervalStatistics currentIntervalStatistics = null; // The "current" interval loaded and being filled with statistics
private GenomeLocParser parser; // just an object to allow us to create genome locs (for the expanded intervals)
@Override
public void initialize() {
super.initialize();
if (intervalTrack == null)
throw new UserException("This tool currently only works if you provide an interval track");
parser = new GenomeLocParser(getToolkit().getMasterSequenceDictionary()); // Important to initialize the parser before creating the intervals below
List<GenomeLoc> originalList = intervalTrack.getIntervals(getToolkit()); // The original list of targets provided by the user that will be expanded or not depending on the options provided
intervalList = new TreeSet<GenomeLoc>(new GenomeLocComparator());
intervalMap = new HashMap<GenomeLoc, IntervalStatistics>(originalList.size() * 2);
for (GenomeLoc interval : originalList)
addAndExpandIntervalToLists(interval);
intervalListIterator = intervalList.iterator();
}
@Override
public Long map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {
GenomeLoc refLocus = ref.getLocus();
while (currentInterval == null || currentInterval.isBefore(refLocus)) {
if (!intervalListIterator.hasNext())
return 0L;
currentInterval = intervalListIterator.next();
currentIntervalStatistics = intervalMap.get(currentInterval);
}
if (currentInterval.isPast(refLocus))
return 0L;
byte[] mappingQualities = context.getBasePileup().getMappingQuals();
byte[] baseQualities = context.getBasePileup().getQuals();
int coverage = context.getBasePileup().getBaseAndMappingFilteredPileup(minimumBaseQuality, minimumMappingQuality).depthOfCoverage();
int rawCoverage = context.size();
IntervalStatisticLocus locusData = new IntervalStatisticLocus(mappingQualities, baseQualities, coverage, rawCoverage);
currentIntervalStatistics.addLocus(refLocus, locusData);
return 1L;
}
@Override
public Long reduceInit() {
return 0L;
}
@Override
public Long reduce(Long value, Long sum) {
return sum + value;
}
@Override
public void onTraversalDone(Long result) {
super.onTraversalDone(result);
out.println("Interval\tCallStatus\tCOV\tAVG");
for (GenomeLoc interval : intervalList) {
IntervalStatistics stats = intervalMap.get(interval);
out.println(String.format("%s\t%s\t%d\t%f", interval, stats.callableStatus(), stats.totalCoverage(), stats.averageCoverage()));
}
}
private GenomeLoc createIntervalBefore(GenomeLoc interval) {
int start = Math.max(interval.getStart() - expandInterval, 0);
int stop = Math.max(interval.getStart() - 1, 0);
return parser.createGenomeLoc(interval.getContig(), interval.getContigIndex(), start, stop);
}
private GenomeLoc createIntervalAfter(GenomeLoc interval) {
int contigLimit = getToolkit().getSAMFileHeader().getSequenceDictionary().getSequence(interval.getContigIndex()).getSequenceLength();
int start = Math.min(interval.getStop() + 1, contigLimit);
int stop = Math.min(interval.getStop() + expandInterval, contigLimit);
return parser.createGenomeLoc(interval.getContig(), interval.getContigIndex(), start, stop);
}
private void addAndExpandIntervalToLists(GenomeLoc interval) {
if (expandInterval > 0) {
GenomeLoc before = createIntervalBefore(interval);
GenomeLoc after = createIntervalAfter(interval);
intervalList.add(before);
intervalList.add(after);
intervalMap.put(before, new IntervalStatistics(before, minimumCoverage, maximumCoverage, minimumMappingQuality, minimumBaseQuality));
intervalMap.put(after, new IntervalStatistics(after, minimumCoverage, maximumCoverage, minimumMappingQuality, minimumBaseQuality));
}
intervalList.add(interval);
intervalMap.put(interval, new IntervalStatistics(interval, minimumCoverage, maximumCoverage, minimumMappingQuality, minimumBaseQuality));
}
}

View File

@ -0,0 +1,34 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
/**
* The definition of a locus for the DiagnoseTargets walker statistics calculation
*
* @author Mauricio Carneiro
* @since 2/3/12
*/
class IntervalStatisticLocus {
private final byte[] mappingQuality;
private final byte[] baseQuality;
private final int coverage;
private final int rawCoverage;
public IntervalStatisticLocus(byte[] mappingQuality, byte[] baseQuality, int coverage, int rawCoverage) {
this.mappingQuality = mappingQuality;
this.baseQuality = baseQuality;
this.coverage = coverage;
this.rawCoverage = rawCoverage;
}
public IntervalStatisticLocus() {
this(new byte[1], new byte[1], 0, 0);
}
public int getCoverage() {
return coverage;
}
public int getRawCoverage() {
return rawCoverage;
}
}

View File

@ -0,0 +1,122 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.ArrayList;
import java.util.HashMap;
/**
* Short one line description of the walker.
*
* @author Mauricio Carneiro
* @since 2/1/12
*/
class IntervalStatistics {
private final GenomeLoc interval;
private final ArrayList<IntervalStatisticLocus> loci;
private final int minimumCoverageThreshold;
private final int maximumCoverageThreshold;
private final int minimumMappingQuality;
private final int minimumBaseQuality;
private int preComputedTotalCoverage = -1; // avoids re-calculating the total sum (-1 means we haven't pre-computed it yet)
private IntervalStatistics(GenomeLoc interval, ArrayList<IntervalStatisticLocus> loci, int minimumCoverageThreshold, int maximumCoverageThreshold, int minimumMappingQuality, int minimumBaseQuality) {
this.interval = interval;
this.loci = loci;
this.minimumCoverageThreshold = minimumCoverageThreshold;
this.maximumCoverageThreshold = maximumCoverageThreshold;
this.minimumMappingQuality = minimumMappingQuality;
this.minimumBaseQuality = minimumBaseQuality;
}
public IntervalStatistics(GenomeLoc interval, int minimumCoverageThreshold, int maximumCoverageThreshold, int minimumMappingQuality, int minimumBaseQuality) {
this(interval, new ArrayList<IntervalStatisticLocus>(interval.size()), minimumCoverageThreshold, maximumCoverageThreshold, minimumMappingQuality, minimumBaseQuality);
// Initialize every loci (this way we don't have to worry about non-existent loci in the object
for (int i = 0; i < interval.size(); i++)
this.loci.add(i, new IntervalStatisticLocus());
}
public long totalCoverage() {
if (preComputedTotalCoverage < 0)
calculateTotalCoverage();
return preComputedTotalCoverage;
}
public double averageCoverage() {
if (preComputedTotalCoverage < 0)
calculateTotalCoverage();
return (double) preComputedTotalCoverage / loci.size();
}
/**
* Calculates the callable status of the entire interval
*
* @return the callable status of the entire interval
*/
public CallableStatus callableStatus() {
long max = -1;
CallableStatus maxCallableStatus = null;
HashMap<CallableStatus, Integer> statusCounts = new HashMap<CallableStatus, Integer>(CallableStatus.values().length);
// initialize the statusCounts with all callable states
for (CallableStatus key : CallableStatus.values())
statusCounts.put(key, 0);
// calculate the callable status for each locus
for (int i = 0; i < loci.size(); i++) {
CallableStatus status = callableStatus(i);
int count = statusCounts.get(status) + 1;
statusCounts.put(status, count);
if (count > max) {
max = count;
maxCallableStatus = status;
}
}
return maxCallableStatus;
}
public void addLocus(GenomeLoc locus, IntervalStatisticLocus locusData) {
if (!interval.containsP(locus))
throw new ReviewedStingException(String.format("Locus %s is not part of the Interval", locus));
int locusIndex = locus.getStart() - interval.getStart();
loci.add(locusIndex, locusData);
}
/**
* returns the callable status of this locus without taking the reference base into account.
*
* @param locusIndex location in the genome to inquire (only one locus)
* @return the callable status of a locus
*/
private CallableStatus callableStatus(int locusIndex) {
if (loci.get(locusIndex).getCoverage() > maximumCoverageThreshold)
return CallableStatus.EXCESSIVE_COVERAGE;
if (loci.get(locusIndex).getCoverage() >= minimumCoverageThreshold)
return CallableStatus.CALLABLE;
if (loci.get(locusIndex).getRawCoverage() >= minimumCoverageThreshold)
return CallableStatus.POOR_QUALITY;
if (loci.get(locusIndex).getRawCoverage() > 0)
return CallableStatus.LOW_COVERAGE;
return CallableStatus.NO_COVERAGE;
}
private void calculateTotalCoverage() {
preComputedTotalCoverage = 0;
for (IntervalStatisticLocus locus : loci)
preComputedTotalCoverage += locus.getCoverage();
}
}

View File

@ -27,7 +27,7 @@ package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.apache.log4j.Logger; import org.apache.log4j.Logger;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.GenotypesContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.io.PrintStream; import java.io.PrintStream;
import java.util.List; import java.util.List;
@ -41,10 +41,11 @@ public abstract class AlleleFrequencyCalculationModel implements Cloneable {
public enum Model { public enum Model {
/** The default model with the best performance in all cases */ /** The default model with the best performance in all cases */
EXACT, EXACT
} }
protected int N; protected int N;
protected int MAX_ALTERNATE_ALLELES_TO_GENOTYPE;
protected Logger logger; protected Logger logger;
protected PrintStream verboseWriter; protected PrintStream verboseWriter;
@ -53,20 +54,21 @@ public abstract class AlleleFrequencyCalculationModel implements Cloneable {
protected static final double VALUE_NOT_CALCULATED = Double.NEGATIVE_INFINITY; protected static final double VALUE_NOT_CALCULATED = Double.NEGATIVE_INFINITY;
protected AlleleFrequencyCalculationModel(UnifiedArgumentCollection UAC, int N, Logger logger, PrintStream verboseWriter) { protected AlleleFrequencyCalculationModel(final UnifiedArgumentCollection UAC, final int N, final Logger logger, final PrintStream verboseWriter) {
this.N = N; this.N = N;
this.MAX_ALTERNATE_ALLELES_TO_GENOTYPE = UAC.MAX_ALTERNATE_ALLELES;
this.logger = logger; this.logger = logger;
this.verboseWriter = verboseWriter; this.verboseWriter = verboseWriter;
} }
/** /**
* Must be overridden by concrete subclasses * Must be overridden by concrete subclasses
* @param GLs genotype likelihoods * @param vc variant context with alleles and genotype likelihoods
* @param Alleles Alleles corresponding to GLs
* @param log10AlleleFrequencyPriors priors * @param log10AlleleFrequencyPriors priors
* @param result (pre-allocated) object to store likelihoods results * @param result (pre-allocated) object to store likelihoods results
* @return the alleles used for genotyping
*/ */
protected abstract void getLog10PNonRef(GenotypesContext GLs, List<Allele> Alleles, protected abstract List<Allele> getLog10PNonRef(final VariantContext vc,
double[][] log10AlleleFrequencyPriors, final double[][] log10AlleleFrequencyPriors,
AlleleFrequencyCalculationResult result); final AlleleFrequencyCalculationResult result);
} }

View File

@ -43,16 +43,81 @@ public class ExactAFCalculationModel extends AlleleFrequencyCalculationModel {
super(UAC, N, logger, verboseWriter); super(UAC, N, logger, verboseWriter);
} }
public void getLog10PNonRef(final GenotypesContext GLs, public List<Allele> getLog10PNonRef(final VariantContext vc,
final List<Allele> alleles, final double[][] log10AlleleFrequencyPriors,
final double[][] log10AlleleFrequencyPriors, final AlleleFrequencyCalculationResult result) {
final AlleleFrequencyCalculationResult result) {
final int numAlleles = alleles.size(); GenotypesContext GLs = vc.getGenotypes();
List<Allele> alleles = vc.getAlleles();
// don't try to genotype too many alternate alleles
if ( vc.getAlternateAlleles().size() > MAX_ALTERNATE_ALLELES_TO_GENOTYPE ) {
logger.warn("this tool is currently set to genotype at most " + MAX_ALTERNATE_ALLELES_TO_GENOTYPE + " alternate alleles in a given context, but the context at " + vc.getChr() + ":" + vc.getStart() + " has " + (vc.getAlternateAlleles().size()) + " alternate alleles so only the top alleles will be used; see the --max_alternate_alleles argument");
alleles = new ArrayList<Allele>(MAX_ALTERNATE_ALLELES_TO_GENOTYPE + 1);
alleles.add(vc.getReference());
alleles.addAll(chooseMostLikelyAlternateAlleles(vc, MAX_ALTERNATE_ALLELES_TO_GENOTYPE));
GLs = UnifiedGenotyperEngine.subsetAlleles(vc, alleles, false);
}
//linearExact(GLs, log10AlleleFrequencyPriors[0], log10AlleleFrequencyLikelihoods, log10AlleleFrequencyPosteriors); //linearExact(GLs, log10AlleleFrequencyPriors[0], log10AlleleFrequencyLikelihoods, log10AlleleFrequencyPosteriors);
linearExactMultiAllelic(GLs, numAlleles - 1, log10AlleleFrequencyPriors, result, false); linearExactMultiAllelic(GLs, alleles.size() - 1, log10AlleleFrequencyPriors, result, false);
return alleles;
} }
private static final class LikelihoodSum implements Comparable<LikelihoodSum> {
public double sum = 0.0;
public Allele allele;
public LikelihoodSum(Allele allele) { this.allele = allele; }
public int compareTo(LikelihoodSum other) {
final double diff = sum - other.sum;
return ( diff < 0.0 ) ? 1 : (diff > 0.0 ) ? -1 : 0;
}
}
private static final int PL_INDEX_OF_HOM_REF = 0;
private static final List<Allele> chooseMostLikelyAlternateAlleles(VariantContext vc, int numAllelesToChoose) {
final int numOriginalAltAlleles = vc.getAlternateAlleles().size();
final LikelihoodSum[] likelihoodSums = new LikelihoodSum[numOriginalAltAlleles];
for ( int i = 0; i < numOriginalAltAlleles; i++ )
likelihoodSums[i] = new LikelihoodSum(vc.getAlternateAllele(i));
// make sure that we've cached enough data
if ( numOriginalAltAlleles > UnifiedGenotyperEngine.PLIndexToAlleleIndex.length - 1 )
UnifiedGenotyperEngine.calculatePLcache(numOriginalAltAlleles);
// based on the GLs, find the alternate alleles with the most probability; sum the GLs for the most likely genotype
final ArrayList<double[]> GLs = getGLs(vc.getGenotypes());
for ( final double[] likelihoods : GLs ) {
final int PLindexOfBestGL = MathUtils.maxElementIndex(likelihoods);
if ( PLindexOfBestGL != PL_INDEX_OF_HOM_REF ) {
int[] alleles = UnifiedGenotyperEngine.PLIndexToAlleleIndex[numOriginalAltAlleles][PLindexOfBestGL];
if ( alleles[0] != 0 )
likelihoodSums[alleles[0]-1].sum += likelihoods[PLindexOfBestGL] - likelihoods[PL_INDEX_OF_HOM_REF];
// don't double-count it
if ( alleles[1] != 0 && alleles[1] != alleles[0] )
likelihoodSums[alleles[1]-1].sum += likelihoods[PLindexOfBestGL] - likelihoods[PL_INDEX_OF_HOM_REF];
}
}
// sort them by probability mass and choose the best ones
Collections.sort(Arrays.asList(likelihoodSums));
final ArrayList<Allele> bestAlleles = new ArrayList<Allele>(numAllelesToChoose);
for ( int i = 0; i < numAllelesToChoose; i++ )
bestAlleles.add(likelihoodSums[i].allele);
final ArrayList<Allele> orderedBestAlleles = new ArrayList<Allele>(numAllelesToChoose);
for ( Allele allele : vc.getAlternateAlleles() ) {
if ( bestAlleles.contains(allele) )
orderedBestAlleles.add(allele);
}
return orderedBestAlleles;
}
private static final ArrayList<double[]> getGLs(GenotypesContext GLs) { private static final ArrayList<double[]> getGLs(GenotypesContext GLs) {
ArrayList<double[]> genotypeLikelihoods = new ArrayList<double[]>(GLs.size()); ArrayList<double[]> genotypeLikelihoods = new ArrayList<double[]>(GLs.size());

View File

@ -37,6 +37,7 @@ import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.Haplotype; import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.clipping.ReadClipper; import org.broadinstitute.sting.utils.clipping.ReadClipper;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.StingException; import org.broadinstitute.sting.utils.exceptions.StingException;
import org.broadinstitute.sting.utils.pileup.ExtendedEventPileupElement; import org.broadinstitute.sting.utils.pileup.ExtendedEventPileupElement;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
@ -55,9 +56,8 @@ public class IndelGenotypeLikelihoodsCalculationModel extends GenotypeLikelihood
private final boolean getAlleleListFromVCF; private final boolean getAlleleListFromVCF;
private boolean DEBUG = false; private boolean DEBUG = false;
private final boolean doMultiAllelicCalls; private final boolean doMultiAllelicCalls = true;
private boolean ignoreSNPAllelesWhenGenotypingIndels = false; private boolean ignoreSNPAllelesWhenGenotypingIndels = false;
private final int maxAlternateAlleles;
private PairHMMIndelErrorModel pairModel; private PairHMMIndelErrorModel pairModel;
private static ThreadLocal<HashMap<PileupElement, LinkedHashMap<Allele, Double>>> indelLikelihoodMap = private static ThreadLocal<HashMap<PileupElement, LinkedHashMap<Allele, Double>>> indelLikelihoodMap =
@ -88,8 +88,6 @@ public class IndelGenotypeLikelihoodsCalculationModel extends GenotypeLikelihood
minIndelCountForGenotyping = UAC.MIN_INDEL_COUNT_FOR_GENOTYPING; minIndelCountForGenotyping = UAC.MIN_INDEL_COUNT_FOR_GENOTYPING;
HAPLOTYPE_SIZE = UAC.INDEL_HAPLOTYPE_SIZE; HAPLOTYPE_SIZE = UAC.INDEL_HAPLOTYPE_SIZE;
DEBUG = UAC.OUTPUT_DEBUG_INDEL_INFO; DEBUG = UAC.OUTPUT_DEBUG_INDEL_INFO;
maxAlternateAlleles = UAC.MAX_ALTERNATE_ALLELES;
doMultiAllelicCalls = UAC.MULTI_ALLELIC;
haplotypeMap = new LinkedHashMap<Allele, Haplotype>(); haplotypeMap = new LinkedHashMap<Allele, Haplotype>();
ignoreSNPAllelesWhenGenotypingIndels = UAC.IGNORE_SNP_ALLELES; ignoreSNPAllelesWhenGenotypingIndels = UAC.IGNORE_SNP_ALLELES;
@ -144,62 +142,76 @@ public class IndelGenotypeLikelihoodsCalculationModel extends GenotypeLikelihood
String indelString = p.getEventBases(); String indelString = p.getEventBases();
if (p.isInsertion()) { if (p.isInsertion()) {
boolean foundKey = false; boolean foundKey = false;
// copy of hashmap into temp arrayList
ArrayList<Pair<String,Integer>> cList = new ArrayList<Pair<String,Integer>>();
for (String s : consensusIndelStrings.keySet()) {
cList.add(new Pair<String, Integer>(s,consensusIndelStrings.get(s)));
}
if (read.getAlignmentEnd() == loc.getStart()) { if (read.getAlignmentEnd() == loc.getStart()) {
// first corner condition: a read has an insertion at the end, and we're right at the insertion. // first corner condition: a read has an insertion at the end, and we're right at the insertion.
// In this case, the read could have any of the inserted bases and we need to build a consensus // In this case, the read could have any of the inserted bases and we need to build a consensus
for (String s : consensusIndelStrings.keySet()) {
int cnt = consensusIndelStrings.get(s); for (int k=0; k < cList.size(); k++) {
String s = cList.get(k).getFirst();
int cnt = cList.get(k).getSecond();
// case 1: current insertion is prefix of indel in hash map
if (s.startsWith(indelString)) { if (s.startsWith(indelString)) {
// case 1: current insertion is prefix of indel in hash map cList.set(k,new Pair<String, Integer>(s,cnt+1));
consensusIndelStrings.put(s, cnt + 1);
foundKey = true; foundKey = true;
break; }
} else if (indelString.startsWith(s)) { else if (indelString.startsWith(s)) {
// case 2: indel stored in hash table is prefix of current insertion // case 2: indel stored in hash table is prefix of current insertion
// In this case, new bases are new key. // In this case, new bases are new key.
consensusIndelStrings.remove(s);
consensusIndelStrings.put(indelString, cnt + 1);
foundKey = true; foundKey = true;
break; cList.set(k,new Pair<String, Integer>(indelString,cnt+1));
} }
} }
if (!foundKey) if (!foundKey)
// none of the above: event bases not supported by previous table, so add new key // none of the above: event bases not supported by previous table, so add new key
consensusIndelStrings.put(indelString, 1); cList.add(new Pair<String, Integer>(indelString,1));
} else if (read.getAlignmentStart() == loc.getStart() + 1) { }
else if (read.getAlignmentStart() == loc.getStart()+1) {
// opposite corner condition: read will start at current locus with an insertion // opposite corner condition: read will start at current locus with an insertion
for (String s : consensusIndelStrings.keySet()) { for (int k=0; k < cList.size(); k++) {
int cnt = consensusIndelStrings.get(s); String s = cList.get(k).getFirst();
int cnt = cList.get(k).getSecond();
if (s.endsWith(indelString)) { if (s.endsWith(indelString)) {
// case 1: current insertion is suffix of indel in hash map // case 1: current insertion (indelString) is suffix of indel in hash map (s)
consensusIndelStrings.put(s, cnt + 1); cList.set(k,new Pair<String, Integer>(s,cnt+1));
foundKey = true; foundKey = true;
break; }
} else if (indelString.endsWith(s)) { else if (indelString.endsWith(s)) {
// case 2: indel stored in hash table is suffix of current insertion // case 2: indel stored in hash table is prefix of current insertion
// In this case, new bases are new key. // In this case, new bases are new key.
consensusIndelStrings.remove(s);
consensusIndelStrings.put(indelString, cnt + 1);
foundKey = true; foundKey = true;
break; cList.set(k,new Pair<String, Integer>(indelString,cnt+1));
} }
} }
if (!foundKey) if (!foundKey)
// none of the above: event bases not supported by previous table, so add new key // none of the above: event bases not supported by previous table, so add new key
consensusIndelStrings.put(indelString, 1); cList.add(new Pair<String, Integer>(indelString,1));
} else {
// normal case: insertion somewhere in the middle of a read: add count to hash map }
int cnt = consensusIndelStrings.containsKey(indelString) ? consensusIndelStrings.get(indelString) : 0; else {
consensusIndelStrings.put(indelString, cnt + 1); // normal case: insertion somewhere in the middle of a read: add count to arrayList
int cnt = consensusIndelStrings.containsKey(indelString)? consensusIndelStrings.get(indelString):0;
cList.add(new Pair<String, Integer>(indelString,cnt+1));
} }
} else if (p.isDeletion()) { // copy back arrayList into hashMap
indelString = String.format("D%d", p.getEventLength()); consensusIndelStrings.clear();
int cnt = consensusIndelStrings.containsKey(indelString) ? consensusIndelStrings.get(indelString) : 0; for (Pair<String,Integer> pair : cList) {
consensusIndelStrings.put(indelString, cnt + 1); consensusIndelStrings.put(pair.getFirst(),pair.getSecond());
}
}
else if (p.isDeletion()) {
indelString = String.format("D%d",p.getEventLength());
int cnt = consensusIndelStrings.containsKey(indelString)? consensusIndelStrings.get(indelString):0;
consensusIndelStrings.put(indelString,cnt+1);
} }
} }

View File

@ -39,17 +39,19 @@ import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileupImpl; import org.broadinstitute.sting.utils.pileup.ReadBackedPileupImpl;
import org.broadinstitute.sting.utils.variantcontext.*; import org.broadinstitute.sting.utils.variantcontext.*;
import java.util.*; import java.util.ArrayList;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel { public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel {
private boolean ALLOW_MULTIPLE_ALLELES;
private final boolean useAlleleFromVCF; private final boolean useAlleleFromVCF;
private final double[] likelihoodSums = new double[4];
protected SNPGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) { protected SNPGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) {
super(UAC, logger); super(UAC, logger);
ALLOW_MULTIPLE_ALLELES = UAC.MULTI_ALLELIC;
useAlleleFromVCF = UAC.GenotypingMode == GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES; useAlleleFromVCF = UAC.GenotypingMode == GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES;
// make sure the PL cache has been initialized with enough alleles // make sure the PL cache has been initialized with enough alleles
@ -69,7 +71,6 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
if ( !(priors instanceof DiploidSNPGenotypePriors) ) if ( !(priors instanceof DiploidSNPGenotypePriors) )
throw new StingException("Only diploid-based SNP priors are supported in the SNP GL model"); throw new StingException("Only diploid-based SNP priors are supported in the SNP GL model");
final boolean[] basesToUse = new boolean[4];
final byte refBase = ref.getBase(); final byte refBase = ref.getBase();
final int indexOfRefBase = BaseUtils.simpleBaseToBaseIndex(refBase); final int indexOfRefBase = BaseUtils.simpleBaseToBaseIndex(refBase);
@ -95,46 +96,40 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
// find the alternate allele(s) that we should be using // find the alternate allele(s) that we should be using
if ( alternateAlleleToUse != null ) { if ( alternateAlleleToUse != null ) {
basesToUse[BaseUtils.simpleBaseToBaseIndex(alternateAlleleToUse.getBases()[0])] = true; alleles.add(alternateAlleleToUse);
} else if ( useAlleleFromVCF ) { } else if ( useAlleleFromVCF ) {
final VariantContext vc = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, ref, ref.getLocus(), true, logger, UAC.alleles); final VariantContext vc = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, ref, ref.getLocus(), true, logger, UAC.alleles);
// ignore places where we don't have a SNP // ignore places where we don't have a SNP
if ( vc == null || !vc.isSNP() ) if ( vc == null || !vc.isSNP() )
return null; return null;
for ( Allele allele : vc.getAlternateAlleles() ) alleles.addAll(vc.getAlternateAlleles());
basesToUse[BaseUtils.simpleBaseToBaseIndex(allele.getBases()[0])] = true;
} else { } else {
determineAlternateAlleles(basesToUse, refBase, GLs); alleles.addAll(determineAlternateAlleles(refBase, GLs));
// how many alternate alleles are we using?
int alleleCounter = Utils.countSetBits(basesToUse);
// if there are no non-ref alleles... // if there are no non-ref alleles...
if ( alleleCounter == 0 ) { if ( alleles.size() == 1 ) {
// if we only want variants, then we don't need to calculate genotype likelihoods // if we only want variants, then we don't need to calculate genotype likelihoods
if ( UAC.OutputMode == UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY ) if ( UAC.OutputMode == UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY )
return builder.make(); return builder.make();
// otherwise, choose any alternate allele (it doesn't really matter) // otherwise, choose any alternate allele (it doesn't really matter)
basesToUse[indexOfRefBase == 0 ? 1 : 0] = true; alleles.add(Allele.create(BaseUtils.baseIndexToSimpleBase(indexOfRefBase == 0 ? 1 : 0)));
} }
} }
// create the alternate alleles and the allele ordering (the ordering is crucial for the GLs) // create the alternate alleles and the allele ordering (the ordering is crucial for the GLs)
final int numAltAlleles = Utils.countSetBits(basesToUse); final int numAlleles = alleles.size();
final int[] alleleOrdering = new int[numAltAlleles + 1]; final int numAltAlleles = numAlleles - 1;
alleleOrdering[0] = indexOfRefBase;
int alleleOrderingIndex = 1; final int[] alleleOrdering = new int[numAlleles];
int numLikelihoods = 1; int alleleOrderingIndex = 0;
for ( int i = 0; i < 4; i++ ) { int numLikelihoods = 0;
if ( i != indexOfRefBase && basesToUse[i] ) { for ( Allele allele : alleles ) {
alleles.add(Allele.create(BaseUtils.baseIndexToSimpleBase(i), false)); alleleOrdering[alleleOrderingIndex++] = BaseUtils.simpleBaseToBaseIndex(allele.getBases()[0]);
alleleOrdering[alleleOrderingIndex++] = i; numLikelihoods += alleleOrderingIndex;
numLikelihoods += alleleOrderingIndex;
}
} }
builder.alleles(alleles); builder.alleles(alleles);
@ -165,40 +160,36 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
return builder.genotypes(genotypes).make(); return builder.genotypes(genotypes).make();
} }
// fills in the allelesToUse array // determines the alleles to use
protected void determineAlternateAlleles(final boolean[] allelesToUse, final byte ref, final List<SampleGenotypeData> sampleDataList) { protected List<Allele> determineAlternateAlleles(final byte ref, final List<SampleGenotypeData> sampleDataList) {
final int baseIndexOfRef = BaseUtils.simpleBaseToBaseIndex(ref); final int baseIndexOfRef = BaseUtils.simpleBaseToBaseIndex(ref);
final int PLindexOfRef = DiploidGenotype.createDiploidGenotype(ref, ref).ordinal(); final int PLindexOfRef = DiploidGenotype.createDiploidGenotype(ref, ref).ordinal();
final double[] likelihoodCounts = new double[4]; for ( int i = 0; i < 4; i++ )
likelihoodSums[i] = 0.0;
// based on the GLs, find the alternate alleles with the most probability
// based on the GLs, find the alternate alleles with enough probability
for ( SampleGenotypeData sampleData : sampleDataList ) { for ( SampleGenotypeData sampleData : sampleDataList ) {
final double[] likelihoods = sampleData.GL.getLikelihoods(); final double[] likelihoods = sampleData.GL.getLikelihoods();
final int PLindexOfBestGL = MathUtils.maxElementIndex(likelihoods); final int PLindexOfBestGL = MathUtils.maxElementIndex(likelihoods);
if ( PLindexOfBestGL != PLindexOfRef ) { if ( PLindexOfBestGL != PLindexOfRef ) {
int[] alleles = UnifiedGenotyperEngine.PLIndexToAlleleIndex[3][PLindexOfBestGL]; int[] alleles = UnifiedGenotyperEngine.PLIndexToAlleleIndex[3][PLindexOfBestGL];
if ( alleles[0] != baseIndexOfRef ) if ( alleles[0] != baseIndexOfRef )
likelihoodCounts[alleles[0]] += likelihoods[PLindexOfBestGL] - likelihoods[PLindexOfRef]; likelihoodSums[alleles[0]] += likelihoods[PLindexOfBestGL] - likelihoods[PLindexOfRef];
// don't double-count it // don't double-count it
if ( alleles[1] != baseIndexOfRef && alleles[1] != alleles[0] ) if ( alleles[1] != baseIndexOfRef && alleles[1] != alleles[0] )
likelihoodCounts[alleles[1]] += likelihoods[PLindexOfBestGL] - likelihoods[PLindexOfRef]; likelihoodSums[alleles[1]] += likelihoods[PLindexOfBestGL] - likelihoods[PLindexOfRef];
} }
} }
if ( ALLOW_MULTIPLE_ALLELES ) { final List<Allele> allelesToUse = new ArrayList<Allele>(3);
for ( int i = 0; i < 4; i++ ) { for ( int i = 0; i < 4; i++ ) {
if ( likelihoodCounts[i] > 0.0 ) { if ( likelihoodSums[i] > 0.0 )
allelesToUse[i] = true; allelesToUse.add(Allele.create(BaseUtils.baseIndexToSimpleBase(i), false));
}
}
} else {
// set the non-ref base which has the maximum sum of non-ref GLs
final int indexOfMax = MathUtils.maxElementIndex(likelihoodCounts);
if ( likelihoodCounts[indexOfMax] > 0.0 )
allelesToUse[indexOfMax] = true;
} }
return allelesToUse;
} }
public ReadBackedPileup createBAQedPileup( final ReadBackedPileup pileup ) { public ReadBackedPileup createBAQedPileup( final ReadBackedPileup pileup ) {
@ -212,7 +203,7 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
public class BAQedPileupElement extends PileupElement { public class BAQedPileupElement extends PileupElement {
public BAQedPileupElement( final PileupElement PE ) { public BAQedPileupElement( final PileupElement PE ) {
super(PE.getRead(), PE.getOffset(), PE.isDeletion(), PE.isBeforeInsertion(), PE.isNextToSoftClip()); super(PE.getRead(), PE.getOffset(), PE.isDeletion(), PE.isBeforeDeletion(), PE.isBeforeInsertion(), PE.isNextToSoftClip());
} }
@Override @Override

View File

@ -84,8 +84,8 @@ public class UnifiedArgumentCollection {
/** /**
* This argument is not enabled by default because it increases the runtime by an appreciable amount. * This argument is not enabled by default because it increases the runtime by an appreciable amount.
*/ */
@Argument(fullName = "computeSLOD", shortName = "sl", doc = "If provided, we will calculate the SLOD", required = false) @Argument(fullName = "noSLOD", shortName = "nosl", doc = "If provided, we will not calculate the SLOD", required = false)
public boolean COMPUTE_SLOD = false; public boolean NO_SLOD = false;
/** /**
* When the UnifiedGenotyper is put into GENOTYPE_GIVEN_ALLELES mode it will genotype the samples using only the alleles provide in this rod binding * When the UnifiedGenotyper is put into GENOTYPE_GIVEN_ALLELES mode it will genotype the samples using only the alleles provide in this rod binding
@ -103,21 +103,12 @@ public class UnifiedArgumentCollection {
@Argument(fullName = "max_deletion_fraction", shortName = "deletions", doc = "Maximum fraction of reads with deletions spanning this locus for it to be callable [to disable, set to < 0 or > 1; default:0.05]", required = false) @Argument(fullName = "max_deletion_fraction", shortName = "deletions", doc = "Maximum fraction of reads with deletions spanning this locus for it to be callable [to disable, set to < 0 or > 1; default:0.05]", required = false)
public Double MAX_DELETION_FRACTION = 0.05; public Double MAX_DELETION_FRACTION = 0.05;
/**
* The default behavior of the Unified Genotyper is to allow the genotyping of just one alternate allele in discovery mode; using this flag
* will enable the discovery of multiple alternate alleles. Please note that this works for SNPs only and that it is still highly experimental.
* For advanced users only.
*/
@Advanced
@Argument(fullName = "multiallelic", shortName = "multiallelic", doc = "Allow the discovery of multiple alleles", required = false)
public boolean MULTI_ALLELIC = false;
/** /**
* If there are more than this number of alternate alleles presented to the genotyper (either through discovery or GENOTYPE_GIVEN ALLELES), * If there are more than this number of alternate alleles presented to the genotyper (either through discovery or GENOTYPE_GIVEN ALLELES),
* then this site will be skipped and a warning printed. Note that genotyping sites with many alternate alleles is both CPU and memory intensive. * then only this many alleles will be used. Note that genotyping sites with many alternate alleles is both CPU and memory intensive.
*/ */
@Argument(fullName = "max_alternate_alleles", shortName = "maxAlleles", doc = "Maximum number of alternate alleles to genotype", required = false) @Argument(fullName = "max_alternate_alleles", shortName = "maxAlleles", doc = "Maximum number of alternate alleles to genotype", required = false)
public int MAX_ALTERNATE_ALLELES = 5; public int MAX_ALTERNATE_ALLELES = 3;
// indel-related arguments // indel-related arguments
/** /**
@ -168,7 +159,7 @@ public class UnifiedArgumentCollection {
uac.PCR_error = PCR_error; uac.PCR_error = PCR_error;
uac.GenotypingMode = GenotypingMode; uac.GenotypingMode = GenotypingMode;
uac.OutputMode = OutputMode; uac.OutputMode = OutputMode;
uac.COMPUTE_SLOD = COMPUTE_SLOD; uac.NO_SLOD = NO_SLOD;
uac.STANDARD_CONFIDENCE_FOR_CALLING = STANDARD_CONFIDENCE_FOR_CALLING; uac.STANDARD_CONFIDENCE_FOR_CALLING = STANDARD_CONFIDENCE_FOR_CALLING;
uac.STANDARD_CONFIDENCE_FOR_EMITTING = STANDARD_CONFIDENCE_FOR_EMITTING; uac.STANDARD_CONFIDENCE_FOR_EMITTING = STANDARD_CONFIDENCE_FOR_EMITTING;
uac.MIN_BASE_QUALTY_SCORE = MIN_BASE_QUALTY_SCORE; uac.MIN_BASE_QUALTY_SCORE = MIN_BASE_QUALTY_SCORE;
@ -185,7 +176,6 @@ public class UnifiedArgumentCollection {
// todo- arguments to remove // todo- arguments to remove
uac.IGNORE_SNP_ALLELES = IGNORE_SNP_ALLELES; uac.IGNORE_SNP_ALLELES = IGNORE_SNP_ALLELES;
uac.DONT_DO_BANDED_INDEL_COMPUTATION = DONT_DO_BANDED_INDEL_COMPUTATION; uac.DONT_DO_BANDED_INDEL_COMPUTATION = DONT_DO_BANDED_INDEL_COMPUTATION;
uac.MULTI_ALLELIC = MULTI_ALLELIC;
return uac; return uac;
} }

View File

@ -240,7 +240,7 @@ public class UnifiedGenotyper extends LocusWalker<VariantCallContext, UnifiedGen
headerInfo.addAll(annotationEngine.getVCFAnnotationDescriptions()); headerInfo.addAll(annotationEngine.getVCFAnnotationDescriptions());
// annotation (INFO) fields from UnifiedGenotyper // annotation (INFO) fields from UnifiedGenotyper
if ( UAC.COMPUTE_SLOD ) if ( !UAC.NO_SLOD )
headerInfo.add(new VCFInfoHeaderLine(VCFConstants.STRAND_BIAS_KEY, 1, VCFHeaderLineType.Float, "Strand Bias")); headerInfo.add(new VCFInfoHeaderLine(VCFConstants.STRAND_BIAS_KEY, 1, VCFHeaderLineType.Float, "Strand Bias"));
headerInfo.add(new VCFInfoHeaderLine(VCFConstants.DOWNSAMPLED_KEY, 0, VCFHeaderLineType.Flag, "Were any of the samples downsampled?")); headerInfo.add(new VCFInfoHeaderLine(VCFConstants.DOWNSAMPLED_KEY, 0, VCFHeaderLineType.Flag, "Were any of the samples downsampled?"));

View File

@ -253,7 +253,7 @@ public class UnifiedGenotyperEngine {
VariantContext vcInput = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, ref, rawContext.getLocation(), false, logger, UAC.alleles); VariantContext vcInput = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, ref, rawContext.getLocation(), false, logger, UAC.alleles);
if ( vcInput == null ) if ( vcInput == null )
return null; return null;
vc = new VariantContextBuilder(vcInput).source("UG_call").noID().referenceBaseForIndel(ref.getBase()).make(); vc = new VariantContextBuilder(vcInput).source("UG_call").noID().referenceBaseForIndel(ref.getBase()).attributes(new HashMap<String, Object>()).filters(new HashSet<String>()).make();
} else { } else {
// deal with bad/non-standard reference bases // deal with bad/non-standard reference bases
if ( !Allele.acceptableAlleleBases(new byte[]{ref.getBase()}) ) if ( !Allele.acceptableAlleleBases(new byte[]{ref.getBase()}) )
@ -295,12 +295,6 @@ public class UnifiedGenotyperEngine {
} }
AlleleFrequencyCalculationResult AFresult = alleleFrequencyCalculationResult.get(); AlleleFrequencyCalculationResult AFresult = alleleFrequencyCalculationResult.get();
// don't try to genotype too many alternate alleles
if ( vc.getAlternateAlleles().size() > UAC.MAX_ALTERNATE_ALLELES ) {
logger.warn("the Unified Genotyper is currently set to genotype at most " + UAC.MAX_ALTERNATE_ALLELES + " alternate alleles in a given context, but the context at " + vc.getChr() + ":" + vc.getStart() + " has " + vc.getAlternateAlleles().size() + " alternate alleles; see the --max_alternate_alleles argument");
return null;
}
// estimate our confidence in a reference call and return // estimate our confidence in a reference call and return
if ( vc.getNSamples() == 0 ) { if ( vc.getNSamples() == 0 ) {
if ( limitedContext ) if ( limitedContext )
@ -313,25 +307,32 @@ public class UnifiedGenotyperEngine {
// 'zero' out the AFs (so that we don't have to worry if not all samples have reads at this position) // 'zero' out the AFs (so that we don't have to worry if not all samples have reads at this position)
clearAFarray(AFresult.log10AlleleFrequencyLikelihoods); clearAFarray(AFresult.log10AlleleFrequencyLikelihoods);
clearAFarray(AFresult.log10AlleleFrequencyPosteriors); clearAFarray(AFresult.log10AlleleFrequencyPosteriors);
afcm.get().getLog10PNonRef(vc.getGenotypes(), vc.getAlleles(), getAlleleFrequencyPriors(model), AFresult); List<Allele> allelesUsedInGenotyping = afcm.get().getLog10PNonRef(vc, getAlleleFrequencyPriors(model), AFresult);
// is the most likely frequency conformation AC=0 for all alternate alleles? // is the most likely frequency conformation AC=0 for all alternate alleles?
boolean bestGuessIsRef = true; boolean bestGuessIsRef = true;
// determine which alternate alleles have AF>0 // determine which alternate alleles have AF>0
boolean[] altAllelesToUse = new boolean[vc.getAlternateAlleles().size()]; final List<Allele> myAlleles = new ArrayList<Allele>(vc.getAlleles().size());
myAlleles.add(vc.getReference());
for ( int i = 0; i < vc.getAlternateAlleles().size(); i++ ) { for ( int i = 0; i < vc.getAlternateAlleles().size(); i++ ) {
int indexOfBestAC = MathUtils.maxElementIndex(AFresult.log10AlleleFrequencyPosteriors[i]); final Allele alternateAllele = vc.getAlternateAllele(i);
final int indexOfAllele = allelesUsedInGenotyping.indexOf(alternateAllele);
// the genotyping model may have stripped it out
if ( indexOfAllele == -1 )
continue;
int indexOfBestAC = MathUtils.maxElementIndex(AFresult.log10AlleleFrequencyPosteriors[indexOfAllele-1]);
// if the most likely AC is not 0, then this is a good alternate allele to use; // if the most likely AC is not 0, then this is a good alternate allele to use;
// make sure to test against log10PosteriorOfAFzero since that no longer is an entry in the array // make sure to test against log10PosteriorOfAFzero since that no longer is an entry in the array
if ( indexOfBestAC != 0 && AFresult.log10AlleleFrequencyPosteriors[i][indexOfBestAC] > AFresult.log10PosteriorOfAFzero ) { if ( indexOfBestAC != 0 && AFresult.log10AlleleFrequencyPosteriors[indexOfAllele-1][indexOfBestAC] > AFresult.log10PosteriorOfAFzero ) {
altAllelesToUse[i] = true; myAlleles.add(alternateAllele);
bestGuessIsRef = false; bestGuessIsRef = false;
} }
// if in GENOTYPE_GIVEN_ALLELES mode, we still want to allow the use of a poor allele // if in GENOTYPE_GIVEN_ALLELES mode, we still want to allow the use of a poor allele
else if ( UAC.GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) { else if ( UAC.GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES ) {
altAllelesToUse[i] = true; myAlleles.add(alternateAllele);
} }
} }
@ -367,20 +368,6 @@ public class UnifiedGenotyperEngine {
return limitedContext ? null : estimateReferenceConfidence(vc, stratifiedContexts, getGenotypePriors(model).getHeterozygosity(), true, 1.0 - PofF); return limitedContext ? null : estimateReferenceConfidence(vc, stratifiedContexts, getGenotypePriors(model).getHeterozygosity(), true, 1.0 - PofF);
} }
// strip out any alleles that aren't going to be used in the VariantContext
final List<Allele> myAlleles;
if ( UAC.GenotypingMode == GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.DISCOVERY ) {
myAlleles = new ArrayList<Allele>(vc.getAlleles().size());
myAlleles.add(vc.getReference());
for ( int i = 0; i < vc.getAlternateAlleles().size(); i++ ) {
if ( altAllelesToUse[i] )
myAlleles.add(vc.getAlternateAllele(i));
}
} else {
// use all of the alleles if we are given them by the user
myAlleles = vc.getAlleles();
}
// start constructing the resulting VC // start constructing the resulting VC
final GenomeLoc loc = genomeLocParser.createGenomeLoc(vc); final GenomeLoc loc = genomeLocParser.createGenomeLoc(vc);
final VariantContextBuilder builder = new VariantContextBuilder("UG_call", loc.getContig(), loc.getStart(), loc.getStop(), myAlleles); final VariantContextBuilder builder = new VariantContextBuilder("UG_call", loc.getContig(), loc.getStart(), loc.getStop(), myAlleles);
@ -394,7 +381,7 @@ public class UnifiedGenotyperEngine {
} }
// create the genotypes // create the genotypes
final GenotypesContext genotypes = assignGenotypes(vc, altAllelesToUse); final GenotypesContext genotypes = subsetAlleles(vc, myAlleles, true);
// print out stats if we have a writer // print out stats if we have a writer
if ( verboseWriter != null && !limitedContext ) if ( verboseWriter != null && !limitedContext )
@ -407,14 +394,14 @@ public class UnifiedGenotyperEngine {
if ( !limitedContext && rawContext.hasPileupBeenDownsampled() ) if ( !limitedContext && rawContext.hasPileupBeenDownsampled() )
attributes.put(VCFConstants.DOWNSAMPLED_KEY, true); attributes.put(VCFConstants.DOWNSAMPLED_KEY, true);
if ( UAC.COMPUTE_SLOD && !limitedContext && !bestGuessIsRef ) { if ( !UAC.NO_SLOD && !limitedContext && !bestGuessIsRef ) {
//final boolean DEBUG_SLOD = false; //final boolean DEBUG_SLOD = false;
// the overall lod // the overall lod
VariantContext vcOverall = calculateLikelihoods(tracker, refContext, stratifiedContexts, AlignmentContextUtils.ReadOrientation.COMPLETE, vc.getAlternateAllele(0), false, model); VariantContext vcOverall = calculateLikelihoods(tracker, refContext, stratifiedContexts, AlignmentContextUtils.ReadOrientation.COMPLETE, vc.getAlternateAllele(0), false, model);
clearAFarray(AFresult.log10AlleleFrequencyLikelihoods); clearAFarray(AFresult.log10AlleleFrequencyLikelihoods);
clearAFarray(AFresult.log10AlleleFrequencyPosteriors); clearAFarray(AFresult.log10AlleleFrequencyPosteriors);
afcm.get().getLog10PNonRef(vcOverall.getGenotypes(), vc.getAlleles(), getAlleleFrequencyPriors(model), AFresult); afcm.get().getLog10PNonRef(vcOverall, getAlleleFrequencyPriors(model), AFresult);
//double overallLog10PofNull = AFresult.log10AlleleFrequencyPosteriors[0]; //double overallLog10PofNull = AFresult.log10AlleleFrequencyPosteriors[0];
double overallLog10PofF = MathUtils.log10sumLog10(AFresult.log10AlleleFrequencyPosteriors[0], 0); double overallLog10PofF = MathUtils.log10sumLog10(AFresult.log10AlleleFrequencyPosteriors[0], 0);
//if ( DEBUG_SLOD ) System.out.println("overallLog10PofF=" + overallLog10PofF); //if ( DEBUG_SLOD ) System.out.println("overallLog10PofF=" + overallLog10PofF);
@ -423,7 +410,7 @@ public class UnifiedGenotyperEngine {
VariantContext vcForward = calculateLikelihoods(tracker, refContext, stratifiedContexts, AlignmentContextUtils.ReadOrientation.FORWARD, vc.getAlternateAllele(0), false, model); VariantContext vcForward = calculateLikelihoods(tracker, refContext, stratifiedContexts, AlignmentContextUtils.ReadOrientation.FORWARD, vc.getAlternateAllele(0), false, model);
clearAFarray(AFresult.log10AlleleFrequencyLikelihoods); clearAFarray(AFresult.log10AlleleFrequencyLikelihoods);
clearAFarray(AFresult.log10AlleleFrequencyPosteriors); clearAFarray(AFresult.log10AlleleFrequencyPosteriors);
afcm.get().getLog10PNonRef(vcForward.getGenotypes(), vc.getAlleles(), getAlleleFrequencyPriors(model), AFresult); afcm.get().getLog10PNonRef(vcForward, getAlleleFrequencyPriors(model), AFresult);
//double[] normalizedLog10Posteriors = MathUtils.normalizeFromLog10(AFresult.log10AlleleFrequencyPosteriors, true); //double[] normalizedLog10Posteriors = MathUtils.normalizeFromLog10(AFresult.log10AlleleFrequencyPosteriors, true);
double forwardLog10PofNull = AFresult.log10PosteriorOfAFzero; double forwardLog10PofNull = AFresult.log10PosteriorOfAFzero;
double forwardLog10PofF = MathUtils.log10sumLog10(AFresult.log10AlleleFrequencyPosteriors[0], 0); double forwardLog10PofF = MathUtils.log10sumLog10(AFresult.log10AlleleFrequencyPosteriors[0], 0);
@ -433,7 +420,7 @@ public class UnifiedGenotyperEngine {
VariantContext vcReverse = calculateLikelihoods(tracker, refContext, stratifiedContexts, AlignmentContextUtils.ReadOrientation.REVERSE, vc.getAlternateAllele(0), false, model); VariantContext vcReverse = calculateLikelihoods(tracker, refContext, stratifiedContexts, AlignmentContextUtils.ReadOrientation.REVERSE, vc.getAlternateAllele(0), false, model);
clearAFarray(AFresult.log10AlleleFrequencyLikelihoods); clearAFarray(AFresult.log10AlleleFrequencyLikelihoods);
clearAFarray(AFresult.log10AlleleFrequencyPosteriors); clearAFarray(AFresult.log10AlleleFrequencyPosteriors);
afcm.get().getLog10PNonRef(vcReverse.getGenotypes(), vc.getAlleles(), getAlleleFrequencyPriors(model), AFresult); afcm.get().getLog10PNonRef(vcReverse, getAlleleFrequencyPriors(model), AFresult);
//normalizedLog10Posteriors = MathUtils.normalizeFromLog10(AFresult.log10AlleleFrequencyPosteriors, true); //normalizedLog10Posteriors = MathUtils.normalizeFromLog10(AFresult.log10AlleleFrequencyPosteriors, true);
double reverseLog10PofNull = AFresult.log10PosteriorOfAFzero; double reverseLog10PofNull = AFresult.log10PosteriorOfAFzero;
double reverseLog10PofF = MathUtils.log10sumLog10(AFresult.log10AlleleFrequencyPosteriors[0], 0); double reverseLog10PofF = MathUtils.log10sumLog10(AFresult.log10AlleleFrequencyPosteriors[0], 0);
@ -772,52 +759,69 @@ public class UnifiedGenotyperEngine {
/** /**
* @param vc variant context with genotype likelihoods * @param vc variant context with genotype likelihoods
* @param allelesToUse bit vector describing which alternate alleles from the vc are okay to use
* @return genotypes * @return genotypes
*/ */
public static GenotypesContext assignGenotypes(final VariantContext vc, public static GenotypesContext assignGenotypes(final VariantContext vc) {
final boolean[] allelesToUse) { return subsetAlleles(vc, vc.getAlleles(), true);
}
// the no-called genotypes /**
final GenotypesContext GLs = vc.getGenotypes(); * @param vc variant context with genotype likelihoods
* @param allelesToUse which alleles from the vc are okay to use; *** must be in the same relative order as those in the original VC ***
* @param assignGenotypes true if we should change the genotypes based on the (subsetted) PLs
* @return genotypes
*/
public static GenotypesContext subsetAlleles(final VariantContext vc,
final List<Allele> allelesToUse,
final boolean assignGenotypes) {
// the genotypes with PLs
final GenotypesContext oldGTs = vc.getGenotypes();
// samples // samples
final List<String> sampleIndices = GLs.getSampleNamesOrderedByName(); final List<String> sampleIndices = oldGTs.getSampleNamesOrderedByName();
// the new called genotypes to create // the new genotypes to create
final GenotypesContext calls = GenotypesContext.create(); final GenotypesContext newGTs = GenotypesContext.create();
// we need to determine which of the alternate alleles (and hence the likelihoods) to use and carry forward // we need to determine which of the alternate alleles (and hence the likelihoods) to use and carry forward
final int numOriginalAltAlleles = allelesToUse.length; final int numOriginalAltAlleles = vc.getAlternateAlleles().size();
final List<Allele> newAlleles = new ArrayList<Allele>(numOriginalAltAlleles+1); final int numNewAltAlleles = allelesToUse.size() - 1;
newAlleles.add(vc.getReference());
for ( int i = 0; i < numOriginalAltAlleles; i++ ) { // which PLs should be carried forward?
if ( allelesToUse[i] )
newAlleles.add(vc.getAlternateAllele(i));
}
final int numNewAltAlleles = newAlleles.size() - 1;
ArrayList<Integer> likelihoodIndexesToUse = null; ArrayList<Integer> likelihoodIndexesToUse = null;
// an optimization: if we are supposed to use all (or none in the case of a ref call) of the alleles, // an optimization: if we are supposed to use all (or none in the case of a ref call) of the alleles,
// then we can keep the PLs as is; otherwise, we determine which ones to keep // then we can keep the PLs as is; otherwise, we determine which ones to keep
if ( numNewAltAlleles != numOriginalAltAlleles && numNewAltAlleles > 0 ) { if ( numNewAltAlleles != numOriginalAltAlleles && numNewAltAlleles > 0 ) {
likelihoodIndexesToUse = new ArrayList<Integer>(30); likelihoodIndexesToUse = new ArrayList<Integer>(30);
// make sure that we've cached enough data
if ( numOriginalAltAlleles > PLIndexToAlleleIndex.length - 1 )
calculatePLcache(numOriginalAltAlleles);
final int[][] PLcache = PLIndexToAlleleIndex[numOriginalAltAlleles]; final int[][] PLcache = PLIndexToAlleleIndex[numOriginalAltAlleles];
final boolean[] altAlleleIndexToUse = new boolean[numOriginalAltAlleles];
for ( int i = 0; i < numOriginalAltAlleles; i++ ) {
if ( allelesToUse.contains(vc.getAlternateAllele(i)) )
altAlleleIndexToUse[i] = true;
}
for ( int PLindex = 0; PLindex < PLcache.length; PLindex++ ) { for ( int PLindex = 0; PLindex < PLcache.length; PLindex++ ) {
int[] alleles = PLcache[PLindex]; final int[] alleles = PLcache[PLindex];
// consider this entry only if both of the alleles are good // consider this entry only if both of the alleles are good
if ( (alleles[0] == 0 || allelesToUse[alleles[0] - 1]) && (alleles[1] == 0 || allelesToUse[alleles[1] - 1]) ) if ( (alleles[0] == 0 || altAlleleIndexToUse[alleles[0] - 1]) && (alleles[1] == 0 || altAlleleIndexToUse[alleles[1] - 1]) )
likelihoodIndexesToUse.add(PLindex); likelihoodIndexesToUse.add(PLindex);
} }
} }
// create the new genotypes // create the new genotypes
for ( int k = GLs.size() - 1; k >= 0; k-- ) { for ( int k = 0; k < oldGTs.size(); k++ ) {
final String sample = sampleIndices.get(k); final Genotype g = oldGTs.get(sampleIndices.get(k));
final Genotype g = GLs.get(sample); if ( !g.hasLikelihoods() ) {
if ( !g.hasLikelihoods() ) newGTs.add(new Genotype(g.getSampleName(), NO_CALL_ALLELES, Genotype.NO_LOG10_PERROR, null, null, false));
continue; continue;
}
// create the new likelihoods array from the alleles we are allowed to use // create the new likelihoods array from the alleles we are allowed to use
final double[] originalLikelihoods = g.getLikelihoods().getAsVector(); final double[] originalLikelihoods = g.getLikelihoods().getAsVector();
@ -834,29 +838,38 @@ public class UnifiedGenotyperEngine {
newLikelihoods = MathUtils.normalizeFromLog10(newLikelihoods, false, true); newLikelihoods = MathUtils.normalizeFromLog10(newLikelihoods, false, true);
} }
// if there is no mass on the (new) likelihoods and we actually have alternate alleles, then just no-call the sample // if there is no mass on the (new) likelihoods, then just no-call the sample
if ( MathUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL ) { if ( MathUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL ) {
calls.add(new Genotype(g.getSampleName(), NO_CALL_ALLELES, Genotype.NO_LOG10_PERROR, null, null, false)); newGTs.add(new Genotype(g.getSampleName(), NO_CALL_ALLELES, Genotype.NO_LOG10_PERROR, null, null, false));
continue;
} }
else {
Map<String, Object> attrs = new HashMap<String, Object>(g.getAttributes());
if ( numNewAltAlleles == 0 )
attrs.remove(VCFConstants.PHRED_GENOTYPE_LIKELIHOODS_KEY);
else
attrs.put(VCFConstants.PHRED_GENOTYPE_LIKELIHOODS_KEY, GenotypeLikelihoods.fromLog10Likelihoods(newLikelihoods));
// find the genotype with maximum likelihoods // if we weren't asked to assign a genotype, then just no-call the sample
int PLindex = numNewAltAlleles == 0 ? 0 : MathUtils.maxElementIndex(newLikelihoods); if ( !assignGenotypes || MathUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL )
int[] alleles = PLIndexToAlleleIndex[numNewAltAlleles][PLindex]; newGTs.add(new Genotype(g.getSampleName(), NO_CALL_ALLELES, Genotype.NO_LOG10_PERROR, null, attrs, false));
else
ArrayList<Allele> myAlleles = new ArrayList<Allele>(); newGTs.add(assignGenotype(g, newLikelihoods, allelesToUse, numNewAltAlleles, attrs));
myAlleles.add(newAlleles.get(alleles[0])); }
myAlleles.add(newAlleles.get(alleles[1]));
final double qual = numNewAltAlleles == 0 ? Genotype.NO_LOG10_PERROR : GenotypeLikelihoods.getQualFromLikelihoods(PLindex, newLikelihoods);
Map<String, Object> attrs = new HashMap<String, Object>(g.getAttributes());
if ( numNewAltAlleles == 0 )
attrs.remove(VCFConstants.PHRED_GENOTYPE_LIKELIHOODS_KEY);
else
attrs.put(VCFConstants.PHRED_GENOTYPE_LIKELIHOODS_KEY, GenotypeLikelihoods.fromLog10Likelihoods(newLikelihoods));
calls.add(new Genotype(sample, myAlleles, qual, null, attrs, false));
} }
return newGTs;
}
protected static Genotype assignGenotype(final Genotype originalGT, final double[] newLikelihoods, final List<Allele> allelesToUse, final int numNewAltAlleles, final Map<String, Object> attrs) {
// find the genotype with maximum likelihoods
int PLindex = numNewAltAlleles == 0 ? 0 : MathUtils.maxElementIndex(newLikelihoods);
int[] alleles = PLIndexToAlleleIndex[numNewAltAlleles][PLindex];
return calls; ArrayList<Allele> myAlleles = new ArrayList<Allele>();
myAlleles.add(allelesToUse.get(alleles[0]));
myAlleles.add(allelesToUse.get(alleles[1]));
final double qual = numNewAltAlleles == 0 ? Genotype.NO_LOG10_PERROR : GenotypeLikelihoods.getQualFromLikelihoods(PLindex, newLikelihoods);
return new Genotype(originalGT.getSampleName(), myAlleles, qual, null, attrs, false);
} }
} }

View File

@ -0,0 +1,70 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.recalibration;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 9/26/11
*/
public class ContextCovariate implements ExperimentalCovariate {
private int CONTEXT_SIZE;
private String allN = "";
// Initialize any member variables using the command-line arguments passed to the walkers
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
CONTEXT_SIZE = RAC.CONTEXT_SIZE;
if (CONTEXT_SIZE <= 0)
throw new UserException("Context Size must be positive, if you don't want to use the context covariate, just turn it off instead");
// initialize allN given the size of the context
for (int i = 0; i < CONTEXT_SIZE; i++)
allN += "N";
}
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
byte[] bases = read.getReadBases();
for (int i = 0; i < read.getReadLength(); i++)
comparable[i] = (i < CONTEXT_SIZE) ? allN : new String(Arrays.copyOfRange(bases, i - CONTEXT_SIZE, i));
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return str;
}
}

View File

@ -41,6 +41,7 @@ import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException; import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.PrintStream; import java.io.PrintStream;
@ -76,20 +77,20 @@ import java.util.Map;
* <h2>Output</h2> * <h2>Output</h2>
* <p> * <p>
* A recalibration table file in CSV format that is used by the TableRecalibration walker. * A recalibration table file in CSV format that is used by the TableRecalibration walker.
* It is a comma-separated text file relating the desired covariates to the number of such bases and their rate of mismatch in the genome, and its implied empirical quality score. * It is a comma-separated text file relating the desired covariates to the number of such bases and their rate of mismatch in the genome, and its implied empirical quality score.
* *
* The first 20 lines of such a file is shown below. * The first 20 lines of such a file is shown below.
* * The file begins with a series of comment lines describing: * * The file begins with a series of comment lines describing:
* ** The number of counted loci * ** The number of counted loci
* ** The number of counted bases * ** The number of counted bases
* ** The number of skipped loci and the fraction skipped, due to presence in dbSNP or bad reference bases * ** The number of skipped loci and the fraction skipped, due to presence in dbSNP or bad reference bases
* *
* * After the comments appears a header line indicating which covariates were used as well as the ordering of elements in the subsequent records. * * After the comments appears a header line indicating which covariates were used as well as the ordering of elements in the subsequent records.
* *
* * After the header, data records occur one per line until the end of the file. The first several items on a line are the values of the individual covariates and will change * * After the header, data records occur one per line until the end of the file. The first several items on a line are the values of the individual covariates and will change
* depending on which covariates were specified at runtime. The last three items are the data- that is, number of observations for this combination of covariates, number of * depending on which covariates were specified at runtime. The last three items are the data- that is, number of observations for this combination of covariates, number of
* reference mismatches, and the raw empirical quality score calculated by phred-scaling the mismatch rate. * reference mismatches, and the raw empirical quality score calculated by phred-scaling the mismatch rate.
* *
* <pre> * <pre>
* # Counted Sites 19451059 * # Counted Sites 19451059
* # Counted Bases 56582018 * # Counted Bases 56582018
@ -128,13 +129,14 @@ import java.util.Map;
* -cov DinucCovariate \ * -cov DinucCovariate \
* -recalFile my_reads.recal_data.csv * -recalFile my_reads.recal_data.csv
* </pre> * </pre>
*
*/ */
@BAQMode(ApplicationTime = BAQ.ApplicationTime.FORBIDDEN) @BAQMode(ApplicationTime = BAQ.ApplicationTime.FORBIDDEN)
@By( DataSource.READS ) // Only look at covered loci, not every loci of the reference file @By(DataSource.READS) // Only look at covered loci, not every loci of the reference file
@ReadFilters( {MappingQualityZeroFilter.class, MappingQualityUnavailableFilter.class} ) // Filter out all reads with zero or unavailable mapping quality @ReadFilters({MappingQualityZeroFilter.class, MappingQualityUnavailableFilter.class})
@Requires( {DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES} ) // This walker requires both -I input.bam and -R reference.fasta // Filter out all reads with zero or unavailable mapping quality
@Requires({DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES})
// This walker requires both -I input.bam and -R reference.fasta
@PartitionBy(PartitionType.LOCUS) @PartitionBy(PartitionType.LOCUS)
public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.CountedData, CountCovariatesWalker.CountedData> implements TreeReducible<CountCovariatesWalker.CountedData> { public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.CountedData, CountCovariatesWalker.CountedData> implements TreeReducible<CountCovariatesWalker.CountedData> {
@ -148,7 +150,8 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
///////////////////////////// /////////////////////////////
// Shared Arguments // Shared Arguments
///////////////////////////// /////////////////////////////
@ArgumentCollection private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection(); @ArgumentCollection
private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
///////////////////////////// /////////////////////////////
// Command Line Arguments // Command Line Arguments
@ -159,7 +162,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* for use as this database. For users wishing to exclude an interval list of known variation simply use -XL my.interval.list to skip over processing those sites. * for use as this database. For users wishing to exclude an interval list of known variation simply use -XL my.interval.list to skip over processing those sites.
* Please note however that the statistics reported by the tool will not accurately reflected those sites skipped by the -XL argument. * Please note however that the statistics reported by the tool will not accurately reflected those sites skipped by the -XL argument.
*/ */
@Input(fullName="knownSites", shortName = "knownSites", doc="A database of known polymorphic sites to skip over in the recalibration algorithm", required=false) @Input(fullName = "knownSites", shortName = "knownSites", doc = "A database of known polymorphic sites to skip over in the recalibration algorithm", required = false)
public List<RodBinding<Feature>> knownSites = Collections.emptyList(); public List<RodBinding<Feature>> knownSites = Collections.emptyList();
/** /**
@ -168,31 +171,31 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches, * three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate. * and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/ */
@Output(fullName="recal_file", shortName="recalFile", required=true, doc="Filename for the output covariates table recalibration file") @Output(fullName = "recal_file", shortName = "recalFile", required = true, doc = "Filename for the output covariates table recalibration file")
@Gather(CountCovariatesGatherer.class) @Gather(CountCovariatesGatherer.class)
public PrintStream RECAL_FILE; public PrintStream RECAL_FILE;
@Argument(fullName="list", shortName="ls", doc="List the available covariates and exit", required=false) @Argument(fullName = "list", shortName = "ls", doc = "List the available covariates and exit", required = false)
private boolean LIST_ONLY = false; private boolean LIST_ONLY = false;
/** /**
* See the -list argument to view available covariates. * See the -list argument to view available covariates.
*/ */
@Argument(fullName="covariate", shortName="cov", doc="Covariates to be used in the recalibration. Each covariate is given as a separate cov parameter. ReadGroup and ReportedQuality are required covariates and are already added for you.", required=false) @Argument(fullName = "covariate", shortName = "cov", doc = "Covariates to be used in the recalibration. Each covariate is given as a separate cov parameter. ReadGroup and ReportedQuality are required covariates and are already added for you.", required = false)
private String[] COVARIATES = null; private String[] COVARIATES = null;
@Argument(fullName="standard_covs", shortName="standard", doc="Use the standard set of covariates in addition to the ones listed using the -cov argument", required=false) @Argument(fullName = "standard_covs", shortName = "standard", doc = "Use the standard set of covariates in addition to the ones listed using the -cov argument", required = false)
private boolean USE_STANDARD_COVARIATES = false; private boolean USE_STANDARD_COVARIATES = false;
///////////////////////////// /////////////////////////////
// Debugging-only Arguments // Debugging-only Arguments
///////////////////////////// /////////////////////////////
@Argument(fullName="dont_sort_output", shortName="unsorted", required=false, doc="If specified, the output table recalibration csv file will be in an unsorted, arbitrary order to save some run time.") @Argument(fullName = "dont_sort_output", shortName = "unsorted", required = false, doc = "If specified, the output table recalibration csv file will be in an unsorted, arbitrary order to save some run time.")
private boolean DONT_SORT_OUTPUT = false; private boolean DONT_SORT_OUTPUT = false;
/** /**
* This calculation is critically dependent on being able to skip over known polymorphic sites. Please be sure that you know what you are doing if you use this option. * This calculation is critically dependent on being able to skip over known polymorphic sites. Please be sure that you know what you are doing if you use this option.
*/ */
@Argument(fullName="run_without_dbsnp_potentially_ruining_quality", shortName="run_without_dbsnp_potentially_ruining_quality", required=false, doc="If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only.") @Argument(fullName = "run_without_dbsnp_potentially_ruining_quality", shortName = "run_without_dbsnp_potentially_ruining_quality", required = false, doc = "If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only.")
private boolean RUN_WITHOUT_DBSNP = false; private boolean RUN_WITHOUT_DBSNP = false;
///////////////////////////// /////////////////////////////
@ -216,6 +219,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/** /**
* Adds the values of other to this, returning this * Adds the values of other to this, returning this
*
* @param other * @param other
* @return this object * @return this object
*/ */
@ -246,53 +250,55 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
*/ */
public void initialize() { public void initialize() {
if( RAC.FORCE_READ_GROUP != null ) { RAC.DEFAULT_READ_GROUP = RAC.FORCE_READ_GROUP; } if (RAC.FORCE_PLATFORM != null) {
if( RAC.FORCE_PLATFORM != null ) { RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM; } RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM;
}
// Get a list of all available covariates // Get a list of all available covariates
final List<Class<? extends Covariate>> covariateClasses = new PluginManager<Covariate>( Covariate.class ).getPlugins(); final List<Class<? extends Covariate>> covariateClasses = new PluginManager<Covariate>(Covariate.class).getPlugins();
final List<Class<? extends RequiredCovariate>> requiredClasses = new PluginManager<RequiredCovariate>( RequiredCovariate.class ).getPlugins(); final List<Class<? extends RequiredCovariate>> requiredClasses = new PluginManager<RequiredCovariate>(RequiredCovariate.class).getPlugins();
final List<Class<? extends StandardCovariate>> standardClasses = new PluginManager<StandardCovariate>( StandardCovariate.class ).getPlugins(); final List<Class<? extends StandardCovariate>> standardClasses = new PluginManager<StandardCovariate>(StandardCovariate.class).getPlugins();
// Print and exit if that's what was requested // Print and exit if that's what was requested
if ( LIST_ONLY ) { if (LIST_ONLY) {
logger.info( "Available covariates:" ); logger.info("Available covariates:");
for( Class<?> covClass : covariateClasses ) { for (Class<?> covClass : covariateClasses) {
logger.info( covClass.getSimpleName() ); logger.info(covClass.getSimpleName());
} }
logger.info(""); logger.info("");
System.exit( 0 ); // Early exit here because user requested it System.exit(0); // Early exit here because user requested it
} }
// Warn the user if no dbSNP file or other variant mask was specified // Warn the user if no dbSNP file or other variant mask was specified
if( knownSites.isEmpty() && !RUN_WITHOUT_DBSNP ) { if (knownSites.isEmpty() && !RUN_WITHOUT_DBSNP) {
throw new UserException.CommandLineException("This calculation is critically dependent on being able to skip over known variant sites. Please provide a VCF file containing known sites of genetic variation."); throw new UserException.CommandLineException("This calculation is critically dependent on being able to skip over known variant sites. Please provide a VCF file containing known sites of genetic variation.");
} }
// Initialize the requested covariates by parsing the -cov argument // Initialize the requested covariates by parsing the -cov argument
// First add the required covariates // First add the required covariates
if( requiredClasses.size() == 2) { // readGroup and reported quality score if (requiredClasses.size() == 2) { // readGroup and reported quality score
requestedCovariates.add( new ReadGroupCovariate() ); // Order is important here requestedCovariates.add(new ReadGroupCovariate()); // Order is important here
requestedCovariates.add( new QualityScoreCovariate() ); requestedCovariates.add(new QualityScoreCovariate());
} else { }
else {
throw new UserException.CommandLineException("There are more required covariates than expected. The instantiation list needs to be updated with the new required covariate and in the correct order."); throw new UserException.CommandLineException("There are more required covariates than expected. The instantiation list needs to be updated with the new required covariate and in the correct order.");
} }
// Next add the standard covariates if -standard was specified by the user // Next add the standard covariates if -standard was specified by the user
if( USE_STANDARD_COVARIATES ) { if (USE_STANDARD_COVARIATES) {
// We want the standard covariates to appear in a consistent order but the packageUtils method gives a random order // We want the standard covariates to appear in a consistent order but the packageUtils method gives a random order
// A list of Classes can't be sorted, but a list of Class names can be // A list of Classes can't be sorted, but a list of Class names can be
final List<String> standardClassNames = new ArrayList<String>(); final List<String> standardClassNames = new ArrayList<String>();
for( Class<?> covClass : standardClasses ) { for (Class<?> covClass : standardClasses) {
standardClassNames.add( covClass.getName() ); standardClassNames.add(covClass.getName());
} }
Collections.sort(standardClassNames); // Sort the list of class names Collections.sort(standardClassNames); // Sort the list of class names
for( String className : standardClassNames ) { for (String className : standardClassNames) {
for( Class<?> covClass : standardClasses ) { // Find the class that matches this class name for (Class<?> covClass : standardClasses) { // Find the class that matches this class name
if( covClass.getName().equals( className ) ) { if (covClass.getName().equals(className)) {
try { try {
final Covariate covariate = (Covariate)covClass.newInstance(); final Covariate covariate = (Covariate) covClass.newInstance();
requestedCovariates.add( covariate ); requestedCovariates.add(covariate);
} catch (Exception e) { } catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e); throw new DynamicClassResolutionException(covClass, e);
} }
@ -301,17 +307,17 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
} }
} }
// Finally parse the -cov arguments that were provided, skipping over the ones already specified // Finally parse the -cov arguments that were provided, skipping over the ones already specified
if( COVARIATES != null ) { if (COVARIATES != null) {
for( String requestedCovariateString : COVARIATES ) { for (String requestedCovariateString : COVARIATES) {
boolean foundClass = false; boolean foundClass = false;
for( Class<?> covClass : covariateClasses ) { for (Class<?> covClass : covariateClasses) {
if( requestedCovariateString.equalsIgnoreCase( covClass.getSimpleName() ) ) { // -cov argument matches the class name for an implementing class if (requestedCovariateString.equalsIgnoreCase(covClass.getSimpleName())) { // -cov argument matches the class name for an implementing class
foundClass = true; foundClass = true;
if( !requiredClasses.contains( covClass ) && (!USE_STANDARD_COVARIATES || !standardClasses.contains( covClass )) ) { if (!requiredClasses.contains(covClass) && (!USE_STANDARD_COVARIATES || !standardClasses.contains(covClass))) {
try { try {
// Now that we've found a matching class, try to instantiate it // Now that we've found a matching class, try to instantiate it
final Covariate covariate = (Covariate)covClass.newInstance(); final Covariate covariate = (Covariate) covClass.newInstance();
requestedCovariates.add( covariate ); requestedCovariates.add(covariate);
} catch (Exception e) { } catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e); throw new DynamicClassResolutionException(covClass, e);
} }
@ -319,20 +325,19 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
} }
} }
if( !foundClass ) { if (!foundClass) {
throw new UserException.CommandLineException( "The requested covariate type (" + requestedCovariateString + ") isn't a valid covariate option. Use --list to see possible covariates." ); throw new UserException.CommandLineException("The requested covariate type (" + requestedCovariateString + ") isn't a valid covariate option. Use --list to see possible covariates.");
} }
} }
} }
logger.info( "The covariates being used here: " ); logger.info("The covariates being used here: ");
for( Covariate cov : requestedCovariates ) { for (Covariate cov : requestedCovariates) {
logger.info( "\t" + cov.getClass().getSimpleName() ); logger.info("\t" + cov.getClass().getSimpleName());
cov.initialize( RAC ); // Initialize any covariate member variables using the shared argument collection cov.initialize(RAC); // Initialize any covariate member variables using the shared argument collection
} }
} }
//--------------------------------------------------------------------------------------------------------------- //---------------------------------------------------------------------------------------------------------------
// //
// map // map
@ -341,62 +346,63 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/** /**
* For each read at this locus get the various covariate values and increment that location in the map based on * For each read at this locus get the various covariate values and increment that location in the map based on
* whether or not the base matches the reference at this particular location * whether or not the base matches the reference at this particular location
*
* @param tracker The reference metadata tracker * @param tracker The reference metadata tracker
* @param ref The reference context * @param ref The reference context
* @param context The alignment context * @param context The alignment context
* @return Returns 1, but this value isn't used in the reduce step * @return Returns 1, but this value isn't used in the reduce step
*/ */
public CountedData map( RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context ) { public CountedData map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {
// Only use data from non-dbsnp sites // Only use data from non-dbsnp sites
// Assume every mismatch at a non-dbsnp site is indicative of poor quality // Assume every mismatch at a non-dbsnp site is indicative of poor quality
CountedData counter = new CountedData(); CountedData counter = new CountedData();
if( tracker.getValues(knownSites).size() == 0 ) { // If something here is in one of the knownSites tracks then skip over it, otherwise proceed if (tracker.getValues(knownSites).size() == 0) { // If something here is in one of the knownSites tracks then skip over it, otherwise proceed
// For each read at this locus // For each read at this locus
for( final PileupElement p : context.getBasePileup() ) { for (final PileupElement p : context.getBasePileup()) {
final GATKSAMRecord gatkRead = (GATKSAMRecord) p.getRead(); final GATKSAMRecord gatkRead = p.getRead();
int offset = p.getOffset(); int offset = p.getOffset();
if( gatkRead.containsTemporaryAttribute( SKIP_RECORD_ATTRIBUTE ) ) { if (gatkRead.containsTemporaryAttribute(SKIP_RECORD_ATTRIBUTE)) {
continue; continue;
} }
if( !gatkRead.containsTemporaryAttribute( SEEN_ATTRIBUTE ) ) if (!gatkRead.containsTemporaryAttribute(SEEN_ATTRIBUTE)) {
{ gatkRead.setTemporaryAttribute(SEEN_ATTRIBUTE, true);
gatkRead.setTemporaryAttribute( SEEN_ATTRIBUTE, true ); RecalDataManager.parseSAMRecord(gatkRead, RAC);
RecalDataManager.parseSAMRecord( gatkRead, RAC );
// Skip over reads with no calls in the color space if the user requested it // Skip over reads with no calls in the color space if the user requested it
if( !(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) && RecalDataManager.checkNoCallColorSpace( gatkRead ) ) { if (!(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) && RecalDataManager.checkNoCallColorSpace(gatkRead)) {
gatkRead.setTemporaryAttribute( SKIP_RECORD_ATTRIBUTE, true); gatkRead.setTemporaryAttribute(SKIP_RECORD_ATTRIBUTE, true);
continue; continue;
} }
RecalDataManager.parseColorSpace( gatkRead ); RecalDataManager.parseColorSpace(gatkRead);
gatkRead.setTemporaryAttribute( COVARS_ATTRIBUTE, gatkRead.setTemporaryAttribute(COVARS_ATTRIBUTE, RecalDataManager.computeCovariates(gatkRead, requestedCovariates));
RecalDataManager.computeCovariates( gatkRead, requestedCovariates ));
} }
// Skip this position if base quality is zero // Skip this position if base quality is zero
if( gatkRead.getBaseQualities()[offset] > 0 ) { if (gatkRead.getBaseQualities()[offset] > 0) {
byte[] bases = gatkRead.getReadBases(); byte[] bases = gatkRead.getReadBases();
byte refBase = ref.getBase(); byte refBase = ref.getBase();
// Skip if this base is an 'N' or etc. // Skip if this base is an 'N' or etc.
if( BaseUtils.isRegularBase( bases[offset] ) ) { if (BaseUtils.isRegularBase(bases[offset])) {
// SOLID bams have inserted the reference base into the read if the color space in inconsistent with the read base so skip it // SOLID bams have inserted the reference base into the read if the color space in inconsistent with the read base so skip it
if( !gatkRead.getReadGroup().getPlatform().toUpperCase().contains("SOLID") || RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING || if (!gatkRead.getReadGroup().getPlatform().toUpperCase().contains("SOLID") || RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING ||
!RecalDataManager.isInconsistentColorSpace( gatkRead, offset ) ) { !RecalDataManager.isInconsistentColorSpace(gatkRead, offset)) {
// This base finally passed all the checks for a good base, so add it to the big data hashmap // This base finally passed all the checks for a good base, so add it to the big data hashmap
updateDataFromRead( counter, gatkRead, offset, refBase ); updateDataFromRead(counter, gatkRead, offset, refBase);
} else { // calculate SOLID reference insertion rate }
if( refBase == bases[offset] ) { else { // calculate SOLID reference insertion rate
if (refBase == bases[offset]) {
counter.solidInsertedReferenceBases++; counter.solidInsertedReferenceBases++;
} else { }
else {
counter.otherColorSpaceInconsistency++; counter.otherColorSpaceInconsistency++;
} }
} }
@ -404,7 +410,8 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
} }
} }
counter.countedSites++; counter.countedSites++;
} else { // We skipped over the dbSNP site, and we are only processing every Nth locus }
else { // We skipped over the dbSNP site, and we are only processing every Nth locus
counter.skippedSites++; counter.skippedSites++;
updateMismatchCounts(counter, context, ref.getBase()); // For sanity check to ensure novel mismatch rate vs dnsnp mismatch rate is reasonable updateMismatchCounts(counter, context, ref.getBase()); // For sanity check to ensure novel mismatch rate vs dnsnp mismatch rate is reasonable
} }
@ -412,7 +419,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
return counter; return counter;
} }
/** /**
* Update the mismatch / total_base counts for a given class of loci. * Update the mismatch / total_base counts for a given class of loci.
* *
* @param counter The CountedData to be updated * @param counter The CountedData to be updated
@ -420,13 +427,13 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* @param refBase The reference base * @param refBase The reference base
*/ */
private static void updateMismatchCounts(CountedData counter, final AlignmentContext context, final byte refBase) { private static void updateMismatchCounts(CountedData counter, final AlignmentContext context, final byte refBase) {
for( PileupElement p : context.getBasePileup() ) { for (PileupElement p : context.getBasePileup()) {
final byte readBase = p.getBase(); final byte readBase = p.getBase();
final int readBaseIndex = BaseUtils.simpleBaseToBaseIndex(readBase); final int readBaseIndex = BaseUtils.simpleBaseToBaseIndex(readBase);
final int refBaseIndex = BaseUtils.simpleBaseToBaseIndex(refBase); final int refBaseIndex = BaseUtils.simpleBaseToBaseIndex(refBase);
if( readBaseIndex != -1 && refBaseIndex != -1 ) { if (readBaseIndex != -1 && refBaseIndex != -1) {
if( readBaseIndex != refBaseIndex ) { if (readBaseIndex != refBaseIndex) {
counter.novelCountsMM++; counter.novelCountsMM++;
} }
counter.novelCountsBases++; counter.novelCountsBases++;
@ -438,13 +445,14 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* Major workhorse routine for this walker. * Major workhorse routine for this walker.
* Loop through the list of requested covariates and pick out the value from the read, offset, and reference * Loop through the list of requested covariates and pick out the value from the read, offset, and reference
* Using the list of covariate values as a key, pick out the RecalDatum and increment, * Using the list of covariate values as a key, pick out the RecalDatum and increment,
* adding one to the number of observations and potentially one to the number of mismatches * adding one to the number of observations and potentially one to the number of mismatches
* Lots of things are passed as parameters to this method as a strategy for optimizing the covariate.getValue calls * Lots of things are passed as parameters to this method as a strategy for optimizing the covariate.getValue calls
* because pulling things out of the SAMRecord is an expensive operation. * because pulling things out of the SAMRecord is an expensive operation.
* @param counter Data structure which holds the counted bases *
* @param counter Data structure which holds the counted bases
* @param gatkRead The SAMRecord holding all the data for this read * @param gatkRead The SAMRecord holding all the data for this read
* @param offset The offset in the read for this locus * @param offset The offset in the read for this locus
* @param refBase The reference base at this locus * @param refBase The reference base at this locus
*/ */
private void updateDataFromRead(CountedData counter, final GATKSAMRecord gatkRead, final int offset, final byte refBase) { private void updateDataFromRead(CountedData counter, final GATKSAMRecord gatkRead, final int offset, final byte refBase) {
final Object[][] covars = (Comparable[][]) gatkRead.getTemporaryAttribute(COVARS_ATTRIBUTE); final Object[][] covars = (Comparable[][]) gatkRead.getTemporaryAttribute(COVARS_ATTRIBUTE);
@ -452,10 +460,10 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
// Using the list of covariate values as a key, pick out the RecalDatum from the data HashMap // Using the list of covariate values as a key, pick out the RecalDatum from the data HashMap
final NestedHashMap data = dataManager.data; //optimization - create local reference final NestedHashMap data = dataManager.data; //optimization - create local reference
RecalDatumOptimized datum = (RecalDatumOptimized) data.get( key ); RecalDatumOptimized datum = (RecalDatumOptimized) data.get(key);
if( datum == null ) { // key doesn't exist yet in the map so make a new bucket and add it if (datum == null) { // key doesn't exist yet in the map so make a new bucket and add it
// initialized with zeros, will be incremented at end of method // initialized with zeros, will be incremented at end of method
datum = (RecalDatumOptimized)data.put( new RecalDatumOptimized(), true, (Object[])key ); datum = (RecalDatumOptimized) data.put(new RecalDatumOptimized(), true, (Object[]) key);
} }
// Need the bases to determine whether or not we have a mismatch // Need the bases to determine whether or not we have a mismatch
@ -463,13 +471,12 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
final long curMismatches = datum.getNumMismatches(); final long curMismatches = datum.getNumMismatches();
// Add one to the number of observations and potentially one to the number of mismatches // Add one to the number of observations and potentially one to the number of mismatches
datum.incrementBaseCounts( base, refBase ); datum.incrementBaseCounts(base, refBase);
counter.countedBases++; counter.countedBases++;
counter.novelCountsBases++; counter.novelCountsBases++;
counter.novelCountsMM += datum.getNumMismatches() - curMismatches; // For sanity check to ensure novel mismatch rate vs dnsnp mismatch rate is reasonable counter.novelCountsMM += datum.getNumMismatches() - curMismatches; // For sanity check to ensure novel mismatch rate vs dnsnp mismatch rate is reasonable
} }
//--------------------------------------------------------------------------------------------------------------- //---------------------------------------------------------------------------------------------------------------
// //
// reduce // reduce
@ -478,6 +485,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/** /**
* Initialize the reduce step by creating a PrintStream from the filename specified as an argument to the walker. * Initialize the reduce step by creating a PrintStream from the filename specified as an argument to the walker.
*
* @return returns A PrintStream created from the -recalFile filename argument specified to the walker * @return returns A PrintStream created from the -recalFile filename argument specified to the walker
*/ */
public CountedData reduceInit() { public CountedData reduceInit() {
@ -486,11 +494,12 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/** /**
* The Reduce method doesn't do anything for this walker. * The Reduce method doesn't do anything for this walker.
*
* @param mapped Result of the map. This value is immediately ignored. * @param mapped Result of the map. This value is immediately ignored.
* @param sum The summing CountedData used to output the CSV data * @param sum The summing CountedData used to output the CSV data
* @return returns The sum used to output the CSV data * @return returns The sum used to output the CSV data
*/ */
public CountedData reduce( CountedData mapped, CountedData sum ) { public CountedData reduce(CountedData mapped, CountedData sum) {
// Do a dbSNP sanity check every so often // Do a dbSNP sanity check every so often
return validatingDbsnpMismatchRate(sum.add(mapped)); return validatingDbsnpMismatchRate(sum.add(mapped));
} }
@ -499,16 +508,15 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* Validate the dbSNP reference mismatch rates. * Validate the dbSNP reference mismatch rates.
*/ */
private CountedData validatingDbsnpMismatchRate(CountedData counter) { private CountedData validatingDbsnpMismatchRate(CountedData counter) {
if( ++counter.lociSinceLastDbsnpCheck >= DBSNP_VALIDATION_CHECK_FREQUENCY ) { if (++counter.lociSinceLastDbsnpCheck >= DBSNP_VALIDATION_CHECK_FREQUENCY) {
counter.lociSinceLastDbsnpCheck = 0; counter.lociSinceLastDbsnpCheck = 0;
if( counter.novelCountsBases != 0L && counter.dbSNPCountsBases != 0L ) { if (counter.novelCountsBases != 0L && counter.dbSNPCountsBases != 0L) {
final double fractionMM_novel = (double)counter.novelCountsMM / (double)counter.novelCountsBases; final double fractionMM_novel = (double) counter.novelCountsMM / (double) counter.novelCountsBases;
final double fractionMM_dbsnp = (double)counter.dbSNPCountsMM / (double)counter.dbSNPCountsBases; final double fractionMM_dbsnp = (double) counter.dbSNPCountsMM / (double) counter.dbSNPCountsBases;
if( fractionMM_dbsnp < DBSNP_VS_NOVEL_MISMATCH_RATE * fractionMM_novel ) { if (fractionMM_dbsnp < DBSNP_VS_NOVEL_MISMATCH_RATE * fractionMM_novel) {
Utils.warnUser("The variation rate at the supplied list of known variant sites seems suspiciously low. Please double-check that the correct ROD is being used. " + Utils.warnUser("The variation rate at the supplied list of known variant sites seems suspiciously low. Please double-check that the correct ROD is being used. " + String.format("[dbSNP variation rate = %.4f, novel variation rate = %.4f]", fractionMM_dbsnp, fractionMM_novel));
String.format("[dbSNP variation rate = %.4f, novel variation rate = %.4f]", fractionMM_dbsnp, fractionMM_novel) );
DBSNP_VALIDATION_CHECK_FREQUENCY *= 2; // Don't annoyingly output the warning message every megabase of a large file DBSNP_VALIDATION_CHECK_FREQUENCY *= 2; // Don't annoyingly output the warning message every megabase of a large file
} }
} }
@ -517,47 +525,50 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
return counter; return counter;
} }
public CountedData treeReduce( CountedData sum1, CountedData sum2 ) { public CountedData treeReduce(CountedData sum1, CountedData sum2) {
return validatingDbsnpMismatchRate(sum1.add(sum2)); return validatingDbsnpMismatchRate(sum1.add(sum2));
} }
/** /**
* Write out the full data hashmap to disk in CSV format * Write out the full data hashmap to disk in CSV format
*
* @param sum The CountedData to write out to RECAL_FILE * @param sum The CountedData to write out to RECAL_FILE
*/ */
public void onTraversalDone( CountedData sum ) { public void onTraversalDone(CountedData sum) {
logger.info( "Writing raw recalibration data..." ); logger.info("Writing raw recalibration data...");
if( sum.countedBases == 0L ) { if (sum.countedBases == 0L) {
throw new UserException.BadInput("Could not find any usable data in the input BAM file(s)."); throw new UserException.BadInput("Could not find any usable data in the input BAM file(s).");
} }
outputToCSV( sum, RECAL_FILE ); outputToCSV(sum, RECAL_FILE);
logger.info( "...done!" ); logger.info("...done!");
} }
/** /**
* For each entry (key-value pair) in the data hashmap output the Covariate's values as well as the RecalDatum's data in CSV format * For each entry (key-value pair) in the data hashmap output the Covariate's values as well as the RecalDatum's data in CSV format
*
* @param recalTableStream The PrintStream to write out to * @param recalTableStream The PrintStream to write out to
*/ */
private void outputToCSV( CountedData sum, final PrintStream recalTableStream ) { private void outputToCSV(CountedData sum, final PrintStream recalTableStream) {
recalTableStream.printf("# Counted Sites %d%n", sum.countedSites); recalTableStream.printf("# Counted Sites %d%n", sum.countedSites);
recalTableStream.printf("# Counted Bases %d%n", sum.countedBases); recalTableStream.printf("# Counted Bases %d%n", sum.countedBases);
recalTableStream.printf("# Skipped Sites %d%n", sum.skippedSites); recalTableStream.printf("# Skipped Sites %d%n", sum.skippedSites);
recalTableStream.printf("# Fraction Skipped 1 / %.0f bp%n", (double)sum.countedSites / sum.skippedSites); recalTableStream.printf("# Fraction Skipped 1 / %.0f bp%n", (double) sum.countedSites / sum.skippedSites);
if( sum.solidInsertedReferenceBases != 0 ) { if (sum.solidInsertedReferenceBases != 0) {
recalTableStream.printf("# Fraction SOLiD inserted reference 1 / %.0f bases%n", (double) sum.countedBases / sum.solidInsertedReferenceBases); recalTableStream.printf("# Fraction SOLiD inserted reference 1 / %.0f bases%n", (double) sum.countedBases / sum.solidInsertedReferenceBases);
recalTableStream.printf("# Fraction other color space inconsistencies 1 / %.0f bases%n", (double) sum.countedBases / sum.otherColorSpaceInconsistency); recalTableStream.printf("# Fraction other color space inconsistencies 1 / %.0f bases%n", (double) sum.countedBases / sum.otherColorSpaceInconsistency);
} }
// Output header saying which covariates were used and in what order // Output header saying which covariates were used and in what order
for( Covariate cov : requestedCovariates ) { for (Covariate cov : requestedCovariates) {
recalTableStream.print( cov.getClass().getSimpleName().split("Covariate")[0] + "," ); recalTableStream.print(cov.getClass().getSimpleName().split("Covariate")[0] + ",");
} }
recalTableStream.println("nObservations,nMismatches,Qempirical"); recalTableStream.println("nObservations,nMismatches,Qempirical");
if( DONT_SORT_OUTPUT ) { if (DONT_SORT_OUTPUT) {
printMappings(recalTableStream, 0, new Object[requestedCovariates.size()], dataManager.data.data); printMappings(recalTableStream, 0, new Object[requestedCovariates.size()], dataManager.data.data);
} else { }
else {
printMappingsSorted(recalTableStream, 0, new Object[requestedCovariates.size()], dataManager.data.data); printMappingsSorted(recalTableStream, 0, new Object[requestedCovariates.size()], dataManager.data.data);
} }
@ -565,45 +576,47 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
recalTableStream.println(TableRecalibrationWalker.EOF_MARKER); recalTableStream.println(TableRecalibrationWalker.EOF_MARKER);
} }
private void printMappingsSorted( final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) { private void printMappingsSorted(final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) {
final ArrayList<Comparable> keyList = new ArrayList<Comparable>(); final ArrayList<Comparable> keyList = new ArrayList<Comparable>();
for( Object comp : data.keySet() ) { for (Object comp : data.keySet()) {
keyList.add((Comparable) comp); keyList.add((Comparable) comp);
} }
Collections.sort(keyList); Collections.sort(keyList);
for( Comparable comp : keyList ) { for (Comparable comp : keyList) {
key[curPos] = comp; key[curPos] = comp;
final Object val = data.get(comp); final Object val = data.get(comp);
if( val instanceof RecalDatumOptimized ) { // We are at the end of the nested hash maps if (val instanceof RecalDatumOptimized) { // We are at the end of the nested hash maps
// For each Covariate in the key // For each Covariate in the key
for( Object compToPrint : key ) { for (Object compToPrint : key) {
// Output the Covariate's value // Output the Covariate's value
recalTableStream.print( compToPrint + "," ); recalTableStream.print(compToPrint + ",");
} }
// Output the RecalDatum entry // Output the RecalDatum entry
recalTableStream.println( ((RecalDatumOptimized)val).outputToCSV() ); recalTableStream.println(((RecalDatumOptimized) val).outputToCSV());
} else { // Another layer in the nested hash map }
printMappingsSorted( recalTableStream, curPos + 1, key, (Map) val ); else { // Another layer in the nested hash map
printMappingsSorted(recalTableStream, curPos + 1, key, (Map) val);
} }
} }
} }
private void printMappings( final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) { private void printMappings(final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) {
for( Object comp : data.keySet() ) { for (Object comp : data.keySet()) {
key[curPos] = comp; key[curPos] = comp;
final Object val = data.get(comp); final Object val = data.get(comp);
if( val instanceof RecalDatumOptimized ) { // We are at the end of the nested hash maps if (val instanceof RecalDatumOptimized) { // We are at the end of the nested hash maps
// For each Covariate in the key // For each Covariate in the key
for( Object compToPrint : key ) { for (Object compToPrint : key) {
// Output the Covariate's value // Output the Covariate's value
recalTableStream.print( compToPrint + "," ); recalTableStream.print(compToPrint + ",");
} }
// Output the RecalDatum entry // Output the RecalDatum entry
recalTableStream.println( ((RecalDatumOptimized)val).outputToCSV() ); recalTableStream.println(((RecalDatumOptimized) val).outputToCSV());
} else { // Another layer in the nested hash map }
printMappings( recalTableStream, curPos + 1, key, (Map) val ); else { // Another layer in the nested hash map
printMappings(recalTableStream, curPos + 1, key, (Map) val);
} }
} }
} }

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -32,24 +33,24 @@ import net.sf.samtools.SAMRecord;
* User: rpoplin * User: rpoplin
* Date: Oct 30, 2009 * Date: Oct 30, 2009
* *
* The Covariate interface. A Covariate is a feature used in the recalibration that can be picked out of the read, offset, and corresponding reference bases * The Covariate interface. A Covariate is a feature used in the recalibration that can be picked out of the read.
* In general most error checking and adjustments to the data are done before the call to the covariates getValue methods in order to speed up the code. * In general most error checking and adjustments to the data are done before the call to the covariates getValue methods in order to speed up the code.
* This unfortunately muddies the code, but most of these corrections can be done per read while the covariates get called per base, resulting in a big speed up. * This unfortunately muddies the code, but most of these corrections can be done per read while the covariates get called per base, resulting in a big speed up.
*/ */
public interface Covariate { public interface Covariate {
public void initialize( RecalibrationArgumentCollection RAC ); // Initialize any member variables using the command-line arguments passed to the walkers public void initialize(RecalibrationArgumentCollection RAC); // Initialize any member variables using the command-line arguments passed to the walkers
public Comparable getValue( String str ); // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public void getValues( SAMRecord read, Comparable[] comparable ); //Takes an array of size (at least) read.getReadLength() and fills it with covariate public Comparable getValue(String str); // Used to get the covariate's value from input csv file in TableRecalibrationWalker
//values for each position in the read. This method was created as an optimization over calling getValue( read, offset ) for each offset and allows
//read-specific calculations to be done just once rather than for each offset. public void getValues(GATKSAMRecord read, Comparable[] comparable);
//Takes an array of size (at least) read.getReadLength() and fills it with covariate
//values for each position in the read. This method was created as an optimization over calling getValue( read, offset ) for each offset and allows
//read-specific calculations to be done just once rather than for each offset.
} }
interface RequiredCovariate extends Covariate { interface RequiredCovariate extends Covariate {}
}
interface StandardCovariate extends Covariate { interface StandardCovariate extends Covariate {}
}
interface ExperimentalCovariate extends Covariate { interface ExperimentalCovariate extends Covariate {}
}

View File

@ -1,9 +1,9 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.NGSPlatform; import org.broadinstitute.sting.utils.NGSPlatform;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.EnumSet; import java.util.EnumSet;
@ -39,67 +39,69 @@ import java.util.EnumSet;
* Date: Oct 30, 2009 * Date: Oct 30, 2009
* *
* The Cycle covariate. * The Cycle covariate.
* For Solexa the cycle is simply the position in the read (counting backwards if it is a negative strand read) * For Solexa the cycle is simply the position in the read (counting backwards if it is a negative strand read)
* For 454 the cycle is the TACG flow cycle, that is, each flow grabs all the TACG's in order in a single cycle * For 454 the cycle is the TACG flow cycle, that is, each flow grabs all the TACG's in order in a single cycle
* For example, for the read: AAACCCCGAAATTTTTACTG * For example, for the read: AAACCCCGAAATTTTTACTG
* the cycle would be 11111111222333333344 * the cycle would be 11111111222333333344
* For SOLiD the cycle is a more complicated mixture of ligation cycle and primer round * For SOLiD the cycle is a more complicated mixture of ligation cycle and primer round
*/ */
public class CycleCovariate implements StandardCovariate { public class CycleCovariate implements StandardCovariate {
private final static EnumSet<NGSPlatform> DISCRETE_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.ILLUMINA, NGSPlatform.SOLID, NGSPlatform.PACBIO, NGSPlatform.COMPLETE_GENOMICS); private final static EnumSet<NGSPlatform> DISCRETE_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.ILLUMINA, NGSPlatform.SOLID, NGSPlatform.PACBIO, NGSPlatform.COMPLETE_GENOMICS);
private final static EnumSet<NGSPlatform> FLOW_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.LS454, NGSPlatform.ION_TORRENT); private final static EnumSet<NGSPlatform> FLOW_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.LS454, NGSPlatform.ION_TORRENT);
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
if( RAC.DEFAULT_PLATFORM != null ) { public void initialize(final RecalibrationArgumentCollection RAC) {
if( RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "SLX" ) || RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "ILLUMINA" ) || if (RAC.DEFAULT_PLATFORM != null) {
RAC.DEFAULT_PLATFORM.contains( "454" ) || RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "SOLID" ) || RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "ABI_SOLID" ) ) { if (RAC.DEFAULT_PLATFORM.equalsIgnoreCase("SLX") || RAC.DEFAULT_PLATFORM.equalsIgnoreCase("ILLUMINA") ||
RAC.DEFAULT_PLATFORM.contains("454") || RAC.DEFAULT_PLATFORM.equalsIgnoreCase("SOLID") || RAC.DEFAULT_PLATFORM.equalsIgnoreCase("ABI_SOLID")) {
// nothing to do // nothing to do
} else { }
throw new UserException.CommandLineException("The requested default platform (" + RAC.DEFAULT_PLATFORM +") is not a recognized platform. Implemented options are illumina, 454, and solid"); else {
throw new UserException.CommandLineException("The requested default platform (" + RAC.DEFAULT_PLATFORM + ") is not a recognized platform. Implemented options are illumina, 454, and solid");
} }
} }
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public void getValues(SAMRecord read, Comparable[] comparable) { @Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
//----------------------------- //-----------------------------
// Illumina, Solid, PacBio, and Complete Genomics // Illumina, Solid, PacBio, and Complete Genomics
//----------------------------- //-----------------------------
final NGSPlatform ngsPlatform = ((GATKSAMRecord)read).getNGSPlatform(); final NGSPlatform ngsPlatform = read.getNGSPlatform();
if( DISCRETE_CYCLE_PLATFORMS.contains(ngsPlatform) ) { if (DISCRETE_CYCLE_PLATFORMS.contains(ngsPlatform)) {
final int init; final int init;
final int increment; final int increment;
if( !read.getReadNegativeStrandFlag() ) { if (!read.getReadNegativeStrandFlag()) {
// Differentiate between first and second of pair. // Differentiate between first and second of pair.
// The sequencing machine cycle keeps incrementing for the second read in a pair. So it is possible for a read group // The sequencing machine cycle keeps incrementing for the second read in a pair. So it is possible for a read group
// to have an error affecting quality at a particular cycle on the first of pair which carries over to the second of pair. // to have an error affecting quality at a particular cycle on the first of pair which carries over to the second of pair.
// Therefore the cycle covariate must differentiate between first and second of pair reads. // Therefore the cycle covariate must differentiate between first and second of pair reads.
// This effect can not be corrected by pulling out the first of pair and second of pair flags into a separate covariate because // This effect can not be corrected by pulling out the first of pair and second of pair flags into a separate covariate because
// the current sequential model would consider the effects independently instead of jointly. // the current sequential model would consider the effects independently instead of jointly.
if( read.getReadPairedFlag() && read.getSecondOfPairFlag() ) { if (read.getReadPairedFlag() && read.getSecondOfPairFlag()) {
//second of pair, positive strand //second of pair, positive strand
init = -1; init = -1;
increment = -1; increment = -1;
} }
else else {
{
//first of pair, positive strand //first of pair, positive strand
init = 1; init = 1;
increment = 1; increment = 1;
} }
} else { }
if( read.getReadPairedFlag() && read.getSecondOfPairFlag() ) { else {
if (read.getReadPairedFlag() && read.getSecondOfPairFlag()) {
//second of pair, negative strand //second of pair, negative strand
init = -read.getReadLength(); init = -read.getReadLength();
increment = 1; increment = 1;
} }
else else {
{
//first of pair, negative strand //first of pair, negative strand
init = read.getReadLength(); init = read.getReadLength();
increment = -1; increment = -1;
@ -107,7 +109,7 @@ public class CycleCovariate implements StandardCovariate {
} }
int cycle = init; int cycle = init;
for(int i = 0; i < read.getReadLength(); i++) { for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = cycle; comparable[i] = cycle;
cycle += increment; cycle += increment;
} }
@ -116,7 +118,7 @@ public class CycleCovariate implements StandardCovariate {
//----------------------------- //-----------------------------
// 454 and Ion Torrent // 454 and Ion Torrent
//----------------------------- //-----------------------------
else if( FLOW_CYCLE_PLATFORMS.contains(ngsPlatform) ) { else if (FLOW_CYCLE_PLATFORMS.contains(ngsPlatform)) {
final int readLength = read.getReadLength(); final int readLength = read.getReadLength();
final byte[] bases = read.getReadBases(); final byte[] bases = read.getReadBases();
@ -133,38 +135,78 @@ public class CycleCovariate implements StandardCovariate {
// BUGBUG: Consider looking at degradation of base quality scores in homopolymer runs to detect when the cycle incremented even though the nucleotide didn't change // BUGBUG: Consider looking at degradation of base quality scores in homopolymer runs to detect when the cycle incremented even though the nucleotide didn't change
// For example, AAAAAAA was probably read in two flow cycles but here we count it as one // For example, AAAAAAA was probably read in two flow cycles but here we count it as one
if( !read.getReadNegativeStrandFlag() ) { // Forward direction if (!read.getReadNegativeStrandFlag()) { // Forward direction
int iii = 0; int iii = 0;
while( iii < readLength ) while (iii < readLength) {
{ while (iii < readLength && bases[iii] == (byte) 'T') {
while( iii < readLength && bases[iii] == (byte)'T' ) { comparable[iii] = cycle; iii++; } comparable[iii] = cycle;
while( iii < readLength && bases[iii] == (byte)'A' ) { comparable[iii] = cycle; iii++; } iii++;
while( iii < readLength && bases[iii] == (byte)'C' ) { comparable[iii] = cycle; iii++; } }
while( iii < readLength && bases[iii] == (byte)'G' ) { comparable[iii] = cycle; iii++; } while (iii < readLength && bases[iii] == (byte) 'A') {
if( iii < readLength ) { if (multiplyByNegative1) cycle--; else cycle++; } comparable[iii] = cycle;
if( iii < readLength && !BaseUtils.isRegularBase(bases[iii]) ) { comparable[iii] = cycle; iii++; } iii++;
}
while (iii < readLength && bases[iii] == (byte) 'C') {
comparable[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'G') {
comparable[iii] = cycle;
iii++;
}
if (iii < readLength) {
if (multiplyByNegative1)
cycle--;
else
cycle++;
}
if (iii < readLength && !BaseUtils.isRegularBase(bases[iii])) {
comparable[iii] = cycle;
iii++;
}
} }
} else { // Negative direction }
int iii = readLength-1; else { // Negative direction
while( iii >= 0 ) int iii = readLength - 1;
{ while (iii >= 0) {
while( iii >= 0 && bases[iii] == (byte)'T' ) { comparable[iii] = cycle; iii--; } while (iii >= 0 && bases[iii] == (byte) 'T') {
while( iii >= 0 && bases[iii] == (byte)'A' ) { comparable[iii] = cycle; iii--; } comparable[iii] = cycle;
while( iii >= 0 && bases[iii] == (byte)'C' ) { comparable[iii] = cycle; iii--; } iii--;
while( iii >= 0 && bases[iii] == (byte)'G' ) { comparable[iii] = cycle; iii--; } }
if( iii >= 0 ) { if (multiplyByNegative1) cycle--; else cycle++; } while (iii >= 0 && bases[iii] == (byte) 'A') {
if( iii >= 0 && !BaseUtils.isRegularBase(bases[iii]) ) { comparable[iii] = cycle; iii--; } comparable[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'C') {
comparable[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'G') {
comparable[iii] = cycle;
iii--;
}
if (iii >= 0) {
if (multiplyByNegative1)
cycle--;
else
cycle++;
}
if (iii >= 0 && !BaseUtils.isRegularBase(bases[iii])) {
comparable[iii] = cycle;
iii--;
}
} }
} }
} }
else { else {
throw new UserException("The platform (" + read.getReadGroup().getPlatform() + ") associated with read group " + read.getReadGroup() + " is not a recognized platform. Implemented options are e.g. illumina, 454, and solid"); throw new UserException("The platform (" + read.getReadGroup().getPlatform() + ") associated with read group " + read.getReadGroup() + " is not a recognized platform. Implemented options are e.g. illumina, 454, and solid");
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
return Integer.parseInt( str ); public final Comparable getValue(final String str) {
return Integer.parseInt(str);
} }
} }

View File

@ -1,7 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.HashMap; import java.util.HashMap;
@ -42,63 +43,30 @@ import java.util.HashMap;
public class DinucCovariate implements StandardCovariate { public class DinucCovariate implements StandardCovariate {
private static final byte NO_CALL = (byte)'N'; private static final byte NO_CALL = (byte) 'N';
private static final Dinuc NO_DINUC = new Dinuc(NO_CALL, NO_CALL); private static final Dinuc NO_DINUC = new Dinuc(NO_CALL, NO_CALL);
private HashMap<Integer, Dinuc> dinucHashMap; private HashMap<Integer, Dinuc> dinucHashMap;
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
final byte[] BASES = { (byte)'A', (byte)'C', (byte)'G', (byte)'T' }; public void initialize(final RecalibrationArgumentCollection RAC) {
final byte[] BASES = {(byte) 'A', (byte) 'C', (byte) 'G', (byte) 'T'};
dinucHashMap = new HashMap<Integer, Dinuc>(); dinucHashMap = new HashMap<Integer, Dinuc>();
for( byte byte1 : BASES ) { for (byte byte1 : BASES) {
for( byte byte2: BASES ) { for (byte byte2 : BASES) {
dinucHashMap.put( Dinuc.hashBytes(byte1, byte2), new Dinuc(byte1, byte2) ); // This might seem silly, but Strings are too slow dinucHashMap.put(Dinuc.hashBytes(byte1, byte2), new Dinuc(byte1, byte2)); // This might seem silly, but Strings are too slow
} }
} }
// Add the "no dinuc" entry too // Add the "no dinuc" entry too
dinucHashMap.put( Dinuc.hashBytes(NO_CALL, NO_CALL), NO_DINUC ); dinucHashMap.put(Dinuc.hashBytes(NO_CALL, NO_CALL), NO_DINUC);
} }
/*
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
byte base;
byte prevBase;
final byte[] bases = read.getReadBases();
// If this is a negative strand read then we need to reverse the direction for our previous base
if( read.getReadNegativeStrandFlag() ) {
// No dinuc at the beginning of the read
if( offset == bases.length-1 ) {
return NO_DINUC;
}
base = (byte)BaseUtils.simpleComplement( (char)(bases[offset]) );
// Note: We are using the previous base in the read, not the previous base in the reference. This is done in part to be consistent with unmapped reads.
prevBase = (byte)BaseUtils.simpleComplement( (char)(bases[offset + 1]) );
} else {
// No dinuc at the beginning of the read
if( offset == 0 ) {
return NO_DINUC;
}
base = bases[offset];
// Note: We are using the previous base in the read, not the previous base in the reference. This is done in part to be consistent with unmapped reads.
prevBase = bases[offset - 1];
}
// Make sure the previous base is good
if( !BaseUtils.isRegularBase( prevBase ) ) {
return NO_DINUC;
}
return dinucHashMap.get( Dinuc.hashBytes( prevBase, base ) );
}
*/
/** /**
* Takes an array of size (at least) read.getReadLength() and fills it with the covariate values for each position in the read. * Takes an array of size (at least) read.getReadLength() and fills it with the covariate values for each position in the read.
*/ */
public void getValues( SAMRecord read, Comparable[] result ) { @Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
final HashMap<Integer, Dinuc> dinucHashMapRef = this.dinucHashMap; //optimize access to dinucHashMap final HashMap<Integer, Dinuc> dinucHashMapRef = this.dinucHashMap; //optimize access to dinucHashMap
final int readLength = read.getReadLength(); final int readLength = read.getReadLength();
final boolean negativeStrand = read.getReadNegativeStrandFlag(); final boolean negativeStrand = read.getReadNegativeStrandFlag();
@ -108,50 +76,51 @@ public class DinucCovariate implements StandardCovariate {
int offset = 0; int offset = 0;
// If this is a negative strand read then we need to reverse the direction for our previous base // If this is a negative strand read then we need to reverse the direction for our previous base
if(negativeStrand) { if (negativeStrand) {
bases = BaseUtils.simpleReverseComplement(bases); //this is NOT in-place bases = BaseUtils.simpleReverseComplement(bases); //this is NOT in-place
} }
result[0] = NO_DINUC; // No dinuc at the beginning of the read comparable[0] = NO_DINUC; // No dinuc at the beginning of the read
prevBase = bases[0]; prevBase = bases[0];
offset++; offset++;
while(offset < readLength) { while (offset < readLength) {
// Note: We are using the previous base in the read, not the // Note: We are using the previous base in the read, not the
// previous base in the reference. This is done in part to be consistent with unmapped reads. // previous base in the reference. This is done in part to be consistent with unmapped reads.
base = bases[offset]; base = bases[offset];
if( BaseUtils.isRegularBase( prevBase ) ) { if (BaseUtils.isRegularBase(prevBase)) {
result[offset] = dinucHashMapRef.get( Dinuc.hashBytes( prevBase, base ) ); comparable[offset] = dinucHashMapRef.get(Dinuc.hashBytes(prevBase, base));
} else { }
result[offset] = NO_DINUC; else {
} comparable[offset] = NO_DINUC;
}
offset++; offset++;
prevBase = base; prevBase = base;
} }
if(negativeStrand) { if (negativeStrand) {
reverse( result ); reverse(comparable);
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
public final Comparable getValue(final String str) {
byte[] bytes = str.getBytes(); byte[] bytes = str.getBytes();
final Dinuc returnDinuc = dinucHashMap.get( Dinuc.hashBytes( bytes[0], bytes[1] ) ); final Dinuc returnDinuc = dinucHashMap.get(Dinuc.hashBytes(bytes[0], bytes[1]));
if( returnDinuc.compareTo(NO_DINUC) == 0 ) { if (returnDinuc.compareTo(NO_DINUC) == 0) {
return null; return null;
} }
return returnDinuc; return returnDinuc;
} }
/** /**
* Reverses the given array in place. * Reverses the given array in place.
* *
* @param array * @param array any array
*/ */
private static void reverse(final Comparable[] array) { private static void reverse(final Comparable[] array) {
final int arrayLength = array.length; final int arrayLength = array.length;
for(int l = 0, r = arrayLength - 1; l < r; l++, r--) { for (int l = 0, r = arrayLength - 1; l < r; l++, r--) {
final Comparable temp = array[l]; final Comparable temp = array[l];
array[l] = array[r]; array[l] = array[r];
array[r] = temp; array[r] = temp;

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2010 The Broad Institute * Copyright (c) 2010 The Broad Institute
@ -38,55 +40,57 @@ import net.sf.samtools.SAMRecord;
public class GCContentCovariate implements ExperimentalCovariate { public class GCContentCovariate implements ExperimentalCovariate {
int numBack = 7; private int numBack = 7;
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
numBack = RAC.HOMOPOLYMER_NBACK; numBack = RAC.HOMOPOLYMER_NBACK;
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) { private Comparable getValue(final SAMRecord read, final int offset) {
// ATTGCCCCGTAAAAAAAGAGAA // ATTGCCCCGTAAAAAAAGAGAA
// 0000123456654321001122 // 0000123456654321001122
if( read.getReadGroup().getPlatform().equalsIgnoreCase( "ILLUMINA" ) || read.getReadGroup().getPlatform().equalsIgnoreCase( "SLX" ) ) { if (read.getReadGroup().getPlatform().equalsIgnoreCase("ILLUMINA") || read.getReadGroup().getPlatform().equalsIgnoreCase("SLX")) {
int numGC = 0; int numGC = 0;
int startPos = 0; int startPos;
int stopPos = 0; int stopPos;
final byte[] bases = read.getReadBases(); final byte[] bases = read.getReadBases();
if( !read.getReadNegativeStrandFlag() ) { // Forward direction if (!read.getReadNegativeStrandFlag()) { // Forward direction
startPos = Math.max(offset - numBack, 0); startPos = Math.max(offset - numBack, 0);
stopPos = Math.max(offset - 1, 0); stopPos = Math.max(offset - 1, 0);
} else { // Negative direction }
else { // Negative direction
startPos = Math.min(offset + 2, bases.length); startPos = Math.min(offset + 2, bases.length);
stopPos = Math.min(offset + numBack + 1, bases.length); stopPos = Math.min(offset + numBack + 1, bases.length);
} }
for( int iii = startPos; iii < stopPos; iii++ ) { for (int iii = startPos; iii < stopPos; iii++) {
if( bases[iii] == (byte)'G' || bases[iii] == (byte)'C' ) { if (bases[iii] == (byte) 'G' || bases[iii] == (byte) 'C') {
numGC++; numGC++;
} }
} }
return numGC; return numGC;
} else { // This effect is specific to the Illumina platform }
else { // This effect is specific to the Illumina platform
return -1; return -1;
} }
} }
public void getValues(SAMRecord read, Comparable[] comparable) { @Override
for(int iii = 0; iii < read.getReadLength(); iii++) { public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
return Integer.parseInt( str ); public final Comparable getValue(final String str) {
return Integer.parseInt(str);
} }
} }

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -40,15 +42,16 @@ import net.sf.samtools.SAMRecord;
public class HomopolymerCovariate implements ExperimentalCovariate { public class HomopolymerCovariate implements ExperimentalCovariate {
int numBack = 7; private int numBack;
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
numBack = RAC.HOMOPOLYMER_NBACK; numBack = RAC.HOMOPOLYMER_NBACK;
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) { private Comparable getValue(final SAMRecord read, final int offset) {
// This block of code is for if you don't want to only count consecutive bases // This block of code is for if you don't want to only count consecutive bases
// ATTGCCCCGTAAAAAAAAATA // ATTGCCCCGTAAAAAAAAATA
@ -75,13 +78,14 @@ public class HomopolymerCovariate implements ExperimentalCovariate {
int numAgree = 0; // The number of consecutive bases that agree with you in the previous numBack bases of the read int numAgree = 0; // The number of consecutive bases that agree with you in the previous numBack bases of the read
final byte[] bases = read.getReadBases(); final byte[] bases = read.getReadBases();
int iii = offset; int iii = offset;
if( !read.getReadNegativeStrandFlag() ) { // Forward direction if (!read.getReadNegativeStrandFlag()) { // Forward direction
while( iii <= bases.length-2 && bases[iii] == bases[iii+1] && numAgree < numBack ) { while (iii <= bases.length - 2 && bases[iii] == bases[iii + 1] && numAgree < numBack) {
numAgree++; numAgree++;
iii++; iii++;
} }
} else { // Negative direction }
while( iii >= 1 && bases[iii] == bases[iii-1] && numAgree < numBack ) { else { // Negative direction
while (iii >= 1 && bases[iii] == bases[iii - 1] && numAgree < numBack) {
numAgree++; numAgree++;
iii--; iii--;
} }
@ -90,15 +94,16 @@ public class HomopolymerCovariate implements ExperimentalCovariate {
return numAgree; return numAgree;
} }
public void getValues(SAMRecord read, Comparable[] comparable) { @Override
for(int iii = 0; iii < read.getReadLength(); iii++) { public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
return Integer.parseInt( str ); public final Comparable getValue(final String str) {
return Integer.parseInt(str);
} }
} }

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -38,23 +39,25 @@ import net.sf.samtools.SAMRecord;
public class MappingQualityCovariate implements ExperimentalCovariate { public class MappingQualityCovariate implements ExperimentalCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) { private Comparable getValue(final GATKSAMRecord read) {
return read.getMappingQuality(); return read.getMappingQuality();
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
return Integer.parseInt( str ); public final Comparable getValue(final String str) {
return Integer.parseInt(str);
} }
public void getValues(SAMRecord read, Comparable[] comparable) { @Override
for(int iii = 0; iii < read.getReadLength(); iii++) { public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read); // BUGBUG: this can be optimized
} }
} }
} }

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -41,34 +43,37 @@ public class MinimumNQSCovariate implements ExperimentalCovariate {
private int windowReach; // How far in each direction from the current base to look private int windowReach; // How far in each direction from the current base to look
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
windowReach = RAC.WINDOW_SIZE / 2; // integer division windowReach = RAC.WINDOW_SIZE / 2; // integer division
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) { private Comparable getValue(final SAMRecord read, final int offset) {
// Loop over the list of base quality scores in the window and find the minimum // Loop over the list of base quality scores in the window and find the minimum
final byte[] quals = read.getBaseQualities(); final byte[] quals = read.getBaseQualities();
int minQual = quals[offset]; int minQual = quals[offset];
final int minIndex = Math.max(offset - windowReach, 0); final int minIndex = Math.max(offset - windowReach, 0);
final int maxIndex = Math.min(offset + windowReach, quals.length - 1); final int maxIndex = Math.min(offset + windowReach, quals.length - 1);
for ( int iii = minIndex; iii < maxIndex; iii++ ) { for (int iii = minIndex; iii < maxIndex; iii++) {
if( quals[iii] < minQual ) { if (quals[iii] < minQual) {
minQual = quals[iii]; minQual = quals[iii];
} }
} }
return minQual; return minQual;
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker @Override
public final Comparable getValue( final String str ) { public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
return Integer.parseInt( str ); for (int iii = 0; iii < read.getReadLength(); iii++) {
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
} }

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -39,27 +41,29 @@ import net.sf.samtools.SAMRecord;
public class PositionCovariate implements ExperimentalCovariate { public class PositionCovariate implements ExperimentalCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) { private Comparable getValue(final SAMRecord read, final int offset) {
int cycle = offset; int cycle = offset;
if( read.getReadNegativeStrandFlag() ) { if (read.getReadNegativeStrandFlag()) {
cycle = read.getReadLength() - (offset + 1); cycle = read.getReadLength() - (offset + 1);
} }
return cycle; return cycle;
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker @Override
public final Comparable getValue( final String str ) { public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
return Integer.parseInt( str ); for (int iii = 0; iii < read.getReadLength(); iii++) {
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
} }

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -33,38 +35,42 @@ import net.sf.samtools.SAMRecord;
* Date: Nov 13, 2009 * Date: Nov 13, 2009
* *
* The Primer Round covariate. * The Primer Round covariate.
* For Solexa and 454 this is the same value of the length of the read. * For Solexa and 454 this is the same value of the length of the read.
* For SOLiD this is different for each position according to http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_057511.pdf * For SOLiD this is different for each position according to http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_057511.pdf
*/ */
public class PrimerRoundCovariate implements ExperimentalCovariate { public class PrimerRoundCovariate implements ExperimentalCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
} }
// Used to pick out the covariate's value from attributes of the read // Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) { private Comparable getValue(final SAMRecord read, final int offset) {
if( read.getReadGroup().getPlatform().equalsIgnoreCase( "SOLID" ) || read.getReadGroup().getPlatform().equalsIgnoreCase( "ABI_SOLID" ) ) { if (read.getReadGroup().getPlatform().equalsIgnoreCase("SOLID") || read.getReadGroup().getPlatform().equalsIgnoreCase("ABI_SOLID")) {
int pos = offset; int pos = offset;
if( read.getReadNegativeStrandFlag() ) { if (read.getReadNegativeStrandFlag()) {
pos = read.getReadLength() - (offset + 1); pos = read.getReadLength() - (offset + 1);
} }
return pos % 5; // the primer round according to http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_057511.pdf return pos % 5; // the primer round according to http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_057511.pdf
} else { }
else {
return 1; // nothing to do here because it is always the same return 1; // nothing to do here because it is always the same
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker @Override
public final Comparable getValue( final String str ) { public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
return Integer.parseInt( str ); for (int iii = 0; iii < read.getReadLength(); iii++) {
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
} }

View File

@ -1,6 +1,9 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -38,26 +41,21 @@ import net.sf.samtools.SAMRecord;
public class QualityScoreCovariate implements RequiredCovariate { public class QualityScoreCovariate implements RequiredCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
} }
/* @Override
// Used to pick out the covariate's value from attributes of the read public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
public final Comparable getValue( final SAMRecord read, final int offset ) {
return (int)(read.getBaseQualities()[offset]);
}
*/
public void getValues(SAMRecord read, Comparable[] comparable) {
byte[] baseQualities = read.getBaseQualities(); byte[] baseQualities = read.getBaseQualities();
for(int i = 0; i < read.getReadLength(); i++) { for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = (int) baseQualities[i]; comparable[i] = (int) baseQualities[i];
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
return Integer.parseInt( str ); public final Comparable getValue(final String str) {
return Integer.parseInt(str);
} }
} }

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/* /*
* Copyright (c) 2009 The Broad Institute * Copyright (c) 2009 The Broad Institute
@ -35,33 +36,26 @@ import net.sf.samtools.SAMRecord;
* The Read Group covariate. * The Read Group covariate.
*/ */
public class ReadGroupCovariate implements RequiredCovariate{ public class ReadGroupCovariate implements RequiredCovariate {
public static final String defaultReadGroup = "DefaultReadGroup";
// Initialize any member variables using the command-line arguments passed to the walkers // Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) { @Override
public void initialize(final RecalibrationArgumentCollection RAC) {
} }
/* @Override
// Used to pick out the covariate's value from attributes of the read public void getValues(final GATKSAMRecord read, final Comparable[] comparable) {
public final Comparable getValue( final SAMRecord read, final int offset ) {
return read.getReadGroup().getReadGroupId();
}
*/
public void getValues(SAMRecord read, Comparable[] comparable) {
final String readGroupId = read.getReadGroup().getReadGroupId(); final String readGroupId = read.getReadGroup().getReadGroupId();
for(int i = 0; i < read.getReadLength(); i++) { for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = readGroupId; comparable[i] = readGroupId;
} }
} }
// Used to get the covariate's value from input csv file in TableRecalibrationWalker // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) { @Override
public final Comparable getValue(final String str) {
return str; return str;
} }
} }

View File

@ -25,8 +25,6 @@
package org.broadinstitute.sting.gatk.walkers.recalibration; package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMReadGroupRecord;
import net.sf.samtools.SAMRecord;
import net.sf.samtools.SAMUtils; import net.sf.samtools.SAMUtils;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.utils.BaseUtils; import org.broadinstitute.sting.utils.BaseUtils;
@ -34,9 +32,11 @@ import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.collections.NestedHashMap; import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.AlignmentUtils; import org.broadinstitute.sting.utils.sam.AlignmentUtils;
import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord; import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils;
import java.util.ArrayList; import java.util.ArrayList;
import java.util.List; import java.util.List;
@ -63,46 +63,60 @@ public class RecalDataManager {
public final static String COLOR_SPACE_QUAL_ATTRIBUTE_TAG = "CQ"; // The tag that holds the color space quality scores for SOLID bams public final static String COLOR_SPACE_QUAL_ATTRIBUTE_TAG = "CQ"; // The tag that holds the color space quality scores for SOLID bams
public final static String COLOR_SPACE_ATTRIBUTE_TAG = "CS"; // The tag that holds the color space for SOLID bams public final static String COLOR_SPACE_ATTRIBUTE_TAG = "CS"; // The tag that holds the color space for SOLID bams
public final static String COLOR_SPACE_INCONSISTENCY_TAG = "ZC"; // A new tag made up for the recalibrator which will hold an array of ints which say if this base is inconsistent with its color public final static String COLOR_SPACE_INCONSISTENCY_TAG = "ZC"; // A new tag made up for the recalibrator which will hold an array of ints which say if this base is inconsistent with its color
private static boolean warnUserNullReadGroup = false;
private static boolean warnUserNullPlatform = false; private static boolean warnUserNullPlatform = false;
public enum SOLID_RECAL_MODE { public enum SOLID_RECAL_MODE {
/** Treat reference inserted bases as reference matching bases. Very unsafe! */ /**
* Treat reference inserted bases as reference matching bases. Very unsafe!
*/
DO_NOTHING, DO_NOTHING,
/** Set reference inserted bases and the previous base (because of color space alignment details) to Q0. This is the default option. */ /**
* Set reference inserted bases and the previous base (because of color space alignment details) to Q0. This is the default option.
*/
SET_Q_ZERO, SET_Q_ZERO,
/** In addition to setting the quality scores to zero, also set the base itself to 'N'. This is useful to visualize in IGV. */ /**
* In addition to setting the quality scores to zero, also set the base itself to 'N'. This is useful to visualize in IGV.
*/
SET_Q_ZERO_BASE_N, SET_Q_ZERO_BASE_N,
/** Look at the color quality scores and probabilistically decide to change the reference inserted base to be the base which is implied by the original color space instead of the reference. */ /**
* Look at the color quality scores and probabilistically decide to change the reference inserted base to be the base which is implied by the original color space instead of the reference.
*/
REMOVE_REF_BIAS REMOVE_REF_BIAS
} }
public enum SOLID_NOCALL_STRATEGY { public enum SOLID_NOCALL_STRATEGY {
/** When a no call is detected throw an exception to alert the user that recalibrating this SOLiD data is unsafe. This is the default option. */ /**
* When a no call is detected throw an exception to alert the user that recalibrating this SOLiD data is unsafe. This is the default option.
*/
THROW_EXCEPTION, THROW_EXCEPTION,
/** Leave the read in the output bam completely untouched. This mode is only okay if the no calls are very rare. */ /**
* Leave the read in the output bam completely untouched. This mode is only okay if the no calls are very rare.
*/
LEAVE_READ_UNRECALIBRATED, LEAVE_READ_UNRECALIBRATED,
/** Mark these reads as failing vendor quality checks so they can be filtered out by downstream analyses. */ /**
* Mark these reads as failing vendor quality checks so they can be filtered out by downstream analyses.
*/
PURGE_READ PURGE_READ
} }
RecalDataManager() { public RecalDataManager() {
data = new NestedHashMap(); data = new NestedHashMap();
dataCollapsedReadGroup = null; dataCollapsedReadGroup = null;
dataCollapsedQualityScore = null; dataCollapsedQualityScore = null;
dataCollapsedByCovariate = null; dataCollapsedByCovariate = null;
} }
RecalDataManager( final boolean createCollapsedTables, final int numCovariates ) { public RecalDataManager(final boolean createCollapsedTables, final int numCovariates) {
if( createCollapsedTables ) { // Initialize all the collapsed tables, only used by TableRecalibrationWalker if (createCollapsedTables) { // Initialize all the collapsed tables, only used by TableRecalibrationWalker
data = null; data = null;
dataCollapsedReadGroup = new NestedHashMap(); dataCollapsedReadGroup = new NestedHashMap();
dataCollapsedQualityScore = new NestedHashMap(); dataCollapsedQualityScore = new NestedHashMap();
dataCollapsedByCovariate = new ArrayList<NestedHashMap>(); dataCollapsedByCovariate = new ArrayList<NestedHashMap>();
for( int iii = 0; iii < numCovariates - 2; iii++ ) { // readGroup and QualityScore aren't counted here, their tables are separate for (int iii = 0; iii < numCovariates - 2; iii++) { // readGroup and QualityScore aren't counted here, their tables are separate
dataCollapsedByCovariate.add( new NestedHashMap() ); dataCollapsedByCovariate.add(new NestedHashMap());
} }
} else { }
else {
data = new NestedHashMap(); data = new NestedHashMap();
dataCollapsedReadGroup = null; dataCollapsedReadGroup = null;
dataCollapsedQualityScore = null; dataCollapsedQualityScore = null;
@ -112,54 +126,58 @@ public class RecalDataManager {
/** /**
* Add the given mapping to all of the collapsed hash tables * Add the given mapping to all of the collapsed hash tables
* @param key The list of comparables that is the key for this mapping *
* @param fullDatum The RecalDatum which is the data for this mapping * @param key The list of comparables that is the key for this mapping
* @param fullDatum The RecalDatum which is the data for this mapping
* @param PRESERVE_QSCORES_LESS_THAN The threshold in report quality for adding to the aggregate collapsed table * @param PRESERVE_QSCORES_LESS_THAN The threshold in report quality for adding to the aggregate collapsed table
*/ */
public final void addToAllTables( final Object[] key, final RecalDatum fullDatum, final int PRESERVE_QSCORES_LESS_THAN ) { public final void addToAllTables(final Object[] key, final RecalDatum fullDatum, final int PRESERVE_QSCORES_LESS_THAN) {
// The full dataset isn't actually ever used for anything because of the sequential calculation so no need to keep the full data HashMap around // The full dataset isn't actually ever used for anything because of the sequential calculation so no need to keep the full data HashMap around
//data.put(key, thisDatum); // add the mapping to the main table //data.put(key, thisDatum); // add the mapping to the main table
final int qualityScore = Integer.parseInt( key[1].toString() ); final int qualityScore = Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1]; final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2]; final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3]; final Object[] covariateCollapsedKey = new Object[3];
RecalDatum collapsedDatum; RecalDatum collapsedDatum;
// Create dataCollapsedReadGroup, the table where everything except read group has been collapsed // Create dataCollapsedReadGroup, the table where everything except read group has been collapsed
if( qualityScore >= PRESERVE_QSCORES_LESS_THAN ) { if (qualityScore >= PRESERVE_QSCORES_LESS_THAN) {
readGroupCollapsedKey[0] = key[0]; // Make a new key with just the read group readGroupCollapsedKey[0] = key[0]; // Make a new key with just the read group
collapsedDatum = (RecalDatum) dataCollapsedReadGroup.get( readGroupCollapsedKey ); collapsedDatum = (RecalDatum) dataCollapsedReadGroup.get(readGroupCollapsedKey);
if( collapsedDatum == null ) { if (collapsedDatum == null) {
dataCollapsedReadGroup.put( new RecalDatum(fullDatum), readGroupCollapsedKey ); dataCollapsedReadGroup.put(new RecalDatum(fullDatum), readGroupCollapsedKey);
} else { }
collapsedDatum.combine( fullDatum ); // using combine instead of increment in order to calculate overall aggregateQReported else {
collapsedDatum.combine(fullDatum); // using combine instead of increment in order to calculate overall aggregateQReported
} }
} }
// Create dataCollapsedQuality, the table where everything except read group and quality score has been collapsed // Create dataCollapsedQuality, the table where everything except read group and quality score has been collapsed
qualityScoreCollapsedKey[0] = key[0]; // Make a new key with the read group ... qualityScoreCollapsedKey[0] = key[0]; // Make a new key with the read group ...
qualityScoreCollapsedKey[1] = key[1]; // and quality score qualityScoreCollapsedKey[1] = key[1]; // and quality score
collapsedDatum = (RecalDatum) dataCollapsedQualityScore.get( qualityScoreCollapsedKey ); collapsedDatum = (RecalDatum) dataCollapsedQualityScore.get(qualityScoreCollapsedKey);
if( collapsedDatum == null ) { if (collapsedDatum == null) {
dataCollapsedQualityScore.put( new RecalDatum(fullDatum), qualityScoreCollapsedKey ); dataCollapsedQualityScore.put(new RecalDatum(fullDatum), qualityScoreCollapsedKey);
} else { }
collapsedDatum.increment( fullDatum ); else {
collapsedDatum.increment(fullDatum);
} }
// Create dataCollapsedByCovariate's, the tables where everything except read group, quality score, and given covariate has been collapsed // Create dataCollapsedByCovariate's, the tables where everything except read group, quality score, and given covariate has been collapsed
for( int iii = 0; iii < dataCollapsedByCovariate.size(); iii++ ) { for (int iii = 0; iii < dataCollapsedByCovariate.size(); iii++) {
covariateCollapsedKey[0] = key[0]; // Make a new key with the read group ... covariateCollapsedKey[0] = key[0]; // Make a new key with the read group ...
covariateCollapsedKey[1] = key[1]; // and quality score ... covariateCollapsedKey[1] = key[1]; // and quality score ...
final Object theCovariateElement = key[iii + 2]; // and the given covariate final Object theCovariateElement = key[iii + 2]; // and the given covariate
if( theCovariateElement != null ) { if (theCovariateElement != null) {
covariateCollapsedKey[2] = theCovariateElement; covariateCollapsedKey[2] = theCovariateElement;
collapsedDatum = (RecalDatum) dataCollapsedByCovariate.get(iii).get( covariateCollapsedKey ); collapsedDatum = (RecalDatum) dataCollapsedByCovariate.get(iii).get(covariateCollapsedKey);
if( collapsedDatum == null ) { if (collapsedDatum == null) {
dataCollapsedByCovariate.get(iii).put( new RecalDatum(fullDatum), covariateCollapsedKey ); dataCollapsedByCovariate.get(iii).put(new RecalDatum(fullDatum), covariateCollapsedKey);
} else { }
collapsedDatum.increment( fullDatum ); else {
collapsedDatum.increment(fullDatum);
} }
} }
} }
@ -167,150 +185,136 @@ public class RecalDataManager {
/** /**
* Loop over all the collapsed tables and turn the recalDatums found there into an empirical quality score * Loop over all the collapsed tables and turn the recalDatums found there into an empirical quality score
* that will be used in the sequential calculation in TableRecalibrationWalker * that will be used in the sequential calculation in TableRecalibrationWalker
*
* @param smoothing The smoothing parameter that goes into empirical quality score calculation * @param smoothing The smoothing parameter that goes into empirical quality score calculation
* @param maxQual At which value to cap the quality scores * @param maxQual At which value to cap the quality scores
*/ */
public final void generateEmpiricalQualities( final int smoothing, final int maxQual ) { public final void generateEmpiricalQualities(final int smoothing, final int maxQual) {
recursivelyGenerateEmpiricalQualities(dataCollapsedReadGroup.data, smoothing, maxQual); recursivelyGenerateEmpiricalQualities(dataCollapsedReadGroup.data, smoothing, maxQual);
recursivelyGenerateEmpiricalQualities(dataCollapsedQualityScore.data, smoothing, maxQual); recursivelyGenerateEmpiricalQualities(dataCollapsedQualityScore.data, smoothing, maxQual);
for( NestedHashMap map : dataCollapsedByCovariate ) { for (NestedHashMap map : dataCollapsedByCovariate) {
recursivelyGenerateEmpiricalQualities(map.data, smoothing, maxQual); recursivelyGenerateEmpiricalQualities(map.data, smoothing, maxQual);
checkForSingletons(map.data); checkForSingletons(map.data);
} }
} }
private void recursivelyGenerateEmpiricalQualities( final Map data, final int smoothing, final int maxQual ) { private void recursivelyGenerateEmpiricalQualities(final Map data, final int smoothing, final int maxQual) {
for( Object comp : data.keySet() ) { for (Object comp : data.keySet()) {
final Object val = data.get(comp); final Object val = data.get(comp);
if( val instanceof RecalDatum ) { // We are at the end of the nested hash maps if (val instanceof RecalDatum) { // We are at the end of the nested hash maps
((RecalDatum)val).calcCombinedEmpiricalQuality(smoothing, maxQual); ((RecalDatum) val).calcCombinedEmpiricalQuality(smoothing, maxQual);
} else { // Another layer in the nested hash map }
recursivelyGenerateEmpiricalQualities( (Map) val, smoothing, maxQual); else { // Another layer in the nested hash map
recursivelyGenerateEmpiricalQualities((Map) val, smoothing, maxQual);
} }
} }
} }
private void checkForSingletons( final Map data ) { private void checkForSingletons(final Map data) {
// todo -- this looks like it's better just as a data.valueSet() call? // todo -- this looks like it's better just as a data.valueSet() call?
for( Object comp : data.keySet() ) { for (Object comp : data.keySet()) {
final Object val = data.get(comp); final Object val = data.get(comp);
if( val instanceof RecalDatum ) { // We are at the end of the nested hash maps if (val instanceof RecalDatum) { // We are at the end of the nested hash maps
if( data.keySet().size() == 1) { if (data.keySet().size() == 1) {
data.clear(); // don't TableRecalibrate a non-required covariate if it only has one element because that correction has already been done ... data.clear(); // don't TableRecalibrate a non-required covariate if it only has one element because that correction has already been done ...
// in a previous step of the sequential calculation model // in a previous step of the sequential calculation model
} }
} else { // Another layer in the nested hash map }
checkForSingletons( (Map) val ); else { // Another layer in the nested hash map
checkForSingletons((Map) val);
} }
} }
} }
/** /**
* Get the appropriate collapsed table out of the set of all the tables held by this Object * Get the appropriate collapsed table out of the set of all the tables held by this Object
*
* @param covariate Which covariate indexes the desired collapsed HashMap * @param covariate Which covariate indexes the desired collapsed HashMap
* @return The desired collapsed HashMap * @return The desired collapsed HashMap
*/ */
public final NestedHashMap getCollapsedTable( final int covariate ) { public final NestedHashMap getCollapsedTable(final int covariate) {
if( covariate == 0) { if (covariate == 0) {
return dataCollapsedReadGroup; // Table where everything except read group has been collapsed return dataCollapsedReadGroup; // Table where everything except read group has been collapsed
} else if( covariate == 1 ) { }
else if (covariate == 1) {
return dataCollapsedQualityScore; // Table where everything except read group and quality score has been collapsed return dataCollapsedQualityScore; // Table where everything except read group and quality score has been collapsed
} else { }
return dataCollapsedByCovariate.get( covariate - 2 ); // Table where everything except read group, quality score, and given covariate has been collapsed else {
return dataCollapsedByCovariate.get(covariate - 2); // Table where everything except read group, quality score, and given covariate has been collapsed
} }
} }
/** /**
* Section of code shared between the two recalibration walkers which uses the command line arguments to adjust attributes of the read such as quals or platform string * Section of code shared between the two recalibration walkers which uses the command line arguments to adjust attributes of the read such as quals or platform string
*
* @param read The read to adjust * @param read The read to adjust
* @param RAC The list of shared command line arguments * @param RAC The list of shared command line arguments
*/ */
public static void parseSAMRecord( final SAMRecord read, final RecalibrationArgumentCollection RAC ) { public static void parseSAMRecord(final GATKSAMRecord read, final RecalibrationArgumentCollection RAC) {
GATKSAMReadGroupRecord readGroup = ((GATKSAMRecord)read).getReadGroup(); GATKSAMReadGroupRecord readGroup = ((GATKSAMRecord) read).getReadGroup();
// If there are no read groups we have to default to something, and that something could be specified by the user using command line arguments if (RAC.FORCE_PLATFORM != null && (readGroup.getPlatform() == null || !readGroup.getPlatform().equals(RAC.FORCE_PLATFORM))) {
if( readGroup == null ) { readGroup.setPlatform(RAC.FORCE_PLATFORM);
if( RAC.DEFAULT_READ_GROUP != null && RAC.DEFAULT_PLATFORM != null) {
if( !warnUserNullReadGroup && RAC.FORCE_READ_GROUP == null ) {
Utils.warnUser("The input .bam file contains reads with no read group. " +
"Defaulting to read group ID = " + RAC.DEFAULT_READ_GROUP + " and platform = " + RAC.DEFAULT_PLATFORM + ". " +
"First observed at read with name = " + read.getReadName() );
warnUserNullReadGroup = true;
}
// There is no readGroup so defaulting to these values
readGroup = new GATKSAMReadGroupRecord( RAC.DEFAULT_READ_GROUP );
readGroup.setPlatform( RAC.DEFAULT_PLATFORM );
((GATKSAMRecord)read).setReadGroup( readGroup );
} else {
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no read group. First observed at read with name = " + read.getReadName() );
}
} }
if( RAC.FORCE_READ_GROUP != null && !readGroup.getReadGroupId().equals(RAC.FORCE_READ_GROUP) ) { // Collapse all the read groups into a single common String provided by the user if (readGroup.getPlatform() == null) {
final String oldPlatform = readGroup.getPlatform(); if (RAC.DEFAULT_PLATFORM != null) {
readGroup = new GATKSAMReadGroupRecord( RAC.FORCE_READ_GROUP ); if (!warnUserNullPlatform) {
readGroup.setPlatform( oldPlatform );
((GATKSAMRecord)read).setReadGroup( readGroup );
}
if( RAC.FORCE_PLATFORM != null && (readGroup.getPlatform() == null || !readGroup.getPlatform().equals(RAC.FORCE_PLATFORM))) {
readGroup.setPlatform( RAC.FORCE_PLATFORM );
}
if ( readGroup.getPlatform() == null ) {
if( RAC.DEFAULT_PLATFORM != null ) {
if( !warnUserNullPlatform ) {
Utils.warnUser("The input .bam file contains reads with no platform information. " + Utils.warnUser("The input .bam file contains reads with no platform information. " +
"Defaulting to platform = " + RAC.DEFAULT_PLATFORM + ". " + "Defaulting to platform = " + RAC.DEFAULT_PLATFORM + ". " +
"First observed at read with name = " + read.getReadName() ); "First observed at read with name = " + read.getReadName());
warnUserNullPlatform = true; warnUserNullPlatform = true;
} }
readGroup.setPlatform( RAC.DEFAULT_PLATFORM ); readGroup.setPlatform(RAC.DEFAULT_PLATFORM);
} else { }
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no platform information. First observed at read with name = " + read.getReadName() ); else {
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no platform information. First observed at read with name = " + read.getReadName());
} }
} }
} }
/** /**
* Parse through the color space of the read and add a new tag to the SAMRecord that says which bases are inconsistent with the color space * Parse through the color space of the read and add a new tag to the SAMRecord that says which bases are inconsistent with the color space
*
* @param read The SAMRecord to parse * @param read The SAMRecord to parse
*/ */
public static void parseColorSpace( final SAMRecord read ) { public static void parseColorSpace(final GATKSAMRecord read) {
// If this is a SOLID read then we have to check if the color space is inconsistent. This is our only sign that SOLID has inserted the reference base // If this is a SOLID read then we have to check if the color space is inconsistent. This is our only sign that SOLID has inserted the reference base
if( read.getReadGroup().getPlatform().toUpperCase().contains("SOLID") ) { if (ReadUtils.isSOLiDRead(read)) {
if( read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG) == null ) { // Haven't calculated the inconsistency array yet for this read if (read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG) == null) { // Haven't calculated the inconsistency array yet for this read
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG); final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if( attr != null ) { if (attr != null) {
byte[] colorSpace; byte[] colorSpace;
if( attr instanceof String ) { if (attr instanceof String) {
colorSpace = ((String)attr).getBytes(); colorSpace = ((String) attr).getBytes();
} else { }
else {
throw new UserException.MalformedBAM(read, String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName())); throw new UserException.MalformedBAM(read, String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
} }
// Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read // Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read
byte[] readBases = read.getReadBases(); byte[] readBases = read.getReadBases();
if( read.getReadNegativeStrandFlag() ) { if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement( read.getReadBases() ); readBases = BaseUtils.simpleReverseComplement(read.getReadBases());
} }
final byte[] inconsistency = new byte[readBases.length]; final byte[] inconsistency = new byte[readBases.length];
int iii; int iii;
byte prevBase = colorSpace[0]; // The sentinel byte prevBase = colorSpace[0]; // The sentinel
for( iii = 0; iii < readBases.length; iii++ ) { for (iii = 0; iii < readBases.length; iii++) {
final byte thisBase = getNextBaseFromColor( read, prevBase, colorSpace[iii + 1] ); final byte thisBase = getNextBaseFromColor(read, prevBase, colorSpace[iii + 1]);
inconsistency[iii] = (byte)( thisBase == readBases[iii] ? 0 : 1 ); inconsistency[iii] = (byte) (thisBase == readBases[iii] ? 0 : 1);
prevBase = readBases[iii]; prevBase = readBases[iii];
} }
read.setAttribute( RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency ); read.setAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency);
} else { }
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() + throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias."); " Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
} }
} }
} }
@ -319,52 +323,57 @@ public class RecalDataManager {
/** /**
* Parse through the color space of the read and apply the desired --solid_recal_mode correction to the bases * Parse through the color space of the read and apply the desired --solid_recal_mode correction to the bases
* This method doesn't add the inconsistent tag to the read like parseColorSpace does * This method doesn't add the inconsistent tag to the read like parseColorSpace does
* @param read The SAMRecord to parse *
* @param read The SAMRecord to parse
* @param originalQualScores The array of original quality scores to modify during the correction * @param originalQualScores The array of original quality scores to modify during the correction
* @param solidRecalMode Which mode of solid recalibration to apply * @param solidRecalMode Which mode of solid recalibration to apply
* @param refBases The reference for this read * @param refBases The reference for this read
* @return A new array of quality scores that have been ref bias corrected * @return A new array of quality scores that have been ref bias corrected
*/ */
public static byte[] calcColorSpace( final SAMRecord read, byte[] originalQualScores, final SOLID_RECAL_MODE solidRecalMode, final byte[] refBases ) { public static byte[] calcColorSpace(final GATKSAMRecord read, byte[] originalQualScores, final SOLID_RECAL_MODE solidRecalMode, final byte[] refBases) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG); final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if( attr != null ) { if (attr != null) {
byte[] colorSpace; byte[] colorSpace;
if( attr instanceof String ) { if (attr instanceof String) {
colorSpace = ((String)attr).getBytes(); colorSpace = ((String) attr).getBytes();
} else { }
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName())); throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
} }
// Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read // Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read
byte[] readBases = read.getReadBases(); byte[] readBases = read.getReadBases();
final byte[] colorImpliedBases = readBases.clone(); final byte[] colorImpliedBases = readBases.clone();
byte[] refBasesDirRead = AlignmentUtils.alignmentToByteArray( read.getCigar(), read.getReadBases(), refBases ); //BUGBUG: This needs to change when read walkers are changed to give the aligned refBases byte[] refBasesDirRead = AlignmentUtils.alignmentToByteArray(read.getCigar(), read.getReadBases(), refBases); //BUGBUG: This needs to change when read walkers are changed to give the aligned refBases
if( read.getReadNegativeStrandFlag() ) { if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement( read.getReadBases() ); readBases = BaseUtils.simpleReverseComplement(read.getReadBases());
refBasesDirRead = BaseUtils.simpleReverseComplement( refBasesDirRead.clone() ); refBasesDirRead = BaseUtils.simpleReverseComplement(refBasesDirRead.clone());
} }
final int[] inconsistency = new int[readBases.length]; final int[] inconsistency = new int[readBases.length];
byte prevBase = colorSpace[0]; // The sentinel byte prevBase = colorSpace[0]; // The sentinel
for( int iii = 0; iii < readBases.length; iii++ ) { for (int iii = 0; iii < readBases.length; iii++) {
final byte thisBase = getNextBaseFromColor( read, prevBase, colorSpace[iii + 1] ); final byte thisBase = getNextBaseFromColor(read, prevBase, colorSpace[iii + 1]);
colorImpliedBases[iii] = thisBase; colorImpliedBases[iii] = thisBase;
inconsistency[iii] = ( thisBase == readBases[iii] ? 0 : 1 ); inconsistency[iii] = (thisBase == readBases[iii] ? 0 : 1);
prevBase = readBases[iii]; prevBase = readBases[iii];
} }
// Now that we have the inconsistency array apply the desired correction to the inconsistent bases // Now that we have the inconsistency array apply the desired correction to the inconsistent bases
if( solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO ) { // Set inconsistent bases and the one before it to Q0 if (solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO) { // Set inconsistent bases and the one before it to Q0
final boolean setBaseN = false; final boolean setBaseN = false;
originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN); originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN);
} else if( solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO_BASE_N ) { }
else if (solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO_BASE_N) {
final boolean setBaseN = true; final boolean setBaseN = true;
originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN); originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN);
} else if( solidRecalMode == SOLID_RECAL_MODE.REMOVE_REF_BIAS ) { // Use the color space quality to probabilistically remove ref bases at inconsistent color space bases }
else if (solidRecalMode == SOLID_RECAL_MODE.REMOVE_REF_BIAS) { // Use the color space quality to probabilistically remove ref bases at inconsistent color space bases
solidRecalRemoveRefBias(read, readBases, inconsistency, colorImpliedBases, refBasesDirRead); solidRecalRemoveRefBias(read, readBases, inconsistency, colorImpliedBases, refBasesDirRead);
} }
} else { }
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() + throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias."); " Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
} }
@ -372,26 +381,28 @@ public class RecalDataManager {
return originalQualScores; return originalQualScores;
} }
public static boolean checkNoCallColorSpace( final SAMRecord read ) { public static boolean checkNoCallColorSpace(final GATKSAMRecord read) {
if( read.getReadGroup().getPlatform().toUpperCase().contains("SOLID") ) { if (ReadUtils.isSOLiDRead(read)) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG); final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if( attr != null ) { if (attr != null) {
byte[] colorSpace; byte[] colorSpace;
if( attr instanceof String ) { if (attr instanceof String) {
colorSpace = ((String)attr).substring(1).getBytes(); // trim off the Sentinel colorSpace = ((String) attr).substring(1).getBytes(); // trim off the Sentinel
} else { }
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName())); throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
} }
for( byte color : colorSpace ) { for (byte color : colorSpace) {
if( color != (byte)'0' && color != (byte)'1' && color != (byte)'2' && color != (byte)'3' ) { if (color != (byte) '0' && color != (byte) '1' && color != (byte) '2' && color != (byte) '3') {
return true; // There is a bad color in this SOLiD read and the user wants to skip over it return true; // There is a bad color in this SOLiD read and the user wants to skip over it
} }
} }
} else { }
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() + throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias."); " Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
} }
} }
@ -400,90 +411,105 @@ public class RecalDataManager {
/** /**
* Perform the SET_Q_ZERO solid recalibration. Inconsistent color space bases and their previous base are set to quality zero * Perform the SET_Q_ZERO solid recalibration. Inconsistent color space bases and their previous base are set to quality zero
* @param read The SAMRecord to recalibrate *
* @param readBases The bases in the read which have been RC'd if necessary * @param read The SAMRecord to recalibrate
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color * @param readBases The bases in the read which have been RC'd if necessary
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color
* @param originalQualScores The array of original quality scores to set to zero if needed * @param originalQualScores The array of original quality scores to set to zero if needed
* @param refBases The reference which has been RC'd if necessary * @param refBases The reference which has been RC'd if necessary
* @param setBaseN Should we also set the base to N as well as quality zero in order to visualize in IGV or something similar * @param setBaseN Should we also set the base to N as well as quality zero in order to visualize in IGV or something similar
* @return The byte array of original quality scores some of which might have been set to zero * @return The byte array of original quality scores some of which might have been set to zero
*/ */
private static byte[] solidRecalSetToQZero( final SAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] originalQualScores, private static byte[] solidRecalSetToQZero(final GATKSAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] originalQualScores, final byte[] refBases, final boolean setBaseN) {
final byte[] refBases, final boolean setBaseN ) {
final boolean negStrand = read.getReadNegativeStrandFlag(); final boolean negStrand = read.getReadNegativeStrandFlag();
for( int iii = 1; iii < originalQualScores.length; iii++ ) { for (int iii = 1; iii < originalQualScores.length; iii++) {
if( inconsistency[iii] == 1 ) { if (inconsistency[iii] == 1) {
if( readBases[iii] == refBases[iii] ) { if (readBases[iii] == refBases[iii]) {
if( negStrand ) { originalQualScores[originalQualScores.length-(iii+1)] = (byte)0; } if (negStrand) {
else { originalQualScores[iii] = (byte)0; } originalQualScores[originalQualScores.length - (iii + 1)] = (byte) 0;
if( setBaseN ) { readBases[iii] = (byte)'N'; } }
else {
originalQualScores[iii] = (byte) 0;
}
if (setBaseN) {
readBases[iii] = (byte) 'N';
}
} }
// Set the prev base to Q0 as well // Set the prev base to Q0 as well
if( readBases[iii-1] == refBases[iii-1] ) { if (readBases[iii - 1] == refBases[iii - 1]) {
if( negStrand ) { originalQualScores[originalQualScores.length-iii] = (byte)0; } if (negStrand) {
else { originalQualScores[iii-1] = (byte)0; } originalQualScores[originalQualScores.length - iii] = (byte) 0;
if( setBaseN ) { readBases[iii-1] = (byte)'N'; } }
else {
originalQualScores[iii - 1] = (byte) 0;
}
if (setBaseN) {
readBases[iii - 1] = (byte) 'N';
}
} }
} }
} }
if( negStrand ) { if (negStrand) {
readBases = BaseUtils.simpleReverseComplement( readBases.clone() ); // Put the bases back in reverse order to stuff them back in the read readBases = BaseUtils.simpleReverseComplement(readBases.clone()); // Put the bases back in reverse order to stuff them back in the read
} }
read.setReadBases( readBases ); read.setReadBases(readBases);
return originalQualScores; return originalQualScores;
} }
/** /**
* Peform the REMOVE_REF_BIAS solid recalibration. Look at the color space qualities and probabilistically decide if the base should be change to match the color or left as reference * Peform the REMOVE_REF_BIAS solid recalibration. Look at the color space qualities and probabilistically decide if the base should be change to match the color or left as reference
* @param read The SAMRecord to recalibrate *
* @param readBases The bases in the read which have been RC'd if necessary * @param read The SAMRecord to recalibrate
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color * @param readBases The bases in the read which have been RC'd if necessary
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color
* @param colorImpliedBases The bases implied by the color space, RC'd if necessary * @param colorImpliedBases The bases implied by the color space, RC'd if necessary
* @param refBases The reference which has been RC'd if necessary * @param refBases The reference which has been RC'd if necessary
*/ */
private static void solidRecalRemoveRefBias( final SAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] colorImpliedBases, private static void solidRecalRemoveRefBias(final GATKSAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] colorImpliedBases, final byte[] refBases) {
final byte[] refBases) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG); final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG);
if( attr != null ) { if (attr != null) {
byte[] colorSpaceQuals; byte[] colorSpaceQuals;
if( attr instanceof String ) { if (attr instanceof String) {
String x = (String)attr; String x = (String) attr;
colorSpaceQuals = x.getBytes(); colorSpaceQuals = x.getBytes();
SAMUtils.fastqToPhred(colorSpaceQuals); SAMUtils.fastqToPhred(colorSpaceQuals);
} else { }
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG, read.getReadName())); throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG, read.getReadName()));
} }
for( int iii = 1; iii < inconsistency.length - 1; iii++ ) { for (int iii = 1; iii < inconsistency.length - 1; iii++) {
if( inconsistency[iii] == 1 ) { if (inconsistency[iii] == 1) {
for( int jjj = iii - 1; jjj <= iii; jjj++ ) { // Correct this base and the one before it along the direction of the read for (int jjj = iii - 1; jjj <= iii; jjj++) { // Correct this base and the one before it along the direction of the read
if( jjj == iii || inconsistency[jjj] == 0 ) { // Don't want to correct the previous base a second time if it was already corrected in the previous step if (jjj == iii || inconsistency[jjj] == 0) { // Don't want to correct the previous base a second time if it was already corrected in the previous step
if( readBases[jjj] == refBases[jjj] ) { if (readBases[jjj] == refBases[jjj]) {
if( colorSpaceQuals[jjj] == colorSpaceQuals[jjj+1] ) { // Equal evidence for the color implied base and the reference base, so flip a coin if (colorSpaceQuals[jjj] == colorSpaceQuals[jjj + 1]) { // Equal evidence for the color implied base and the reference base, so flip a coin
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt( 2 ); final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt(2);
if( rand == 0 ) { // The color implied base won the coin flip if (rand == 0) { // The color implied base won the coin flip
readBases[jjj] = colorImpliedBases[jjj]; readBases[jjj] = colorImpliedBases[jjj];
} }
} else { }
final int maxQuality = Math.max((int)colorSpaceQuals[jjj], (int)colorSpaceQuals[jjj+1]); else {
final int minQuality = Math.min((int)colorSpaceQuals[jjj], (int)colorSpaceQuals[jjj+1]); final int maxQuality = Math.max((int) colorSpaceQuals[jjj], (int) colorSpaceQuals[jjj + 1]);
final int minQuality = Math.min((int) colorSpaceQuals[jjj], (int) colorSpaceQuals[jjj + 1]);
int diffInQuality = maxQuality - minQuality; int diffInQuality = maxQuality - minQuality;
int numLow = minQuality; int numLow = minQuality;
if( numLow == 0 ) { if (numLow == 0) {
numLow++; numLow++;
diffInQuality++; diffInQuality++;
} }
final int numHigh = Math.round( numLow * (float)Math.pow(10.0f, (float) diffInQuality / 10.0f) ); // The color with higher quality is exponentially more likely final int numHigh = Math.round(numLow * (float) Math.pow(10.0f, (float) diffInQuality / 10.0f)); // The color with higher quality is exponentially more likely
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt( numLow + numHigh ); final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt(numLow + numHigh);
if( rand >= numLow ) { // higher q score won if (rand >= numLow) { // higher q score won
if( maxQuality == (int)colorSpaceQuals[jjj] ) { if (maxQuality == (int) colorSpaceQuals[jjj]) {
readBases[jjj] = colorImpliedBases[jjj]; readBases[jjj] = colorImpliedBases[jjj];
} // else ref color had higher q score, and won out, so nothing to do here } // else ref color had higher q score, and won out, so nothing to do here
} else { // lower q score won }
if( minQuality == (int)colorSpaceQuals[jjj] ) { else { // lower q score won
if (minQuality == (int) colorSpaceQuals[jjj]) {
readBases[jjj] = colorImpliedBases[jjj]; readBases[jjj] = colorImpliedBases[jjj];
} // else ref color had lower q score, and won out, so nothing to do here } // else ref color had lower q score, and won out, so nothing to do here
} }
@ -494,52 +520,56 @@ public class RecalDataManager {
} }
} }
if( read.getReadNegativeStrandFlag() ) { if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement( readBases.clone() ); // Put the bases back in reverse order to stuff them back in the read readBases = BaseUtils.simpleReverseComplement(readBases.clone()); // Put the bases back in reverse order to stuff them back in the read
} }
read.setReadBases( readBases ); read.setReadBases(readBases);
} else { // No color space quality tag in file }
else { // No color space quality tag in file
throw new UserException.MalformedBAM(read, "REMOVE_REF_BIAS recal mode requires color space qualities but they can't be found for read: " + read.getReadName()); throw new UserException.MalformedBAM(read, "REMOVE_REF_BIAS recal mode requires color space qualities but they can't be found for read: " + read.getReadName());
} }
} }
/** /**
* Given the base and the color calculate the next base in the sequence * Given the base and the color calculate the next base in the sequence
*
* @param prevBase The base * @param prevBase The base
* @param color The color * @param color The color
* @return The next base in the sequence * @return The next base in the sequence
*/ */
private static byte getNextBaseFromColor( SAMRecord read, final byte prevBase, final byte color ) { private static byte getNextBaseFromColor(GATKSAMRecord read, final byte prevBase, final byte color) {
switch(color) { switch (color) {
case '0': case '0':
return prevBase; return prevBase;
case '1': case '1':
return performColorOne( prevBase ); return performColorOne(prevBase);
case '2': case '2':
return performColorTwo( prevBase ); return performColorTwo(prevBase);
case '3': case '3':
return performColorThree( prevBase ); return performColorThree(prevBase);
default: default:
throw new UserException.MalformedBAM(read, "Unrecognized color space in SOLID read, color = " + (char)color + throw new UserException.MalformedBAM(read, "Unrecognized color space in SOLID read, color = " + (char) color +
" Unfortunately this bam file can not be recalibrated without full color space information because of potential reference bias."); " Unfortunately this bam file can not be recalibrated without full color space information because of potential reference bias.");
} }
} }
/** /**
* Check if this base is inconsistent with its color space. If it is then SOLID inserted the reference here and we should reduce the quality * Check if this base is inconsistent with its color space. If it is then SOLID inserted the reference here and we should reduce the quality
* @param read The read which contains the color space to check against *
* @param read The read which contains the color space to check against
* @param offset The offset in the read at which to check * @param offset The offset in the read at which to check
* @return Returns true if the base was inconsistent with the color space * @return Returns true if the base was inconsistent with the color space
*/ */
public static boolean isInconsistentColorSpace( final SAMRecord read, final int offset ) { public static boolean isInconsistentColorSpace(final GATKSAMRecord read, final int offset) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG); final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG);
if( attr != null ) { if (attr != null) {
final byte[] inconsistency = (byte[])attr; final byte[] inconsistency = (byte[]) attr;
// NOTE: The inconsistency array is in the direction of the read, not aligned to the reference! // NOTE: The inconsistency array is in the direction of the read, not aligned to the reference!
if( read.getReadNegativeStrandFlag() ) { // Negative direction if (read.getReadNegativeStrandFlag()) { // Negative direction
return inconsistency[inconsistency.length - offset - 1] != (byte)0; return inconsistency[inconsistency.length - offset - 1] != (byte) 0;
} else { // Forward direction }
return inconsistency[offset] != (byte)0; else { // Forward direction
return inconsistency[offset] != (byte) 0;
} }
// This block of code is for if you want to check both the offset and the next base for color space inconsistency // This block of code is for if you want to check both the offset and the next base for color space inconsistency
@ -557,7 +587,8 @@ public class RecalDataManager {
// } // }
//} //}
} else { // No inconsistency array, so nothing is inconsistent }
else { // No inconsistency array, so nothing is inconsistent
return false; return false;
} }
} }
@ -566,36 +597,31 @@ public class RecalDataManager {
* Computes all requested covariates for every offset in the given read * Computes all requested covariates for every offset in the given read
* by calling covariate.getValues(..). * by calling covariate.getValues(..).
* *
* @param gatkRead The read for which to compute covariate values. * @param gatkRead The read for which to compute covariate values.
* @param requestedCovariates The list of requested covariates. * @param requestedCovariates The list of requested covariates.
* @return An array of covariate values where result[i][j] is the covariate * @return An array of covariate values where result[i][j] is the covariate
* value for the ith position in the read and the jth covariate in * value for the ith position in the read and the jth covariate in
* reqeustedCovariates list. * reqeustedCovariates list.
*/ */
public static Comparable[][] computeCovariates(final GATKSAMRecord gatkRead, final List<Covariate> requestedCovariates) { public static Comparable[][] computeCovariates(final GATKSAMRecord gatkRead, final List<Covariate> requestedCovariates) {
//compute all covariates for this read //compute all covariates for this read
final List<Covariate> requestedCovariatesRef = requestedCovariates; final int numRequestedCovariates = requestedCovariates.size();
final int numRequestedCovariates = requestedCovariatesRef.size(); final int readLength = gatkRead.getReadLength();
final int readLength = gatkRead.getReadLength();
final Comparable[][] covariateValues_offset_x_covar = new Comparable[readLength][numRequestedCovariates]; final Comparable[][] covariateValues_offset_x_covar = new Comparable[readLength][numRequestedCovariates];
final Comparable[] tempCovariateValuesHolder = new Comparable[readLength]; final Comparable[] tempCovariateValuesHolder = new Comparable[readLength];
// Loop through the list of requested covariates and compute the values of each covariate for all positions in this read for (int i = 0; i < numRequestedCovariates; i++) { // Loop through the list of requested covariates and compute the values of each covariate for all positions in this read
for( int i = 0; i < numRequestedCovariates; i++ ) { requestedCovariates.get(i).getValues(gatkRead, tempCovariateValuesHolder);
requestedCovariatesRef.get(i).getValues( gatkRead, tempCovariateValuesHolder ); for (int j = 0; j < readLength; j++)
for(int j = 0; j < readLength; j++) { covariateValues_offset_x_covar[j][i] = tempCovariateValuesHolder[j]; // copy values into a 2D array that allows all covar types to be extracted at once for an offset j by doing covariateValues_offset_x_covar[j]. This avoids the need to later iterate over covar types.
//copy values into a 2D array that allows all covar types to be extracted at once for }
//an offset j by doing covariateValues_offset_x_covar[j]. This avoids the need to later iterate over covar types.
covariateValues_offset_x_covar[j][i] = tempCovariateValuesHolder[j];
}
}
return covariateValues_offset_x_covar; return covariateValues_offset_x_covar;
} }
/** /**
* Perform a ceratin transversion (A <-> C or G <-> T) on the base. * Perform a certain transversion (A <-> C or G <-> T) on the base.
* *
* @param base the base [AaCcGgTt] * @param base the base [AaCcGgTt]
* @return the transversion of the base, or the input base if it's not one of the understood ones * @return the transversion of the base, or the input base if it's not one of the understood ones
@ -603,14 +629,19 @@ public class RecalDataManager {
private static byte performColorOne(byte base) { private static byte performColorOne(byte base) {
switch (base) { switch (base) {
case 'A': case 'A':
case 'a': return 'C'; case 'a':
return 'C';
case 'C': case 'C':
case 'c': return 'A'; case 'c':
return 'A';
case 'G': case 'G':
case 'g': return 'T'; case 'g':
return 'T';
case 'T': case 'T':
case 't': return 'G'; case 't':
default: return base; return 'G';
default:
return base;
} }
} }
@ -623,14 +654,19 @@ public class RecalDataManager {
private static byte performColorTwo(byte base) { private static byte performColorTwo(byte base) {
switch (base) { switch (base) {
case 'A': case 'A':
case 'a': return 'G'; case 'a':
return 'G';
case 'C': case 'C':
case 'c': return 'T'; case 'c':
return 'T';
case 'G': case 'G':
case 'g': return 'A'; case 'g':
return 'A';
case 'T': case 'T':
case 't': return 'C'; case 't':
default: return base; return 'C';
default:
return base;
} }
} }
@ -643,14 +679,19 @@ public class RecalDataManager {
private static byte performColorThree(byte base) { private static byte performColorThree(byte base) {
switch (base) { switch (base) {
case 'A': case 'A':
case 'a': return 'T'; case 'a':
return 'T';
case 'C': case 'C':
case 'c': return 'G'; case 'c':
return 'G';
case 'G': case 'G':
case 'g': return 'C'; case 'g':
return 'C';
case 'T': case 'T':
case 't': return 'A'; case 't':
default: return base; return 'A';
default:
return base;
} }
} }
} }

View File

@ -43,36 +43,20 @@ public class RecalibrationArgumentCollection {
// Shared Command Line Arguments // Shared Command Line Arguments
////////////////////////////////// //////////////////////////////////
@Hidden @Hidden
@Argument(fullName="default_read_group", shortName="dRG", required=false, doc="If a read has no read group then default to the provided String.") @Argument(fullName = "default_platform", shortName = "dP", required = false, doc = "If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.")
public String DEFAULT_READ_GROUP = null;
@Hidden
@Argument(fullName="default_platform", shortName="dP", required=false, doc="If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.")
public String DEFAULT_PLATFORM = null; public String DEFAULT_PLATFORM = null;
@Hidden @Hidden
@Argument(fullName="force_read_group", shortName="fRG", required=false, doc="If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group.") @Argument(fullName = "force_platform", shortName = "fP", required = false, doc = "If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.")
public String FORCE_READ_GROUP = null;
@Hidden
@Argument(fullName="force_platform", shortName="fP", required=false, doc="If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.")
public String FORCE_PLATFORM = null; public String FORCE_PLATFORM = null;
@Hidden @Hidden
@Argument(fullName = "window_size_nqs", shortName="nqs", doc="The window size used by MinimumNQSCovariate for its calculation", required=false) @Argument(fullName = "window_size_nqs", shortName = "nqs", doc = "The window size used by MinimumNQSCovariate for its calculation", required = false)
public int WINDOW_SIZE = 5; public int WINDOW_SIZE = 5;
/**
* This window size tells the module in how big of a neighborhood around the current base it should look for the minimum base quality score.
*/
@Hidden
@Argument(fullName = "homopolymer_nback", shortName="nback", doc="The number of previous bases to look at in HomopolymerCovariate", required=false)
public int HOMOPOLYMER_NBACK = 7;
@Hidden
@Argument(fullName = "exception_if_no_tile", shortName="throwTileException", doc="If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1", required=false)
public boolean EXCEPTION_IF_NO_TILE = false;
/** /**
* CountCovariates and TableRecalibration accept a --solid_recal_mode <MODE> flag which governs how the recalibrator handles the * CountCovariates and TableRecalibration accept a --solid_recal_mode <MODE> flag which governs how the recalibrator handles the
* reads which have had the reference inserted because of color space inconsistencies. * reads which have had the reference inserted because of color space inconsistencies.
*/ */
@Argument(fullName="solid_recal_mode", shortName="sMode", required = false, doc="How should we recalibrate solid bases in which the reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS") @Argument(fullName = "solid_recal_mode", shortName = "sMode", required = false, doc = "How should we recalibrate solid bases in which the reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS")
public RecalDataManager.SOLID_RECAL_MODE SOLID_RECAL_MODE = RecalDataManager.SOLID_RECAL_MODE.SET_Q_ZERO; public RecalDataManager.SOLID_RECAL_MODE SOLID_RECAL_MODE = RecalDataManager.SOLID_RECAL_MODE.SET_Q_ZERO;
/** /**
@ -80,6 +64,19 @@ public class RecalibrationArgumentCollection {
* no calls in the color space tag. Unfortunately because of the reference inserted bases mentioned above, reads with no calls in * no calls in the color space tag. Unfortunately because of the reference inserted bases mentioned above, reads with no calls in
* their color space tag can not be recalibrated. * their color space tag can not be recalibrated.
*/ */
@Argument(fullName = "solid_nocall_strategy", shortName="solid_nocall_strategy", doc="Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ", required=false) @Argument(fullName = "solid_nocall_strategy", shortName = "solid_nocall_strategy", doc = "Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ", required = false)
public RecalDataManager.SOLID_NOCALL_STRATEGY SOLID_NOCALL_STRATEGY = RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION; public RecalDataManager.SOLID_NOCALL_STRATEGY SOLID_NOCALL_STRATEGY = RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION;
/**
* The context covariate will use a context of this size to calculate it's covariate value
*/
@Argument(fullName = "context_size", shortName = "cs", doc = "size of the k-mer context to be used", required = false)
public int CONTEXT_SIZE = 8;
/**
* This window size tells the module in how big of a neighborhood around the current base it should look for the minimum base quality score.
*/
@Argument(fullName = "homopolymer_nback", shortName = "nback", doc = "The number of previous bases to look at in HomopolymerCovariate", required = false)
public int HOMOPOLYMER_NBACK = 7;
} }

View File

@ -39,6 +39,7 @@ import org.broadinstitute.sting.utils.classloader.PluginManager;
import org.broadinstitute.sting.utils.collections.NestedHashMap; import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException; import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.text.TextFormattingUtils; import org.broadinstitute.sting.utils.text.TextFormattingUtils;
import org.broadinstitute.sting.utils.text.XReadLines; import org.broadinstitute.sting.utils.text.XReadLines;
@ -85,12 +86,12 @@ import java.util.regex.Pattern;
* -o my_reads.recal.bam \ * -o my_reads.recal.bam \
* -recalFile my_reads.recal_data.csv * -recalFile my_reads.recal_data.csv
* </pre> * </pre>
*
*/ */
@BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_OUTPUT) @BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_OUTPUT)
@WalkerName("TableRecalibration") @WalkerName("TableRecalibration")
@Requires({ DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES }) // This walker requires -I input.bam, it also requires -R reference.fasta @Requires({DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES})
// This walker requires -I input.bam, it also requires -R reference.fasta
public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWriter> { public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWriter> {
public static final String PROGRAM_RECORD_NAME = "GATK TableRecalibration"; public static final String PROGRAM_RECORD_NAME = "GATK TableRecalibration";
@ -98,7 +99,8 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
///////////////////////////// /////////////////////////////
// Shared Arguments // Shared Arguments
///////////////////////////// /////////////////////////////
@ArgumentCollection private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection(); @ArgumentCollection
private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
///////////////////////////// /////////////////////////////
// Command Line Arguments // Command Line Arguments
@ -109,12 +111,12 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches, * three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate. * and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/ */
@Input(fullName="recal_file", shortName="recalFile", required=true, doc="Filename for the input covariates table recalibration .csv file") @Input(fullName = "recal_file", shortName = "recalFile", required = true, doc = "Filename for the input covariates table recalibration .csv file")
public File RECAL_FILE = null; public File RECAL_FILE = null;
/** /**
* A new bam file in which the quality scores in each read have been recalibrated. The alignment of the reads is left untouched. * A new bam file in which the quality scores in each read have been recalibrated. The alignment of the reads is left untouched.
*/ */
@Output(doc="The output recalibrated BAM file", required=true) @Output(doc = "The output recalibrated BAM file", required = true)
private StingSAMFileWriter OUTPUT_BAM = null; private StingSAMFileWriter OUTPUT_BAM = null;
/** /**
@ -125,7 +127,7 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* your Q2 and Q3 bins can be elevated to Q8 or Q10, leading to issues downstream. With the default value of 5, all Q0-Q4 bases * your Q2 and Q3 bins can be elevated to Q8 or Q10, leading to issues downstream. With the default value of 5, all Q0-Q4 bases
* are unmodified during recalibration, so they don't get inappropriately evaluated. * are unmodified during recalibration, so they don't get inappropriately evaluated.
*/ */
@Argument(fullName="preserve_qscores_less_than", shortName="pQ", doc="Bases with quality scores less than this threshold won't be recalibrated. In general it's unsafe to change qualities scores below < 5, since base callers use these values to indicate random or bad bases", required=false) @Argument(fullName = "preserve_qscores_less_than", shortName = "pQ", doc = "Bases with quality scores less than this threshold won't be recalibrated. In general it's unsafe to change qualities scores below < 5, since base callers use these values to indicate random or bad bases", required = false)
private int PRESERVE_QSCORES_LESS_THAN = 5; private int PRESERVE_QSCORES_LESS_THAN = 5;
/** /**
@ -134,37 +136,36 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* argument which sets how many unobserved counts to add to every bin. Use --smoothing 0 to turn off all smoothing or, for example, * argument which sets how many unobserved counts to add to every bin. Use --smoothing 0 to turn off all smoothing or, for example,
* --smoothing 15 for a large amount of smoothing. * --smoothing 15 for a large amount of smoothing.
*/ */
@Argument(fullName="smoothing", shortName="sm", required = false, doc="Number of imaginary counts to add to each bin in order to smooth out bins with few data points") @Argument(fullName = "smoothing", shortName = "sm", required = false, doc = "Number of imaginary counts to add to each bin in order to smooth out bins with few data points")
private int SMOOTHING = 1; private int SMOOTHING = 1;
/** /**
* Combinations of covariates in which there are zero mismatches technically have infinite quality. We get around this situation * Combinations of covariates in which there are zero mismatches technically have infinite quality. We get around this situation
* by capping at the specified value. We've found that Q40 is too low when using a more completely database of known variation like dbSNP build 132 or later. * by capping at the specified value. We've found that Q40 is too low when using a more completely database of known variation like dbSNP build 132 or later.
*/ */
@Argument(fullName="max_quality_score", shortName="maxQ", required = false, doc="The integer value at which to cap the quality scores") @Argument(fullName = "max_quality_score", shortName = "maxQ", required = false, doc = "The integer value at which to cap the quality scores")
private int MAX_QUALITY_SCORE = 50; private int MAX_QUALITY_SCORE = 50;
/** /**
* By default TableRecalibration emits the OQ field -- so you can go back and look at the original quality scores, rerun * By default TableRecalibration emits the OQ field -- so you can go back and look at the original quality scores, rerun
* the system using the OQ flags, etc, on the output BAM files; to turn off emission of the OQ field use this flag. * the system using the OQ flags, etc, on the output BAM files; to turn off emission of the OQ field use this flag.
*/ */
@Argument(fullName="doNotWriteOriginalQuals", shortName="noOQs", required=false, doc="If true, we will not write the original quality (OQ) tag for each read") @Argument(fullName = "doNotWriteOriginalQuals", shortName = "noOQs", required = false, doc = "If true, we will not write the original quality (OQ) tag for each read")
private boolean DO_NOT_WRITE_OQ = false; private boolean DO_NOT_WRITE_OQ = false;
///////////////////////////// /////////////////////////////
// Debugging-only Arguments // Debugging-only Arguments
///////////////////////////// /////////////////////////////
@Hidden @Hidden
@Argument(fullName="no_pg_tag", shortName="noPG", required=false, doc="Don't output the usual PG tag in the recalibrated bam file header. FOR DEBUGGING PURPOSES ONLY. This option is required in order to pass integration tests.") @Argument(fullName = "no_pg_tag", shortName = "noPG", required = false, doc = "Don't output the usual PG tag in the recalibrated bam file header. FOR DEBUGGING PURPOSES ONLY. This option is required in order to pass integration tests.")
private boolean NO_PG_TAG = false; private boolean NO_PG_TAG = false;
@Hidden @Hidden
@Argument(fullName="fail_with_no_eof_marker", shortName="requireEOF", required=false, doc="If no EOF marker is present in the covariates file, exit the program with an exception.") @Argument(fullName = "fail_with_no_eof_marker", shortName = "requireEOF", required = false, doc = "If no EOF marker is present in the covariates file, exit the program with an exception.")
private boolean REQUIRE_EOF = false; private boolean REQUIRE_EOF = false;
@Hidden @Hidden
@Argument(fullName="skipUQUpdate", shortName="skipUQUpdate", required=false, doc="If true, we will skip the UQ updating step for each read, speeding up the calculations") @Argument(fullName = "skipUQUpdate", shortName = "skipUQUpdate", required = false, doc = "If true, we will skip the UQ updating step for each read, speeding up the calculations")
private boolean skipUQUpdate = false; private boolean skipUQUpdate = false;
///////////////////////////// /////////////////////////////
// Private Member Variables // Private Member Variables
///////////////////////////// /////////////////////////////
@ -181,7 +182,6 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
///////////////////////////// /////////////////////////////
private NestedHashMap qualityScoreByFullCovariateKey = new NestedHashMap(); // Caches the result of performSequentialQualityCalculation(..) for all sets of covariate values. private NestedHashMap qualityScoreByFullCovariateKey = new NestedHashMap(); // Caches the result of performSequentialQualityCalculation(..) for all sets of covariate values.
//--------------------------------------------------------------------------------------------------------------- //---------------------------------------------------------------------------------------------------------------
// //
// initialize // initialize
@ -195,8 +195,9 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
*/ */
public void initialize() { public void initialize() {
if( RAC.FORCE_READ_GROUP != null ) { RAC.DEFAULT_READ_GROUP = RAC.FORCE_READ_GROUP; } if (RAC.FORCE_PLATFORM != null) {
if( RAC.FORCE_PLATFORM != null ) { RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM; } RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM;
}
// Get a list of all available covariates // Get a list of all available covariates
final List<Class<? extends Covariate>> classes = new PluginManager<Covariate>(Covariate.class).getPlugins(); final List<Class<? extends Covariate>> classes = new PluginManager<Covariate>(Covariate.class).getPlugins();
@ -205,31 +206,33 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
boolean foundAllCovariates = false; boolean foundAllCovariates = false;
// Read in the data from the csv file and populate the data map and covariates list // Read in the data from the csv file and populate the data map and covariates list
logger.info( "Reading in the data from input csv file..." ); logger.info("Reading in the data from input csv file...");
boolean sawEOF = false; boolean sawEOF = false;
try { try {
for ( String line : new XReadLines(RECAL_FILE) ) { for (String line : new XReadLines(RECAL_FILE)) {
lineNumber++; lineNumber++;
if ( EOF_MARKER.equals(line) ) { if (EOF_MARKER.equals(line)) {
sawEOF = true; sawEOF = true;
} else if( COMMENT_PATTERN.matcher(line).matches() || OLD_RECALIBRATOR_HEADER.matcher(line).matches() ) { }
else if (COMMENT_PATTERN.matcher(line).matches() || OLD_RECALIBRATOR_HEADER.matcher(line).matches()) {
; // Skip over the comment lines, (which start with '#') ; // Skip over the comment lines, (which start with '#')
} }
// Read in the covariates that were used from the input file // Read in the covariates that were used from the input file
else if( COVARIATE_PATTERN.matcher(line).matches() ) { // The line string is either specifying a covariate or is giving csv data else if (COVARIATE_PATTERN.matcher(line).matches()) { // The line string is either specifying a covariate or is giving csv data
if( foundAllCovariates ) { if (foundAllCovariates) {
throw new UserException.MalformedFile( RECAL_FILE, "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE ); throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE);
} else { // Found the covariate list in input file, loop through all of them and instantiate them }
else { // Found the covariate list in input file, loop through all of them and instantiate them
String[] vals = line.split(","); String[] vals = line.split(",");
for( int iii = 0; iii < vals.length - 3; iii++ ) { // There are n-3 covariates. The last three items are nObservations, nMismatch, and Qempirical for (int iii = 0; iii < vals.length - 3; iii++) { // There are n-3 covariates. The last three items are nObservations, nMismatch, and Qempirical
boolean foundClass = false; boolean foundClass = false;
for( Class<?> covClass : classes ) { for (Class<?> covClass : classes) {
if( (vals[iii] + "Covariate").equalsIgnoreCase( covClass.getSimpleName() ) ) { if ((vals[iii] + "Covariate").equalsIgnoreCase(covClass.getSimpleName())) {
foundClass = true; foundClass = true;
try { try {
Covariate covariate = (Covariate)covClass.newInstance(); Covariate covariate = (Covariate) covClass.newInstance();
requestedCovariates.add( covariate ); requestedCovariates.add(covariate);
} catch (Exception e) { } catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e); throw new DynamicClassResolutionException(covClass, e);
} }
@ -237,107 +240,110 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
} }
} }
if( !foundClass ) { if (!foundClass) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option." ); throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option.");
} }
} }
} }
} else { // Found a line of data }
if( !foundAllCovariates ) { else { // Found a line of data
if (!foundAllCovariates) {
foundAllCovariates = true; foundAllCovariates = true;
// At this point all the covariates should have been found and initialized // At this point all the covariates should have been found and initialized
if( requestedCovariates.size() < 2 ) { if (requestedCovariates.size() < 2) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration csv file. Covariate names can't be found in file: " + RECAL_FILE ); throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration csv file. Covariate names can't be found in file: " + RECAL_FILE);
} }
final boolean createCollapsedTables = true; final boolean createCollapsedTables = true;
// Initialize any covariate member variables using the shared argument collection // Initialize any covariate member variables using the shared argument collection
for( Covariate cov : requestedCovariates ) { for (Covariate cov : requestedCovariates) {
cov.initialize( RAC ); cov.initialize(RAC);
} }
// Initialize the data hashMaps // Initialize the data hashMaps
dataManager = new RecalDataManager( createCollapsedTables, requestedCovariates.size() ); dataManager = new RecalDataManager(createCollapsedTables, requestedCovariates.size());
} }
addCSVData(RECAL_FILE, line); // Parse the line and add the data to the HashMap addCSVData(RECAL_FILE, line); // Parse the line and add the data to the HashMap
} }
} }
} catch ( FileNotFoundException e ) { } catch (FileNotFoundException e) {
throw new UserException.CouldNotReadInputFile(RECAL_FILE, "Can not find input file", e); throw new UserException.CouldNotReadInputFile(RECAL_FILE, "Can not find input file", e);
} catch ( NumberFormatException e ) { } catch (NumberFormatException e) {
throw new UserException.MalformedFile(RECAL_FILE, "Error parsing recalibration data at line " + lineNumber + ". Perhaps your table was generated by an older version of CovariateCounterWalker."); throw new UserException.MalformedFile(RECAL_FILE, "Error parsing recalibration data at line " + lineNumber + ". Perhaps your table was generated by an older version of CovariateCounterWalker.");
} }
logger.info( "...done!" ); logger.info("...done!");
if ( !sawEOF ) { if (!sawEOF) {
final String errorMessage = "No EOF marker was present in the recal covariates table; this could mean that the file is corrupted or was generated with an old version of the CountCovariates tool."; final String errorMessage = "No EOF marker was present in the recal covariates table; this could mean that the file is corrupted or was generated with an old version of the CountCovariates tool.";
if ( REQUIRE_EOF ) if (REQUIRE_EOF)
throw new UserException.MalformedFile(RECAL_FILE, errorMessage); throw new UserException.MalformedFile(RECAL_FILE, errorMessage);
logger.warn(errorMessage); logger.warn(errorMessage);
} }
logger.info( "The covariates being used here: " ); logger.info("The covariates being used here: ");
for( Covariate cov : requestedCovariates ) { for (Covariate cov : requestedCovariates) {
logger.info( "\t" + cov.getClass().getSimpleName() ); logger.info("\t" + cov.getClass().getSimpleName());
} }
if( dataManager == null ) { if (dataManager == null) {
throw new UserException.MalformedFile(RECAL_FILE, "Can't initialize the data manager. Perhaps the recal csv file contains no data?"); throw new UserException.MalformedFile(RECAL_FILE, "Can't initialize the data manager. Perhaps the recal csv file contains no data?");
} }
// Create the tables of empirical quality scores that will be used in the sequential calculation // Create the tables of empirical quality scores that will be used in the sequential calculation
logger.info( "Generating tables of empirical qualities for use in sequential calculation..." ); logger.info("Generating tables of empirical qualities for use in sequential calculation...");
dataManager.generateEmpiricalQualities( SMOOTHING, MAX_QUALITY_SCORE ); dataManager.generateEmpiricalQualities(SMOOTHING, MAX_QUALITY_SCORE);
logger.info( "...done!" ); logger.info("...done!");
// Take the header of the input SAM file and tweak it by adding in a new programRecord with the version number and list of covariates that were used // Take the header of the input SAM file and tweak it by adding in a new programRecord with the version number and list of covariates that were used
final SAMFileHeader header = getToolkit().getSAMFileHeader().clone(); final SAMFileHeader header = getToolkit().getSAMFileHeader().clone();
if( !NO_PG_TAG ) { if (!NO_PG_TAG) {
final SAMProgramRecord programRecord = new SAMProgramRecord(PROGRAM_RECORD_NAME); final SAMProgramRecord programRecord = new SAMProgramRecord(PROGRAM_RECORD_NAME);
final ResourceBundle headerInfo = TextFormattingUtils.loadResourceBundle("StingText"); final ResourceBundle headerInfo = TextFormattingUtils.loadResourceBundle("StingText");
try { try {
final String version = headerInfo.getString("org.broadinstitute.sting.gatk.version"); final String version = headerInfo.getString("org.broadinstitute.sting.gatk.version");
programRecord.setProgramVersion(version); programRecord.setProgramVersion(version);
} catch (MissingResourceException e) {} } catch (MissingResourceException e) {
}
StringBuffer sb = new StringBuffer(); StringBuffer sb = new StringBuffer();
sb.append(getToolkit().createApproximateCommandLineArgumentString(getToolkit(), this)); sb.append(getToolkit().createApproximateCommandLineArgumentString(getToolkit(), this));
sb.append(" Covariates=["); sb.append(" Covariates=[");
for( Covariate cov : requestedCovariates ) { for (Covariate cov : requestedCovariates) {
sb.append(cov.getClass().getSimpleName()); sb.append(cov.getClass().getSimpleName());
sb.append(", "); sb.append(", ");
} }
sb.setCharAt(sb.length()-2, ']'); sb.setCharAt(sb.length() - 2, ']');
sb.setCharAt(sb.length()-1, ' '); sb.setCharAt(sb.length() - 1, ' ');
programRecord.setCommandLine(sb.toString()); programRecord.setCommandLine(sb.toString());
List<SAMProgramRecord> oldRecords = header.getProgramRecords(); List<SAMProgramRecord> oldRecords = header.getProgramRecords();
List<SAMProgramRecord> newRecords = new ArrayList<SAMProgramRecord>(oldRecords.size()+1); List<SAMProgramRecord> newRecords = new ArrayList<SAMProgramRecord>(oldRecords.size() + 1);
for ( SAMProgramRecord record : oldRecords ) { for (SAMProgramRecord record : oldRecords) {
if ( !record.getId().startsWith(PROGRAM_RECORD_NAME) ) if (!record.getId().startsWith(PROGRAM_RECORD_NAME))
newRecords.add(record); newRecords.add(record);
} }
newRecords.add(programRecord); newRecords.add(programRecord);
header.setProgramRecords(newRecords); header.setProgramRecords(newRecords);
// Write out the new header // Write out the new header
OUTPUT_BAM.writeHeader( header ); OUTPUT_BAM.writeHeader(header);
} }
} }
/** /**
* For each covariate read in a value and parse it. Associate those values with the data itself (num observation and num mismatches) * For each covariate read in a value and parse it. Associate those values with the data itself (num observation and num mismatches)
*
* @param line A line of CSV data read from the recalibration table data file * @param line A line of CSV data read from the recalibration table data file
*/ */
private void addCSVData(final File file, final String line) { private void addCSVData(final File file, final String line) {
final String[] vals = line.split(","); final String[] vals = line.split(",");
// Check if the data line is malformed, for example if the read group string contains a comma then it won't be parsed correctly // Check if the data line is malformed, for example if the read group string contains a comma then it won't be parsed correctly
if( vals.length != requestedCovariates.size() + 3 ) { // +3 because of nObservations, nMismatch, and Qempirical if (vals.length != requestedCovariates.size() + 3) { // +3 because of nObservations, nMismatch, and Qempirical
throw new UserException.MalformedFile(file, "Malformed input recalibration file. Found data line with too many fields: " + line + throw new UserException.MalformedFile(file, "Malformed input recalibration file. Found data line with too many fields: " + line +
" --Perhaps the read group string contains a comma and isn't being parsed correctly."); " --Perhaps the read group string contains a comma and isn't being parsed correctly.");
} }
@ -345,15 +351,15 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
final Object[] key = new Object[requestedCovariates.size()]; final Object[] key = new Object[requestedCovariates.size()];
Covariate cov; Covariate cov;
int iii; int iii;
for( iii = 0; iii < requestedCovariates.size(); iii++ ) { for (iii = 0; iii < requestedCovariates.size(); iii++) {
cov = requestedCovariates.get( iii ); cov = requestedCovariates.get(iii);
key[iii] = cov.getValue( vals[iii] ); key[iii] = cov.getValue(vals[iii]);
} }
// Create a new datum using the number of observations, number of mismatches, and reported quality score // Create a new datum using the number of observations, number of mismatches, and reported quality score
final RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 ); final RecalDatum datum = new RecalDatum(Long.parseLong(vals[iii]), Long.parseLong(vals[iii + 1]), Double.parseDouble(vals[1]), 0.0);
// Add that datum to all the collapsed tables which will be used in the sequential calculation // Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, PRESERVE_QSCORES_LESS_THAN ); dataManager.addToAllTables(key, datum, PRESERVE_QSCORES_LESS_THAN);
} }
//--------------------------------------------------------------------------------------------------------------- //---------------------------------------------------------------------------------------------------------------
@ -366,64 +372,63 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* For each base in the read calculate a new recalibrated quality score and replace the quality scores in the read * For each base in the read calculate a new recalibrated quality score and replace the quality scores in the read
* *
* @param refBases References bases over the length of the read * @param refBases References bases over the length of the read
* @param read The read to be recalibrated * @param read The read to be recalibrated
* @return The read with quality scores replaced * @return The read with quality scores replaced
*/ */
public SAMRecord map( ReferenceContext refBases, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker ) { public SAMRecord map(ReferenceContext refBases, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker) {
if( read.getReadLength() == 0 ) { // Some reads have '*' as the SEQ field and samtools returns length zero. We don't touch these reads. if (read.getReadLength() == 0) { // Some reads have '*' as the SEQ field and samtools returns length zero. We don't touch these reads.
return read; return read;
} }
RecalDataManager.parseSAMRecord( read, RAC ); RecalDataManager.parseSAMRecord(read, RAC);
byte[] originalQuals = read.getBaseQualities(); byte[] originalQuals = read.getBaseQualities();
final byte[] recalQuals = originalQuals.clone(); final byte[] recalQuals = originalQuals.clone();
final String platform = read.getReadGroup().getPlatform(); final String platform = read.getReadGroup().getPlatform();
if( platform.toUpperCase().contains("SOLID") && !(RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING) ) { if (platform.toUpperCase().contains("SOLID") && !(RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING)) {
if( !(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) ) { if (!(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION)) {
final boolean badColor = RecalDataManager.checkNoCallColorSpace( read ); final boolean badColor = RecalDataManager.checkNoCallColorSpace(read);
if( badColor ) { if (badColor) {
numReadsWithMalformedColorSpace++; numReadsWithMalformedColorSpace++;
if( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED ) { if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED) {
return read; // can't recalibrate a SOLiD read with no calls in the color space, and the user wants to skip over them return read; // can't recalibrate a SOLiD read with no calls in the color space, and the user wants to skip over them
} else if ( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ ) { }
else if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ) {
read.setReadFailsVendorQualityCheckFlag(true); read.setReadFailsVendorQualityCheckFlag(true);
return read; return read;
} }
} }
} }
originalQuals = RecalDataManager.calcColorSpace( read, originalQuals, RAC.SOLID_RECAL_MODE, refBases == null ? null : refBases.getBases() ); originalQuals = RecalDataManager.calcColorSpace(read, originalQuals, RAC.SOLID_RECAL_MODE, refBases == null ? null : refBases.getBases());
} }
//compute all covariate values for this read //compute all covariate values for this read
final Comparable[][] covariateValues_offset_x_covar = final Comparable[][] covariateValues_offset_x_covar = RecalDataManager.computeCovariates(read, requestedCovariates);
RecalDataManager.computeCovariates((GATKSAMRecord) read, requestedCovariates);
// For each base in the read // For each base in the read
for( int offset = 0; offset < read.getReadLength(); offset++ ) { for (int offset = 0; offset < read.getReadLength(); offset++) {
final Object[] fullCovariateKey = covariateValues_offset_x_covar[offset]; final Object[] fullCovariateKey = covariateValues_offset_x_covar[offset];
Byte qualityScore = (Byte) qualityScoreByFullCovariateKey.get(fullCovariateKey); Byte qualityScore = (Byte) qualityScoreByFullCovariateKey.get(fullCovariateKey);
if(qualityScore == null) if (qualityScore == null) {
{ qualityScore = performSequentialQualityCalculation(fullCovariateKey);
qualityScore = performSequentialQualityCalculation( fullCovariateKey );
qualityScoreByFullCovariateKey.put(qualityScore, fullCovariateKey); qualityScoreByFullCovariateKey.put(qualityScore, fullCovariateKey);
} }
recalQuals[offset] = qualityScore; recalQuals[offset] = qualityScore;
} }
preserveQScores( originalQuals, recalQuals ); // Overwrite the work done if original quality score is too low preserveQScores(originalQuals, recalQuals); // Overwrite the work done if original quality score is too low
read.setBaseQualities( recalQuals ); // Overwrite old qualities with new recalibrated qualities read.setBaseQualities(recalQuals); // Overwrite old qualities with new recalibrated qualities
if ( !DO_NOT_WRITE_OQ && read.getAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG) == null ) { // Save the old qualities if the tag isn't already taken in the read if (!DO_NOT_WRITE_OQ && read.getAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG) == null) { // Save the old qualities if the tag isn't already taken in the read
read.setAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG, SAMUtils.phredToFastq(originalQuals)); read.setAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG, SAMUtils.phredToFastq(originalQuals));
} }
if (! skipUQUpdate && refBases != null && read.getAttribute(SAMTag.UQ.name()) != null) { if (!skipUQUpdate && refBases != null && read.getAttribute(SAMTag.UQ.name()) != null) {
read.setAttribute(SAMTag.UQ.name(), SequenceUtil.sumQualitiesOfMismatches(read, refBases.getBases(), read.getAlignmentStart() - 1, false)); read.setAttribute(SAMTag.UQ.name(), SequenceUtil.sumQualitiesOfMismatches(read, refBases.getBases(), read.getAlignmentStart() - 1, false));
} }
@ -440,27 +445,28 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* *
* Given the full recalibration table, we perform the following preprocessing steps: * Given the full recalibration table, we perform the following preprocessing steps:
* *
* - calculate the global quality score shift across all data [DeltaQ] * - calculate the global quality score shift across all data [DeltaQ]
* - calculate for each of cycle and dinuc the shift of the quality scores relative to the global shift * - calculate for each of cycle and dinuc the shift of the quality scores relative to the global shift
* -- i.e., DeltaQ(dinuc) = Sum(pos) Sum(Qual) Qempirical(pos, qual, dinuc) - Qreported(pos, qual, dinuc) / Npos * Nqual * -- i.e., DeltaQ(dinuc) = Sum(pos) Sum(Qual) Qempirical(pos, qual, dinuc) - Qreported(pos, qual, dinuc) / Npos * Nqual
* - The final shift equation is: * - The final shift equation is:
*
* Qrecal = Qreported + DeltaQ + DeltaQ(pos) + DeltaQ(dinuc) + DeltaQ( ... any other covariate ... )
* *
* Qrecal = Qreported + DeltaQ + DeltaQ(pos) + DeltaQ(dinuc) + DeltaQ( ... any other covariate ... )
* @param key The list of Comparables that were calculated from the covariates * @param key The list of Comparables that were calculated from the covariates
* @return A recalibrated quality score as a byte * @return A recalibrated quality score as a byte
*/ */
private byte performSequentialQualityCalculation( final Object... key ) { private byte performSequentialQualityCalculation(final Object... key) {
final byte qualFromRead = (byte)Integer.parseInt(key[1].toString()); final byte qualFromRead = (byte) Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1]; final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2]; final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3]; final Object[] covariateCollapsedKey = new Object[3];
// The global quality shift (over the read group only) // The global quality shift (over the read group only)
readGroupCollapsedKey[0] = key[0]; readGroupCollapsedKey[0] = key[0];
final RecalDatum globalRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(0).get( readGroupCollapsedKey )); final RecalDatum globalRecalDatum = ((RecalDatum) dataManager.getCollapsedTable(0).get(readGroupCollapsedKey));
double globalDeltaQ = 0.0; double globalDeltaQ = 0.0;
if( globalRecalDatum != null ) { if (globalRecalDatum != null) {
final double globalDeltaQEmpirical = globalRecalDatum.getEmpiricalQuality(); final double globalDeltaQEmpirical = globalRecalDatum.getEmpiricalQuality();
final double aggregrateQReported = globalRecalDatum.getEstimatedQReported(); final double aggregrateQReported = globalRecalDatum.getEstimatedQReported();
globalDeltaQ = globalDeltaQEmpirical - aggregrateQReported; globalDeltaQ = globalDeltaQEmpirical - aggregrateQReported;
@ -469,9 +475,9 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
// The shift in quality between reported and empirical // The shift in quality between reported and empirical
qualityScoreCollapsedKey[0] = key[0]; qualityScoreCollapsedKey[0] = key[0];
qualityScoreCollapsedKey[1] = key[1]; qualityScoreCollapsedKey[1] = key[1];
final RecalDatum qReportedRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(1).get( qualityScoreCollapsedKey )); final RecalDatum qReportedRecalDatum = ((RecalDatum) dataManager.getCollapsedTable(1).get(qualityScoreCollapsedKey));
double deltaQReported = 0.0; double deltaQReported = 0.0;
if( qReportedRecalDatum != null ) { if (qReportedRecalDatum != null) {
final double deltaQReportedEmpirical = qReportedRecalDatum.getEmpiricalQuality(); final double deltaQReportedEmpirical = qReportedRecalDatum.getEmpiricalQuality();
deltaQReported = deltaQReportedEmpirical - qualFromRead - globalDeltaQ; deltaQReported = deltaQReportedEmpirical - qualFromRead - globalDeltaQ;
} }
@ -481,17 +487,17 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
double deltaQCovariateEmpirical; double deltaQCovariateEmpirical;
covariateCollapsedKey[0] = key[0]; covariateCollapsedKey[0] = key[0];
covariateCollapsedKey[1] = key[1]; covariateCollapsedKey[1] = key[1];
for( int iii = 2; iii < key.length; iii++ ) { for (int iii = 2; iii < key.length; iii++) {
covariateCollapsedKey[2] = key[iii]; // The given covariate covariateCollapsedKey[2] = key[iii]; // The given covariate
final RecalDatum covariateRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(iii).get( covariateCollapsedKey )); final RecalDatum covariateRecalDatum = ((RecalDatum) dataManager.getCollapsedTable(iii).get(covariateCollapsedKey));
if( covariateRecalDatum != null ) { if (covariateRecalDatum != null) {
deltaQCovariateEmpirical = covariateRecalDatum.getEmpiricalQuality(); deltaQCovariateEmpirical = covariateRecalDatum.getEmpiricalQuality();
deltaQCovariates += ( deltaQCovariateEmpirical - qualFromRead - (globalDeltaQ + deltaQReported) ); deltaQCovariates += (deltaQCovariateEmpirical - qualFromRead - (globalDeltaQ + deltaQReported));
} }
} }
final double newQuality = qualFromRead + globalDeltaQ + deltaQReported + deltaQCovariates; final double newQuality = qualFromRead + globalDeltaQ + deltaQReported + deltaQCovariates;
return QualityUtils.boundQual( (int)Math.round(newQuality), (byte)MAX_QUALITY_SCORE ); return QualityUtils.boundQual((int) Math.round(newQuality), (byte) MAX_QUALITY_SCORE);
// Verbose printouts used to validate with old recalibrator // Verbose printouts used to validate with old recalibrator
//if(key.contains(null)) { //if(key.contains(null)) {
@ -508,12 +514,13 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/** /**
* Loop over the list of qualities and overwrite the newly recalibrated score to be the original score if it was less than some threshold * Loop over the list of qualities and overwrite the newly recalibrated score to be the original score if it was less than some threshold
*
* @param originalQuals The list of original base quality scores * @param originalQuals The list of original base quality scores
* @param recalQuals A list of the new recalibrated quality scores * @param recalQuals A list of the new recalibrated quality scores
*/ */
private void preserveQScores( final byte[] originalQuals, final byte[] recalQuals ) { private void preserveQScores(final byte[] originalQuals, final byte[] recalQuals) {
for( int iii = 0; iii < recalQuals.length; iii++ ) { for (int iii = 0; iii < recalQuals.length; iii++) {
if( originalQuals[iii] < PRESERVE_QSCORES_LESS_THAN ) { if (originalQuals[iii] < PRESERVE_QSCORES_LESS_THAN) {
recalQuals[iii] = originalQuals[iii]; recalQuals[iii] = originalQuals[iii];
} }
} }
@ -527,6 +534,7 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/** /**
* Start the reduce with a handle to the output bam file * Start the reduce with a handle to the output bam file
*
* @return A FileWriter pointing to a new bam file * @return A FileWriter pointing to a new bam file
*/ */
public SAMFileWriter reduceInit() { public SAMFileWriter reduceInit() {
@ -535,12 +543,13 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/** /**
* Output each read to disk * Output each read to disk
* @param read The read to output *
* @param read The read to output
* @param output The FileWriter to write the read to * @param output The FileWriter to write the read to
* @return The FileWriter * @return The FileWriter
*/ */
public SAMFileWriter reduce( SAMRecord read, SAMFileWriter output ) { public SAMFileWriter reduce(SAMRecord read, SAMFileWriter output) {
if( output != null ) { if (output != null) {
output.addAlignment(read); output.addAlignment(read);
} }
return output; return output;
@ -548,20 +557,22 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/** /**
* Do nothing * Do nothing
*
* @param output The SAMFileWriter that outputs the bam file * @param output The SAMFileWriter that outputs the bam file
*/ */
public void onTraversalDone(SAMFileWriter output) { public void onTraversalDone(SAMFileWriter output) {
if( numReadsWithMalformedColorSpace != 0 ) { if (numReadsWithMalformedColorSpace != 0) {
if( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED ) { if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED) {
Utils.warnUser("Discovered " + numReadsWithMalformedColorSpace + " SOLiD reads with no calls in the color space. Unfortunately these reads cannot be recalibrated with this recalibration algorithm " + Utils.warnUser("Discovered " + numReadsWithMalformedColorSpace + " SOLiD reads with no calls in the color space. Unfortunately these reads cannot be recalibrated with this recalibration algorithm " +
"because we use reference mismatch rate as the only indication of a base's true quality. These reads have had reference bases inserted as a way of correcting " + "because we use reference mismatch rate as the only indication of a base's true quality. These reads have had reference bases inserted as a way of correcting " +
"for color space misalignments and there is now no way of knowing how often it mismatches the reference and therefore no way to recalibrate the quality score. " + "for color space misalignments and there is now no way of knowing how often it mismatches the reference and therefore no way to recalibrate the quality score. " +
"These reads remain in the output bam file but haven't been corrected for reference bias. !!! USE AT YOUR OWN RISK !!!"); "These reads remain in the output bam file but haven't been corrected for reference bias. !!! USE AT YOUR OWN RISK !!!");
} else if ( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ ) { }
else if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ) {
Utils.warnUser("Discovered " + numReadsWithMalformedColorSpace + " SOLiD reads with no calls in the color space. Unfortunately these reads cannot be recalibrated with this recalibration algorithm " + Utils.warnUser("Discovered " + numReadsWithMalformedColorSpace + " SOLiD reads with no calls in the color space. Unfortunately these reads cannot be recalibrated with this recalibration algorithm " +
"because we use reference mismatch rate as the only indication of a base's true quality. These reads have had reference bases inserted as a way of correcting " + "because we use reference mismatch rate as the only indication of a base's true quality. These reads have had reference bases inserted as a way of correcting " +
"for color space misalignments and there is now no way of knowing how often it mismatches the reference and therefore no way to recalibrate the quality score. " + "for color space misalignments and there is now no way of knowing how often it mismatches the reference and therefore no way to recalibrate the quality score. " +
"These reads were completely removed from the output bam file."); "These reads were completely removed from the output bam file.");
} }
} }

View File

@ -71,25 +71,24 @@ public class KeepAFSpectrumFrequencySelector extends FrequencyModeSelector {
// recompute AF,AC,AN based on genotypes: // recompute AF,AC,AN based on genotypes:
// todo - - maybe too inefficient?? // todo - - maybe too inefficient??
VariantContextUtils.calculateChromosomeCounts(vc, attributes, false); VariantContextUtils.calculateChromosomeCounts(vc, attributes, false);
afArray = new double[] {Double.valueOf((String)attributes.get(VCFConstants.ALLELE_FREQUENCY_KEY))}; }
} else {
// sites-only vc or we explicitly tell to ignore genotypes; we trust the AF field if present
if ( vc.hasAttribute(VCFConstants.ALLELE_FREQUENCY_KEY) ) {
String afo = vc.getAttributeAsString(VCFConstants.ALLELE_FREQUENCY_KEY, null);
if (afo.contains(",")) { // sites-only vc or we explicitly tell to ignore genotypes; we trust the AF field if present
String[] afs = afo.split(","); if ( vc.hasAttribute(VCFConstants.ALLELE_FREQUENCY_KEY) ) {
afs[0] = afs[0].substring(1,afs[0].length()); String afo = vc.getAttributeAsString(VCFConstants.ALLELE_FREQUENCY_KEY, null);
afs[afs.length-1] = afs[afs.length-1].substring(0,afs[afs.length-1].length()-1);
afArray = new double[afs.length]; if (afo.contains(",")) {
String[] afs = afo.split(",");
afs[0] = afs[0].substring(1,afs[0].length());
afs[afs.length-1] = afs[afs.length-1].substring(0,afs[afs.length-1].length()-1);
for (int k=0; k < afArray.length; k++) afArray = new double[afs.length];
afArray[k] = Double.valueOf(afs[k]);
} for (int k=0; k < afArray.length; k++)
else afArray[k] = Double.valueOf(afs[k]);
afArray = new double[] {Double.valueOf(afo)};
} }
else
afArray = new double[] {Double.valueOf(afo)};
} }

View File

@ -52,13 +52,16 @@ public class UniformSamplingFrequencySelector extends FrequencyModeSelector {
if (! selectedInTargetSamples && !IGNORE_POLYMORPHIC) if (! selectedInTargetSamples && !IGNORE_POLYMORPHIC)
return; return;
} else { } else {
if ( attributes.containsKey(VCFConstants.ALLELE_COUNT_KEY) ) { if (!IGNORE_POLYMORPHIC) {
int ac = vc.getAttributeAsInt(VCFConstants.ALLELE_COUNT_KEY, 0); if (vc.getAttributes().containsKey(VCFConstants.ALLELE_COUNT_KEY))
if (ac == 0) return; // site not polymorphic {
int ac = vc.getAttributeAsInt(VCFConstants.ALLELE_COUNT_KEY, 0);
if (ac == 0) return; // site not polymorphic
}
else
// no allele count field in VC
return;
} }
else
return;
} }
// create bare-bones event and log in corresponding bin // create bare-bones event and log in corresponding bin
// attributes contains AC,AF,AN pulled from original vc, and we keep them here and log in output file for bookkeeping purposes // attributes contains AC,AF,AN pulled from original vc, and we keep them here and log in output file for bookkeeping purposes

View File

@ -83,29 +83,39 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
@DataPoint(description = "Multi-allelic SNP Novelty Rate") @DataPoint(description = "Multi-allelic SNP Novelty Rate")
public String SNPNoveltyRate = "NA"; public String SNPNoveltyRate = "NA";
@DataPoint(description = "Multi-allelic Indels partially known") //TODO -- implement me
//@DataPoint(description = "Multi-allelic Indels partially known")
public int knownIndelsPartial = 0; public int knownIndelsPartial = 0;
@DataPoint(description = "Multi-allelic Indels completely known") //@DataPoint(description = "Multi-allelic Indels completely known")
public int knownIndelsComplete = 0; public int knownIndelsComplete = 0;
@DataPoint(description = "Multi-allelic Indel Novelty Rate") //@DataPoint(description = "Multi-allelic Indel Novelty Rate")
public String indelNoveltyRate = "NA"; public String indelNoveltyRate = "NA";
@DataPoint(description="Histogram of allele frequencies") @DataPoint(description="Histogram of allele frequencies for most common SNP alternate allele")
AFHistogram AFhistogram = new AFHistogram(); AFHistogram AFhistogramMaxSnp = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for less common SNP alternate alleles")
AFHistogram AFhistogramMinSnp = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for most common Indel alternate allele")
AFHistogram AFhistogramMaxIndel = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for less common Indel alternate alleles")
AFHistogram AFhistogramMinIndel = new AFHistogram();
/* /*
* AF histogram table object * AF histogram table object
*/ */
static class AFHistogram implements TableType { static class AFHistogram implements TableType {
private Object[] colKeys, rowKeys = {"pairwise_AF"}; private Object[] rowKeys, colKeys = {"count"};
private int[] AFhistogram; private int[] AFhistogram;
private static final double AFincrement = 0.01; private static final double AFincrement = 0.01;
private static final int numBins = (int)(1.00 / AFincrement); private static final int numBins = (int)(1.00 / AFincrement);
public AFHistogram() { public AFHistogram() {
colKeys = initColKeys(); rowKeys = initRowKeys();
AFhistogram = new int[colKeys.length]; AFhistogram = new int[rowKeys.length];
} }
public Object[] getColumnKeys() { public Object[] getColumnKeys() {
@ -117,10 +127,10 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
} }
public Object getCell(int row, int col) { public Object getCell(int row, int col) {
return AFhistogram[col]; return AFhistogram[row];
} }
private static Object[] initColKeys() { private static Object[] initRowKeys() {
ArrayList<String> keyList = new ArrayList<String>(numBins + 1); ArrayList<String> keyList = new ArrayList<String>(numBins + 1);
for ( double a = 0.00; a <= 1.01; a += AFincrement ) { for ( double a = 0.00; a <= 1.01; a += AFincrement ) {
keyList.add(String.format("%.2f", a)); keyList.add(String.format("%.2f", a));
@ -130,18 +140,10 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
public String getName() { return "AFHistTable"; } public String getName() { return "AFHistTable"; }
public void update(VariantContext vc) { public void update(final double AF) {
final Object obj = vc.getAttribute(VCFConstants.ALLELE_FREQUENCY_KEY, null); final int bin = (int)(numBins * MathUtils.round(AF, 2));
if ( obj == null || !(obj instanceof List) ) AFhistogram[bin]++;
return; }
List<String> list = (List<String>)obj;
for ( String str : list ) {
final double AF = Double.valueOf(str);
final int bin = (int)(numBins * MathUtils.round(AF, 2));
AFhistogram[bin]++;
}
}
} }
public void initialize(VariantEvalWalker walker) {} public void initialize(VariantEvalWalker walker) {}
@ -168,6 +170,7 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
nMultiSNPs++; nMultiSNPs++;
calculatePairwiseTiTv(eval); calculatePairwiseTiTv(eval);
calculateSNPPairwiseNovelty(eval, comp); calculateSNPPairwiseNovelty(eval, comp);
updateAFhistogram(eval, AFhistogramMaxSnp, AFhistogramMinSnp);
} }
break; break;
case INDEL: case INDEL:
@ -175,13 +178,13 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
if ( !eval.isBiallelic() ) { if ( !eval.isBiallelic() ) {
nMultiIndels++; nMultiIndels++;
calculateIndelPairwiseNovelty(eval, comp); calculateIndelPairwiseNovelty(eval, comp);
updateAFhistogram(eval, AFhistogramMaxIndel, AFhistogramMinIndel);
} }
break; break;
default: default:
throw new UserException.BadInput("Unexpected variant context type: " + eval); throw new UserException.BadInput("Unexpected variant context type: " + eval);
} }
AFhistogram.update(eval);
return null; // we don't capture any interesting sites return null; // we don't capture any interesting sites
} }
@ -213,6 +216,24 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
private void calculateIndelPairwiseNovelty(VariantContext eval, VariantContext comp) { private void calculateIndelPairwiseNovelty(VariantContext eval, VariantContext comp) {
} }
private void updateAFhistogram(VariantContext vc, AFHistogram max, AFHistogram min) {
final Object obj = vc.getAttribute(VCFConstants.ALLELE_FREQUENCY_KEY, null);
if ( obj == null || !(obj instanceof List) )
return;
List<String> list = (List<String>)obj;
ArrayList<Double> AFs = new ArrayList<Double>(list.size());
for ( String str : list ) {
AFs.add(Double.valueOf(str));
}
Collections.sort(AFs);
max.update(AFs.get(AFs.size()-1));
for ( int i = 0; i < AFs.size() - 1; i++ )
min.update(AFs.get(i));
}
private final String noveltyRate(final int all, final int known) { private final String noveltyRate(final int all, final int known) {
final int novel = all - known; final int novel = all - known;
final double rate = (novel / (1.0 * all)); final double rate = (novel / (1.0 * all));

View File

@ -128,13 +128,13 @@ public class ValidateVariants extends RodWalker<Integer, Integer> {
// get the true reference allele // get the true reference allele
Allele reportedRefAllele = vc.getReference(); Allele reportedRefAllele = vc.getReference();
Allele observedRefAllele; Allele observedRefAllele = null;
// insertions // insertions
if ( vc.isSimpleInsertion() ) { if ( vc.isSimpleInsertion() ) {
observedRefAllele = Allele.create(Allele.NULL_ALLELE_STRING); observedRefAllele = Allele.create(Allele.NULL_ALLELE_STRING);
} }
// deletions // deletions
else if ( vc.isSimpleDeletion() || vc.isMixed() || vc.isMNP() ) { else if ( vc.isSimpleDeletion() || vc.isMNP() ) {
// we can't validate arbitrarily long deletions // we can't validate arbitrarily long deletions
if ( reportedRefAllele.length() > 100 ) { if ( reportedRefAllele.length() > 100 ) {
logger.info(String.format("Reference allele is too long (%d) at position %s:%d; skipping that record.", reportedRefAllele.length(), vc.getChr(), vc.getStart())); logger.info(String.format("Reference allele is too long (%d) at position %s:%d; skipping that record.", reportedRefAllele.length(), vc.getChr(), vc.getStart()));
@ -143,16 +143,15 @@ public class ValidateVariants extends RodWalker<Integer, Integer> {
// deletions are associated with the (position of) the last (preceding) non-deleted base; // deletions are associated with the (position of) the last (preceding) non-deleted base;
// hence to get actually deleted bases we need offset = 1 // hence to get actually deleted bases we need offset = 1
int offset = 1 ; int offset = vc.isMNP() ? 0 : 1;
if ( vc.isMNP() ) offset = 0; // if it's an MNP, the reported position IS the first modified base
byte[] refBytes = ref.getBases(); byte[] refBytes = ref.getBases();
byte[] trueRef = new byte[reportedRefAllele.length()]; byte[] trueRef = new byte[reportedRefAllele.length()];
for (int i = 0; i < reportedRefAllele.length(); i++) for (int i = 0; i < reportedRefAllele.length(); i++)
trueRef[i] = refBytes[i+offset]; trueRef[i] = refBytes[i+offset];
observedRefAllele = Allele.create(trueRef, true); observedRefAllele = Allele.create(trueRef, true);
} }
// SNPs, etc. // SNPs, etc. but not mixed types because they are too difficult
else { else if ( !vc.isMixed() ) {
byte[] refByte = new byte[1]; byte[] refByte = new byte[1];
refByte[0] = ref.getBase(); refByte[0] = ref.getBase();
observedRefAllele = Allele.create(refByte, true); observedRefAllele = Allele.create(refByte, true);

View File

@ -26,7 +26,6 @@ package org.broadinstitute.sting.gatk.walkers.variantutils;
import org.broadinstitute.sting.commandline.*; import org.broadinstitute.sting.commandline.*;
import org.broadinstitute.sting.gatk.arguments.StandardVariantContextInputArgumentCollection; import org.broadinstitute.sting.gatk.arguments.StandardVariantContextInputArgumentCollection;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
@ -49,7 +48,13 @@ import java.util.*;
* fields to print with the -F NAME, each of which appears as a single column in * fields to print with the -F NAME, each of which appears as a single column in
* the output file, with a header named NAME, and the value of this field in the VCF * the output file, with a header named NAME, and the value of this field in the VCF
* one per line. NAME can be any standard VCF column (CHROM, ID, QUAL) or any binding * one per line. NAME can be any standard VCF column (CHROM, ID, QUAL) or any binding
* in the INFO field (AC=10). Note that this tool does not support capturing any * in the INFO field (AC=10). In addition, there are specially supported values like
* EVENTLENGTH (length of the event), TRANSITION (for SNPs), HET (count of het genotypes),
* HOM-REF (count of homozygous reference genotypes), HOM-VAR (count of homozygous variant
* genotypes), NO-CALL (count of no-call genotypes), TYPE (the type of event), VAR (count of
* non-reference genotypes), NSAMPLES (number of samples), NCALLED (number of called samples),
* GQ (from the genotype field; works only for a file with a single sample), and MULTI-ALLELIC
* (is the record from a multi-allelic site). Note that this tool does not support capturing any
* GENOTYPE field values. If a VCF record is missing a value, then the tool by * GENOTYPE field values. If a VCF record is missing a value, then the tool by
* default throws an error, but the special value NA can be emitted instead with * default throws an error, but the special value NA can be emitted instead with
* appropriate tool arguments. * appropriate tool arguments.
@ -121,18 +126,13 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
int nRecords = 0; int nRecords = 0;
/** /**
* By default, only biallelic (REF=A, ALT=B) sites are including in the output. If this flag is provided, then * By default, records with multiple ALT alleles will comprise just one line of output; note that in general this can make your resulting file
* VariantsToTable will emit field values for records with multiple ALT alleles. Note that in general this * unreadable/malformed for certain tools like R, as the representation of multi-allelic INFO field values are often comma-separated lists
* can make your resulting file unreadable and malformated according to tools like R, as the representation of * of values. Using the flag will cause multi-allelic records to be split into multiple lines of output (one for each allele in the ALT field);
* multi-allelic INFO field values can be lists of values. * INFO field values that are not lists are copied for each of the output records while only the appropriate entry is used for lists.
*/ */
@Advanced @Argument(fullName="splitMultiAllelic", shortName="SMA", doc="If provided, we will split multi-allelic records into multiple lines of output", required=false)
@Argument(fullName="keepMultiAllelic", shortName="KMA", doc="If provided, we will not require the site to be biallelic", required=false) public boolean splitMultiAllelic = false;
public boolean keepMultiAllelic = false;
@Hidden
@Argument(fullName="logACSum", shortName="logACSum", doc="Log sum of AC instead of max value in case of multiallelic variants", required=false)
public boolean logACSum = false;
/** /**
* By default, this tool throws a UserException when it encounters a field without a value in some record. This * By default, this tool throws a UserException when it encounters a field without a value in some record. This
@ -144,6 +144,7 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
@Advanced @Advanced
@Argument(fullName="allowMissingData", shortName="AMD", doc="If provided, we will not require every record to contain every field", required=false) @Argument(fullName="allowMissingData", shortName="AMD", doc="If provided, we will not require every record to contain every field", required=false)
public boolean ALLOW_MISSING_DATA = false; public boolean ALLOW_MISSING_DATA = false;
private final static String MISSING_DATA = "NA";
public void initialize() { public void initialize() {
// print out the header // print out the header
@ -155,9 +156,9 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
return 0; return 0;
for ( VariantContext vc : tracker.getValues(variantCollection.variants, context.getLocation())) { for ( VariantContext vc : tracker.getValues(variantCollection.variants, context.getLocation())) {
if ( (keepMultiAllelic || vc.isBiallelic()) && ( showFiltered || vc.isNotFiltered() ) ) { if ( showFiltered || vc.isNotFiltered() ) {
List<String> vals = extractFields(vc, fieldsToTake, ALLOW_MISSING_DATA, keepMultiAllelic, logACSum); for ( final List<String> record : extractFields(vc, fieldsToTake, ALLOW_MISSING_DATA, splitMultiAllelic) )
out.println(Utils.join("\t", vals)); out.println(Utils.join("\t", record));
} }
} }
@ -180,22 +181,25 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
* *
* @param vc the VariantContext whose field values we can to capture * @param vc the VariantContext whose field values we can to capture
* @param fields a non-null list of fields to capture from VC * @param fields a non-null list of fields to capture from VC
* @param allowMissingData if false, then throws a UserException if any field isn't found in vc. Otherwise * @param allowMissingData if false, then throws a UserException if any field isn't found in vc. Otherwise provides a value of NA
* provides a value of NA * @param splitMultiAllelic if true, multiallelic variants are to be split into multiple records
* @param kma if true, multiallelic variants are to be kept * @return List of lists of field values
* @param logsum if true, AF and AC are computed based on sum of allele counts. Otherwise, based on allele with highest count.
* @return
*/ */
private static List<String> extractFields(VariantContext vc, List<String> fields, boolean allowMissingData, boolean kma, boolean logsum) { private static List<List<String>> extractFields(VariantContext vc, List<String> fields, boolean allowMissingData, boolean splitMultiAllelic) {
List<String> vals = new ArrayList<String>();
final int numRecordsToProduce = splitMultiAllelic ? vc.getAlternateAlleles().size() : 1;
final List<List<String>> records = new ArrayList<List<String>>(numRecordsToProduce);
for ( int i = 0; i < numRecordsToProduce; i++ )
records.add(new ArrayList<String>(fields.size()));
for ( String field : fields ) { for ( String field : fields ) {
String val = "NA";
if ( getters.containsKey(field) ) { if ( splitMultiAllelic && field.equals("ALT") ) { // we need to special case the ALT field when splitting out multi-allelic records
val = getters.get(field).get(vc); addFieldValue(splitAltAlleles(vc), records);
} else if ( getters.containsKey(field) ) {
addFieldValue(getters.get(field).get(vc), records);
} else if ( vc.hasAttribute(field) ) { } else if ( vc.hasAttribute(field) ) {
val = vc.getAttributeAsString(field, null); addFieldValue(vc.getAttribute(field, null), records);
} else if ( isWildCard(field) ) { } else if ( isWildCard(field) ) {
Set<String> wildVals = new HashSet<String>(); Set<String> wildVals = new HashSet<String>();
for ( Map.Entry<String,Object> elt : vc.getAttributes().entrySet()) { for ( Map.Entry<String,Object> elt : vc.getAttributes().entrySet()) {
@ -204,51 +208,47 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
} }
} }
String val = MISSING_DATA;
if ( wildVals.size() > 0 ) { if ( wildVals.size() > 0 ) {
List<String> toVal = new ArrayList<String>(wildVals); List<String> toVal = new ArrayList<String>(wildVals);
Collections.sort(toVal); Collections.sort(toVal);
val = Utils.join(",", toVal); val = Utils.join(",", toVal);
} }
addFieldValue(val, records);
} else if ( ! allowMissingData ) { } else if ( ! allowMissingData ) {
throw new UserException(String.format("Missing field %s in vc %s at %s", field, vc.getSource(), vc)); throw new UserException(String.format("Missing field %s in vc %s at %s", field, vc.getSource(), vc));
} else {
addFieldValue(MISSING_DATA, records);
} }
if (field.equals("AF") || field.equals("AC")) {
String afo = val;
double af=0;
if (afo.contains(",")) {
String[] afs = afo.split(",");
afs[0] = afs[0].substring(1,afs[0].length());
afs[afs.length-1] = afs[afs.length-1].substring(0,afs[afs.length-1].length()-1);
double[] afd = new double[afs.length];
for (int k=0; k < afd.length; k++)
afd[k] = Double.valueOf(afs[k]);
if (kma && logsum)
af = MathUtils.sum(afd);
else
af = MathUtils.arrayMax(afd);
//af = Double.valueOf(afs[0]);
}
else
if (!afo.equals("NA"))
af = Double.valueOf(afo);
val = Double.toString(af);
}
vals.add(val);
} }
return vals; return records;
} }
public static List<String> extractFields(VariantContext vc, List<String> fields, boolean allowMissingData) { private static void addFieldValue(Object val, List<List<String>> result) {
return extractFields(vc, fields, allowMissingData, false, false); final int numResultRecords = result.size();
// if we're trying to create a single output record, add it
if ( numResultRecords == 1 ) {
result.get(0).add(val.toString());
}
// if this field is a list of the proper size, add the appropriate entry to each record
else if ( (val instanceof List) && ((List)val).size() == numResultRecords ) {
final List list = (List)val;
for ( int i = 0; i < numResultRecords; i++ )
result.get(i).add(list.get(i).toString());
}
// otherwise, add the original value to all of the records
else {
final String valStr = val.toString();
for ( List<String> record : result )
record.add(valStr);
}
}
public static List<List<String>> extractFields(VariantContext vc, List<String> fields, boolean allowMissingData) {
return extractFields(vc, fields, allowMissingData, false);
} }
// //
// default reduce -- doesn't do anything at all // default reduce -- doesn't do anything at all
@ -272,12 +272,9 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
getters.put("POS", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getStart()); } }); getters.put("POS", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getStart()); } });
getters.put("REF", new Getter() { getters.put("REF", new Getter() {
public String get(VariantContext vc) { public String get(VariantContext vc) {
String x = ""; StringBuilder x = new StringBuilder();
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() ) { x.append(getAlleleDisplayString(vc, vc.getReference()));
Byte refByte = vc.getReferenceBaseForIndel(); return x.toString();
x=x+new String(new byte[]{refByte});
}
return x+vc.getReference().getDisplayString();
} }
}); });
getters.put("ALT", new Getter() { getters.put("ALT", new Getter() {
@ -285,14 +282,10 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
StringBuilder x = new StringBuilder(); StringBuilder x = new StringBuilder();
int n = vc.getAlternateAlleles().size(); int n = vc.getAlternateAlleles().size();
if ( n == 0 ) return "."; if ( n == 0 ) return ".";
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() ) {
Byte refByte = vc.getReferenceBaseForIndel();
x.append(new String(new byte[]{refByte}));
}
for ( int i = 0; i < n; i++ ) { for ( int i = 0; i < n; i++ ) {
if ( i != 0 ) x.append(","); if ( i != 0 ) x.append(",");
x.append(vc.getAlternateAllele(i).getDisplayString()); x.append(getAlleleDisplayString(vc, vc.getAlternateAllele(i)));
} }
return x.toString(); return x.toString();
} }
@ -324,10 +317,29 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
getters.put("VAR", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getHetCount() + vc.getHomVarCount()); } }); getters.put("VAR", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getHetCount() + vc.getHomVarCount()); } });
getters.put("NSAMPLES", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getNSamples()); } }); getters.put("NSAMPLES", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getNSamples()); } });
getters.put("NCALLED", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getNSamples() - vc.getNoCallCount()); } }); getters.put("NCALLED", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getNSamples() - vc.getNoCallCount()); } });
getters.put("MULTI-ALLELIC", new Getter() { public String get(VariantContext vc) { return Boolean.toString(vc.getAlternateAlleles().size() > 1); } });
getters.put("GQ", new Getter() { public String get(VariantContext vc) { getters.put("GQ", new Getter() { public String get(VariantContext vc) {
if ( vc.getNSamples() > 1 ) throw new UserException("Cannot get GQ values for multi-sample VCF"); if ( vc.getNSamples() > 1 ) throw new UserException("Cannot get GQ values for multi-sample VCF");
return String.format("%.2f", -10 * vc.getGenotype(0).getLog10PError()); return String.format("%.2f", -10 * vc.getGenotype(0).getLog10PError());
}}); }});
} }
private static String getAlleleDisplayString(VariantContext vc, Allele allele) {
StringBuilder sb = new StringBuilder();
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() )
sb.append((char)vc.getReferenceBaseForIndel().byteValue());
sb.append(allele.getDisplayString());
return sb.toString();
}
private static Object splitAltAlleles(VariantContext vc) {
final int numAltAlleles = vc.getAlternateAlleles().size();
if ( numAltAlleles == 1 )
return getAlleleDisplayString(vc, vc.getAlternateAllele(0));
final List<String> alleles = new ArrayList<String>(numAltAlleles);
for ( Allele allele : vc.getAlternateAlleles() )
alleles.add(getAlleleDisplayString(vc, allele));
return alleles;
}
} }

View File

@ -2,57 +2,59 @@ package org.broadinstitute.sting.utils;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
/** /**
* BaseUtils contains some basic utilities for manipulating nucleotides. * BaseUtils contains some basic utilities for manipulating nucleotides.
*/ */
public class BaseUtils { public class BaseUtils {
public final static byte A = (byte)'A'; public final static byte A = (byte) 'A';
public final static byte C = (byte)'C'; public final static byte C = (byte) 'C';
public final static byte G = (byte)'G'; public final static byte G = (byte) 'G';
public final static byte T = (byte)'T'; public final static byte T = (byte) 'T';
public final static byte N = (byte)'N'; public final static byte N = (byte) 'N';
public final static byte D = (byte)'D'; public final static byte D = (byte) 'D';
// //
// todo -- we need a generalized base abstraction using the Base enum. // todo -- we need a generalized base abstraction using the Base enum.
// //
public final static byte[] BASES = { 'A', 'C', 'G', 'T' }; public final static byte[] BASES = {'A', 'C', 'G', 'T'};
public final static byte[] EXTENDED_BASES = { 'A', 'C', 'G', 'T', 'N', 'D' }; public final static byte[] EXTENDED_BASES = {'A', 'C', 'G', 'T', 'N', 'D'};
public enum Base { public enum Base {
A ( 'A', 0 ), A('A', 0),
C ( 'C', 1 ), C('C', 1),
G ( 'G', 2 ), G('G', 2),
T ( 'T', 3 ); T('T', 3);
byte b; byte b;
int index; int index;
private Base(char base, int index) { private Base(char base, int index) {
this.b = (byte)base; this.b = (byte) base;
this.index = index; this.index = index;
} }
public byte getBase() { return b; } public byte getBase() { return b; }
public char getBaseAsChar() { return (char)b; }
public char getBaseAsChar() { return (char) b; }
public int getIndex() { return index; } public int getIndex() { return index; }
public boolean sameBase(byte o) { return b == o; } public boolean sameBase(byte o) { return b == o; }
public boolean sameBase(char o) { return b == (byte)o; }
public boolean sameBase(int i) { return index == i; }
}
public boolean sameBase(char o) { return b == (byte) o; }
public boolean sameBase(int i) { return index == i; }
}
// todo -- fix me (enums?) // todo -- fix me (enums?)
public static final byte DELETION_INDEX = 4; public static final byte DELETION_INDEX = 4;
public static final byte NO_CALL_INDEX = 5; // (this is 'N') public static final byte NO_CALL_INDEX = 5; // (this is 'N')
public static int gIndex = BaseUtils.simpleBaseToBaseIndex((byte)'G'); public static int gIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'G');
public static int cIndex = BaseUtils.simpleBaseToBaseIndex((byte)'C'); public static int cIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'C');
public static int aIndex = BaseUtils.simpleBaseToBaseIndex((byte)'A'); public static int aIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'A');
public static int tIndex = BaseUtils.simpleBaseToBaseIndex((byte)'T'); public static int tIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'T');
/// In genetics, a transition is a mutation changing a purine to another purine nucleotide (A <-> G) or /// In genetics, a transition is a mutation changing a purine to another purine nucleotide (A <-> G) or
// a pyrimidine to another pyrimidine nucleotide (C <-> T). // a pyrimidine to another pyrimidine nucleotide (C <-> T).
@ -64,28 +66,31 @@ public class BaseUtils {
/** /**
* Returns the base substitution type of the 2 state SNP * Returns the base substitution type of the 2 state SNP
*
* @param base1 * @param base1
* @param base2 * @param base2
* @return * @return
*/ */
public static BaseSubstitutionType SNPSubstitutionType( byte base1, byte base2 ) { public static BaseSubstitutionType SNPSubstitutionType(byte base1, byte base2) {
BaseSubstitutionType t = isTransition(base1, base2) ? BaseSubstitutionType.TRANSITION : BaseSubstitutionType.TRANSVERSION; BaseSubstitutionType t = isTransition(base1, base2) ? BaseSubstitutionType.TRANSITION : BaseSubstitutionType.TRANSVERSION;
//System.out.printf("SNPSubstitutionType( char %c, char %c ) => %s%n", base1, base2, t); //System.out.printf("SNPSubstitutionType( char %c, char %c ) => %s%n", base1, base2, t);
return t; return t;
} }
public static boolean isTransition( byte base1, byte base2 ) { public static boolean isTransition(byte base1, byte base2) {
int b1 = simpleBaseToBaseIndex(base1); int b1 = simpleBaseToBaseIndex(base1);
int b2 = simpleBaseToBaseIndex(base2); int b2 = simpleBaseToBaseIndex(base2);
return b1 == 0 && b2 == 2 || b1 == 2 && b2 == 0 || return b1 == 0 && b2 == 2 || b1 == 2 && b2 == 0 ||
b1 == 1 && b2 == 3 || b1 == 3 && b2 == 1; b1 == 1 && b2 == 3 || b1 == 3 && b2 == 1;
} }
public static boolean isTransversion( byte base1, byte base2 ) { public static boolean isTransversion(byte base1, byte base2) {
return ! isTransition(base1, base2); return !isTransition(base1, base2);
} }
/** Private constructor. No instantiating this class! */ /**
* Private constructor. No instantiating this class!
*/
private BaseUtils() {} private BaseUtils() {}
static public boolean basesAreEqual(byte base1, byte base2) { static public boolean basesAreEqual(byte base1, byte base2) {
@ -96,7 +101,6 @@ public class BaseUtils {
return extendedBaseToBaseIndex(base1) == extendedBaseToBaseIndex(base2); return extendedBaseToBaseIndex(base1) == extendedBaseToBaseIndex(base2);
} }
/** /**
* Converts a IUPAC nucleotide code to a pair of bases * Converts a IUPAC nucleotide code to a pair of bases
* *
@ -163,33 +167,37 @@ public class BaseUtils {
/** /**
* Converts a simple base to a base index * Converts a simple base to a base index
* *
* @param base [AaCcGgTt] * @param base [AaCcGgTt]
* @return 0, 1, 2, 3, or -1 if the base can't be understood * @return 0, 1, 2, 3, or -1 if the base can't be understood
*/ */
static public int simpleBaseToBaseIndex(byte base) { static public int simpleBaseToBaseIndex(byte base) {
switch (base) { switch (base) {
case '*': // the wildcard character counts as an A case '*': // the wildcard character counts as an A
case 'A': case 'A':
case 'a': return 0; case 'a':
return 0;
case 'C': case 'C':
case 'c': return 1; case 'c':
return 1;
case 'G': case 'G':
case 'g': return 2; case 'g':
return 2;
case 'T': case 'T':
case 't': return 3; case 't':
return 3;
default: return -1; default:
return -1;
} }
} }
/** /**
* Converts a simple base to a base index * Converts a simple base to a base index
* *
* @param base [AaCcGgTt] * @param base [AaCcGgTt]
* @return 0, 1, 2, 3, or -1 if the base can't be understood * @return 0, 1, 2, 3, or -1 if the base can't be understood
*/ */
@Deprecated @Deprecated
@ -197,29 +205,37 @@ public class BaseUtils {
switch (base) { switch (base) {
case '*': // the wildcard character counts as an A case '*': // the wildcard character counts as an A
case 'A': case 'A':
case 'a': return 0; case 'a':
return 0;
case 'C': case 'C':
case 'c': return 1; case 'c':
return 1;
case 'G': case 'G':
case 'g': return 2; case 'g':
return 2;
case 'T': case 'T':
case 't': return 3; case 't':
return 3;
default: return -1; default:
return -1;
} }
} }
static public int extendedBaseToBaseIndex(byte base) { static public int extendedBaseToBaseIndex(byte base) {
switch (base) { switch (base) {
case 'd': case 'd':
case 'D': return DELETION_INDEX; case 'D':
return DELETION_INDEX;
case 'n': case 'n':
case 'N': return NO_CALL_INDEX; case 'N':
return NO_CALL_INDEX;
default: return simpleBaseToBaseIndex(base); default:
return simpleBaseToBaseIndex(base);
} }
} }
@ -232,11 +248,6 @@ public class BaseUtils {
return simpleBaseToBaseIndex(base) != -1; return simpleBaseToBaseIndex(base) != -1;
} }
@Deprecated
static public boolean isNBase(char base) {
return isNBase((byte)base);
}
static public boolean isNBase(byte base) { static public boolean isNBase(byte base) {
return base == 'N' || base == 'n'; return base == 'N' || base == 'n';
} }
@ -244,68 +255,83 @@ public class BaseUtils {
/** /**
* Converts a base index to a simple base * Converts a base index to a simple base
* *
* @param baseIndex 0, 1, 2, 3 * @param baseIndex 0, 1, 2, 3
* @return A, C, G, T, or '.' if the index can't be understood * @return A, C, G, T, or '.' if the index can't be understood
*/ */
static public byte baseIndexToSimpleBase(int baseIndex) { static public byte baseIndexToSimpleBase(int baseIndex) {
switch (baseIndex) { switch (baseIndex) {
case 0: return 'A'; case 0:
case 1: return 'C'; return 'A';
case 2: return 'G'; case 1:
case 3: return 'T'; return 'C';
default: return '.'; case 2:
return 'G';
case 3:
return 'T';
default:
return '.';
} }
} }
@Deprecated @Deprecated
static public char baseIndexToSimpleBaseAsChar(int baseIndex) { static public char baseIndexToSimpleBaseAsChar(int baseIndex) {
return (char)baseIndexToSimpleBase(baseIndex); return (char) baseIndexToSimpleBase(baseIndex);
} }
/** /**
* Converts a base index to a base index representing its cross-talk partner * Converts a base index to a base index representing its cross-talk partner
* *
* @param baseIndex 0, 1, 2, 3 * @param baseIndex 0, 1, 2, 3
* @return 1, 0, 3, 2, or -1 if the index can't be understood * @return 1, 0, 3, 2, or -1 if the index can't be understood
*/ */
static public int crossTalkPartnerIndex(int baseIndex) { static public int crossTalkPartnerIndex(int baseIndex) {
switch (baseIndex) { switch (baseIndex) {
case 0: return 1; // A -> C case 0:
case 1: return 0; // C -> A return 1; // A -> C
case 2: return 3; // G -> T case 1:
case 3: return 2; // T -> G return 0; // C -> A
default: return -1; case 2:
return 3; // G -> T
case 3:
return 2; // T -> G
default:
return -1;
} }
} }
/** /**
* Converts a base to the base representing its cross-talk partner * Converts a base to the base representing its cross-talk partner
* *
* @param base [AaCcGgTt] * @param base [AaCcGgTt]
* @return C, A, T, G, or '.' if the base can't be understood * @return C, A, T, G, or '.' if the base can't be understood
*/ */
@Deprecated @Deprecated
static public char crossTalkPartnerBase(char base) { static public char crossTalkPartnerBase(char base) {
return (char)baseIndexToSimpleBase(crossTalkPartnerIndex(simpleBaseToBaseIndex(base))); return (char) baseIndexToSimpleBase(crossTalkPartnerIndex(simpleBaseToBaseIndex(base)));
} }
/** /**
* Return the complement of a base index. * Return the complement of a base index.
* *
* @param baseIndex the base index (0:A, 1:C, 2:G, 3:T) * @param baseIndex the base index (0:A, 1:C, 2:G, 3:T)
* @return the complementary base index * @return the complementary base index
*/ */
static public byte complementIndex(int baseIndex) { static public byte complementIndex(int baseIndex) {
switch (baseIndex) { switch (baseIndex) {
case 0: return 3; // a -> t case 0:
case 1: return 2; // c -> g return 3; // a -> t
case 2: return 1; // g -> c case 1:
case 3: return 0; // t -> a return 2; // c -> g
default: return -1; // wtf? case 2:
return 1; // g -> c
case 3:
return 0; // t -> a
default:
return -1; // wtf?
} }
} }
/** /**
* Return the complement (A <-> T or C <-> G) of a base, or the specified base if it can't be complemented (i.e. an ambiguous base). * Return the complement (A <-> T or C <-> G) of a base, or the specified base if it can't be complemented (i.e. an ambiguous base).
* *
* @param base the base [AaCcGgTt] * @param base the base [AaCcGgTt]
@ -314,20 +340,25 @@ public class BaseUtils {
static public byte simpleComplement(byte base) { static public byte simpleComplement(byte base) {
switch (base) { switch (base) {
case 'A': case 'A':
case 'a': return 'T'; case 'a':
return 'T';
case 'C': case 'C':
case 'c': return 'G'; case 'c':
return 'G';
case 'G': case 'G':
case 'g': return 'C'; case 'g':
return 'C';
case 'T': case 'T':
case 't': return 'A'; case 't':
default: return base; return 'A';
default:
return base;
} }
} }
@Deprecated @Deprecated
static public char simpleComplement(char base) { static public char simpleComplement(char base) {
return (char)simpleComplement((byte)base); return (char) simpleComplement((byte) base);
} }
/** /**
@ -349,7 +380,7 @@ public class BaseUtils {
/** /**
* Complement a byte array of bases (that is, chars casted to bytes, *not* base indices in byte form) * Complement a byte array of bases (that is, chars casted to bytes, *not* base indices in byte form)
* *
* @param bases the byte array of bases * @param bases the byte array of bases
* @return the complement of the base byte array * @return the complement of the base byte array
*/ */
static public byte[] simpleComplement(byte[] bases) { static public byte[] simpleComplement(byte[] bases) {
@ -382,7 +413,7 @@ public class BaseUtils {
/** /**
* Complement a char array of bases * Complement a char array of bases
* *
* @param bases the char array of bases * @param bases the char array of bases
* @return the complement of the base char array * @return the complement of the base char array
*/ */
@Deprecated @Deprecated
@ -399,7 +430,7 @@ public class BaseUtils {
/** /**
* Reverse complement a String of bases. Preserves ambiguous bases. * Reverse complement a String of bases. Preserves ambiguous bases.
* *
* @param bases the String of bases * @param bases the String of bases
* @return the reverse complement of the String * @return the reverse complement of the String
*/ */
@Deprecated @Deprecated
@ -407,11 +438,10 @@ public class BaseUtils {
return new String(simpleReverseComplement(bases.getBytes())); return new String(simpleReverseComplement(bases.getBytes()));
} }
/** /**
* Complement a String of bases. Preserves ambiguous bases. * Complement a String of bases. Preserves ambiguous bases.
* *
* @param bases the String of bases * @param bases the String of bases
* @return the complement of the String * @return the complement of the String
*/ */
@Deprecated @Deprecated
@ -451,7 +481,7 @@ public class BaseUtils {
/** /**
* Returns the most common base in the basecounts array. To be used with pileup.getBaseCounts. * Returns the most common base in the basecounts array. To be used with pileup.getBaseCounts.
* *
* @param baseCounts counts of a,c,g,t in order. * @param baseCounts counts of a,c,g,t in order.
* @return the most common base * @return the most common base
*/ */
static public byte mostFrequentSimpleBase(int[] baseCounts) { static public byte mostFrequentSimpleBase(int[] baseCounts) {
@ -461,13 +491,13 @@ public class BaseUtils {
/** /**
* For the most frequent base in the sequence, return the percentage of the read it constitutes. * For the most frequent base in the sequence, return the percentage of the read it constitutes.
* *
* @param sequence the read sequence * @param sequence the read sequence
* @return the percentage of the read that's made up of the most frequent base * @return the percentage of the read that's made up of the most frequent base
*/ */
static public double mostFrequentBaseFraction(byte[] sequence) { static public double mostFrequentBaseFraction(byte[] sequence) {
int[] baseCounts = new int[4]; int[] baseCounts = new int[4];
for ( byte base : sequence ) { for (byte base : sequence) {
int baseIndex = simpleBaseToBaseIndex(base); int baseIndex = simpleBaseToBaseIndex(base);
if (baseIndex >= 0) { if (baseIndex >= 0) {
@ -477,7 +507,7 @@ public class BaseUtils {
int mostFrequentBaseIndex = mostFrequentBaseIndex(baseCounts); int mostFrequentBaseIndex = mostFrequentBaseIndex(baseCounts);
return ((double) baseCounts[mostFrequentBaseIndex])/((double) sequence.length); return ((double) baseCounts[mostFrequentBaseIndex]) / ((double) sequence.length);
} }
// -------------------------------------------------------------------------------- // --------------------------------------------------------------------------------
@ -531,50 +561,50 @@ public class BaseUtils {
static public byte getRandomBase(char excludeBase) { static public byte getRandomBase(char excludeBase) {
return BaseUtils.baseIndexToSimpleBase(getRandomBaseIndex(BaseUtils.simpleBaseToBaseIndex(excludeBase))); return BaseUtils.baseIndexToSimpleBase(getRandomBaseIndex(BaseUtils.simpleBaseToBaseIndex(excludeBase)));
} }
/**
/** Computes the smallest period >= minPeriod for the specified string. The period is defined as such p, * Computes the smallest period >= minPeriod for the specified string. The period is defined as such p,
* that for all i = 0... seq.length-1, seq[ i % p ] = seq[i] (or equivalently seq[i] = seq[i+p] for i=0...seq.length-1-p). * that for all i = 0... seq.length-1, seq[ i % p ] = seq[i] (or equivalently seq[i] = seq[i+p] for i=0...seq.length-1-p).
* The sequence does <i>not</i> have to contain whole number of periods. For instance, "ACACACAC" has a period * The sequence does <i>not</i> have to contain whole number of periods. For instance, "ACACACAC" has a period
* of 2 (it has a period of 4 as well), and so does * of 2 (it has a period of 4 as well), and so does
* "ACACA"; similarly, smallest periods of "CTCCTC", "CTCCT", and "CTCC" are all equal to 3. The "trivial" period is * "ACACA"; similarly, smallest periods of "CTCCTC", "CTCCT", and "CTCC" are all equal to 3. The "trivial" period is
* the length of the string itself, and it will always be returned if no smaller period can be found in the specified period range * the length of the string itself, and it will always be returned if no smaller period can be found in the specified period range
* or if specified minPeriod is greater than the sequence length. * or if specified minPeriod is greater than the sequence length.
* *
* @param seq * @param seq
* @return * @return
*/ */
public static int sequencePeriod(byte[] seq, int minPeriod) { public static int sequencePeriod(byte[] seq, int minPeriod) {
int period = ( minPeriod > seq.length ? seq.length : minPeriod ); int period = (minPeriod > seq.length ? seq.length : minPeriod);
// we assume that bases [0,period-1] repeat themselves and check this assumption // we assume that bases [0,period-1] repeat themselves and check this assumption
// until we find correct period // until we find correct period
for ( int pos = period ; pos < seq.length ; pos++ ) { for (int pos = period; pos < seq.length; pos++) {
int offset = pos % period; // we are currenlty 'offset' bases into the putative repeat of period 'period' int offset = pos % period; // we are currenlty 'offset' bases into the putative repeat of period 'period'
// if our current hypothesis holds, base[pos] must be the same as base[offset] // if our current hypothesis holds, base[pos] must be the same as base[offset]
if ( Character.toUpperCase( seq[pos] ) != if (Character.toUpperCase(seq[pos]) != Character.toUpperCase(seq[offset])) {
Character.toUpperCase( seq[offset] )
) { // period we have been trying so far does not work.
// two possibilities:
// period we have been trying so far does not work. // A) offset = 0, i.e. current position pos must be start of the next repeat, but it is not;
// two possibilities: // in this case only bases from start up to the current one, inclusive, may form a repeat, if at all;
// A) offset = 0, i.e. current position pos must be start of the next repeat, but it is not; // so period is at least pos+1 (remember, pos is 0-based), then on the next loop re-entrance
// in this case only bases from start up to the current one, inclusive, may form a repeat, if at all; // pos will be autoincremented and we will be checking next base
// so period is at least pos+1 (remember, pos is 0-based), then on the next loop re-entrance // B) offset != 0, i.e. the current base breaks the repeat, but maybe it starts a new one?
// pos will be autoincremented and we will be checking next base // hence we should first check if it matches the first base of the sequence, and to do that
// B) offset != 0, i.e. the current base breaks the repeat, but maybe it starts a new one? // we set period to pos (thus trying the hypothesis that bases from start up to the current one,
// hence we should first check if it matches the first base of the sequence, and to do that // non-inclusive are repeated hereafter), and decrement pos (this will re-test current base against the first base
// we set period to pos (thus trying the hypothesis that bases from start up to the current one, // on the next loop re-entrance after pos is autoincremented)
// non-inclusive are repeated hereafter), and decrement pos (this will re-test current base against the first base if (offset == 0)
// on the next loop re-entrance after pos is autoincremented) period = pos + 1;
if ( offset == 0 ) period = pos+1; else
else period = pos-- ; period = pos--;
} }
} }
return period; return period;
} }
} }

View File

@ -436,7 +436,7 @@ public class GenomeLoc implements Comparable<GenomeLoc>, Serializable, HasGenome
* never be < 1. * never be < 1.
*/ */
@Ensures("result > 0") @Ensures("result > 0")
public long size() { public int size() {
return stop - start + 1; return stop - start + 1;
} }

View File

@ -24,11 +24,17 @@
package org.broadinstitute.sting.utils; package org.broadinstitute.sting.utils;
import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement;
import net.sf.samtools.CigarOperator;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import java.util.Arrays; import java.util.Arrays;
import java.util.Iterator;
import java.util.LinkedHashMap; import java.util.LinkedHashMap;
import java.util.List; import java.util.List;
@ -109,6 +115,54 @@ public class Haplotype {
return isReference; return isReference;
} }
public byte[] insertAllele( final Allele refAllele, final Allele altAllele, int refInsertLocation, final byte[] paddedRef, final int refStart,
final Cigar haplotypeCigar, final int numBasesAddedToStartOfHaplotype, final int refHaplotypeLength ) {
if( refAllele.length() != altAllele.length() ) { refInsertLocation++; }
int haplotypeInsertLocation = getHaplotypeCoordinateForReferenceCoordinate(refStart + numBasesAddedToStartOfHaplotype, haplotypeCigar, refInsertLocation);
if( haplotypeInsertLocation == -1 ) { // desired change falls inside deletion so don't bother creating a new haplotype
return getBases().clone();
}
haplotypeInsertLocation += numBasesAddedToStartOfHaplotype;
final byte[] newHaplotype = getBases().clone();
try {
if( refAllele.length() == altAllele.length() ) { // SNP or MNP
for( int iii = 0; iii < altAllele.length(); iii++ ) {
newHaplotype[haplotypeInsertLocation+iii] = altAllele.getBases()[iii];
}
} else if( refAllele.length() < altAllele.length() ) { // insertion
final int altAlleleLength = altAllele.length();
for( int iii = newHaplotype.length -1; iii > haplotypeInsertLocation + altAlleleLength; iii-- ) {
newHaplotype[iii] = newHaplotype[iii-altAlleleLength];
}
for( int iii = 0; iii < altAlleleLength; iii++ ) {
newHaplotype[haplotypeInsertLocation+iii] = altAllele.getBases()[iii];
}
} else { // deletion
int refHaplotypeOffset = 0;
for( final CigarElement ce : haplotypeCigar.getCigarElements()) {
if(ce.getOperator() == CigarOperator.D) { refHaplotypeOffset += ce.getLength(); }
else if(ce.getOperator() == CigarOperator.I) { refHaplotypeOffset -= ce.getLength(); }
}
for( int iii = 0; iii < altAllele.length(); iii++ ) {
newHaplotype[haplotypeInsertLocation+iii] = altAllele.getBases()[iii];
}
final int shift = refAllele.length() - altAllele.length();
for( int iii = haplotypeInsertLocation + altAllele.length(); iii < newHaplotype.length - shift; iii++ ) {
newHaplotype[iii] = newHaplotype[iii+shift];
}
for( int iii = 0; iii < shift; iii++ ) {
newHaplotype[iii+newHaplotype.length-shift] = paddedRef[refStart+refHaplotypeLength+refHaplotypeOffset+iii];
}
}
} catch (Exception e) { // event already on haplotype is too large/complex to insert another allele, most likely because of not enough reference padding
return getBases().clone();
}
return newHaplotype;
}
public static LinkedHashMap<Allele,Haplotype> makeHaplotypeListFromAlleles(List<Allele> alleleList, int startPos, ReferenceContext ref, public static LinkedHashMap<Allele,Haplotype> makeHaplotypeListFromAlleles(List<Allele> alleleList, int startPos, ReferenceContext ref,
final int haplotypeSize, final int numPrefBases) { final int haplotypeSize, final int numPrefBases) {
@ -165,4 +219,84 @@ public class Haplotype {
return haplotypeMap; return haplotypeMap;
} }
private static Integer getHaplotypeCoordinateForReferenceCoordinate( final int haplotypeStart, final Cigar haplotypeCigar, final int refCoord ) {
int readBases = 0;
int refBases = 0;
boolean fallsInsideDeletion = false;
int goal = refCoord - haplotypeStart; // The goal is to move this many reference bases
boolean goalReached = refBases == goal;
Iterator<CigarElement> cigarElementIterator = haplotypeCigar.getCigarElements().iterator();
while (!goalReached && cigarElementIterator.hasNext()) {
CigarElement cigarElement = cigarElementIterator.next();
int shift = 0;
if (cigarElement.getOperator().consumesReferenceBases() || cigarElement.getOperator() == CigarOperator.SOFT_CLIP) {
if (refBases + cigarElement.getLength() < goal)
shift = cigarElement.getLength();
else
shift = goal - refBases;
refBases += shift;
}
goalReached = refBases == goal;
if (!goalReached && cigarElement.getOperator().consumesReadBases())
readBases += cigarElement.getLength();
if (goalReached) {
// Is this base's reference position within this cigar element? Or did we use it all?
boolean endsWithinCigar = shift < cigarElement.getLength();
// If it isn't, we need to check the next one. There should *ALWAYS* be a next one
// since we checked if the goal coordinate is within the read length, so this is just a sanity check.
if (!endsWithinCigar && !cigarElementIterator.hasNext())
return -1;
CigarElement nextCigarElement;
// if we end inside the current cigar element, we just have to check if it is a deletion
if (endsWithinCigar)
fallsInsideDeletion = cigarElement.getOperator() == CigarOperator.DELETION;
// if we end outside the current cigar element, we need to check if the next element is an insertion or deletion.
else {
nextCigarElement = cigarElementIterator.next();
// if it's an insertion, we need to clip the whole insertion before looking at the next element
if (nextCigarElement.getOperator() == CigarOperator.INSERTION) {
readBases += nextCigarElement.getLength();
if (!cigarElementIterator.hasNext())
return -1;
nextCigarElement = cigarElementIterator.next();
}
// if it's a deletion, we will pass the information on to be handled downstream.
fallsInsideDeletion = nextCigarElement.getOperator() == CigarOperator.DELETION;
}
// If we reached our goal outside a deletion, add the shift
if (!fallsInsideDeletion && cigarElement.getOperator().consumesReadBases())
readBases += shift;
// If we reached our goal inside a deletion, but the deletion is the next cigar element then we need
// to add the shift of the current cigar element but go back to it's last element to return the last
// base before the deletion (see warning in function contracts)
else if (fallsInsideDeletion && !endsWithinCigar)
readBases += shift - 1;
// If we reached our goal inside a deletion then we must backtrack to the last base before the deletion
else if (fallsInsideDeletion && endsWithinCigar)
readBases--;
}
}
if (!goalReached)
return -1;
return (fallsInsideDeletion ? -1 : readBases);
}
} }

View File

@ -49,7 +49,6 @@ public class MathUtils {
* high precision * high precision
*/ */
/** /**
* Private constructor. No instantiating this class! * Private constructor. No instantiating this class!
*/ */
@ -60,48 +59,48 @@ public class MathUtils {
// under/overflow checking, so this shouldn't be used in the general case (but is fine // under/overflow checking, so this shouldn't be used in the general case (but is fine
// if one is already make those checks before calling in to the rounding). // if one is already make those checks before calling in to the rounding).
public static int fastRound(double d) { public static int fastRound(double d) {
return (d > 0) ? (int)(d + 0.5d) : (int)(d - 0.5d); return (d > 0) ? (int) (d + 0.5d) : (int) (d - 0.5d);
} }
public static double approximateLog10SumLog10(final double[] vals) { public static double approximateLog10SumLog10(final double[] vals) {
return approximateLog10SumLog10(vals, vals.length); return approximateLog10SumLog10(vals, vals.length);
} }
public static double approximateLog10SumLog10(final double[] vals, final int endIndex) { public static double approximateLog10SumLog10(final double[] vals, final int endIndex) {
final int maxElementIndex = MathUtils.maxElementIndex(vals, endIndex); final int maxElementIndex = MathUtils.maxElementIndex(vals, endIndex);
double approxSum = vals[maxElementIndex]; double approxSum = vals[maxElementIndex];
if ( approxSum == Double.NEGATIVE_INFINITY ) if (approxSum == Double.NEGATIVE_INFINITY)
return approxSum; return approxSum;
for ( int i = 0; i < endIndex; i++ ) { for (int i = 0; i < endIndex; i++) {
if ( i == maxElementIndex || vals[i] == Double.NEGATIVE_INFINITY ) if (i == maxElementIndex || vals[i] == Double.NEGATIVE_INFINITY)
continue; continue;
final double diff = approxSum - vals[i]; final double diff = approxSum - vals[i];
if ( diff < MathUtils.MAX_JACOBIAN_TOLERANCE ) { if (diff < MathUtils.MAX_JACOBIAN_TOLERANCE) {
// See notes from the 2-inout implementation below // See notes from the 2-inout implementation below
final int ind = fastRound(diff / MathUtils.JACOBIAN_LOG_TABLE_STEP); // hard rounding final int ind = fastRound(diff / MathUtils.JACOBIAN_LOG_TABLE_STEP); // hard rounding
approxSum += MathUtils.jacobianLogTable[ind]; approxSum += MathUtils.jacobianLogTable[ind];
} }
} }
return approxSum; return approxSum;
} }
public static double approximateLog10SumLog10(double small, double big) { public static double approximateLog10SumLog10(double small, double big) {
// make sure small is really the smaller value // make sure small is really the smaller value
if ( small > big ) { if (small > big) {
final double t = big; final double t = big;
big = small; big = small;
small = t; small = t;
} }
if ( small == Double.NEGATIVE_INFINITY || big == Double.NEGATIVE_INFINITY ) if (small == Double.NEGATIVE_INFINITY || big == Double.NEGATIVE_INFINITY)
return big; return big;
final double diff = big - small; final double diff = big - small;
if ( diff >= MathUtils.MAX_JACOBIAN_TOLERANCE ) if (diff >= MathUtils.MAX_JACOBIAN_TOLERANCE)
return big; return big;
// OK, so |y-x| < tol: we use the following identity then: // OK, so |y-x| < tol: we use the following identity then:
@ -138,10 +137,15 @@ public class MathUtils {
return size; return size;
} }
public static double average(Collection<Integer> x) {
return (double) sum(x) / x.size();
}
public static double average(Collection<Number> numbers, boolean ignoreNan) { public static double average(Collection<Number> numbers, boolean ignoreNan) {
if (ignoreNan) { if (ignoreNan) {
return sum(numbers, true) / nonNanSize(numbers); return sum(numbers, true) / nonNanSize(numbers);
} else { }
else {
return sum(numbers, false) / nonNanSize(numbers); return sum(numbers, false) / nonNanSize(numbers);
} }
} }
@ -172,10 +176,17 @@ public class MathUtils {
public static double sum(double[] values) { public static double sum(double[] values) {
double s = 0.0; double s = 0.0;
for (double v : values) s += v; for (double v : values)
s += v;
return s; return s;
} }
public static long sum(int[] x) {
long total = 0;
for (int v : x)
total += v;
return total;
}
/** /**
* Calculates the log10 cumulative sum of an array with log10 probabilities * Calculates the log10 cumulative sum of an array with log10 probabilities
@ -218,21 +229,23 @@ public class MathUtils {
public static double sumDoubles(List<Double> values) { public static double sumDoubles(List<Double> values) {
double s = 0.0; double s = 0.0;
for (double v : values) s += v; for (double v : values)
s += v;
return s; return s;
} }
public static int sumIntegers(List<Integer> values) { public static int sumIntegers(List<Integer> values) {
int s = 0; int s = 0;
for (int v : values) s += v; for (int v : values)
s += v;
return s; return s;
} }
public static double sumLog10(double[] log10values) { public static double sumLog10(double[] log10values) {
return Math.pow(10.0, log10sumLog10(log10values)); return Math.pow(10.0, log10sumLog10(log10values));
// double s = 0.0; // double s = 0.0;
// for ( double v : log10values) s += Math.pow(10.0, v); // for ( double v : log10values) s += Math.pow(10.0, v);
// return s; // return s;
} }
public static double log10sumLog10(double[] log10values) { public static double log10sumLog10(double[] log10values) {
@ -445,7 +458,6 @@ public class MathUtils {
return Math.sqrt(rms); return Math.sqrt(rms);
} }
/** /**
* calculate the Root Mean Square of an array of integers * calculate the Root Mean Square of an array of integers
* *
@ -506,7 +518,6 @@ public class MathUtils {
return result; return result;
} }
/** /**
* normalizes the log10-based array. ASSUMES THAT ALL ARRAY ENTRIES ARE <= 0 (<= 1 IN REAL-SPACE). * normalizes the log10-based array. ASSUMES THAT ALL ARRAY ENTRIES ARE <= 0 (<= 1 IN REAL-SPACE).
* *
@ -543,7 +554,8 @@ public class MathUtils {
sum += normalized[i]; sum += normalized[i];
for (int i = 0; i < array.length; i++) { for (int i = 0; i < array.length; i++) {
double x = normalized[i] / sum; double x = normalized[i] / sum;
if (takeLog10OfOutput) x = Math.log10(x); if (takeLog10OfOutput)
x = Math.log10(x);
normalized[i] = x; normalized[i] = x;
} }
@ -565,7 +577,8 @@ public class MathUtils {
sum += normalized[i]; sum += normalized[i];
for (int i = 0; i < array.size(); i++) { for (int i = 0; i < array.size(); i++) {
double x = normalized[i] / sum; double x = normalized[i] / sum;
if (takeLog10OfOutput) x = Math.log10(x); if (takeLog10OfOutput)
x = Math.log10(x);
normalized[i] = x; normalized[i] = x;
} }
@ -587,11 +600,12 @@ public class MathUtils {
} }
public static int maxElementIndex(final double[] array) { public static int maxElementIndex(final double[] array) {
return maxElementIndex(array, array.length); return maxElementIndex(array, array.length);
} }
public static int maxElementIndex(final double[] array, final int endIndex) { public static int maxElementIndex(final double[] array, final int endIndex) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int maxI = -1; int maxI = -1;
for (int i = 0; i < endIndex; i++) { for (int i = 0; i < endIndex; i++) {
@ -603,11 +617,12 @@ public class MathUtils {
} }
public static int maxElementIndex(final int[] array) { public static int maxElementIndex(final int[] array) {
return maxElementIndex(array, array.length); return maxElementIndex(array, array.length);
} }
public static int maxElementIndex(final int[] array, int endIndex) { public static int maxElementIndex(final int[] array, int endIndex) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int maxI = -1; int maxI = -1;
for (int i = 0; i < endIndex; i++) { for (int i = 0; i < endIndex; i++) {
@ -635,7 +650,8 @@ public class MathUtils {
} }
public static int minElementIndex(double[] array) { public static int minElementIndex(double[] array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int minI = -1; int minI = -1;
for (int i = 0; i < array.length; i++) { for (int i = 0; i < array.length; i++) {
@ -647,7 +663,8 @@ public class MathUtils {
} }
public static int minElementIndex(byte[] array) { public static int minElementIndex(byte[] array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int minI = -1; int minI = -1;
for (int i = 0; i < array.length; i++) { for (int i = 0; i < array.length; i++) {
@ -659,7 +676,8 @@ public class MathUtils {
} }
public static int minElementIndex(int[] array) { public static int minElementIndex(int[] array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int minI = -1; int minI = -1;
for (int i = 0; i < array.length; i++) { for (int i = 0; i < array.length; i++) {
@ -671,20 +689,26 @@ public class MathUtils {
} }
public static int arrayMaxInt(List<Integer> array) { public static int arrayMaxInt(List<Integer> array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
if (array.size() == 0) throw new IllegalArgumentException("Array size cannot be 0!"); throw new IllegalArgumentException("Array cannot be null!");
if (array.size() == 0)
throw new IllegalArgumentException("Array size cannot be 0!");
int m = array.get(0); int m = array.get(0);
for (int e : array) m = Math.max(m, e); for (int e : array)
m = Math.max(m, e);
return m; return m;
} }
public static double arrayMaxDouble(List<Double> array) { public static double arrayMaxDouble(List<Double> array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!"); if (array == null)
if (array.size() == 0) throw new IllegalArgumentException("Array size cannot be 0!"); throw new IllegalArgumentException("Array cannot be null!");
if (array.size() == 0)
throw new IllegalArgumentException("Array size cannot be 0!");
double m = array.get(0); double m = array.get(0);
for (double e : array) m = Math.max(m, e); for (double e : array)
m = Math.max(m, e);
return m; return m;
} }
@ -722,6 +746,13 @@ public class MathUtils {
return average(vals, vals.size()); return average(vals, vals.size());
} }
public static double average(int[] x) {
int sum = 0;
for (int v : x)
sum += v;
return (double) sum / x.length;
}
public static byte average(byte[] vals) { public static byte average(byte[] vals) {
int sum = 0; int sum = 0;
for (byte v : vals) { for (byte v : vals) {
@ -798,7 +829,6 @@ public class MathUtils {
return permutation; return permutation;
} }
public static int[] permuteArray(int[] array, Integer[] permutation) { public static int[] permuteArray(int[] array, Integer[] permutation) {
int[] output = new int[array.length]; int[] output = new int[array.length];
for (int i = 0; i < output.length; i++) { for (int i = 0; i < output.length; i++) {
@ -839,7 +869,6 @@ public class MathUtils {
return output; return output;
} }
/** /**
* Draw N random elements from list. * Draw N random elements from list.
*/ */
@ -905,7 +934,8 @@ public class MathUtils {
public static <T> int countOccurrences(T x, List<T> l) { public static <T> int countOccurrences(T x, List<T> l) {
int count = 0; int count = 0;
for (T y : l) { for (T y : l) {
if (x.equals(y)) count++; if (x.equals(y))
count++;
} }
return count; return count;
@ -1013,9 +1043,11 @@ public class MathUtils {
for (Comparable y : list) { for (Comparable y : list) {
if (x.compareTo(y) > 0) { if (x.compareTo(y) > 0) {
lessThanX.add(y); lessThanX.add(y);
} else if (x.compareTo(y) < 0) { }
else if (x.compareTo(y) < 0) {
greaterThanX.add(y); greaterThanX.add(y);
} else }
else
equalToX.add(y); equalToX.add(y);
} }
@ -1028,7 +1060,6 @@ public class MathUtils {
} }
public static Object getMedian(List<Comparable> list) { public static Object getMedian(List<Comparable> list) {
return orderStatisticSearch((int) Math.ceil(list.size() / 2), list); return orderStatisticSearch((int) Math.ceil(list.size() / 2), list);
} }
@ -1058,10 +1089,12 @@ public class MathUtils {
if (quality < qk) { if (quality < qk) {
lessThanQReads.add(read); lessThanQReads.add(read);
lessThanQOffsets.add(offset); lessThanQOffsets.add(offset);
} else if (quality > qk) { }
else if (quality > qk) {
greaterThanQReads.add(read); greaterThanQReads.add(read);
greaterThanQOffsets.add(offset); greaterThanQOffsets.add(offset);
} else { }
else {
equalToQReads.add(reads.get(iter)); equalToQReads.add(reads.get(iter));
} }
} }
@ -1079,6 +1112,13 @@ public class MathUtils {
return getQScoreOrderStatistic(reads, offsets, (int) Math.floor(reads.size() / 2.)); return getQScoreOrderStatistic(reads, offsets, (int) Math.floor(reads.size() / 2.));
} }
public static long sum(Collection<Integer> x) {
long sum = 0;
for (int v : x)
sum += v;
return sum;
}
/** /**
* A utility class that computes on the fly average and standard deviation for a stream of numbers. * A utility class that computes on the fly average and standard deviation for a stream of numbers.
* The number of observations does not have to be known in advance, and can be also very big (so that * The number of observations does not have to be known in advance, and can be also very big (so that
@ -1184,8 +1224,7 @@ public class MathUtils {
log10Cache[k] = Math.log10(k); log10Cache[k] = Math.log10(k);
for (int k = 0; k < JACOBIAN_LOG_TABLE_SIZE; k++) { for (int k = 0; k < JACOBIAN_LOG_TABLE_SIZE; k++) {
jacobianLogTable[k] = Math.log10(1.0 + Math.pow(10.0, -((double) k) jacobianLogTable[k] = Math.log10(1.0 + Math.pow(10.0, -((double) k) * JACOBIAN_LOG_TABLE_STEP));
* JACOBIAN_LOG_TABLE_STEP));
} }
} }
@ -1232,7 +1271,8 @@ public class MathUtils {
else if (diff >= 0) { else if (diff >= 0) {
int ind = (int) (diff * INV_JACOBIAN_LOG_TABLE_STEP + 0.5); int ind = (int) (diff * INV_JACOBIAN_LOG_TABLE_STEP + 0.5);
return x + jacobianLogTable[ind]; return x + jacobianLogTable[ind];
} else { }
else {
int ind = (int) (-diff * INV_JACOBIAN_LOG_TABLE_STEP + 0.5); int ind = (int) (-diff * INV_JACOBIAN_LOG_TABLE_STEP + 0.5);
return y + jacobianLogTable[ind]; return y + jacobianLogTable[ind];
} }
@ -1273,71 +1313,7 @@ public class MathUtils {
/** /**
* Constants to simplify the log gamma function calculation. * Constants to simplify the log gamma function calculation.
*/ */
private static final double private static final double zero = 0.0, one = 1.0, half = .5, a0 = 7.72156649015328655494e-02, a1 = 3.22467033424113591611e-01, a2 = 6.73523010531292681824e-02, a3 = 2.05808084325167332806e-02, a4 = 7.38555086081402883957e-03, a5 = 2.89051383673415629091e-03, a6 = 1.19270763183362067845e-03, a7 = 5.10069792153511336608e-04, a8 = 2.20862790713908385557e-04, a9 = 1.08011567247583939954e-04, a10 = 2.52144565451257326939e-05, a11 = 4.48640949618915160150e-05, tc = 1.46163214496836224576e+00, tf = -1.21486290535849611461e-01, tt = -3.63867699703950536541e-18, t0 = 4.83836122723810047042e-01, t1 = -1.47587722994593911752e-01, t2 = 6.46249402391333854778e-02, t3 = -3.27885410759859649565e-02, t4 = 1.79706750811820387126e-02, t5 = -1.03142241298341437450e-02, t6 = 6.10053870246291332635e-03, t7 = -3.68452016781138256760e-03, t8 = 2.25964780900612472250e-03, t9 = -1.40346469989232843813e-03, t10 = 8.81081882437654011382e-04, t11 = -5.38595305356740546715e-04, t12 = 3.15632070903625950361e-04, t13 = -3.12754168375120860518e-04, t14 = 3.35529192635519073543e-04, u0 = -7.72156649015328655494e-02, u1 = 6.32827064025093366517e-01, u2 = 1.45492250137234768737e+00, u3 = 9.77717527963372745603e-01, u4 = 2.28963728064692451092e-01, u5 = 1.33810918536787660377e-02, v1 = 2.45597793713041134822e+00, v2 = 2.12848976379893395361e+00, v3 = 7.69285150456672783825e-01, v4 = 1.04222645593369134254e-01, v5 = 3.21709242282423911810e-03, s0 = -7.72156649015328655494e-02, s1 = 2.14982415960608852501e-01, s2 = 3.25778796408930981787e-01, s3 = 1.46350472652464452805e-01, s4 = 2.66422703033638609560e-02, s5 = 1.84028451407337715652e-03, s6 = 3.19475326584100867617e-05, r1 = 1.39200533467621045958e+00, r2 = 7.21935547567138069525e-01, r3 = 1.71933865632803078993e-01, r4 = 1.86459191715652901344e-02, r5 = 7.77942496381893596434e-04, r6 = 7.32668430744625636189e-06, w0 = 4.18938533204672725052e-01, w1 = 8.33333333333329678849e-02, w2 = -2.77777777728775536470e-03, w3 = 7.93650558643019558500e-04, w4 = -5.95187557450339963135e-04, w5 = 8.36339918996282139126e-04, w6 = -1.63092934096575273989e-03;
zero = 0.0,
one = 1.0,
half = .5,
a0 = 7.72156649015328655494e-02,
a1 = 3.22467033424113591611e-01,
a2 = 6.73523010531292681824e-02,
a3 = 2.05808084325167332806e-02,
a4 = 7.38555086081402883957e-03,
a5 = 2.89051383673415629091e-03,
a6 = 1.19270763183362067845e-03,
a7 = 5.10069792153511336608e-04,
a8 = 2.20862790713908385557e-04,
a9 = 1.08011567247583939954e-04,
a10 = 2.52144565451257326939e-05,
a11 = 4.48640949618915160150e-05,
tc = 1.46163214496836224576e+00,
tf = -1.21486290535849611461e-01,
tt = -3.63867699703950536541e-18,
t0 = 4.83836122723810047042e-01,
t1 = -1.47587722994593911752e-01,
t2 = 6.46249402391333854778e-02,
t3 = -3.27885410759859649565e-02,
t4 = 1.79706750811820387126e-02,
t5 = -1.03142241298341437450e-02,
t6 = 6.10053870246291332635e-03,
t7 = -3.68452016781138256760e-03,
t8 = 2.25964780900612472250e-03,
t9 = -1.40346469989232843813e-03,
t10 = 8.81081882437654011382e-04,
t11 = -5.38595305356740546715e-04,
t12 = 3.15632070903625950361e-04,
t13 = -3.12754168375120860518e-04,
t14 = 3.35529192635519073543e-04,
u0 = -7.72156649015328655494e-02,
u1 = 6.32827064025093366517e-01,
u2 = 1.45492250137234768737e+00,
u3 = 9.77717527963372745603e-01,
u4 = 2.28963728064692451092e-01,
u5 = 1.33810918536787660377e-02,
v1 = 2.45597793713041134822e+00,
v2 = 2.12848976379893395361e+00,
v3 = 7.69285150456672783825e-01,
v4 = 1.04222645593369134254e-01,
v5 = 3.21709242282423911810e-03,
s0 = -7.72156649015328655494e-02,
s1 = 2.14982415960608852501e-01,
s2 = 3.25778796408930981787e-01,
s3 = 1.46350472652464452805e-01,
s4 = 2.66422703033638609560e-02,
s5 = 1.84028451407337715652e-03,
s6 = 3.19475326584100867617e-05,
r1 = 1.39200533467621045958e+00,
r2 = 7.21935547567138069525e-01,
r3 = 1.71933865632803078993e-01,
r4 = 1.86459191715652901344e-02,
r5 = 7.77942496381893596434e-04,
r6 = 7.32668430744625636189e-06,
w0 = 4.18938533204672725052e-01,
w1 = 8.33333333333329678849e-02,
w2 = -2.77777777728775536470e-03,
w3 = 7.93650558643019558500e-04,
w4 = -5.95187557450339963135e-04,
w5 = 8.36339918996282139126e-04,
w6 = -1.63092934096575273989e-03;
/** /**
* Efficient rounding functions to simplify the log gamma function calculation * Efficient rounding functions to simplify the log gamma function calculation
@ -1368,14 +1344,17 @@ public class MathUtils {
/* purge off +-inf, NaN, +-0, and negative arguments */ /* purge off +-inf, NaN, +-0, and negative arguments */
int ix = hx & 0x7fffffff; int ix = hx & 0x7fffffff;
if (ix >= 0x7ff00000) return Double.POSITIVE_INFINITY; if (ix >= 0x7ff00000)
if ((ix | lx) == 0 || hx < 0) return Double.NaN; return Double.POSITIVE_INFINITY;
if ((ix | lx) == 0 || hx < 0)
return Double.NaN;
if (ix < 0x3b900000) { /* |x|<2**-70, return -log(|x|) */ if (ix < 0x3b900000) { /* |x|<2**-70, return -log(|x|) */
return -Math.log(x); return -Math.log(x);
} }
/* purge off 1 and 2 */ /* purge off 1 and 2 */
if ((((ix - 0x3ff00000) | lx) == 0) || (((ix - 0x40000000) | lx) == 0)) r = 0; if ((((ix - 0x3ff00000) | lx) == 0) || (((ix - 0x40000000) | lx) == 0))
r = 0;
/* for x < 2.0 */ /* for x < 2.0 */
else if (ix < 0x40000000) { else if (ix < 0x40000000) {
if (ix <= 0x3feccccc) { /* lgamma(x) = lgamma(x+1)-log(x) */ if (ix <= 0x3feccccc) { /* lgamma(x) = lgamma(x+1)-log(x) */
@ -1383,22 +1362,27 @@ public class MathUtils {
if (ix >= 0x3FE76944) { if (ix >= 0x3FE76944) {
y = one - x; y = one - x;
i = 0; i = 0;
} else if (ix >= 0x3FCDA661) { }
else if (ix >= 0x3FCDA661) {
y = x - (tc - one); y = x - (tc - one);
i = 1; i = 1;
} else { }
else {
y = x; y = x;
i = 2; i = 2;
} }
} else { }
else {
r = zero; r = zero;
if (ix >= 0x3FFBB4C3) { if (ix >= 0x3FFBB4C3) {
y = 2.0 - x; y = 2.0 - x;
i = 0; i = 0;
} /* [1.7316,2] */ else if (ix >= 0x3FF3B4C4) { } /* [1.7316,2] */
else if (ix >= 0x3FF3B4C4) {
y = x - tc; y = x - tc;
i = 1; i = 1;
} /* [1.23,1.73] */ else { } /* [1.23,1.73] */
else {
y = x - one; y = x - one;
i = 2; i = 2;
} }
@ -1426,7 +1410,8 @@ public class MathUtils {
p2 = one + y * (v1 + y * (v2 + y * (v3 + y * (v4 + y * v5)))); p2 = one + y * (v1 + y * (v2 + y * (v3 + y * (v4 + y * v5))));
r += (-0.5 * y + p1 / p2); r += (-0.5 * y + p1 / p2);
} }
} else if (ix < 0x40200000) { /* x < 8.0 */ }
else if (ix < 0x40200000) { /* x < 8.0 */
i = (int) x; i = (int) x;
t = zero; t = zero;
y = x - (double) i; y = x - (double) i;
@ -1449,13 +1434,15 @@ public class MathUtils {
break; break;
} }
/* 8.0 <= x < 2**58 */ /* 8.0 <= x < 2**58 */
} else if (ix < 0x43900000) { }
else if (ix < 0x43900000) {
t = Math.log(x); t = Math.log(x);
z = one / x; z = one / x;
y = z * z; y = z * z;
w = w0 + z * (w1 + y * (w2 + y * (w3 + y * (w4 + y * (w5 + y * w6))))); w = w0 + z * (w1 + y * (w2 + y * (w3 + y * (w4 + y * (w5 + y * w6)))));
r = (x - half) * (t - one) + w; r = (x - half) * (t - one) + w;
} else }
else
/* 2**58 <= x <= inf */ /* 2**58 <= x <= inf */
r = x * (Math.log(x) - one); r = x * (Math.log(x) - one);
return r; return r;
@ -1490,7 +1477,6 @@ public class MathUtils {
return log10BinomialCoefficient(n, k) + log10p * k + log10OneMinusP * (n - k); return log10BinomialCoefficient(n, k) + log10p * k + log10OneMinusP * (n - k);
} }
/** /**
* Calculates the log10 of the multinomial coefficient. Designed to prevent * Calculates the log10 of the multinomial coefficient. Designed to prevent
* overflows even with very large numbers. * overflows even with very large numbers.
@ -1534,7 +1520,6 @@ public class MathUtils {
return log10Gamma(x + 1); return log10Gamma(x + 1);
} }
/** /**
* Adds two arrays together and returns a new array with the sum. * Adds two arrays together and returns a new array with the sum.
* *
@ -1572,17 +1557,18 @@ public class MathUtils {
/** /**
* Vector operations * Vector operations
*
* @param v1 first numerical array * @param v1 first numerical array
* @param v2 second numerical array * @param v2 second numerical array
* @return a new array with the elements added * @return a new array with the elements added
*/ */
public static <E extends Number> Double[] vectorSum(E v1[], E v2[]) { public static <E extends Number> Double[] vectorSum(E v1[], E v2[]) {
if (v1.length != v2.length) if (v1.length != v2.length)
throw new UserException("BUG: vectors v1, v2 of different size in vectorSum()"); throw new UserException("BUG: vectors v1, v2 of different size in vectorSum()");
Double[] result = new Double[v1.length]; Double[] result = new Double[v1.length];
for (int k=0; k < v1.length; k++) for (int k = 0; k < v1.length; k++)
result[k] = v1[k].doubleValue()+v2[k].doubleValue(); result[k] = v1[k].doubleValue() + v2[k].doubleValue();
return result; return result;
} }
@ -1590,19 +1576,19 @@ public class MathUtils {
public static <E extends Number> Double[] scalarTimesVector(E a, E[] v1) { public static <E extends Number> Double[] scalarTimesVector(E a, E[] v1) {
Double result[] = new Double[v1.length]; Double result[] = new Double[v1.length];
for (int k=0; k < v1.length; k++) for (int k = 0; k < v1.length; k++)
result[k] = a.doubleValue()*v1[k].doubleValue(); result[k] = a.doubleValue() * v1[k].doubleValue();
return result; return result;
} }
public static <E extends Number> Double dotProduct(E[] v1, E[] v2) { public static <E extends Number> Double dotProduct(E[] v1, E[] v2) {
if (v1.length != v2.length) if (v1.length != v2.length)
throw new UserException("BUG: vectors v1, v2 of different size in vectorSum()"); throw new UserException("BUG: vectors v1, v2 of different size in vectorSum()");
Double result = 0.0; Double result = 0.0;
for (int k=0; k < v1.length; k++) for (int k = 0; k < v1.length; k++)
result += v1[k].doubleValue() *v2[k].doubleValue(); result += v1[k].doubleValue() * v2[k].doubleValue();
return result; return result;
@ -1610,7 +1596,7 @@ public class MathUtils {
public static double[] vectorLog10(double v1[]) { public static double[] vectorLog10(double v1[]) {
double result[] = new double[v1.length]; double result[] = new double[v1.length];
for (int k=0; k < v1.length; k++) for (int k = 0; k < v1.length; k++)
result[k] = Math.log10(v1[k]); result[k] = Math.log10(v1[k]);
return result; return result;
@ -1620,7 +1606,7 @@ public class MathUtils {
// todo - silly overloading, just because Java can't unbox/box arrays of primitive types, and we can't do generics with primitive types! // todo - silly overloading, just because Java can't unbox/box arrays of primitive types, and we can't do generics with primitive types!
public static Double[] vectorLog10(Double v1[]) { public static Double[] vectorLog10(Double v1[]) {
Double result[] = new Double[v1.length]; Double result[] = new Double[v1.length];
for (int k=0; k < v1.length; k++) for (int k = 0; k < v1.length; k++)
result[k] = Math.log10(v1[k]); result[k] = Math.log10(v1[k]);
return result; return result;

View File

@ -87,7 +87,7 @@ public enum NGSPlatform {
/** /**
* Returns the NGSPlatform corresponding to the PL tag in the read group * Returns the NGSPlatform corresponding to the PL tag in the read group
* @param plFromRG -- the PL field (or equivalent) in a ReadGroup object * @param plFromRG -- the PL field (or equivalent) in a ReadGroup object
* @return an NGSPlatform object matching the PL field of the header, of UNKNOWN if there was no match * @return an NGSPlatform object matching the PL field of the header, or UNKNOWN if there was no match
*/ */
public static final NGSPlatform fromReadGroupPL(final String plFromRG) { public static final NGSPlatform fromReadGroupPL(final String plFromRG) {
if ( plFromRG == null ) return UNKNOWN; if ( plFromRG == null ) return UNKNOWN;
@ -105,4 +105,14 @@ public enum NGSPlatform {
return UNKNOWN; return UNKNOWN;
} }
/**
* checks whether or not the requested platform is listed in the set (and is not unknown)
*
* @param platform the read group string that describes the platform used
* @return true if the platform is known (i.e. it's in the list and is not UNKNOWN)
*/
public static final boolean isKnown (final String platform) {
return fromReadGroupPL(platform) != UNKNOWN;
}
} }

View File

@ -55,6 +55,14 @@ public class QualityUtils {
return qualToErrorProbCache[(int)qual & 0xff]; // Map: 127 -> 127; -128 -> 128; -1 -> 255; etc. return qualToErrorProbCache[(int)qual & 0xff]; // Map: 127 -> 127; -128 -> 128; -1 -> 255; etc.
} }
static public double[] qualArrayToLog10ErrorProb(byte[] quals) {
double[] returnArray = new double[quals.length];
for( int iii = 0; iii < quals.length; iii++ ) {
returnArray[iii] = ((double) quals[iii])/-10.0;
}
return returnArray;
}
/** /**
* Convert a probability to a quality score. Note, this is capped at Q40. * Convert a probability to a quality score. Note, this is capped at Q40.
* *

View File

@ -673,7 +673,7 @@ public class BAQ {
} }
/** /**
* Returns true if we don't think this read is eligable for the BAQ calculation. Examples include non-PF reads, * Returns true if we don't think this read is eligible for the BAQ calculation. Examples include non-PF reads,
* duplicates, or unmapped reads. Used by baqRead to determine if a read should fall through the calculation. * duplicates, or unmapped reads. Used by baqRead to determine if a read should fall through the calculation.
* *
* @param read * @param read

View File

@ -34,7 +34,7 @@ public class BAQSamIterator implements StingSAMIterator {
"cmode != null" , "cmode != null" ,
"qmode != null"}) "qmode != null"})
public BAQSamIterator(IndexedFastaSequenceFile refReader, StingSAMIterator it, BAQ.CalculationMode cmode, BAQ.QualityMode qmode) { public BAQSamIterator(IndexedFastaSequenceFile refReader, StingSAMIterator it, BAQ.CalculationMode cmode, BAQ.QualityMode qmode) {
if ( cmode == BAQ.CalculationMode.OFF) throw new ReviewedStingException("BUG: shouldn't create BAQSamIterator with calculation mode OFF"); if ( cmode == BAQ.CalculationMode.OFF ) throw new ReviewedStingException("BUG: shouldn't create BAQSamIterator with calculation mode OFF");
if ( qmode == BAQ.QualityMode.DONT_MODIFY ) throw new ReviewedStingException("BUG: shouldn't create BAQSamIterator with quailty mode DONT_MODIFY"); if ( qmode == BAQ.QualityMode.DONT_MODIFY ) throw new ReviewedStingException("BUG: shouldn't create BAQSamIterator with quailty mode DONT_MODIFY");
this.refReader = refReader; this.refReader = refReader;

View File

@ -4,6 +4,7 @@ import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement; import net.sf.samtools.CigarElement;
import net.sf.samtools.CigarOperator; import net.sf.samtools.CigarOperator;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.gatk.walkers.bqsr.RecalDataManager;
import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
@ -150,13 +151,23 @@ public class FragmentUtils {
final int numBases = firstReadStop + secondRead.getReadLength(); final int numBases = firstReadStop + secondRead.getReadLength();
final byte[] bases = new byte[numBases]; final byte[] bases = new byte[numBases];
final byte[] quals = new byte[numBases]; final byte[] quals = new byte[numBases];
// BUGBUG: too verbose, clean this up.
final byte[] insertionQuals = new byte[numBases];
final byte[] deletionQuals = new byte[numBases];
final byte[] firstReadBases = firstRead.getReadBases(); final byte[] firstReadBases = firstRead.getReadBases();
final byte[] firstReadQuals = firstRead.getBaseQualities(); final byte[] firstReadQuals = firstRead.getBaseQualities();
final byte[] firstReadInsertionQuals = firstRead.getBaseInsertionQualities();
final byte[] firstReadDeletionQuals = firstRead.getBaseDeletionQualities();
final byte[] secondReadBases = secondRead.getReadBases(); final byte[] secondReadBases = secondRead.getReadBases();
final byte[] secondReadQuals = secondRead.getBaseQualities(); final byte[] secondReadQuals = secondRead.getBaseQualities();
final byte[] secondReadInsertionQuals = secondRead.getBaseInsertionQualities();
final byte[] secondReadDeletionQuals = secondRead.getBaseDeletionQualities();
for(int iii = 0; iii < firstReadStop; iii++) { for(int iii = 0; iii < firstReadStop; iii++) {
bases[iii] = firstReadBases[iii]; bases[iii] = firstReadBases[iii];
quals[iii] = firstReadQuals[iii]; quals[iii] = firstReadQuals[iii];
insertionQuals[iii] = firstReadInsertionQuals[iii];
deletionQuals[iii] = firstReadDeletionQuals[iii];
} }
for(int iii = firstReadStop; iii < firstRead.getReadLength(); iii++) { for(int iii = firstReadStop; iii < firstRead.getReadLength(); iii++) {
if( firstReadQuals[iii] > MIN_QUAL_BAD_OVERLAP && secondReadQuals[iii-firstReadStop] > MIN_QUAL_BAD_OVERLAP && firstReadBases[iii] != secondReadBases[iii-firstReadStop] ) { if( firstReadQuals[iii] > MIN_QUAL_BAD_OVERLAP && secondReadQuals[iii-firstReadStop] > MIN_QUAL_BAD_OVERLAP && firstReadBases[iii] != secondReadBases[iii-firstReadStop] ) {
@ -164,16 +175,22 @@ public class FragmentUtils {
} }
bases[iii] = ( firstReadQuals[iii] > secondReadQuals[iii-firstReadStop] ? firstReadBases[iii] : secondReadBases[iii-firstReadStop] ); bases[iii] = ( firstReadQuals[iii] > secondReadQuals[iii-firstReadStop] ? firstReadBases[iii] : secondReadBases[iii-firstReadStop] );
quals[iii] = ( firstReadQuals[iii] > secondReadQuals[iii-firstReadStop] ? firstReadQuals[iii] : secondReadQuals[iii-firstReadStop] ); quals[iii] = ( firstReadQuals[iii] > secondReadQuals[iii-firstReadStop] ? firstReadQuals[iii] : secondReadQuals[iii-firstReadStop] );
insertionQuals[iii] = ( firstReadQuals[iii] > secondReadQuals[iii-firstReadStop] ? firstReadInsertionQuals[iii] : secondReadInsertionQuals[iii-firstReadStop] ); // Purposefully checking the highest base quality score
deletionQuals[iii] = ( firstReadQuals[iii] > secondReadQuals[iii-firstReadStop] ? firstReadDeletionQuals[iii] : secondReadDeletionQuals[iii-firstReadStop] ); // Purposefully checking the highest base quality score
} }
for(int iii = firstRead.getReadLength(); iii < numBases; iii++) { for(int iii = firstRead.getReadLength(); iii < numBases; iii++) {
bases[iii] = secondReadBases[iii-firstReadStop]; bases[iii] = secondReadBases[iii-firstReadStop];
quals[iii] = secondReadQuals[iii-firstReadStop]; quals[iii] = secondReadQuals[iii-firstReadStop];
insertionQuals[iii] = secondReadInsertionQuals[iii-firstReadStop];
deletionQuals[iii] = secondReadDeletionQuals[iii-firstReadStop];
} }
final GATKSAMRecord returnRead = new GATKSAMRecord(firstRead.getHeader()); final GATKSAMRecord returnRead = new GATKSAMRecord(firstRead.getHeader());
returnRead.setAlignmentStart(firstRead.getUnclippedStart()); returnRead.setAlignmentStart(firstRead.getUnclippedStart());
returnRead.setReadBases( bases ); returnRead.setReadBases( bases );
returnRead.setBaseQualities( quals ); returnRead.setBaseQualities( quals, RecalDataManager.BaseRecalibrationType.BASE_SUBSTITUTION );
returnRead.setBaseQualities( insertionQuals, RecalDataManager.BaseRecalibrationType.BASE_INSERTION );
returnRead.setBaseQualities( deletionQuals, RecalDataManager.BaseRecalibrationType.BASE_DELETION );
returnRead.setReadGroup( firstRead.getReadGroup() ); returnRead.setReadGroup( firstRead.getReadGroup() );
returnRead.setReferenceName( firstRead.getReferenceName() ); returnRead.setReferenceName( firstRead.getReferenceName() );
final CigarElement c = new CigarElement(bases.length, CigarOperator.M); final CigarElement c = new CigarElement(bases.length, CigarOperator.M);

View File

@ -314,10 +314,10 @@ public class IntervalUtils {
* @param reference The reference for the intervals. * @param reference The reference for the intervals.
* @return A map of contig names with their sizes. * @return A map of contig names with their sizes.
*/ */
public static Map<String, Long> getContigSizes(File reference) { public static Map<String, Integer> getContigSizes(File reference) {
ReferenceDataSource referenceSource = new ReferenceDataSource(reference); ReferenceDataSource referenceSource = new ReferenceDataSource(reference);
List<GenomeLoc> locs = GenomeLocSortedSet.createSetFromSequenceDictionary(referenceSource.getReference().getSequenceDictionary()).toList(); List<GenomeLoc> locs = GenomeLocSortedSet.createSetFromSequenceDictionary(referenceSource.getReference().getSequenceDictionary()).toList();
Map<String, Long> lengths = new LinkedHashMap<String, Long>(); Map<String, Integer> lengths = new LinkedHashMap<String, Integer>();
for (GenomeLoc loc: locs) for (GenomeLoc loc: locs)
lengths.put(loc.getContig(), loc.size()); lengths.put(loc.getContig(), loc.size());
return lengths; return lengths;

View File

@ -177,7 +177,7 @@ public abstract class AbstractReadBackedPileup<RBP extends AbstractReadBackedPil
for (int i = 0; i < reads.size(); i++) { for (int i = 0; i < reads.size(); i++) {
GATKSAMRecord read = reads.get(i); GATKSAMRecord read = reads.get(i);
int offset = offsets.get(i); int offset = offsets.get(i);
pileup.add(createNewPileupElement(read, offset, false, false, false)); // only used to create fake pileups for testing so ancillary information is not important pileup.add(createNewPileupElement(read, offset, false, false, false, false)); // only used to create fake pileups for testing so ancillary information is not important
} }
return pileup; return pileup;
@ -196,7 +196,7 @@ public abstract class AbstractReadBackedPileup<RBP extends AbstractReadBackedPil
UnifiedPileupElementTracker<PE> pileup = new UnifiedPileupElementTracker<PE>(); UnifiedPileupElementTracker<PE> pileup = new UnifiedPileupElementTracker<PE>();
for (GATKSAMRecord read : reads) { for (GATKSAMRecord read : reads) {
pileup.add(createNewPileupElement(read, offset, false, false, false)); // only used to create fake pileups for testing so ancillary information is not important pileup.add(createNewPileupElement(read, offset, false, false, false, false)); // only used to create fake pileups for testing so ancillary information is not important
} }
return pileup; return pileup;
@ -204,7 +204,7 @@ public abstract class AbstractReadBackedPileup<RBP extends AbstractReadBackedPil
protected abstract AbstractReadBackedPileup<RBP, PE> createNewPileup(GenomeLoc loc, PileupElementTracker<PE> pileupElementTracker); protected abstract AbstractReadBackedPileup<RBP, PE> createNewPileup(GenomeLoc loc, PileupElementTracker<PE> pileupElementTracker);
protected abstract PE createNewPileupElement(GATKSAMRecord read, int offset, boolean isDeletion, boolean isBeforeInsertion, boolean isNextToSoftClip); protected abstract PE createNewPileupElement(GATKSAMRecord read, int offset, boolean isDeletion, boolean isBeforeDeletion, boolean isBeforeInsertion, boolean isNextToSoftClip);
// -------------------------------------------------------- // --------------------------------------------------------
// //

View File

@ -48,7 +48,7 @@ public class ExtendedEventPileupElement extends PileupElement {
public ExtendedEventPileupElement(GATKSAMRecord read, int offset, int eventLength, String eventBases, Type type) { public ExtendedEventPileupElement(GATKSAMRecord read, int offset, int eventLength, String eventBases, Type type) {
super(read, offset, type == Type.DELETION, false, false); // extended events are slated for removal super(read, offset, type == Type.DELETION, false, false, false); // extended events are slated for removal
this.read = read; this.read = read;
this.offset = offset; this.offset = offset;
this.eventLength = eventLength; this.eventLength = eventLength;

View File

@ -24,16 +24,17 @@ public class PileupElement implements Comparable<PileupElement> {
protected final GATKSAMRecord read; protected final GATKSAMRecord read;
protected final int offset; protected final int offset;
protected final boolean isDeletion; protected final boolean isDeletion;
protected final boolean isBeforeDeletion;
protected final boolean isBeforeInsertion; protected final boolean isBeforeInsertion;
protected final boolean isNextToSoftClip; protected final boolean isNextToSoftClip;
/** /**
* Creates a new pileup element. * Creates a new pileup element.
* *
* @param read the read we are adding to the pileup * @param read the read we are adding to the pileup
* @param offset the position in the read for this base. All deletions must be left aligned! (-1 is only allowed for reads starting with insertions) * @param offset the position in the read for this base. All deletions must be left aligned! (-1 is only allowed for reads starting with insertions)
* @param isDeletion whether or not this base is a deletion * @param isDeletion whether or not this base is a deletion
* @param isBeforeDeletion whether or not this base is before a deletion
* @param isBeforeInsertion whether or not this base is before an insertion * @param isBeforeInsertion whether or not this base is before an insertion
* @param isNextToSoftClip whether or not this base is next to a soft clipped base * @param isNextToSoftClip whether or not this base is next to a soft clipped base
*/ */
@ -41,13 +42,14 @@ public class PileupElement implements Comparable<PileupElement> {
"read != null", "read != null",
"offset >= -1", "offset >= -1",
"offset <= read.getReadLength()"}) "offset <= read.getReadLength()"})
public PileupElement(final GATKSAMRecord read, final int offset, final boolean isDeletion, final boolean isBeforeInsertion, final boolean isNextToSoftClip) { public PileupElement(final GATKSAMRecord read, final int offset, final boolean isDeletion, final boolean isBeforeDeletion, final boolean isBeforeInsertion, final boolean isNextToSoftClip) {
if (offset < 0 && isDeletion) if (offset < 0 && isDeletion)
throw new ReviewedStingException("Pileup Element cannot create a deletion with a negative offset"); throw new ReviewedStingException("Pileup Element cannot create a deletion with a negative offset");
this.read = read; this.read = read;
this.offset = offset; this.offset = offset;
this.isDeletion = isDeletion; this.isDeletion = isDeletion;
this.isBeforeDeletion = isBeforeDeletion;
this.isBeforeInsertion = isBeforeInsertion; this.isBeforeInsertion = isBeforeInsertion;
this.isNextToSoftClip = isNextToSoftClip; this.isNextToSoftClip = isNextToSoftClip;
} }
@ -56,6 +58,10 @@ public class PileupElement implements Comparable<PileupElement> {
return isDeletion; return isDeletion;
} }
public boolean isBeforeDeletion() {
return isBeforeDeletion;
}
public boolean isBeforeInsertion() { public boolean isBeforeInsertion() {
return isBeforeInsertion; return isBeforeInsertion;
} }
@ -89,6 +95,14 @@ public class PileupElement implements Comparable<PileupElement> {
public byte getQual() { public byte getQual() {
return getQual(offset); return getQual(offset);
} }
public byte getBaseInsertionQual() {
return getBaseInsertionQual(offset);
}
public byte getBaseDeletionQual() {
return getBaseDeletionQual(offset);
}
public int getMappingQual() { public int getMappingQual() {
return read.getMappingQuality(); return read.getMappingQuality();
@ -111,6 +125,14 @@ public class PileupElement implements Comparable<PileupElement> {
return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseQualities()[offset]; return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseQualities()[offset];
} }
protected byte getBaseInsertionQual(final int offset) {
return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseInsertionQualities()[offset];
}
protected byte getBaseDeletionQual(final int offset) {
return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseDeletionQualities()[offset];
}
@Override @Override
public int compareTo(final PileupElement pileupElement) { public int compareTo(final PileupElement pileupElement) {
if (offset < pileupElement.offset) if (offset < pileupElement.offset)

View File

@ -96,7 +96,7 @@ public class ReadBackedExtendedEventPileupImpl extends AbstractReadBackedPileup<
} }
@Override @Override
protected ExtendedEventPileupElement createNewPileupElement(GATKSAMRecord read, int offset, boolean isDeletion, boolean isBeforeInsertion, boolean isNextToSoftClip) { protected ExtendedEventPileupElement createNewPileupElement(GATKSAMRecord read, int offset, boolean isDeletion, boolean isBeforeDeletion, boolean isBeforeInsertion, boolean isNextToSoftClip) {
throw new UnsupportedOperationException("Not enough information provided to create a new pileup element"); throw new UnsupportedOperationException("Not enough information provided to create a new pileup element");
} }

View File

@ -71,7 +71,7 @@ public class ReadBackedPileupImpl extends AbstractReadBackedPileup<ReadBackedPil
} }
@Override @Override
protected PileupElement createNewPileupElement(GATKSAMRecord read, int offset, boolean isDeletion, boolean isBeforeInsertion, boolean isNextToSoftClip) { protected PileupElement createNewPileupElement(GATKSAMRecord read, int offset, boolean isDeletion, boolean isBeforeDeletion, boolean isBeforeInsertion, boolean isNextToSoftClip) {
return new PileupElement(read, offset, isDeletion, isBeforeInsertion, isNextToSoftClip); return new PileupElement(read, offset, isDeletion, isBeforeDeletion, isBeforeInsertion, isNextToSoftClip);
} }
} }

View File

@ -0,0 +1,50 @@
package org.broadinstitute.sting.utils.recalibration;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.gatk.iterators.StingSAMIterator;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Iterator;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 2/13/12
*/
public class BQSRSamIterator implements StingSAMIterator {
private final StingSAMIterator it;
private final BaseRecalibration bqsr;
/**
* Creates a new BQSRSamIterator and applies BQSR on the fly to incoming reads.
*
* @param it The incoming SamIterator to wrap
* @param bqsr The object which holds the BQSR table information and knows how to apply it
*/
@Requires({
"it != null",
"bqsr != null"})
public BQSRSamIterator(StingSAMIterator it, BaseRecalibration bqsr) {
if ( bqsr == null ) throw new ReviewedStingException("BUG: shouldn't create BQSRSamIterator with null recalibration object");
this.it = it;
this.bqsr = bqsr;
}
@Requires("hasNext()")
@Ensures("result != null")
public SAMRecord next() {
SAMRecord read = it.next();
bqsr.recalibrateRead((GATKSAMRecord) read);
return read;
}
public boolean hasNext() { return this.it.hasNext(); }
public void remove() { throw new UnsupportedOperationException("Can not remove records from a SAM file via an iterator!"); }
public void close() { it.close(); }
public Iterator<SAMRecord> iterator() { return this; }
}

View File

@ -0,0 +1,280 @@
/*
* Copyright (c) 2012 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.utils.recalibration;
import org.broadinstitute.sting.gatk.walkers.bqsr.*;
import org.broadinstitute.sting.utils.QualityUtils;
import org.broadinstitute.sting.utils.classloader.PluginManager;
import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.text.XReadLines;
import java.io.File;
import java.io.FileNotFoundException;
import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;
import java.util.regex.Pattern;
/**
* Utility methods to facilitate on-the-fly base quality score recalibration.
*
* User: rpoplin
* Date: 2/4/12
*/
public class BaseRecalibration {
private RecalDataManager dataManager; // Holds the data HashMap, mostly used by TableRecalibrationWalker to create collapsed data hashmaps
private final ArrayList<Covariate> requestedCovariates = new ArrayList<Covariate>(); // List of covariates to be used in this calculation
public static final Pattern COMMENT_PATTERN = Pattern.compile("^#.*");
public static final Pattern COVARIATE_PATTERN = Pattern.compile("^ReadGroup,QualityScore,.*");
public static final String EOF_MARKER = "EOF";
private static final int MAX_QUALITY_SCORE = 65; //BUGBUG: what value to use here?
private NestedHashMap qualityScoreByFullCovariateKey = new NestedHashMap(); // Caches the result of performSequentialQualityCalculation(...) for all sets of covariate values.
public BaseRecalibration( final File RECAL_FILE ) {
// Get a list of all available covariates
final List<Class<? extends Covariate>> classes = new PluginManager<Covariate>(Covariate.class).getPlugins();
int lineNumber = 0;
boolean foundAllCovariates = false;
// Read in the data from the csv file and populate the data map and covariates list
boolean sawEOF = false;
try {
for ( String line : new XReadLines(RECAL_FILE) ) {
lineNumber++;
if ( EOF_MARKER.equals(line) ) {
sawEOF = true;
} else if( COMMENT_PATTERN.matcher(line).matches() ) {
; // Skip over the comment lines, (which start with '#')
}
// Read in the covariates that were used from the input file
else if( COVARIATE_PATTERN.matcher(line).matches() ) { // The line string is either specifying a covariate or is giving csv data
if( foundAllCovariates ) {
throw new UserException.MalformedFile( RECAL_FILE, "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE );
} else { // Found the covariate list in input file, loop through all of them and instantiate them
String[] vals = line.split(",");
for( int iii = 0; iii < vals.length - 4; iii++ ) { // There are n-4 covariates. The last four items are ErrorModel, nObservations, nMismatch, and Qempirical
boolean foundClass = false;
for( Class<?> covClass : classes ) {
if( (vals[iii] + "Covariate").equalsIgnoreCase( covClass.getSimpleName() ) ) {
foundClass = true;
try {
Covariate covariate = (Covariate)covClass.newInstance();
requestedCovariates.add( covariate );
} catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e);
}
}
}
if( !foundClass ) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option." );
}
}
}
} else { // Found a line of data
if( !foundAllCovariates ) {
foundAllCovariates = true;
// At this point all the covariates should have been found and initialized
if( requestedCovariates.size() < 2 ) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration csv file. Covariate names can't be found in file: " + RECAL_FILE );
}
final boolean createCollapsedTables = true;
// Initialize any covariate member variables using the shared argument collection
RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
for( Covariate cov : requestedCovariates ) {
cov.initialize( RAC );
}
// Initialize the data hashMaps
dataManager = new RecalDataManager( createCollapsedTables, requestedCovariates.size() );
}
addCSVData(RECAL_FILE, line); // Parse the line and add the data to the HashMap
}
}
} catch ( FileNotFoundException e ) {
throw new UserException.CouldNotReadInputFile(RECAL_FILE, "Can not find input file", e);
} catch ( NumberFormatException e ) {
throw new UserException.MalformedFile(RECAL_FILE, "Error parsing recalibration data at line " + lineNumber + ". Perhaps your table was generated by an older version of CovariateCounterWalker.");
}
if ( !sawEOF ) {
final String errorMessage = "No EOF marker was present in the recal covariates table; this could mean that the file is corrupted or was generated with an old version of the CountCovariates tool.";
throw new UserException.MalformedFile(RECAL_FILE, errorMessage);
}
if( dataManager == null ) {
throw new UserException.MalformedFile(RECAL_FILE, "Can't initialize the data manager. Perhaps the recal csv file contains no data?");
}
dataManager.generateEmpiricalQualities( 1, MAX_QUALITY_SCORE );
}
/**
* For each covariate read in a value and parse it. Associate those values with the data itself (num observation and num mismatches)
* @param line A line of CSV data read from the recalibration table data file
*/
private void addCSVData(final File file, final String line) {
final String[] vals = line.split(",");
// Check if the data line is malformed, for example if the read group string contains a comma then it won't be parsed correctly
if( vals.length != requestedCovariates.size() + 4 ) { // +4 because of ErrorModel, nObservations, nMismatch, and Qempirical
throw new UserException.MalformedFile(file, "Malformed input recalibration file. Found data line with too many fields: " + line +
" --Perhaps the read group string contains a comma and isn't being parsed correctly.");
}
final Object[] key = new Object[requestedCovariates.size()];
Covariate cov;
int iii;
for( iii = 0; iii < requestedCovariates.size(); iii++ ) {
cov = requestedCovariates.get( iii );
key[iii] = cov.getValue( vals[iii] );
}
final String modelString = vals[iii++];
final RecalDataManager.BaseRecalibrationType errorModel = CovariateKeySet.getErrorModelFromString(modelString);
// Create a new datum using the number of observations, number of mismatches, and reported quality score
final RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 );
// Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, QualityUtils.MIN_USABLE_Q_SCORE, errorModel ); //BUGBUG: used to be Q5 now is Q6, probably doesn't matter
}
public void recalibrateRead( final GATKSAMRecord read ) {
//compute all covariate values for this read
RecalDataManager.computeCovariates(read, requestedCovariates);
final CovariateKeySet covariateKeySet = RecalDataManager.getAllCovariateValuesFor( read );
for( final RecalDataManager.BaseRecalibrationType errorModel : RecalDataManager.BaseRecalibrationType.values() ) {
final byte[] originalQuals = read.getBaseQualities( errorModel );
final byte[] recalQuals = originalQuals.clone();
// For each base in the read
for( int offset = 0; offset < read.getReadLength(); offset++ ) {
final Object[] fullCovariateKeyWithErrorMode = covariateKeySet.getKeySet(offset, errorModel);
final Object[] fullCovariateKey = Arrays.copyOfRange(fullCovariateKeyWithErrorMode, 0, fullCovariateKeyWithErrorMode.length-1); // need to strip off the error mode which was appended to the list of covariates
// BUGBUG: This caching seems to put the entire key set into memory which negates the benefits of storing the delta delta tables?
//Byte qualityScore = (Byte) qualityScoreByFullCovariateKey.get(fullCovariateKeyWithErrorMode);
//if( qualityScore == null ) {
final byte qualityScore = performSequentialQualityCalculation( errorModel, fullCovariateKey );
// qualityScoreByFullCovariateKey.put(qualityScore, fullCovariateKeyWithErrorMode);
//}
recalQuals[offset] = qualityScore;
}
preserveQScores( originalQuals, recalQuals ); // Overwrite the work done if original quality score is too low
read.setBaseQualities( recalQuals, errorModel );
}
}
/**
* Implements a serial recalibration of the reads using the combinational table.
* First, we perform a positional recalibration, and then a subsequent dinuc correction.
*
* Given the full recalibration table, we perform the following preprocessing steps:
*
* - calculate the global quality score shift across all data [DeltaQ]
* - calculate for each of cycle and dinuc the shift of the quality scores relative to the global shift
* -- i.e., DeltaQ(dinuc) = Sum(pos) Sum(Qual) Qempirical(pos, qual, dinuc) - Qreported(pos, qual, dinuc) / Npos * Nqual
* - The final shift equation is:
*
* Qrecal = Qreported + DeltaQ + DeltaQ(pos) + DeltaQ(dinuc) + DeltaQ( ... any other covariate ... )
* @param key The list of Comparables that were calculated from the covariates
* @return A recalibrated quality score as a byte
*/
private byte performSequentialQualityCalculation( final RecalDataManager.BaseRecalibrationType errorModel, final Object... key ) {
final byte qualFromRead = (byte)Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3];
// The global quality shift (over the read group only)
readGroupCollapsedKey[0] = key[0];
final RecalDatum globalRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(0, errorModel).get( readGroupCollapsedKey ));
double globalDeltaQ = 0.0;
if( globalRecalDatum != null ) {
final double globalDeltaQEmpirical = globalRecalDatum.getEmpiricalQuality();
final double aggregrateQReported = globalRecalDatum.getEstimatedQReported();
globalDeltaQ = globalDeltaQEmpirical - aggregrateQReported;
}
// The shift in quality between reported and empirical
qualityScoreCollapsedKey[0] = key[0];
qualityScoreCollapsedKey[1] = key[1];
final RecalDatum qReportedRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(1, errorModel).get( qualityScoreCollapsedKey ));
double deltaQReported = 0.0;
if( qReportedRecalDatum != null ) {
final double deltaQReportedEmpirical = qReportedRecalDatum.getEmpiricalQuality();
deltaQReported = deltaQReportedEmpirical - qualFromRead - globalDeltaQ;
}
// The shift in quality due to each covariate by itself in turn
double deltaQCovariates = 0.0;
double deltaQCovariateEmpirical;
covariateCollapsedKey[0] = key[0];
covariateCollapsedKey[1] = key[1];
for( int iii = 2; iii < key.length; iii++ ) {
covariateCollapsedKey[2] = key[iii]; // The given covariate
final RecalDatum covariateRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(iii, errorModel).get( covariateCollapsedKey ));
if( covariateRecalDatum != null ) {
deltaQCovariateEmpirical = covariateRecalDatum.getEmpiricalQuality();
deltaQCovariates += ( deltaQCovariateEmpirical - qualFromRead - (globalDeltaQ + deltaQReported) );
}
}
final double newQuality = qualFromRead + globalDeltaQ + deltaQReported + deltaQCovariates;
return QualityUtils.boundQual( (int)Math.round(newQuality), (byte)MAX_QUALITY_SCORE );
}
/**
* Loop over the list of qualities and overwrite the newly recalibrated score to be the original score if it was less than some threshold
* @param originalQuals The list of original base quality scores
* @param recalQuals A list of the new recalibrated quality scores
*/
private void preserveQScores( final byte[] originalQuals, final byte[] recalQuals ) {
for( int iii = 0; iii < recalQuals.length; iii++ ) {
if( originalQuals[iii] < QualityUtils.MIN_USABLE_Q_SCORE ) { //BUGBUG: used to be Q5 now is Q6, probably doesn't matter
recalQuals[iii] = originalQuals[iii];
}
}
}
}

View File

@ -361,10 +361,10 @@ public class ArtificialSAMUtils {
final GATKSAMRecord left = pair.get(0); final GATKSAMRecord left = pair.get(0);
final GATKSAMRecord right = pair.get(1); final GATKSAMRecord right = pair.get(1);
pileupElements.add(new PileupElement(left, pos - leftStart, false, false, false)); pileupElements.add(new PileupElement(left, pos - leftStart, false, false, false, false));
if (pos >= right.getAlignmentStart() && pos <= right.getAlignmentEnd()) { if (pos >= right.getAlignmentStart() && pos <= right.getAlignmentEnd()) {
pileupElements.add(new PileupElement(right, pos - rightStart, false, false, false)); pileupElements.add(new PileupElement(right, pos - rightStart, false, false, false, false));
} }
} }

View File

@ -25,8 +25,11 @@
package org.broadinstitute.sting.utils.sam; package org.broadinstitute.sting.utils.sam;
import net.sf.samtools.*; import net.sf.samtools.*;
import org.broadinstitute.sting.gatk.walkers.bqsr.RecalDataManager;
import org.broadinstitute.sting.utils.NGSPlatform; import org.broadinstitute.sting.utils.NGSPlatform;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.Arrays;
import java.util.HashMap; import java.util.HashMap;
import java.util.Map; import java.util.Map;
@ -48,6 +51,10 @@ public class GATKSAMRecord extends BAMRecord {
public static final String REDUCED_READ_ORIGINAL_ALIGNMENT_START_SHIFT = "OP"; // reads that are clipped may use this attribute to keep track of their original alignment start public static final String REDUCED_READ_ORIGINAL_ALIGNMENT_START_SHIFT = "OP"; // reads that are clipped may use this attribute to keep track of their original alignment start
public static final String REDUCED_READ_ORIGINAL_ALIGNMENT_END_SHIFT = "OE"; // reads that are clipped may use this attribute to keep track of their original alignment end public static final String REDUCED_READ_ORIGINAL_ALIGNMENT_END_SHIFT = "OE"; // reads that are clipped may use this attribute to keep track of their original alignment end
// Base Quality Score Recalibrator specific attribute tags
public static final String BQSR_BASE_INSERTION_QUALITIES = "BI";
public static final String BQSR_BASE_DELETION_QUALITIES = "BD";
// the SAMRecord data we're caching // the SAMRecord data we're caching
private String mReadString = null; private String mReadString = null;
private GATKSAMReadGroupRecord mReadGroup = null; private GATKSAMReadGroupRecord mReadGroup = null;
@ -155,6 +162,60 @@ public class GATKSAMRecord extends BAMRecord {
return super.equals(o); return super.equals(o);
} }
/**
* Setters and Accessors for base insertion and base deletion quality scores
*/
public void setBaseQualities( final byte[] quals, final RecalDataManager.BaseRecalibrationType errorModel ) {
switch( errorModel ) {
case BASE_SUBSTITUTION:
setBaseQualities(quals);
break;
case BASE_INSERTION:
setAttribute( GATKSAMRecord.BQSR_BASE_INSERTION_QUALITIES, SAMUtils.phredToFastq(quals) );
break;
case BASE_DELETION:
setAttribute( GATKSAMRecord.BQSR_BASE_DELETION_QUALITIES, SAMUtils.phredToFastq(quals) );
break;
default:
throw new ReviewedStingException("Unrecognized Base Recalibration type: " + errorModel );
}
}
public byte[] getBaseQualities( final RecalDataManager.BaseRecalibrationType errorModel ) {
switch( errorModel ) {
case BASE_SUBSTITUTION:
return getBaseQualities();
case BASE_INSERTION:
return getBaseInsertionQualities();
case BASE_DELETION:
return getBaseDeletionQualities();
default:
throw new ReviewedStingException("Unrecognized Base Recalibration type: " + errorModel );
}
}
public byte[] getBaseInsertionQualities() {
byte[] quals = SAMUtils.fastqToPhred( getStringAttribute( BQSR_BASE_INSERTION_QUALITIES ) );
if( quals == null ) {
quals = new byte[getBaseQualities().length];
Arrays.fill(quals, (byte) 45); // Some day in the future when base insertion and base deletion quals exist the samtools API will
// be updated and the original quals will be pulled here, but for now we assume the original quality is a flat Q45
setBaseQualities(quals, RecalDataManager.BaseRecalibrationType.BASE_INSERTION);
}
return quals;
}
public byte[] getBaseDeletionQualities() {
byte[] quals = SAMUtils.fastqToPhred( getStringAttribute( BQSR_BASE_DELETION_QUALITIES ) );
if( quals == null ) {
quals = new byte[getBaseQualities().length];
Arrays.fill(quals, (byte) 45); // Some day in the future when base insertion and base deletion quals exist the samtools API will
// be updated and the original quals will be pulled here, but for now we assume the original quality is a flat Q45
setBaseQualities(quals, RecalDataManager.BaseRecalibrationType.BASE_DELETION);
}
return quals;
}
/** /**
* Efficient caching accessor that returns the GATK NGSPlatform of this read * Efficient caching accessor that returns the GATK NGSPlatform of this read
* @return * @return
@ -198,12 +259,10 @@ public class GATKSAMRecord extends BAMRecord {
return (i==0) ? firstCount : (byte) Math.min(firstCount + offsetCount, Byte.MAX_VALUE); return (i==0) ? firstCount : (byte) Math.min(firstCount + offsetCount, Byte.MAX_VALUE);
} }
/////////////////////////////////////////////////////////////////////////////// ///////////////////////////////////////////////////////////////////////////////
// *** GATKSAMRecord specific methods ***// // *** GATKSAMRecord specific methods ***//
/////////////////////////////////////////////////////////////////////////////// ///////////////////////////////////////////////////////////////////////////////
/** /**
* Checks whether an attribute has been set for the given key. * Checks whether an attribute has been set for the given key.
* *

View File

@ -920,6 +920,9 @@ public class VariantContext implements Feature { // to enable tribble intergrati
} }
public void validateReferenceBases(Allele reference, Byte paddedRefBase) { public void validateReferenceBases(Allele reference, Byte paddedRefBase) {
if ( reference == null )
return;
// don't validate if we're a complex event // don't validate if we're a complex event
if ( !isComplexIndel() && !reference.isNull() && !reference.basesMatch(getReference()) ) { if ( !isComplexIndel() && !reference.isNull() && !reference.basesMatch(getReference()) ) {
throw new TribbleException.InternalCodecException(String.format("the REF allele is incorrect for the record at position %s:%d, fasta says %s vs. VCF says %s", getChr(), getStart(), reference.getBaseString(), getReference().getBaseString())); throw new TribbleException.InternalCodecException(String.format("the REF allele is incorrect for the record at position %s:%d, fasta says %s vs. VCF says %s", getChr(), getStart(), reference.getBaseString(), getReference().getBaseString()));
@ -963,6 +966,9 @@ public class VariantContext implements Feature { // to enable tribble intergrati
} }
public void validateChromosomeCounts() { public void validateChromosomeCounts() {
if ( !hasGenotypes() )
return;
// AN // AN
if ( hasAttribute(VCFConstants.ALLELE_NUMBER_KEY) ) { if ( hasAttribute(VCFConstants.ALLELE_NUMBER_KEY) ) {
int reportedAN = Integer.valueOf(getAttribute(VCFConstants.ALLELE_NUMBER_KEY).toString()); int reportedAN = Integer.valueOf(getAttribute(VCFConstants.ALLELE_NUMBER_KEY).toString());
@ -993,7 +999,7 @@ public class VariantContext implements Feature { // to enable tribble intergrati
throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag doesn't have the correct number of values for the record at position %s:%d, %d vs. %d", getChr(), getStart(), reportedACs.size(), observedACs.size())); throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag doesn't have the correct number of values for the record at position %s:%d, %d vs. %d", getChr(), getStart(), reportedACs.size(), observedACs.size()));
for (int i = 0; i < observedACs.size(); i++) { for (int i = 0; i < observedACs.size(); i++) {
if ( Integer.valueOf(reportedACs.get(i).toString()) != observedACs.get(i) ) if ( Integer.valueOf(reportedACs.get(i).toString()) != observedACs.get(i) )
throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag is incorrect for the record at position %s:%d, %d vs. %d", getChr(), getStart(), reportedACs.get(i), observedACs.get(i))); throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag is incorrect for the record at position %s:%d, %s vs. %d", getChr(), getStart(), reportedACs.get(i), observedACs.get(i)));
} }
} else { } else {
if ( observedACs.size() != 1 ) if ( observedACs.size() != 1 )

View File

@ -50,7 +50,10 @@ public class GATKBAMFileSpanUnitTest {
} }
@Test @Test
public void testUnionOfOverlappingFileSpans() { public void testUnionOfContiguousFileSpans() {
// Region 1 ends at position adjacent to Region 2 start:
// |---1----|---2----|
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(0,1<<16)); GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(0,1<<16));
GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535)); GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535));
GATKBAMFileSpan union = regionOne.union(regionTwo); GATKBAMFileSpan union = regionOne.union(regionTwo);
@ -58,6 +61,71 @@ public class GATKBAMFileSpanUnitTest {
Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(0,(1<<16)|65535)); Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(0,(1<<16)|65535));
} }
@Test
public void testUnionOfFileSpansFirstRegionEndsWithinSecondRegion() {
// Region 1 ends within Region 2:
// |---2----|
// |---1----|
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(0,(1<<16)|32767));
GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535));
GATKBAMFileSpan union = regionOne.union(regionTwo);
Assert.assertEquals(union.getGATKChunks().size(),1,"Elements to be merged were not.");
Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(0,(1<<16)|65535));
}
@Test
public void testUnionOfFileSpansFirstRegionEndsAtSecondRegionEnd() {
// Region 1 ends at Region 2 end:
// |---2----|
// |---1-----------|
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(0,(1<<16)|65535));
GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535));
GATKBAMFileSpan union = regionOne.union(regionTwo);
Assert.assertEquals(union.getGATKChunks().size(),1,"Elements to be merged were not.");
Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(0,(1<<16)|65535));
}
@Test
public void testUnionOfFileSpansFirstRegionEndsAfterSecondRegionEnd() {
// Region 1 ends after Region 2 end:
// |---2----|
// |---1---------------|
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(0,(1<<16)|65535));
GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|32767));
GATKBAMFileSpan union = regionOne.union(regionTwo);
Assert.assertEquals(union.getGATKChunks().size(),1,"Elements to be merged were not.");
Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(0,(1<<16)|65535));
}
@Test
public void testUnionOfFileSpansFirstRegionStartsAtSecondRegionStart() {
// Region 1 starts at Region 2 start, but ends before Region 2:
// |---2--------|
// |---1----|
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|32767));
GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535));
GATKBAMFileSpan union = regionOne.union(regionTwo);
Assert.assertEquals(union.getGATKChunks().size(),1,"Elements to be merged were not.");
Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(1<<16,(1<<16)|65535));
}
@Test
public void testUnionOfFileSpansFirstRegionEqualToSecondRegion() {
// Region 1 and Region 2 represent the same region:
// |---2----|
// |---1----|
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535));
GATKBAMFileSpan regionTwo = new GATKBAMFileSpan(new GATKChunk(1<<16,(1<<16)|65535));
GATKBAMFileSpan union = regionOne.union(regionTwo);
Assert.assertEquals(union.getGATKChunks().size(),1,"Elements to be merged were not.");
Assert.assertEquals(union.getGATKChunks().get(0),new GATKChunk(1<<16,(1<<16)|65535));
}
@Test @Test
public void testUnionOfStringOfFileSpans() { public void testUnionOfStringOfFileSpans() {
GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk[] { new GATKChunk(0,1<<16), new GATKChunk(2<<16,3<<16) }); GATKBAMFileSpan regionOne = new GATKBAMFileSpan(new GATKChunk[] { new GATKChunk(0,1<<16), new GATKChunk(2<<16,3<<16) });

View File

@ -79,7 +79,8 @@ public class DownsamplerBenchmark extends ReadProcessingBenchmark {
false, false,
BAQ.CalculationMode.OFF, BAQ.CalculationMode.OFF,
BAQ.QualityMode.DONT_MODIFY, BAQ.QualityMode.DONT_MODIFY,
null, null, // no BAQ
null, // no BQSR
(byte)0); (byte)0);
GenomeLocParser genomeLocParser = new GenomeLocParser(reader.getFileHeader().getSequenceDictionary()); GenomeLocParser genomeLocParser = new GenomeLocParser(reader.getFileHeader().getSequenceDictionary());

View File

@ -308,6 +308,7 @@ public class LocusIteratorByStateUnitTest extends BaseTest {
BAQ.CalculationMode.OFF, BAQ.CalculationMode.OFF,
BAQ.QualityMode.DONT_MODIFY, BAQ.QualityMode.DONT_MODIFY,
null, // no BAQ null, // no BAQ
null, // no BQSR
(byte) -1 (byte) -1
); );
} }

View File

@ -30,7 +30,7 @@ import org.testng.annotations.DataProvider;
import org.testng.annotations.Test; import org.testng.annotations.Test;
public class GATKReportUnitTest extends BaseTest { public class GATKReportUnitTest extends BaseTest {
@Test @Test(enabled = false)
public void testParse() throws Exception { public void testParse() throws Exception {
String reportPath = validationDataLocation + "exampleGATKReport.eval"; String reportPath = validationDataLocation + "exampleGATKReport.eval";
GATKReport report = new GATKReport(reportPath); GATKReport report = new GATKReport(reportPath);

View File

@ -179,7 +179,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest {
@Test @Test
public void testTDTAnnotation() { public void testTDTAnnotation() {
final String MD5 = "0aedd760e8099f0b95d53a41bdcd793e"; final String MD5 = "a78c1e950740d3c13c0258960c5fa8e1";
WalkerTestSpec spec = new WalkerTestSpec( WalkerTestSpec spec = new WalkerTestSpec(
"-T VariantAnnotator -R " + b37KGReference + " -A TransmissionDisequilibriumTest --variant:vcf " + validationDataLocation + "ug.random50000.subset300bp.chr1.family.vcf" + "-T VariantAnnotator -R " + b37KGReference + " -A TransmissionDisequilibriumTest --variant:vcf " + validationDataLocation + "ug.random50000.subset300bp.chr1.family.vcf" +
" -L " + validationDataLocation + "ug.random50000.subset300bp.chr1.family.vcf -NO_HEADER -ped " + validationDataLocation + "ug.random50000.family.ped -o %s", 1, " -L " + validationDataLocation + "ug.random50000.subset300bp.chr1.family.vcf -NO_HEADER -ped " + validationDataLocation + "ug.random50000.family.ped -o %s", 1,

View File

@ -15,9 +15,9 @@ import java.util.Map;
public class UnifiedGenotyperIntegrationTest extends WalkerTest { public class UnifiedGenotyperIntegrationTest extends WalkerTest {
private final static String baseCommand = "-T UnifiedGenotyper -R " + b36KGReference + " -NO_HEADER -glm BOTH --dbsnp " + b36dbSNP129; private final static String baseCommand = "-T UnifiedGenotyper -R " + b36KGReference + " -nosl -NO_HEADER -glm BOTH --dbsnp " + b36dbSNP129;
private final static String baseCommandIndels = "-T UnifiedGenotyper -R " + b36KGReference + " -NO_HEADER -glm INDEL -mbq 20 --dbsnp " + b36dbSNP129; private final static String baseCommandIndels = "-T UnifiedGenotyper -R " + b36KGReference + " -nosl -NO_HEADER -glm INDEL -mbq 20 --dbsnp " + b36dbSNP129;
private final static String baseCommandIndelsb37 = "-T UnifiedGenotyper -R " + b37KGReference + " -NO_HEADER -glm INDEL -mbq 20 --dbsnp " + b37dbSNP132; private final static String baseCommandIndelsb37 = "-T UnifiedGenotyper -R " + b37KGReference + " -nosl -NO_HEADER -glm INDEL -mbq 20 --dbsnp " + b37dbSNP132;
// -------------------------------------------------------------------------------------------------------------- // --------------------------------------------------------------------------------------------------------------
// //
@ -28,7 +28,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testMultiSamplePilot1() { public void testMultiSamplePilot1() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
baseCommand + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10,022,000-10,025,000", 1, baseCommand + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10,022,000-10,025,000", 1,
Arrays.asList("653172b43b19003d9f7df6dab21f4b09")); Arrays.asList("202b337ebbea3def1be8495eb363dfa8"));
executeTest("test MultiSample Pilot1", spec); executeTest("test MultiSample Pilot1", spec);
} }
@ -56,6 +56,14 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
executeTest("test SingleSample Pilot2", spec); executeTest("test SingleSample Pilot2", spec);
} }
@Test
public void testMultipleSNPAlleles() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b37KGReference + " -nosl -NO_HEADER -glm BOTH --dbsnp " + b37dbSNP129 + " -I " + validationDataLocation + "multiallelic.snps.bam -o %s -L " + validationDataLocation + "multiallelic.snps.intervals", 1,
Arrays.asList("b53cb55a5f868663068812b13578af57"));
executeTest("test Multiple SNP alleles", spec);
}
// -------------------------------------------------------------------------------------------------------------- // --------------------------------------------------------------------------------------------------------------
// //
// testing compressed output // testing compressed output
@ -114,8 +122,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
@Test @Test
public void testCallingParameters() { public void testCallingParameters() {
HashMap<String, String> e = new HashMap<String, String>(); HashMap<String, String> e = new HashMap<String, String>();
e.put( "--min_base_quality_score 26", "7acb1a5aee5fdadb0cc0ea07a212efc6" ); e.put( "--min_base_quality_score 26", "258c1b33349eb3b2d395ec4d69302725" );
e.put( "--computeSLOD", "6172d2f3d370132f4c57a26aa94c256e" );
for ( Map.Entry<String, String> entry : e.entrySet() ) { for ( Map.Entry<String, String> entry : e.entrySet() ) {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
@ -125,6 +132,14 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
} }
} }
@Test
public void testSLOD() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b36KGReference + " -NO_HEADER -glm BOTH --dbsnp " + b36dbSNP129 + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,010,000", 1,
Arrays.asList("6172d2f3d370132f4c57a26aa94c256e"));
executeTest("test SLOD", spec);
}
@Test @Test
public void testOutputParameter() { public void testOutputParameter() {
HashMap<String, String> e = new HashMap<String, String>(); HashMap<String, String> e = new HashMap<String, String>();
@ -285,7 +300,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
WalkerTest.WalkerTestSpec spec3 = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec3 = new WalkerTest.WalkerTestSpec(
baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "ALL.wgs.union_v2.20101123.indels.sites.vcf -I " + validationDataLocation + baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "ALL.wgs.union_v2.20101123.indels.sites.vcf -I " + validationDataLocation +
"pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,080,000", 1, "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,080,000", 1,
Arrays.asList("d356cbaf240d7025d1aecdabaff3a3e0")); Arrays.asList("c9897b80615c53a4ea10a4b193d56d9c"));
executeTest("test MultiSample Pilot2 indels with complicated records", spec3); executeTest("test MultiSample Pilot2 indels with complicated records", spec3);
} }
@ -294,7 +309,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
WalkerTest.WalkerTestSpec spec4 = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec4 = new WalkerTest.WalkerTestSpec(
baseCommandIndelsb37 + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "ALL.wgs.union_v2_chr20_100_110K.20101123.indels.sites.vcf -I " + validationDataLocation + baseCommandIndelsb37 + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "ALL.wgs.union_v2_chr20_100_110K.20101123.indels.sites.vcf -I " + validationDataLocation +
"phase1_GBR_realigned.chr20.100K-110K.bam -o %s -L 20:100,000-110,000", 1, "phase1_GBR_realigned.chr20.100K-110K.bam -o %s -L 20:100,000-110,000", 1,
Arrays.asList("1d1956fd7b0f0d30935674b2f5019860")); Arrays.asList("5282fdb1711a532d726c13507bf80a21"));
executeTest("test MultiSample Phase1 indels with complicated records", spec4); executeTest("test MultiSample Phase1 indels with complicated records", spec4);
} }

View File

@ -27,10 +27,8 @@ package org.broadinstitute.sting.gatk.walkers.variantutils;
import org.broadinstitute.sting.WalkerTest; import org.broadinstitute.sting.WalkerTest;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.testng.annotations.Test; import org.testng.annotations.Test;
import org.testng.annotations.DataProvider;
import java.util.*; import java.util.*;
import java.io.File;
public class VariantsToTableIntegrationTest extends WalkerTest { public class VariantsToTableIntegrationTest extends WalkerTest {
private String variantsToTableCmd(String moreArgs) { private String variantsToTableCmd(String moreArgs) {
@ -38,7 +36,15 @@ public class VariantsToTableIntegrationTest extends WalkerTest {
" --variant:vcf " + validationDataLocation + "/soap_gatk_annotated.vcf" + " --variant:vcf " + validationDataLocation + "/soap_gatk_annotated.vcf" +
" -T VariantsToTable" + " -T VariantsToTable" +
" -F CHROM -F POS -F ID -F REF -F ALT -F QUAL -F FILTER -F TRANSITION -F DP -F SB -F set -F RankSumP -F refseq.functionalClass*" + " -F CHROM -F POS -F ID -F REF -F ALT -F QUAL -F FILTER -F TRANSITION -F DP -F SB -F set -F RankSumP -F refseq.functionalClass*" +
" -L chr1 -KMA -o %s" + moreArgs; " -L chr1 -o %s" + moreArgs;
}
private String variantsToTableMultiAllelicCmd(String moreArgs) {
return "-R " + b37KGReference +
" --variant " + validationDataLocation + "/multiallelic.vcf" +
" -T VariantsToTable" +
" -F CHROM -F POS -F ID -F REF -F ALT -F QUAL -F MULTI-ALLELIC -F AC -F AF" +
" -o %s" + moreArgs;
} }
@Test(enabled = true) @Test(enabled = true)
@ -53,4 +59,18 @@ public class VariantsToTableIntegrationTest extends WalkerTest {
WalkerTestSpec spec = new WalkerTestSpec(variantsToTableCmd(""), 1, UserException.class); WalkerTestSpec spec = new WalkerTestSpec(variantsToTableCmd(""), 1, UserException.class);
executeTest("testComplexVariantsToTable-FAIL", spec); executeTest("testComplexVariantsToTable-FAIL", spec);
} }
@Test(enabled = true)
public void testMultiAllelicOneRecord() {
WalkerTestSpec spec = new WalkerTestSpec(variantsToTableMultiAllelicCmd(""),
Arrays.asList("13dd36c08be6c800f23988e6000d963e"));
executeTest("testMultiAllelicOneRecord", spec).getFirst();
}
@Test(enabled = true)
public void testMultiAllelicSplitRecords() {
WalkerTestSpec spec = new WalkerTestSpec(variantsToTableMultiAllelicCmd(" -SMA"),
Arrays.asList("17a0fc80409d2fc00ad2bbb94b3a346b"));
executeTest("testMultiAllelicSplitRecords", spec).getFirst();
}
} }

View File

@ -8,13 +8,12 @@ import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.commandline.IntervalBinding; import org.broadinstitute.sting.commandline.IntervalBinding;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource; import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource;
import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.testng.Assert;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile;
import org.testng.Assert;
import org.testng.annotations.BeforeClass; import org.testng.annotations.BeforeClass;
import org.testng.annotations.DataProvider; import org.testng.annotations.DataProvider;
import org.testng.annotations.Test; import org.testng.annotations.Test;
@ -341,7 +340,7 @@ public class IntervalUtilsUnitTest extends BaseTest {
@Test @Test
public void testGetContigLengths() { public void testGetContigLengths() {
Map<String, Long> lengths = IntervalUtils.getContigSizes(new File(BaseTest.hg18Reference)); Map<String, Integer> lengths = IntervalUtils.getContigSizes(new File(BaseTest.hg18Reference));
Assert.assertEquals((long)lengths.get("chr1"), 247249719); Assert.assertEquals((long)lengths.get("chr1"), 247249719);
Assert.assertEquals((long)lengths.get("chr2"), 242951149); Assert.assertEquals((long)lengths.get("chr2"), 242951149);
Assert.assertEquals((long)lengths.get("chr3"), 199501827); Assert.assertEquals((long)lengths.get("chr3"), 199501827);

View File

@ -42,8 +42,8 @@ public class GATKSAMRecordUnitTest extends BaseTest {
@Test @Test
public void testReducedReadPileupElement() { public void testReducedReadPileupElement() {
PileupElement readp = new PileupElement(read, 0, false, false, false); PileupElement readp = new PileupElement(read, 0, false, false, false, false);
PileupElement reducedreadp = new PileupElement(reducedRead, 0, false, false, false); PileupElement reducedreadp = new PileupElement(reducedRead, 0, false, false, false, false);
Assert.assertFalse(readp.getRead().isReducedRead()); Assert.assertFalse(readp.getRead().isReducedRead());

View File

@ -26,7 +26,7 @@ package org.broadinstitute.sting.queue.extensions.gatk
import java.io.File import java.io.File
import collection.JavaConversions._ import collection.JavaConversions._
import org.broadinstitute.sting.utils.interval.IntervalUtils import org.broadinstitute.sting.utils.interval.{IntervalMergingRule, IntervalUtils}
import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource
import net.sf.samtools.SAMFileHeader import net.sf.samtools.SAMFileHeader
import java.util.Collections import java.util.Collections
@ -50,6 +50,8 @@ case class GATKIntervals(reference: File, intervals: Seq[String]) {
IntervalUtils.parseIntervalArguments(parser, intervals) IntervalUtils.parseIntervalArguments(parser, intervals)
Collections.sort(parsedLocs) Collections.sort(parsedLocs)
Collections.unmodifiableList(parsedLocs) Collections.unmodifiableList(parsedLocs)
val mergedLocs = IntervalUtils.mergeIntervalLocations(parsedLocs, IntervalMergingRule.OVERLAPPING_ONLY)
Collections.unmodifiableList(mergedLocs)
} }
lazy val contigs = locs.map(_.getContig).distinct.toSeq lazy val contigs = locs.map(_.getContig).distinct.toSeq

View File

@ -32,6 +32,7 @@ import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource
import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile
import org.broadinstitute.sting.utils.{GenomeLocSortedSet, GenomeLocParser} import org.broadinstitute.sting.utils.{GenomeLocSortedSet, GenomeLocParser}
import collection.JavaConversions._ import collection.JavaConversions._
import org.broadinstitute.sting.utils.interval.IntervalUtils
class GATKIntervalsUnitTest { class GATKIntervalsUnitTest {
private final lazy val hg18Reference = new File(BaseTest.hg18Reference) private final lazy val hg18Reference = new File(BaseTest.hg18Reference)
@ -60,7 +61,7 @@ class GATKIntervalsUnitTest {
// for(Item item: javaConvertedScalaList) // for(Item item: javaConvertedScalaList)
// This for loop is actually an O(N^2) operation as the iterator calls the // This for loop is actually an O(N^2) operation as the iterator calls the
// O(N) javaConvertedScalaList.size() for each iteration of the loop. // O(N) javaConvertedScalaList.size() for each iteration of the loop.
//Assert.assertEquals(gi.getSplits(gi.locs.size).size, 189894) Assert.assertEquals(IntervalUtils.splitFixedIntervals(gi.locs, 189894).size(), 189894)
Assert.assertEquals(gi.contigs.size, 24) Assert.assertEquals(gi.contigs.size, 24)
} }
@ -77,4 +78,17 @@ class GATKIntervalsUnitTest {
Assert.assertEquals(new GATKIntervals(hg18Reference, Seq("chr1", "chr2", "chr3")).contigs, Seq("chr1", "chr2", "chr3")) Assert.assertEquals(new GATKIntervals(hg18Reference, Seq("chr1", "chr2", "chr3")).contigs, Seq("chr1", "chr2", "chr3"))
Assert.assertEquals(new GATKIntervals(hg18Reference, Seq("chr1:1-2", "chr1:4-5", "chr2:1-1", "chr3:2-2")).contigs, Seq("chr1", "chr2", "chr3")) Assert.assertEquals(new GATKIntervals(hg18Reference, Seq("chr1:1-2", "chr1:4-5", "chr2:1-1", "chr3:2-2")).contigs, Seq("chr1", "chr2", "chr3"))
} }
@Test
def testSortAndMergeIntervals() {
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:1-10", "chr1:1-10"), Seq("chr1:1-10"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:1-11", "chr1:1-12"), Seq("chr1:1-12"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:11-20", "chr1:21-30"), Seq("chr1:1-10", "chr1:11-20", "chr1:21-30"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:10-20", "chr1:21-30"), Seq("chr1:1-20", "chr1:21-30"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:21-30", "chr1:10-20"), Seq("chr1:1-20", "chr1:21-30"))
}
private def testSortAndMergeIntervals(actual: Seq[String], expected: Seq[String]) {
Assert.assertEquals(new GATKIntervals(hg18Reference, actual).locs.toSeq, expected.map(hg18GenomeLocParser.parseGenomeLoc(_)))
}
} }