diff --git a/build.xml b/build.xml index 80627fae0..fe4c7a3f4 100644 --- a/build.xml +++ b/build.xml @@ -780,6 +780,50 @@ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + @@ -814,6 +858,22 @@ + + + + + + + + + + + + + + + + @@ -981,6 +1041,7 @@ + diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/BatchMergeIntegrationTest.java b/public/java/src/org/broadinstitute/sting/gatk/filters/MappingQualityUnavailableReadFilter.java old mode 100755 new mode 100644 similarity index 50% rename from public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/BatchMergeIntegrationTest.java rename to public/java/src/org/broadinstitute/sting/gatk/filters/MappingQualityUnavailableReadFilter.java index 7e1d86105..cecbedda8 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/BatchMergeIntegrationTest.java +++ b/public/java/src/org/broadinstitute/sting/gatk/filters/MappingQualityUnavailableReadFilter.java @@ -1,6 +1,5 @@ /* - * Copyright (c) 2010, The Broad Institute - * + * Copyright (c) 2009 The Broad Institute * Permission is hereby granted, free of charge, to any person * obtaining a copy of this software and associated documentation * files (the "Software"), to deal in the Software without @@ -12,6 +11,7 @@ * * The above copyright notice and this permission notice shall be * included in all copies or substantial portions of the Software. + * * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND @@ -22,25 +22,22 @@ * OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.sting.gatk.walkers.variantutils; +package org.broadinstitute.sting.gatk.filters; -import org.broadinstitute.sting.WalkerTest; -import org.testng.annotations.Test; +import net.sf.picard.util.QualityUtil; +import net.sf.samtools.SAMRecord; +import org.broadinstitute.sting.utils.QualityUtils; -import java.io.File; -import java.util.Arrays; +/** + * Filter out mapping quality zero reads. + * + * @author ebanks + * @version 0.1 + */ -public class BatchMergeIntegrationTest extends WalkerTest { - @Test - public void testBatchMerge1() { - String bam = validationDataLocation + "NA12878.HiSeq.b37.chr20.10_11mb.bam"; - String alleles = validationDataLocation + "batch.merge.alleles.vcf"; - WalkerTestSpec spec = new WalkerTestSpec( - "-T UnifiedGenotyper -NO_HEADER -BTI alleles -stand_call_conf 0.0 -glm BOTH -G none -nsl -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -o %s -R " + b37KGReference - + " -B:alleles,VCF " + alleles - + " -I " + bam, - 1, - Arrays.asList("f4ed8f4ef2cba96823c06e90e9d0de35")); - executeTest("testBatchMerge UG genotype given alleles:" + new File(bam).getName() + " with " + new File(alleles).getName(), spec); +public class MappingQualityUnavailableReadFilter extends ReadFilter { + public boolean filterOut(SAMRecord rec) { + return (rec.getMappingQuality() == QualityUtils.MAPPING_QUALITY_UNAVAILABLE); } -} \ No newline at end of file +} + diff --git a/public/java/src/org/broadinstitute/sting/gatk/filters/ZeroMappingQualityReadFilter.java b/public/java/src/org/broadinstitute/sting/gatk/filters/MappingQualityZeroReadFilter.java similarity index 90% rename from public/java/src/org/broadinstitute/sting/gatk/filters/ZeroMappingQualityReadFilter.java rename to public/java/src/org/broadinstitute/sting/gatk/filters/MappingQualityZeroReadFilter.java index 7e6fc5e82..e49d4117c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/filters/ZeroMappingQualityReadFilter.java +++ b/public/java/src/org/broadinstitute/sting/gatk/filters/MappingQualityZeroReadFilter.java @@ -24,17 +24,16 @@ package org.broadinstitute.sting.gatk.filters; -import net.sf.picard.filter.SamRecordFilter; import net.sf.samtools.SAMRecord; /** - * Filter out zero mapping quality reads. + * Filter out mapping quality zero reads. * * @author hanna * @version 0.1 */ -public class ZeroMappingQualityReadFilter extends ReadFilter { +public class MappingQualityZeroReadFilter extends ReadFilter { public boolean filterOut(SAMRecord rec) { return (rec.getMappingQuality() == 0); } diff --git a/public/java/src/org/broadinstitute/sting/gatk/refdata/features/table/TableCodec.java b/public/java/src/org/broadinstitute/sting/gatk/refdata/features/table/TableCodec.java old mode 100644 new mode 100755 diff --git a/public/java/src/org/broadinstitute/sting/gatk/refdata/features/table/TableFeature.java b/public/java/src/org/broadinstitute/sting/gatk/refdata/features/table/TableFeature.java old mode 100644 new mode 100755 index 6ff0384a0..4b4ebe450 --- a/public/java/src/org/broadinstitute/sting/gatk/refdata/features/table/TableFeature.java +++ b/public/java/src/org/broadinstitute/sting/gatk/refdata/features/table/TableFeature.java @@ -55,10 +55,14 @@ public class TableFeature implements Feature { } public List getAllValues() { - return getValuesTo(values.size()-1); + return getValuesTo(values.size()); } public List getValuesTo(int columnPosition) { return values.subList(0,columnPosition); } + + public List getHeader() { + return keys; + } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java index 0be737897..51d290763 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java @@ -62,5 +62,5 @@ public class AlleleBalanceBySample implements GenotypeAnnotation, ExperimentalAn public List getKeyNames() { return Arrays.asList("AB"); } - public List getDescriptions() { return Arrays.asList(new VCFFormatHeaderLine(getKeyNames().get(0), -1, VCFHeaderLineType.Float, "Allele balance for each het genotype")); } + public List getDescriptions() { return Arrays.asList(new VCFFormatHeaderLine(getKeyNames().get(0), 1, VCFHeaderLineType.Float, "Allele balance for each het genotype")); } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ChromosomeCounts.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ChromosomeCounts.java index 143722d7c..f3ec2b1df 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ChromosomeCounts.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ChromosomeCounts.java @@ -25,6 +25,7 @@ package org.broadinstitute.sting.gatk.walkers.annotator; +import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineCount; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine; @@ -41,8 +42,8 @@ import java.util.*; public class ChromosomeCounts implements InfoFieldAnnotation, StandardAnnotation { private String[] keyNames = { VCFConstants.ALLELE_NUMBER_KEY, VCFConstants.ALLELE_COUNT_KEY, VCFConstants.ALLELE_FREQUENCY_KEY }; - private VCFInfoHeaderLine[] descriptions = { new VCFInfoHeaderLine(VCFConstants.ALLELE_FREQUENCY_KEY, -1, VCFHeaderLineType.Float, "Allele Frequency, for each ALT allele, in the same order as listed"), - new VCFInfoHeaderLine(VCFConstants.ALLELE_COUNT_KEY, -1, VCFHeaderLineType.Integer, "Allele count in genotypes, for each ALT allele, in the same order as listed"), + private VCFInfoHeaderLine[] descriptions = { new VCFInfoHeaderLine(VCFConstants.ALLELE_FREQUENCY_KEY, VCFHeaderLineCount.A, VCFHeaderLineType.Float, "Allele Frequency, for each ALT allele, in the same order as listed"), + new VCFInfoHeaderLine(VCFConstants.ALLELE_COUNT_KEY, VCFHeaderLineCount.A, VCFHeaderLineType.Integer, "Allele count in genotypes, for each ALT allele, in the same order as listed"), new VCFInfoHeaderLine(VCFConstants.ALLELE_NUMBER_KEY, 1, VCFHeaderLineType.Integer, "Total number of alleles in called genotypes") }; public Map annotate(RefMetaDataTracker tracker, ReferenceContext ref, Map stratifiedContexts, VariantContext vc) { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/DepthPerAlleleBySample.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/DepthPerAlleleBySample.java index 754d28dfd..ee66b50ee 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/DepthPerAlleleBySample.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/DepthPerAlleleBySample.java @@ -1,5 +1,6 @@ package org.broadinstitute.sting.gatk.walkers.annotator; +import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineCount; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; @@ -142,5 +143,5 @@ public class DepthPerAlleleBySample implements GenotypeAnnotation, StandardAnnot // public String getIndelBases() public List getKeyNames() { return Arrays.asList("AD"); } - public List getDescriptions() { return Arrays.asList(new VCFFormatHeaderLine(getKeyNames().get(0), VCFCompoundHeaderLine.UNBOUNDED, VCFHeaderLineType.Integer, "Allelic depths for the ref and alt alleles in the order listed")); } + public List getDescriptions() { return Arrays.asList(new VCFFormatHeaderLine(getKeyNames().get(0), VCFHeaderLineCount.UNBOUNDED, VCFHeaderLineType.Integer, "Allelic depths for the ref and alt alleles in the order listed")); } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityRankSumTest.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityRankSumTest.java index 11f86b972..8260a5a81 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityRankSumTest.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityRankSumTest.java @@ -1,5 +1,6 @@ package org.broadinstitute.sting.gatk.walkers.annotator; +import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine; @@ -21,7 +22,7 @@ public class MappingQualityRankSumTest extends RankSumTest { protected void fillQualsFromPileup(byte ref, byte alt, ReadBackedPileup pileup, List refQuals, List altQuals) { for ( final PileupElement p : pileup ) { - if( isUsableBase(p) && p.getMappingQual() < 254 ) { // 254 and 255 are special mapping qualities used as a code by aligners + if ( isUsableBase(p) ) { if ( p.getBase() == ref ) { refQuals.add((double)p.getMappingQual()); } else if ( p.getBase() == alt ) { @@ -34,7 +35,7 @@ public class MappingQualityRankSumTest extends RankSumTest { // equivalent is whether indel likelihoods for reads corresponding to ref allele are more likely than reads corresponding to alt allele ? HashMap> indelLikelihoodMap = IndelGenotypeLikelihoodsCalculationModel.getIndelLikelihoodMap(); for (final PileupElement p: pileup) { - if (indelLikelihoodMap.containsKey(p) && p.getMappingQual() < 254) { + if (indelLikelihoodMap.containsKey(p) && p.getMappingQual() != 0 && p.getMappingQual() != QualityUtils.MAPPING_QUALITY_UNAVAILABLE) { // retrieve likelihood information corresponding to this read LinkedHashMap el = indelLikelihoodMap.get(p); // by design, first element in LinkedHashMap was ref allele @@ -54,8 +55,6 @@ public class MappingQualityRankSumTest extends RankSumTest { refQuals.add((double)p.getMappingQual()); else if (altLikelihood > refLikelihood + INDEL_LIKELIHOOD_THRESH) altQuals.add((double)p.getMappingQual()); - - } } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java index ba3e2cc8b..3b64abfff 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java @@ -47,5 +47,5 @@ public class NBaseCount implements InfoFieldAnnotation { public List getKeyNames() { return Arrays.asList("PercentNBaseSolid"); } - public List getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("PercentNBaseSolid", 4, VCFHeaderLineType.Float, "Percentage of N bases in the pileup (counting only SOLiD reads)")); } + public List getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("PercentNBaseSolid", 1, VCFHeaderLineType.Float, "Percentage of N bases in the pileup (counting only SOLiD reads)")); } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RMSMappingQuality.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RMSMappingQuality.java index 6e80c7555..1ef7ccd0b 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RMSMappingQuality.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RMSMappingQuality.java @@ -1,5 +1,6 @@ package org.broadinstitute.sting.gatk.walkers.annotator; +import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; @@ -38,8 +39,10 @@ public class RMSMappingQuality implements InfoFieldAnnotation, StandardAnnotatio pileup = context.getBasePileup(); if (pileup != null) { - for (PileupElement p : pileup ) - qualities[index++] = p.getRead().getMappingQuality(); + for (PileupElement p : pileup ) { + if ( p.getMappingQual() != QualityUtils.MAPPING_QUALITY_UNAVAILABLE ) + qualities[index++] = p.getMappingQual(); + } } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java index 1a967293f..f00abd6a1 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java @@ -106,6 +106,9 @@ public abstract class RankSumTest implements InfoFieldAnnotation, StandardAnnota protected abstract void fillIndelQualsFromPileup(ReadBackedPileup pileup, List refQuals, List altQuals); protected static boolean isUsableBase( final PileupElement p ) { - return !( p.isDeletion() || p.getMappingQual() == 0 || ((int)p.getQual()) < 6 ); // need the unBAQed quality score here + return !( p.isDeletion() || + p.getMappingQual() == 0 || + p.getMappingQual() == QualityUtils.MAPPING_QUALITY_UNAVAILABLE || + ((int)p.getQual()) < QualityUtils.MIN_USABLE_Q_SCORE ); // need the unBAQed quality score here } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ReadDepthAndAllelicFractionBySample.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ReadDepthAndAllelicFractionBySample.java index f287549bb..a670532af 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ReadDepthAndAllelicFractionBySample.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/ReadDepthAndAllelicFractionBySample.java @@ -29,6 +29,7 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.GenotypeAnnotation; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; +import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineCount; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedExtendedEventPileup; @@ -200,8 +201,8 @@ public class ReadDepthAndAllelicFractionBySample implements GenotypeAnnotation { 1, VCFHeaderLineType.Integer, "Total read depth per sample, including MQ0"), - new VCFFormatHeaderLine(getKeyNames().get(1), - VCFCompoundHeaderLine.UNBOUNDED, + new VCFFormatHeaderLine(getKeyNames().get(1), + VCFHeaderLineCount.UNBOUNDED, VCFHeaderLineType.Float, "Fractions of reads (excluding MQ0 from both ref and alt) supporting each reported alternative allele, per sample")); } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SampleList.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SampleList.java index 82f16be42..e2fd2a3d4 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SampleList.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SampleList.java @@ -25,6 +25,7 @@ package org.broadinstitute.sting.gatk.walkers.annotator; +import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineCount; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType; @@ -65,5 +66,5 @@ public class SampleList implements InfoFieldAnnotation { public List getKeyNames() { return Arrays.asList("Samples"); } - public List getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("Samples", VCFInfoHeaderLine.UNBOUNDED, VCFHeaderLineType.String, "List of polymorphic samples")); } + public List getDescriptions() { return Arrays.asList(new VCFInfoHeaderLine("Samples", VCFHeaderLineCount.UNBOUNDED, VCFHeaderLineType.String, "List of polymorphic samples")); } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java new file mode 100644 index 000000000..a5ebf27bb --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java @@ -0,0 +1,121 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import net.sf.samtools.*; +import net.sf.samtools.util.BlockCompressedInputStream; +import org.broad.tribble.readers.AsciiLineReader; +import org.broad.tribble.readers.LineReader; +import org.broadinstitute.sting.utils.codecs.vcf.VCFCodec; +import org.broadinstitute.sting.utils.codecs.vcf.VCFHeader; +import org.broadinstitute.sting.utils.variantcontext.Genotype; +import org.broadinstitute.sting.utils.variantcontext.VariantContext; + +import java.io.DataInputStream; +import java.io.File; +import java.io.FileInputStream; +import java.io.IOException; +import java.util.Arrays; +import java.util.Map; +import java.util.zip.GZIPInputStream; + + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 1:09 PM + * + * Class implementing diffnode reader for VCF + */ +public class BAMDiffableReader implements DiffableReader { + @Override + public String getName() { return "BAM"; } + + @Override + public DiffElement readFromFile(File file, int maxElementsToRead) { + final SAMFileReader reader = new SAMFileReader(file, null); // null because we don't want it to look for the index + reader.setValidationStringency(SAMFileReader.ValidationStringency.SILENT); + + DiffNode root = DiffNode.rooted(file.getName()); + SAMRecordIterator iterator = reader.iterator(); + + int count = 0; + while ( iterator.hasNext() ) { + if ( count++ > maxElementsToRead && maxElementsToRead != -1) + break; + final SAMRecord record = iterator.next(); + + // name is the read name + first of pair + String name = record.getReadName().replace('.', '_'); + if ( record.getReadPairedFlag() ) { + name += record.getFirstOfPairFlag() ? "_1" : "_2"; + } + + DiffNode readRoot = DiffNode.empty(name, root); + + // add fields + readRoot.add("NAME", record.getReadName()); + readRoot.add("FLAGS", record.getFlags()); + readRoot.add("RNAME", record.getReferenceName()); + readRoot.add("POS", record.getAlignmentStart()); + readRoot.add("MAPQ", record.getMappingQuality()); + readRoot.add("CIGAR", record.getCigarString()); + readRoot.add("RNEXT", record.getMateReferenceName()); + readRoot.add("PNEXT", record.getMateAlignmentStart()); + readRoot.add("TLEN", record.getInferredInsertSize()); + readRoot.add("SEQ", record.getReadString()); + readRoot.add("QUAL", record.getBaseQualityString()); + + for ( SAMRecord.SAMTagAndValue xt : record.getAttributes() ) { + readRoot.add(xt.tag, xt.value); + } + + // add record to root + if ( ! root.hasElement(name) ) + // protect ourselves from malformed files + root.add(readRoot); + } + + reader.close(); + + return root.getBinding(); + } + + @Override + public boolean canRead(File file) { + final byte[] BAM_MAGIC = "BAM\1".getBytes(); + final byte[] buffer = new byte[BAM_MAGIC.length]; + try { + FileInputStream fstream = new FileInputStream(file); + new BlockCompressedInputStream(fstream).read(buffer,0,BAM_MAGIC.length); + return Arrays.equals(buffer, BAM_MAGIC); + } catch ( IOException e ) { + return false; + } catch ( net.sf.samtools.FileTruncatedException e ) { + return false; + } + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java new file mode 100644 index 000000000..4c3f7bd95 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffElement.java @@ -0,0 +1,122 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import com.google.java.contract.*; +import org.broadinstitute.sting.utils.Utils; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 12:55 PM + * + * An interface that must be implemented to allow us to calculate differences + * between structured objects + */ +@Invariant({ + "name != null", + "value != null", + "parent != null || name.equals(\"ROOT\")", + "value == null || value.getBinding() == this"}) +public class DiffElement { + public final static DiffElement ROOT = new DiffElement(); + + final private String name; + final private DiffElement parent; + final private DiffValue value; + + /** + * For ROOT only + */ + private DiffElement() { + this.name = "ROOT"; + this.parent = null; + this.value = new DiffValue(this, "ROOT"); + } + + @Requires({"name != null", "parent != null", "value != null"}) + public DiffElement(String name, DiffElement parent, DiffValue value) { + if ( name.equals("ROOT") ) throw new IllegalArgumentException("Cannot use reserved name ROOT"); + this.name = name; + this.parent = parent; + this.value = value; + this.value.setBinding(this); + } + + @Ensures({"result != null"}) + public String getName() { + return name; + } + + public DiffElement getParent() { + return parent; + } + + @Ensures({"result != null"}) + public DiffValue getValue() { + return value; + } + + public boolean isRoot() { return this == ROOT; } + + @Ensures({"result != null"}) + @Override + public String toString() { + return getName() + "=" + getValue().toString(); + } + + public String toString(int offset) { + return (offset > 0 ? Utils.dupString(' ', offset) : 0) + getName() + "=" + getValue().toString(offset); + } + + @Ensures({"result != null"}) + public final String fullyQualifiedName() { + if ( isRoot() ) + return ""; + else if ( parent.isRoot() ) + return name; + else + return parent.fullyQualifiedName() + "." + name; + } + + @Ensures({"result != null"}) + public String toOneLineString() { + return getName() + "=" + getValue().toOneLineString(); + } + + @Ensures({"result != null"}) + public DiffNode getValueAsNode() { + if ( getValue().isCompound() ) + return (DiffNode)getValue(); + else + throw new ReviewedStingException("Illegal request conversion of a DiffValue into a DiffNode: " + this); + } + + public int size() { + return 1 + getValue().size(); + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java new file mode 100644 index 000000000..2f87a900a --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngine.java @@ -0,0 +1,360 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import org.apache.log4j.Logger; +import org.broadinstitute.sting.gatk.report.GATKReport; +import org.broadinstitute.sting.gatk.report.GATKReportTable; +import org.broadinstitute.sting.utils.Utils; +import org.broadinstitute.sting.utils.classloader.PluginManager; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; +import org.broadinstitute.sting.utils.exceptions.UserException; + +import java.io.File; +import java.io.PrintStream; +import java.util.*; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 12:51 PM + * A generic engine for comparing tree-structured objects + */ +public class DiffEngine { + final protected static Logger logger = Logger.getLogger(DiffEngine.class); + + private final Map readers = new HashMap(); + + public DiffEngine() { + loadDiffableReaders(); + } + + // -------------------------------------------------------------------------------- + // + // difference calculation + // + // -------------------------------------------------------------------------------- + + public List diff(DiffElement master, DiffElement test) { + DiffValue masterValue = master.getValue(); + DiffValue testValue = test.getValue(); + + if ( masterValue.isCompound() && masterValue.isCompound() ) { + return diff(master.getValueAsNode(), test.getValueAsNode()); + } else if ( masterValue.isAtomic() && testValue.isAtomic() ) { + return diff(masterValue, testValue); + } else { + // structural difference in types. one is node, other is leaf + return Arrays.asList(new SpecificDifference(master, test)); + } + } + + public List diff(DiffNode master, DiffNode test) { + Set allNames = new HashSet(master.getElementNames()); + allNames.addAll(test.getElementNames()); + List diffs = new ArrayList(); + + for ( String name : allNames ) { + DiffElement masterElt = master.getElement(name); + DiffElement testElt = test.getElement(name); + if ( masterElt == null && testElt == null ) { + throw new ReviewedStingException("BUG: unexceptedly got two null elements for field: " + name); + } else if ( masterElt == null || testElt == null ) { // if either is null, we are missing a value + // todo -- should one of these be a special MISSING item? + diffs.add(new SpecificDifference(masterElt, testElt)); + } else { + diffs.addAll(diff(masterElt, testElt)); + } + } + + return diffs; + } + + public List diff(DiffValue master, DiffValue test) { + if ( master.getValue().equals(test.getValue()) ) { + return Collections.emptyList(); + } else { + return Arrays.asList(new SpecificDifference(master.getBinding(), test.getBinding())); + } + } + + // -------------------------------------------------------------------------------- + // + // Summarizing differences + // + // -------------------------------------------------------------------------------- + + /** + * Emits a summary of the diffs to out. Suppose you have the following three differences: + * + * A.X.Z:1!=2 + * A.Y.Z:3!=4 + * B.X.Z:5!=6 + * + * The above is the itemized list of the differences. The summary looks for common differences + * in the name hierarchy, counts those shared elements, and emits the differences that occur + * in order of decreasing counts. + * + * So, in the above example, what are the shared elements? + * + * A.X.Z and B.X.Z share X.Z, so there's a *.X.Z with count 2 + * A.X.Z, A.Y.Z, and B.X.Z all share *.*.Z, with count 3 + * Each of A.X.Z, A.Y.Z, and B.X.Z are individually unique, with count 1 + * + * So we would emit the following summary: + * + * *.*.Z: 3 + * *.X.Z: 2 + * A.X.Z: 1 [specific difference: 1!=2] + * A.Y.Z: 1 [specific difference: 3!=4] + * B.X.Z: 1 [specific difference: 5!=6] + * + * The algorithm to accomplish this calculation is relatively simple. Start with all of the + * concrete differences. For each pair of differences A1.A2....AN and B1.B2....BN: + * + * find the longest common subsequence Si.Si+1...SN where Ai = Bi = Si + * If i == 0, then there's no shared substructure + * If i > 0, then generate the summarized value X = *.*...Si.Si+1...SN + * if X is a known summary, increment it's count, otherwise set its count to 1 + * + * Not that only pairs of the same length are considered as potentially equivalent + * + * @param params determines how we display the items + * @param diffs + */ + public void reportSummarizedDifferences(List diffs, SummaryReportParams params ) { + printSummaryReport(summarizeDifferences(diffs), params ); + } + + public List summarizeDifferences(List diffs) { + return summarizedDifferencesOfPaths(diffs); + } + + final protected static String[] diffNameToPath(String diffName) { + return diffName.split("\\."); + } + + protected List summarizedDifferencesOfPathsFromString(List singletonDiffs) { + List diffs = new ArrayList(); + + for ( String diff : singletonDiffs ) { + diffs.add(new Difference(diff)); + } + + return summarizedDifferencesOfPaths(diffs); + } + + protected List summarizedDifferencesOfPaths(List singletonDiffs) { + Map summaries = new HashMap(); + + // create the initial set of differences + for ( int i = 0; i < singletonDiffs.size(); i++ ) { + for ( int j = 0; j <= i; j++ ) { + Difference diffPath1 = singletonDiffs.get(i); + Difference diffPath2 = singletonDiffs.get(j); + if ( diffPath1.length() == diffPath2.length() ) { + int lcp = longestCommonPostfix(diffPath1.getParts(), diffPath2.getParts()); + String path = lcp > 0 ? summarizedPath(diffPath2.getParts(), lcp) : diffPath2.getPath(); + addSummary(summaries, path, true); + } + } + } + + // count differences + for ( Difference diffPath : singletonDiffs ) { + for ( Difference sumDiff : summaries.values() ) { + if ( sumDiff.matches(diffPath.getParts()) ) + addSummary(summaries, sumDiff.getPath(), false); + } + } + + List sortedSummaries = new ArrayList(summaries.values()); + Collections.sort(sortedSummaries); + return sortedSummaries; + } + + private static void addSummary(Map summaries, String path, boolean onlyCatalog) { + if ( summaries.containsKey(path) ) { + if ( ! onlyCatalog ) + summaries.get(path).incCount(); + } else { + Difference sumDiff = new Difference(path); + summaries.put(sumDiff.getPath(), sumDiff); + } + } + + protected void printSummaryReport(List sortedSummaries, SummaryReportParams params ) { + GATKReport report = new GATKReport(); + final String tableName = "diffences"; + report.addTable(tableName, "Summarized differences between the master and test files.\nSee http://www.broadinstitute.org/gsa/wiki/index.php/DiffEngine for more information"); + GATKReportTable table = report.getTable(tableName); + table.addPrimaryKey("Difference", true); + table.addColumn("NumberOfOccurrences", 0); + + int count = 0, count1 = 0; + for ( Difference diff : sortedSummaries ) { + if ( diff.getCount() < params.minSumDiffToShow ) + // in order, so break as soon as the count is too low + break; + + if ( params.maxItemsToDisplay != 0 && count++ > params.maxItemsToDisplay ) + break; + + if ( diff.getCount() == 1 ) { + count1++; + if ( params.maxCountOneItems != 0 && count1 > params.maxCountOneItems ) + break; + } + + table.set(diff.getPath(), "NumberOfOccurrences", diff.getCount()); + } + + table.write(params.out); + } + + protected static int longestCommonPostfix(String[] diffPath1, String[] diffPath2) { + int i = 0; + for ( ; i < diffPath1.length; i++ ) { + int j = diffPath1.length - i - 1; + if ( ! diffPath1[j].equals(diffPath2[j]) ) + break; + } + return i; + } + + /** + * parts is [A B C D] + * commonPostfixLength: how many parts are shared at the end, suppose its 2 + * We want to create a string *.*.C.D + * + * @param parts + * @param commonPostfixLength + * @return + */ + protected static String summarizedPath(String[] parts, int commonPostfixLength) { + int stop = parts.length - commonPostfixLength; + if ( stop > 0 ) parts = parts.clone(); + for ( int i = 0; i < stop; i++ ) { + parts[i] = "*"; + } + return Utils.join(".", parts); + } + + // -------------------------------------------------------------------------------- + // + // plugin manager + // + // -------------------------------------------------------------------------------- + + public void loadDiffableReaders() { + List> drClasses = new PluginManager( DiffableReader.class ).getPlugins(); + + logger.info("Loading diffable modules:"); + for (Class drClass : drClasses ) { + logger.info("\t" + drClass.getSimpleName()); + + try { + DiffableReader dr = drClass.newInstance(); + readers.put(dr.getName(), dr); + } catch (InstantiationException e) { + throw new ReviewedStingException("Unable to instantiate module '" + drClass.getSimpleName() + "'"); + } catch (IllegalAccessException e) { + throw new ReviewedStingException("Illegal access error when trying to instantiate '" + drClass.getSimpleName() + "'"); + } + } + } + + protected Map getReaders() { + return readers; + } + + protected DiffableReader getReader(String name) { + return readers.get(name); + } + + /** + * Returns a reader appropriate for this file, or null if no such reader exists + * @param file + * @return + */ + public DiffableReader findReaderForFile(File file) { + for ( DiffableReader reader : readers.values() ) + if (reader.canRead(file) ) + return reader; + + return null; + } + + /** + * Returns true if reader appropriate for this file, or false if no such reader exists + * @param file + * @return + */ + public boolean canRead(File file) { + return findReaderForFile(file) != null; + } + + + public DiffElement createDiffableFromFile(File file) { + return createDiffableFromFile(file, -1); + } + + public DiffElement createDiffableFromFile(File file, int maxElementsToRead) { + DiffableReader reader = findReaderForFile(file); + if ( reader == null ) + throw new UserException("Unsupported file type: " + file); + else + return reader.readFromFile(file, maxElementsToRead); + } + + public static boolean simpleDiffFiles(File masterFile, File testFile, DiffEngine.SummaryReportParams params) { + DiffEngine diffEngine = new DiffEngine(); + + if ( diffEngine.canRead(masterFile) && diffEngine.canRead(testFile) ) { + DiffElement master = diffEngine.createDiffableFromFile(masterFile); + DiffElement test = diffEngine.createDiffableFromFile(testFile); + List diffs = diffEngine.diff(master, test); + diffEngine.reportSummarizedDifferences(diffs, params); + return true; + } else { + return false; + } + } + + public static class SummaryReportParams { + PrintStream out = System.out; + int maxItemsToDisplay = 0; + int maxCountOneItems = 0; + int minSumDiffToShow = 0; + + public SummaryReportParams(PrintStream out, int maxItemsToDisplay, int maxCountOneItems, int minSumDiffToShow) { + this.out = out; + this.maxItemsToDisplay = maxItemsToDisplay; + this.maxCountOneItems = maxCountOneItems; + this.minSumDiffToShow = minSumDiffToShow; + } + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java new file mode 100644 index 000000000..2f48de2d3 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNode.java @@ -0,0 +1,248 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import com.google.java.contract.Requires; +import org.broadinstitute.sting.utils.Utils; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; + +import java.util.*; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 12:55 PM + * + * An interface that must be implemented to allow us to calculate differences + * between structured objects + */ +public class DiffNode extends DiffValue { + private Map getElementMap() { + return (Map)super.getValue(); + } + private static Map emptyElements() { return new HashMap(); } + + private DiffNode(Map elements) { + super(elements); + } + + private DiffNode(DiffElement binding, Map elements) { + super(binding, elements); + } + + // --------------------------------------------------------------------------- + // + // constructors + // + // --------------------------------------------------------------------------- + + public static DiffNode rooted(String name) { + return empty(name, DiffElement.ROOT); + } + + public static DiffNode empty(String name, DiffElement parent) { + DiffNode df = new DiffNode(emptyElements()); + DiffElement elt = new DiffElement(name, parent, df); + df.setBinding(elt); + return df; + } + + public static DiffNode empty(String name, DiffValue parent) { + return empty(name, parent.getBinding()); + } + + // --------------------------------------------------------------------------- + // + // accessors + // + // --------------------------------------------------------------------------- + + @Override + public boolean isAtomic() { return false; } + + public Collection getElementNames() { + return getElementMap().keySet(); + } + + public Collection getElements() { + return getElementMap().values(); + } + + private Collection getElements(boolean atomicOnly) { + List elts = new ArrayList(); + for ( DiffElement elt : getElements() ) + if ( (atomicOnly && elt.getValue().isAtomic()) || (! atomicOnly && elt.getValue().isCompound())) + elts.add(elt); + return elts; + } + + public Collection getAtomicElements() { + return getElements(true); + } + + public Collection getCompoundElements() { + return getElements(false); + } + + /** + * Returns the element bound to name, or null if no such binding exists + * @param name + * @return + */ + public DiffElement getElement(String name) { + return getElementMap().get(name); + } + + /** + * Returns true if name is bound in this node + * @param name + * @return + */ + public boolean hasElement(String name) { + return getElement(name) != null; + } + + // --------------------------------------------------------------------------- + // + // add + // + // --------------------------------------------------------------------------- + + @Requires("elt != null") + public void add(DiffElement elt) { + if ( getElementMap().containsKey(elt.getName()) ) + throw new IllegalArgumentException("Attempting to rebind already existing binding: " + elt + " node=" + this); + getElementMap().put(elt.getName(), elt); + } + + @Requires("elt != null") + public void add(DiffValue elt) { + add(elt.getBinding()); + } + + @Requires("elts != null") + public void add(Collection elts) { + for ( DiffElement e : elts ) + add(e); + } + + public void add(String name, Object value) { + add(new DiffElement(name, this.getBinding(), new DiffValue(value))); + } + + public int size() { + int count = 0; + for ( DiffElement value : getElements() ) + count += value.size(); + return count; + } + + // --------------------------------------------------------------------------- + // + // toString + // + // --------------------------------------------------------------------------- + + @Override + public String toString() { + return toString(0); + } + + @Override + public String toString(int offset) { + String off = offset > 0 ? Utils.dupString(' ', offset) : ""; + StringBuilder b = new StringBuilder(); + + b.append("(").append("\n"); + Collection atomicElts = getAtomicElements(); + for ( DiffElement elt : atomicElts ) { + b.append(elt.toString(offset + 2)).append('\n'); + } + + for ( DiffElement elt : getCompoundElements() ) { + b.append(elt.toString(offset + 4)).append('\n'); + } + b.append(off).append(")").append("\n"); + + return b.toString(); + } + + @Override + public String toOneLineString() { + StringBuilder b = new StringBuilder(); + + b.append('('); + List parts = new ArrayList(); + for ( DiffElement elt : getElements() ) + parts.add(elt.toOneLineString()); + b.append(Utils.join(" ", parts)); + b.append(')'); + + return b.toString(); + } + + // -------------------------------------------------------------------------------- + // + // fromString and toOneLineString + // + // -------------------------------------------------------------------------------- + + public static DiffElement fromString(String tree) { + return fromString(tree, DiffElement.ROOT); + } + + /** + * Doesn't support full tree structure parsing + * @param tree + * @param parent + * @return + */ + private static DiffElement fromString(String tree, DiffElement parent) { + // X=(A=A B=B C=(D=D)) + String[] parts = tree.split("=", 2); + if ( parts.length != 2 ) + throw new ReviewedStingException("Unexpected tree structure: " + tree + " parts=" + parts); + String name = parts[0]; + String value = parts[1]; + + if ( value.length() == 0 ) + throw new ReviewedStingException("Illegal tree structure: " + value + " at " + tree); + + if ( value.charAt(0) == '(' ) { + if ( ! value.endsWith(")") ) + throw new ReviewedStingException("Illegal tree structure. Missing ): " + value + " at " + tree); + String subtree = value.substring(1, value.length()-1); + DiffNode rec = DiffNode.empty(name, parent); + String[] subParts = subtree.split(" "); + for ( String subPart : subParts ) { + rec.add(fromString(subPart, rec.getBinding())); + } + return rec.getBinding(); + } else { + return new DiffValue(name, parent, value).getBinding(); + } + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java new file mode 100644 index 000000000..ecb836af9 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffObjectsWalker.java @@ -0,0 +1,117 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import org.broadinstitute.sting.commandline.Argument; +import org.broadinstitute.sting.commandline.Output; +import org.broadinstitute.sting.gatk.contexts.AlignmentContext; +import org.broadinstitute.sting.gatk.contexts.ReferenceContext; +import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; +import org.broadinstitute.sting.gatk.walkers.Requires; +import org.broadinstitute.sting.gatk.walkers.RodWalker; + +import java.io.File; +import java.io.PrintStream; +import java.util.List; + +/** + * Compares two record-oriented files, itemizing specific difference between equivalent + * records in the two files. Reports both itemized and summarized differences. + * @author Mark DePristo + * @version 0.1 + */ +@Requires(value={}) +public class DiffObjectsWalker extends RodWalker { + @Output(doc="File to which results should be written",required=true) + protected PrintStream out; + + @Argument(fullName="maxObjectsToRead", shortName="motr", doc="Max. number of objects to read from the files. -1 [default] means unlimited", required=false) + int MAX_OBJECTS_TO_READ = -1; + + @Argument(fullName="maxDiffs", shortName="M", doc="Max. number of diffs to process", required=false) + int MAX_DIFFS = 0; + + @Argument(fullName="maxCount1Diffs", shortName="M1", doc="Max. number of diffs occuring exactly once in the file to process", required=false) + int MAX_COUNT1_DIFFS = 0; + + @Argument(fullName="minCountForDiff", shortName="MCFD", doc="Min number of observations for a records to display", required=false) + int minCountForDiff = 1; + + @Argument(fullName="showItemizedDifferences", shortName="SID", doc="Should we enumerate all differences between the files?", required=false) + boolean showItemizedDifferences = false; + + @Argument(fullName="master", shortName="m", doc="Master file: expected results", required=true) + File masterFile; + + @Argument(fullName="test", shortName="t", doc="Test file: new results to compare to the master file", required=true) + File testFile; + + final DiffEngine diffEngine = new DiffEngine(); + + @Override + public void initialize() { + + } + + @Override + public Integer map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) { + return 0; + } + + @Override + public Integer reduceInit() { + return 0; + } + + @Override + public Integer reduce(Integer counter, Integer sum) { + return counter + sum; + } + + @Override + public void onTraversalDone(Integer sum) { + out.printf("Reading master file %s%n", masterFile); + DiffElement master = diffEngine.createDiffableFromFile(masterFile, MAX_OBJECTS_TO_READ); + out.printf(" Read %d objects%n", master.size()); + out.printf("Reading test file %s%n", testFile); + DiffElement test = diffEngine.createDiffableFromFile(testFile, MAX_OBJECTS_TO_READ); + out.printf(" Read %d objects%n", test.size()); + +// out.printf("Master diff objects%n"); +// out.println(master.toString()); +// out.printf("Test diff objects%n"); +// out.println(test.toString()); + + List diffs = diffEngine.diff(master, test); + if ( showItemizedDifferences ) { + out.printf("Itemized results%n"); + for ( SpecificDifference diff : diffs ) + out.printf("DIFF: %s%n", diff.toString()); + } + + DiffEngine.SummaryReportParams params = new DiffEngine.SummaryReportParams(out, MAX_DIFFS, MAX_COUNT1_DIFFS, minCountForDiff); + diffEngine.reportSummarizedDifferences(diffs, params); + } +} \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java new file mode 100644 index 000000000..3750496a1 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffValue.java @@ -0,0 +1,91 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import org.broadinstitute.sting.utils.Utils; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 12:55 PM + * + * An interface that must be implemented to allow us to calculate differences + * between structured objects + */ +public class DiffValue { + private DiffElement binding = null; + final private Object value; + + public DiffValue(Object value) { + this.value = value; + } + + public DiffValue(DiffElement binding, Object value) { + this.binding = binding; + this.value = value; + } + + public DiffValue(DiffValue parent, Object value) { + this(parent.getBinding(), value); + } + + public DiffValue(String name, DiffElement parent, Object value) { + this.binding = new DiffElement(name, parent, this); + this.value = value; + } + + public DiffValue(String name, DiffValue parent, Object value) { + this(name, parent.getBinding(), value); + } + + public DiffElement getBinding() { + return binding; + } + + protected void setBinding(DiffElement binding) { + this.binding = binding; + } + + public Object getValue() { + return value; + } + + public String toString() { + return getValue().toString(); + } + + public String toString(int offset) { + return toString(); + } + + public String toOneLineString() { + return getValue().toString(); + } + + public boolean isAtomic() { return true; } + public boolean isCompound() { return ! isAtomic(); } + public int size() { return 1; } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java new file mode 100644 index 000000000..a117206f1 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReader.java @@ -0,0 +1,65 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import com.google.java.contract.Ensures; +import com.google.java.contract.Requires; + +import java.io.File; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 1:09 PM + * + * Interface for readers creating diffable objects from a file + */ +public interface DiffableReader { + @Ensures("result != null") + /** + * Return the name of this DiffableReader type. For example, the VCF reader returns 'VCF' and the + * bam reader 'BAM' + */ + public String getName(); + + @Ensures("result != null") + @Requires("file != null") + /** + * Read up to maxElementsToRead DiffElements from file, and return them. + */ + public DiffElement readFromFile(File file, int maxElementsToRead); + + /** + * Return true if the file can be read into DiffElement objects with this reader. This should + * be uniquely true/false for all readers, as the system will use the first reader that can read the + * file. This routine should never throw an exception. The VCF reader, for example, looks at the + * first line of the file for the ##format=VCF4.1 header, and the BAM reader for the BAM_MAGIC value + * @param file + * @return + */ + @Requires("file != null") + public boolean canRead(File file); +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java new file mode 100644 index 000000000..efc6ef160 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/Difference.java @@ -0,0 +1,95 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +public class Difference implements Comparable { + final String path; // X.Y.Z + final String[] parts; + int count = 0; + + public Difference(String path) { + this.path = path; + this.parts = DiffEngine.diffNameToPath(path); + } + + public String[] getParts() { + return parts; + } + + public void incCount() { count++; } + + public int getCount() { + return count; + } + + /** + * The fully qualified path object A.B.C etc + * @return + */ + public String getPath() { + return path; + } + + /** + * @return the length of the parts of this summary + */ + public int length() { + return this.parts.length; + } + + /** + * Returns true if the string parts matches this summary. Matches are + * must be equal() everywhere where this summary isn't *. + * @param otherParts + * @return + */ + public boolean matches(String[] otherParts) { + if ( otherParts.length != length() ) + return false; + + // TODO optimization: can start at right most non-star element + for ( int i = 0; i < length(); i++ ) { + String part = parts[i]; + if ( ! part.equals("*") && ! part.equals(otherParts[i]) ) + return false; + } + + return true; + } + + @Override + public String toString() { + return String.format("%s:%d", getPath(), getCount()); + } + + @Override + public int compareTo(Difference other) { + // sort first highest to lowest count, then by lowest to highest path + int countCmp = Integer.valueOf(count).compareTo(other.count); + return countCmp != 0 ? -1 * countCmp : path.compareTo(other.path); + } + + +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java new file mode 100644 index 000000000..2fe9b47f8 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/SpecificDifference.java @@ -0,0 +1,59 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 12:53 PM + * + * Represents a specific difference between two specific DiffElements + */ +public class SpecificDifference extends Difference { + DiffElement master, test; + + public SpecificDifference(DiffElement master, DiffElement test) { + super(createName(master, test)); + if ( master == null && test == null ) throw new IllegalArgumentException("Master and test both cannot be null"); + this.master = master; + this.test = test; + } + + public String toString() { + return String.format("%s:%s!=%s", + getPath(), + getOneLineString(master), + getOneLineString(test)); + } + + private static String createName(DiffElement master, DiffElement test) { + return (master == null ? test : master).fullyQualifiedName(); + } + + private static String getOneLineString(DiffElement elt) { + return elt == null ? "MISSING" : elt.getValue().toOneLineString(); + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java new file mode 100644 index 000000000..a812babaf --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java @@ -0,0 +1,127 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +package org.broadinstitute.sting.gatk.walkers.diffengine; + +import org.broad.tribble.readers.AsciiLineReader; +import org.broad.tribble.readers.LineReader; +import org.broadinstitute.sting.utils.codecs.vcf.*; +import org.broadinstitute.sting.utils.variantcontext.Genotype; +import org.broadinstitute.sting.utils.variantcontext.VariantContext; + +import java.io.*; +import java.util.Map; + + +/** + * Created by IntelliJ IDEA. + * User: depristo + * Date: 7/4/11 + * Time: 1:09 PM + * + * Class implementing diffnode reader for VCF + */ +public class VCFDiffableReader implements DiffableReader { + @Override + public String getName() { return "VCF"; } + + @Override + public DiffElement readFromFile(File file, int maxElementsToRead) { + DiffNode root = DiffNode.rooted(file.getName()); + try { + LineReader lineReader = new AsciiLineReader(new FileInputStream(file)); + VCFCodec vcfCodec = new VCFCodec(); + + // must be read as state is stored in reader itself + VCFHeader header = (VCFHeader)vcfCodec.readHeader(lineReader); + for ( VCFHeaderLine headerLine : header.getMetaData() ) { + String key = headerLine.getKey(); + if ( headerLine instanceof VCFNamedHeaderLine ) + key += "_" + ((VCFNamedHeaderLine) headerLine).getName(); + root.add(key, headerLine.toString()); + } + + String line = lineReader.readLine(); + int count = 0; + while ( line != null ) { + if ( count++ > maxElementsToRead && maxElementsToRead != -1) + break; + + VariantContext vc = (VariantContext)vcfCodec.decode(line); + String name = vc.getChr() + ":" + vc.getStart(); + DiffNode vcRoot = DiffNode.empty(name, root); + + // add fields + vcRoot.add("CHROM", vc.getChr()); + vcRoot.add("POS", vc.getStart()); + vcRoot.add("ID", vc.hasID() ? vc.getID() : VCFConstants.MISSING_VALUE_v4); + vcRoot.add("REF", vc.getReference()); + vcRoot.add("ALT", vc.getAlternateAlleles()); + vcRoot.add("QUAL", vc.hasNegLog10PError() ? vc.getNegLog10PError() * 10 : VCFConstants.MISSING_VALUE_v4); + vcRoot.add("FILTER", vc.getFilters()); + + // add info fields + for (Map.Entry attribute : vc.getAttributes().entrySet()) { + if ( ! attribute.getKey().startsWith("_") && ! attribute.getKey().equals(VariantContext.ID_KEY)) + vcRoot.add(attribute.getKey(), attribute.getValue()); + } + + for (Genotype g : vc.getGenotypes().values() ) { + DiffNode gRoot = DiffNode.empty(g.getSampleName(), vcRoot); + gRoot.add("GT", g.getGenotypeString()); + gRoot.add("GQ", g.hasNegLog10PError() ? g.getNegLog10PError() * 10 : VCFConstants.MISSING_VALUE_v4 ); + + for (Map.Entry attribute : g.getAttributes().entrySet()) { + if ( ! attribute.getKey().startsWith("_") ) + gRoot.add(attribute.getKey(), attribute.getValue()); + } + + vcRoot.add(gRoot); + } + + root.add(vcRoot); + line = lineReader.readLine(); + } + + lineReader.close(); + } catch ( IOException e ) { + return null; + } + + return root.getBinding(); + } + + @Override + public boolean canRead(File file) { + try { + final String VCF4_HEADER = "##fileformat=VCFv4"; + char[] buff = new char[VCF4_HEADER.length()]; + new FileReader(file).read(buff, 0, VCF4_HEADER.length()); + String firstLine = new String(buff); + return firstLine.startsWith(VCF4_HEADER); + } catch ( IOException e ) { + return false; + } + } +} diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java index 7a765c602..fc8a5819a 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java @@ -25,6 +25,7 @@ package org.broadinstitute.sting.gatk.walkers.genotyper; +import org.broadinstitute.sting.gatk.filters.MappingQualityUnavailableReadFilter; import org.broadinstitute.sting.utils.codecs.vcf.*; import org.broadinstitute.sting.gatk.contexts.*; import org.broadinstitute.sting.gatk.filters.BadMateFilter; @@ -37,7 +38,6 @@ import org.broadinstitute.sting.gatk.datasources.rmd.ReferenceOrderedDataSource; import org.broadinstitute.sting.utils.*; import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.commandline.*; -import org.broadinstitute.sting.utils.codecs.vcf.VCFUtils; import java.util.*; import java.io.PrintStream; @@ -48,7 +48,7 @@ import java.io.PrintStream; * multi-sample data. The user can choose from several different incorporated calculation models. */ @BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_INPUT) -@ReadFilters( {BadMateFilter.class} ) +@ReadFilters( {BadMateFilter.class, MappingQualityUnavailableReadFilter.class} ) @Reference(window=@Window(start=-200,stop=200)) @By(DataSource.REFERENCE) @Downsample(by=DownsampleType.BY_SAMPLE, toCoverage=250) @@ -158,7 +158,7 @@ public class UnifiedGenotyper extends LocusWalker getSupportedHeaderStrings() { + Set result = new HashSet(); + result.add(new VCFFormatHeaderLine(VCFConstants.GENOTYPE_KEY, 1, VCFHeaderLineType.String, "Genotype")); + result.add(new VCFFormatHeaderLine(VCFConstants.GENOTYPE_QUALITY_KEY, 1, VCFHeaderLineType.Float, "Genotype Quality")); + result.add(new VCFFormatHeaderLine(VCFConstants.DEPTH_KEY, 1, VCFHeaderLineType.Integer, "Read Depth (only filtered reads used for calling)")); + result.add(new VCFFormatHeaderLine(VCFConstants.PHRED_GENOTYPE_LIKELIHOODS_KEY, VCFHeaderLineCount.G, VCFHeaderLineType.Integer, "Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification")); + + return result; + } + /** * Compute at a given locus. * diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java index 4c9080884..6fc972b5d 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java @@ -634,17 +634,27 @@ public class UnifiedGenotyperEngine { if (vcInput == null) return null; - if (vcInput.isSNP() && ( UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.BOTH || UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.SNP)) - return GenotypeLikelihoodsCalculationModel.Model.SNP; + // todo - no support to genotype MNP's yet + if (vcInput.isMNP()) + return null; + + if (vcInput.isSNP()) { + if (( UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.BOTH || UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.SNP)) + return GenotypeLikelihoodsCalculationModel.Model.SNP; + else + // ignore SNP's if user chose INDEL mode + return null; + } else if ((vcInput.isIndel() || vcInput.isMixed()) && (UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.BOTH || UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.INDEL)) return GenotypeLikelihoodsCalculationModel.Model.INDEL; - } else { + } + else { // todo - this assumes SNP's take priority when BOTH is selected, should do a smarter way once extended events are removed if( UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.BOTH || UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.SNP) return GenotypeLikelihoodsCalculationModel.Model.SNP; else if (UAC.GLmodel == GenotypeLikelihoodsCalculationModel.Model.INDEL) return GenotypeLikelihoodsCalculationModel.Model.INDEL; - } + } } return null; } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/RealignerTargetCreator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/RealignerTargetCreator.java index 048dbd8cb..3b94989aa 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/RealignerTargetCreator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/RealignerTargetCreator.java @@ -30,7 +30,7 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.filters.BadCigarFilter; import org.broadinstitute.sting.gatk.filters.Platform454Filter; -import org.broadinstitute.sting.gatk.filters.ZeroMappingQualityReadFilter; +import org.broadinstitute.sting.gatk.filters.MappingQualityZeroReadFilter; import org.broadinstitute.sting.gatk.filters.BadMateFilter; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.*; @@ -50,7 +50,7 @@ import java.io.PrintStream; /** * Emits intervals for the Local Indel Realigner to target for cleaning. Ignores 454 reads, MQ0 reads, and reads with consecutive indel operators in the CIGAR string. */ -@ReadFilters({Platform454Filter.class, ZeroMappingQualityReadFilter.class, BadCigarFilter.class}) +@ReadFilters({Platform454Filter.class, MappingQualityZeroReadFilter.class, BadCigarFilter.class}) @Reference(window=@Window(start=-1,stop=50)) @Allows(value={DataSource.READS, DataSource.REFERENCE}) @By(DataSource.REFERENCE) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/SomaticIndelDetectorWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/SomaticIndelDetectorWalker.java index c2953d1d7..1f05ddaf0 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/SomaticIndelDetectorWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/indels/SomaticIndelDetectorWalker.java @@ -72,7 +72,7 @@ import java.util.*; * if first bam has coverage at the site but no indication for an indel. In the --somatic mode, BED output contains * only somatic calls, while --verbose output contains all calls annotated with GERMLINE/SOMATIC keywords. */ -@ReadFilters({Platform454Filter.class, ZeroMappingQualityReadFilter.class, PlatformUnitFilter.class}) +@ReadFilters({Platform454Filter.class, MappingQualityZeroReadFilter.class, PlatformUnitFilter.class}) public class SomaticIndelDetectorWalker extends ReadWalker { // @Output // PrintStream out; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingWalker.java index e59b29502..fbe6e5b5a 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingWalker.java @@ -32,7 +32,7 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.gatk.datasources.sample.Sample; -import org.broadinstitute.sting.gatk.filters.ZeroMappingQualityReadFilter; +import org.broadinstitute.sting.gatk.filters.MappingQualityZeroReadFilter; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedDatum; import org.broadinstitute.sting.gatk.walkers.*; @@ -58,7 +58,7 @@ import static org.broadinstitute.sting.utils.codecs.vcf.VCFUtils.getVCFHeadersFr @Requires(value = {DataSource.READS, DataSource.REFERENCE}, referenceMetaData = @RMD(name = "variant", type = ReferenceOrderedDatum.class)) @By(DataSource.READS) -@ReadFilters({ZeroMappingQualityReadFilter.class}) +@ReadFilters({MappingQualityZeroReadFilter.class}) // Filter out all reads with zero mapping quality public class ReadBackedPhasingWalker extends RodWalker { @@ -220,6 +220,9 @@ public class ReadBackedPhasingWalker extends RodWalker KEYS_TO_KEEP_IN_REDUCED_VCF = new HashSet(Arrays.asList(PQ_KEY)); private VariantContext reduceVCToSamples(VariantContext vc, List samplesToPhase) { // for ( String sample : samplesToPhase ) @@ -1105,7 +1108,7 @@ public class ReadBackedPhasingWalker extends RodWalker(vc.getGenotypes()); // since vc.getGenotypes() is unmodifiable this.negLog10PError = vc.getNegLog10PError(); - this.filters = vc.getFilters(); + this.filters = vc.filtersWereApplied() ? vc.getFilters() : null; this.attributes = new HashMap(vc.getAttributes()); } diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java index ee504b6e7..c21f548b3 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/recalibration/CountCovariatesWalker.java @@ -27,6 +27,7 @@ package org.broadinstitute.sting.gatk.walkers.recalibration; import org.broad.tribble.bed.BEDCodec; import org.broad.tribble.dbsnp.DbSNPCodec; +import org.broadinstitute.sting.gatk.filters.MappingQualityUnavailableReadFilter; import org.broadinstitute.sting.utils.codecs.vcf.VCF3Codec; import org.broadinstitute.sting.utils.codecs.vcf.VCFCodec; import org.broadinstitute.sting.commandline.Gather; @@ -34,7 +35,7 @@ import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.datasources.rmd.ReferenceOrderedDataSource; -import org.broadinstitute.sting.gatk.filters.ZeroMappingQualityReadFilter; +import org.broadinstitute.sting.gatk.filters.MappingQualityZeroReadFilter; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.utils.GATKFeature; import org.broadinstitute.sting.gatk.walkers.*; @@ -75,7 +76,7 @@ import java.util.Map; @BAQMode(ApplicationTime = BAQ.ApplicationTime.FORBIDDEN) @By( DataSource.READS ) // Only look at covered loci, not every loci of the reference file -@ReadFilters( {ZeroMappingQualityReadFilter.class} ) // Filter out all reads with zero mapping quality +@ReadFilters( {MappingQualityZeroReadFilter.class, MappingQualityUnavailableReadFilter.class} ) // Filter out all reads with zero or unavailable mapping quality @Requires( {DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES} ) // This walker requires both -I input.bam and -R reference.fasta @PartitionBy(PartitionType.LOCUS) public class CountCovariatesWalker extends LocusWalker implements TreeReducible { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalWalker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalWalker.java index 15d808ebe..c9c5e09a8 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalWalker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalWalker.java @@ -20,7 +20,7 @@ import org.broadinstitute.sting.gatk.walkers.TreeReducible; import org.broadinstitute.sting.gatk.walkers.Window; import org.broadinstitute.sting.gatk.walkers.varianteval.evaluators.VariantEvaluator; import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.VariantStratifier; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.gatk.walkers.varianteval.util.*; import org.broadinstitute.sting.gatk.walkers.variantrecalibration.Tranche; import org.broadinstitute.sting.gatk.walkers.variantrecalibration.VariantRecalibrator; @@ -30,10 +30,9 @@ import org.broadinstitute.sting.utils.exceptions.StingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; import org.broadinstitute.sting.utils.codecs.vcf.VCFUtils; -import net.sf.picard.reference.FastaSequenceFile; import net.sf.picard.reference.IndexedFastaSequenceFile; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; -import net.sf.picard.reference.ReferenceSequence; + import java.io.FileNotFoundException; import java.io.File; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java index 76db330ed..85373baa8 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java @@ -1,12 +1,12 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; /** * The Broad Institute diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java index c4277adc9..befb2ff13 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java @@ -1,12 +1,12 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; @Analysis(description = "Counts different classes of variants in the sample") diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypeConcordance.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypeConcordance.java index 4b56cf130..58803c9d0 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypeConcordance.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypeConcordance.java @@ -1,14 +1,14 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; import org.apache.log4j.Logger; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.StingException; import org.broadinstitute.sting.utils.exceptions.UserException; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypePhasingEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypePhasingEvaluator.java index 3d14dd0e5..407b71893 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypePhasingEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/GenotypePhasingEvaluator.java @@ -1,6 +1,7 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; import org.apache.log4j.Logger; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.*; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; @@ -9,10 +10,8 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.phasing.AllelePair; import org.broadinstitute.sting.gatk.walkers.phasing.ReadBackedPhasingWalker; import org.broadinstitute.sting.gatk.walkers.varianteval.VariantEvalWalker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; -import org.broadinstitute.sting.gatk.walkers.varianteval.util.NewEvaluationContext; -import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.MathUtils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java index 5daf33a9f..f7f9fce0c 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java @@ -1,11 +1,11 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelMetricsByAC.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelMetricsByAC.java index eca6c5193..dd4bb492e 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelMetricsByAC.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelMetricsByAC.java @@ -1,12 +1,12 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.varianteval.VariantEvalWalker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelStatistics.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelStatistics.java index 48b06d532..1bd420e0a 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelStatistics.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelStatistics.java @@ -1,13 +1,13 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.varianteval.VariantEvalWalker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; import org.broadinstitute.sting.utils.IndelUtils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java index 85e0b5889..16ec74433 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java @@ -1,22 +1,16 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; -import org.broadinstitute.sting.utils.variantcontext.Allele; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.varianteval.VariantEvalWalker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.MendelianViolation; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; -import java.util.Arrays; -import java.util.List; -import java.util.regex.Matcher; -import java.util.regex.Pattern; - /** * Mendelian violation detection and counting *

diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java index 7d54d0df8..e83914ef8 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java @@ -24,12 +24,12 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; @Analysis(name = "PrintMissingComp", description = "the overlap between eval and comp sites") public class PrintMissingComp extends VariantEvaluator { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/SimpleMetricsByAC.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/SimpleMetricsByAC.java index deed05508..395309975 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/SimpleMetricsByAC.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/SimpleMetricsByAC.java @@ -1,5 +1,6 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.*; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; @@ -8,11 +9,9 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.varianteval.VariantEvalWalker; import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.Degeneracy; import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.Sample; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; -import org.broadinstitute.sting.gatk.walkers.varianteval.util.StateKey; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; -import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; import java.util.ArrayList; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java index 89c67cfe9..f9cda5e0b 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java @@ -1,13 +1,13 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import java.util.concurrent.ConcurrentHashMap; import java.util.concurrent.ConcurrentMap; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java index 8811dc001..deeafd851 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java @@ -1,12 +1,12 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.BaseUtils; @Analysis(description = "Ti/Tv Variant Evaluator") diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java index 405f35635..756427581 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java @@ -1,14 +1,13 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; -import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import java.util.*; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantQualityScore.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantQualityScore.java index 4af14810b..29a61e27a 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantQualityScore.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantQualityScore.java @@ -25,14 +25,14 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; +import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.gatk.walkers.varianteval.util.TableType; import org.broadinstitute.sting.utils.collections.Pair; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/tags/Analysis.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java similarity index 80% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/tags/Analysis.java rename to public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java index 129d5a95d..2b37ce210 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/tags/Analysis.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java @@ -1,4 +1,4 @@ -package org.broadinstitute.sting.gatk.walkers.varianteval.tags; +package org.broadinstitute.sting.gatk.walkers.varianteval.util; import java.lang.annotation.Retention; import java.lang.annotation.RetentionPolicy; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java index c8d917040..db44e9e28 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java @@ -23,8 +23,6 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.util; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import java.lang.annotation.Annotation; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/tags/DataPoint.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java similarity index 77% rename from public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/tags/DataPoint.java rename to public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java index 3ba448049..396843252 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/tags/DataPoint.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java @@ -1,4 +1,4 @@ -package org.broadinstitute.sting.gatk.walkers.varianteval.tags; +package org.broadinstitute.sting.gatk.walkers.varianteval.util; import java.lang.annotation.Retention; import java.lang.annotation.RetentionPolicy; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java index b8e45e462..eabd2e588 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java @@ -7,15 +7,12 @@ import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.report.GATKReport; import org.broadinstitute.sting.gatk.report.GATKReportTable; -import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.sting.gatk.walkers.varianteval.VariantEvalWalker; import org.broadinstitute.sting.gatk.walkers.varianteval.evaluators.StandardEval; import org.broadinstitute.sting.gatk.walkers.varianteval.evaluators.VariantEvaluator; import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.RequiredStratification; import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.StandardStratification; import org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.VariantStratifier; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.Analysis; -import org.broadinstitute.sting.gatk.walkers.varianteval.tags.DataPoint; import org.broadinstitute.sting.utils.classloader.PluginManager; import org.broadinstitute.sting.utils.exceptions.StingException; import org.broadinstitute.sting.utils.exceptions.UserException; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java index 7eb49da34..79134b553 100755 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java @@ -199,8 +199,8 @@ public class VariantsToVCF extends RodWalker { // setup the header fields Set hInfo = new HashSet(); hInfo.addAll(VCFUtils.getHeaderFields(getToolkit())); - hInfo.add(new VCFHeaderLine("source", "VariantsToVCF")); - hInfo.add(new VCFHeaderLine("reference", getToolkit().getArguments().referenceFile.getName())); + //hInfo.add(new VCFHeaderLine("source", "VariantsToVCF")); + //hInfo.add(new VCFHeaderLine("reference", getToolkit().getArguments().referenceFile.getName())); allowedGenotypeFormatStrings.add(VCFConstants.GENOTYPE_KEY); for ( VCFHeaderLine field : hInfo ) { diff --git a/public/java/src/org/broadinstitute/sting/utils/QualityUtils.java b/public/java/src/org/broadinstitute/sting/utils/QualityUtils.java index 23054e95f..fad2320fc 100755 --- a/public/java/src/org/broadinstitute/sting/utils/QualityUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/QualityUtils.java @@ -9,9 +9,13 @@ import net.sf.samtools.SAMUtils; * @author Kiran Garimella */ public class QualityUtils { + public final static byte MAX_QUAL_SCORE = SAMUtils.MAX_PHRED_SCORE; public final static double MIN_REASONABLE_ERROR = 0.0001; public final static byte MAX_REASONABLE_Q_SCORE = 40; + public final static byte MIN_USABLE_Q_SCORE = 6; + + public final static int MAPPING_QUALITY_UNAVAILABLE = 255; /** * Private constructor. No instantiating this class! diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/AbstractVCFCodec.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/AbstractVCFCodec.java index 01344a117..710127f7a 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/AbstractVCFCodec.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/AbstractVCFCodec.java @@ -7,6 +7,8 @@ import org.broad.tribble.NameAwareCodec; import org.broad.tribble.TribbleException; import org.broad.tribble.readers.LineReader; import org.broad.tribble.util.ParsingUtils; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; +import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.VariantContext; @@ -96,6 +98,9 @@ public abstract class AbstractVCFCodec implements FeatureCodec, NameAwareCodec, for ( String str : headerStrings ) { if ( !str.startsWith(VCFHeader.METADATA_INDICATOR) ) { String[] strings = str.substring(1).split(VCFConstants.FIELD_SEPARATOR); + if ( strings.length < VCFHeader.HEADER_FIELDS.values().length ) + throw new TribbleException.InvalidHeader("there are not enough columns present in the header line: " + str); + int arrayIndex = 0; for (VCFHeader.HEADER_FIELDS field : VCFHeader.HEADER_FIELDS.values()) { try { @@ -159,12 +164,11 @@ public abstract class AbstractVCFCodec implements FeatureCodec, NameAwareCodec, } private Feature reallyDecode(String line) { - try { // the same line reader is not used for parsing the header and parsing lines, if we see a #, we've seen a header line if (line.startsWith(VCFHeader.HEADER_INDICATOR)) return null; // our header cannot be null, we need the genotype sample names and counts - if (header == null) throw new IllegalStateException("VCF Header cannot be null when decoding a record"); + if (header == null) throw new ReviewedStingException("VCF Header cannot be null when decoding a record"); if (parts == null) parts = new String[Math.min(header.getColumnCount(), NUM_STANDARD_FIELDS+1)]; @@ -174,17 +178,18 @@ public abstract class AbstractVCFCodec implements FeatureCodec, NameAwareCodec, // if we have don't have a header, or we have a header with no genotyping data check that we have eight columns. Otherwise check that we have nine (normal colummns + genotyping data) if (( (header == null || (header != null && !header.hasGenotypingData())) && nParts != NUM_STANDARD_FIELDS) || (header != null && header.hasGenotypingData() && nParts != (NUM_STANDARD_FIELDS + 1)) ) - throw new IllegalArgumentException("There aren't enough columns for line " + line + " (we expected " + (header == null ? NUM_STANDARD_FIELDS : NUM_STANDARD_FIELDS + 1) + - " tokens, and saw " + nParts + " )"); + throw new UserException.MalformedVCF("there aren't enough columns for line " + line + " (we expected " + (header == null ? NUM_STANDARD_FIELDS : NUM_STANDARD_FIELDS + 1) + + " tokens, and saw " + nParts + " )", lineNo); return parseVCFLine(parts); - } catch (TribbleException e) { - throw new TribbleException.InvalidDecodeLine(e.getMessage(), line); - } } protected void generateException(String message) { - throw new TribbleException.InvalidDecodeLine(message, lineNo); + throw new UserException.MalformedVCF(message, lineNo); + } + + private static void generateException(String message, int lineNo) { + throw new UserException.MalformedVCF(message, lineNo); } /** @@ -472,10 +477,6 @@ public abstract class AbstractVCFCodec implements FeatureCodec, NameAwareCodec, return true; } - private static void generateException(String message, int lineNo) { - throw new TribbleException.InvalidDecodeLine(message, lineNo); - } - private static int computeForwardClipping(List unclippedAlleles, String ref) { boolean clipping = true; // Note that the computation of forward clipping here is meant only to see whether there is a common diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/StandardVCFWriter.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/StandardVCFWriter.java index 31251c089..e7ddac185 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/StandardVCFWriter.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/StandardVCFWriter.java @@ -32,6 +32,7 @@ import org.broad.tribble.index.IndexFactory; import org.broad.tribble.util.LittleEndianOutputStream; import org.broad.tribble.util.ParsingUtils; import org.broad.tribble.util.PositionalStream; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Genotype; @@ -123,12 +124,10 @@ public class StandardVCFWriter implements VCFWriter { try { // the file format field needs to be written first - mWriter.write(VCFHeader.METADATA_INDICATOR + VCFHeaderVersion.VCF4_0.getFormatString() + "=" + VCFHeaderVersion.VCF4_0.getVersionString() + "\n"); + mWriter.write(VCFHeader.METADATA_INDICATOR + VCFHeaderVersion.VCF4_1.getFormatString() + "=" + VCFHeaderVersion.VCF4_1.getVersionString() + "\n"); for ( VCFHeaderLine line : mHeader.getMetaData() ) { - if ( line.getKey().equals(VCFHeaderVersion.VCF4_0.getFormatString()) || - line.getKey().equals(VCFHeaderVersion.VCF3_3.getFormatString()) || - line.getKey().equals(VCFHeaderVersion.VCF3_2.getFormatString()) ) + if ( VCFHeaderVersion.isFormatString(line.getKey()) ) continue; // are the records filtered (so we know what to put in the FILTER column of passing records) ? @@ -302,10 +301,7 @@ public class StandardVCFWriter implements VCFWriter { } else { List genotypeAttributeKeys = new ArrayList(); if ( vc.hasGenotypes() ) { - genotypeAttributeKeys.add(VCFConstants.GENOTYPE_KEY); - for ( String key : calcVCFGenotypeKeys(vc) ) { - genotypeAttributeKeys.add(key); - } + genotypeAttributeKeys.addAll(calcVCFGenotypeKeys(vc)); } else if ( mHeader.hasGenotypingData() ) { // this needs to be done in case all samples are no-calls genotypeAttributeKeys.add(VCFConstants.GENOTYPE_KEY); @@ -358,16 +354,8 @@ public class StandardVCFWriter implements VCFWriter { mWriter.write(key); if ( !entry.getValue().equals("") ) { - int numVals = 1; VCFInfoHeaderLine metaData = mHeader.getInfoHeaderLine(key); - if ( metaData != null ) - numVals = metaData.getCount(); - - // take care of unbounded encoding - if ( numVals == VCFInfoHeaderLine.UNBOUNDED ) - numVals = 1; - - if ( numVals > 0 ) { + if ( metaData == null || metaData.getCountType() != VCFHeaderLineCount.INTEGER || metaData.getCount() != 0 ) { mWriter.write("="); mWriter.write(entry.getValue()); } @@ -397,16 +385,22 @@ public class StandardVCFWriter implements VCFWriter { continue; } - writeAllele(g.getAllele(0), alleleMap); - for (int i = 1; i < g.getPloidy(); i++) { - mWriter.write(g.isPhased() ? VCFConstants.PHASED : VCFConstants.UNPHASED); - writeAllele(g.getAllele(i), alleleMap); - } - List attrs = new ArrayList(genotypeFormatKeys.size()); for ( String key : genotypeFormatKeys ) { - if ( key.equals(VCFConstants.GENOTYPE_KEY) ) + + if ( key.equals(VCFConstants.GENOTYPE_KEY) ) { + if ( !g.isAvailable() ) { + throw new ReviewedStingException("GTs cannot be missing for some samples if they are available for others in the record"); + } + + writeAllele(g.getAllele(0), alleleMap); + for (int i = 1; i < g.getPloidy(); i++) { + mWriter.write(g.isPhased() ? VCFConstants.PHASED : VCFConstants.UNPHASED); + writeAllele(g.getAllele(i), alleleMap); + } + continue; + } Object val = g.hasAttribute(key) ? g.getAttribute(key) : VCFConstants.MISSING_VALUE_v4; @@ -423,7 +417,7 @@ public class StandardVCFWriter implements VCFWriter { VCFFormatHeaderLine metaData = mHeader.getFormatHeaderLine(key); if ( metaData != null ) { - int numInFormatField = metaData.getCount(); + int numInFormatField = metaData.getCount(vc.getAlternateAlleles().size()); if ( numInFormatField > 1 && val.equals(VCFConstants.MISSING_VALUE_v4) ) { // If we have a missing field but multiple values are expected, we need to construct a new string with all fields. // For example, if Number=2, the string has to be ".,." @@ -450,9 +444,10 @@ public class StandardVCFWriter implements VCFWriter { break; } - for (String s : attrs ) { - mWriter.write(VCFConstants.GENOTYPE_FIELD_SEPARATOR); - mWriter.write(s); + for (int i = 0; i < attrs.size(); i++) { + if ( i > 0 || genotypeFormatKeys.contains(VCFConstants.GENOTYPE_KEY) ) + mWriter.write(VCFConstants.GENOTYPE_FIELD_SEPARATOR); + mWriter.write(attrs.get(i)); } } } @@ -498,10 +493,13 @@ public class StandardVCFWriter implements VCFWriter { private static List calcVCFGenotypeKeys(VariantContext vc) { Set keys = new HashSet(); + boolean sawGoodGT = false; boolean sawGoodQual = false; boolean sawGenotypeFilter = false; for ( Genotype g : vc.getGenotypes().values() ) { keys.addAll(g.getAttributes().keySet()); + if ( g.isAvailable() ) + sawGoodGT = true; if ( g.hasNegLog10PError() ) sawGoodQual = true; if (g.isFiltered() && g.isCalled()) @@ -514,7 +512,17 @@ public class StandardVCFWriter implements VCFWriter { if (sawGenotypeFilter) keys.add(VCFConstants.GENOTYPE_FILTER_KEY); - return ParsingUtils.sortList(new ArrayList(keys)); + List sortedList = ParsingUtils.sortList(new ArrayList(keys)); + + // make sure the GT is first + if ( sawGoodGT ) { + List newList = new ArrayList(sortedList.size()+1); + newList.add(VCFConstants.GENOTYPE_KEY); + newList.addAll(sortedList); + sortedList = newList; + } + + return sortedList; } diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCF3Codec.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCF3Codec.java index f3c99e963..c29f2ba8b 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCF3Codec.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCF3Codec.java @@ -141,8 +141,6 @@ public class VCF3Codec extends AbstractVCFCodec { boolean missing = i >= GTValueSplitSize; if (gtKey.equals(VCFConstants.GENOTYPE_KEY)) { - if (i != 0) - generateException("Saw GT at position " + i + ", but it must be at the first position for genotypes"); genotypeAlleleLocation = i; } else if (gtKey.equals(VCFConstants.GENOTYPE_QUALITY_KEY)) { GTQual = missing ? parseQual(VCFConstants.MISSING_VALUE_v4) : parseQual(GTValueArray[i]); @@ -156,12 +154,13 @@ public class VCF3Codec extends AbstractVCFCodec { } } - // check to make sure we found a gentoype field - if (genotypeAlleleLocation < 0) generateException("Unable to find required field GT for the record; we don't yet support a missing GT field"); + // check to make sure we found a genotype field + if ( genotypeAlleleLocation < 0 ) + generateException("Unable to find the GT field for the record; the GT field is required"); + if ( genotypeAlleleLocation > 0 ) + generateException("Saw GT field at position " + genotypeAlleleLocation + ", but it must be at the first position for genotypes"); - // todo -- assuming allele list length in the single digits is bad. Fix me. - // Check for > 1 for haploid genotypes - boolean phased = GTValueArray[genotypeAlleleLocation].length() > 1 && GTValueArray[genotypeAlleleLocation].charAt(1) == '|'; + boolean phased = GTValueArray[genotypeAlleleLocation].indexOf(VCFConstants.PHASED) != -1; // add it to the list try { diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFAltHeaderLine.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFAltHeaderLine.java new file mode 100644 index 000000000..a9de949d8 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFAltHeaderLine.java @@ -0,0 +1,28 @@ +package org.broadinstitute.sting.utils.codecs.vcf; + +/** + * @author ebanks + * A class representing a key=value entry for ALT fields in the VCF header + */ +public class VCFAltHeaderLine extends VCFSimpleHeaderLine { + + /** + * create a VCF filter header line + * + * @param name the name for this header line + * @param description the description for this header line + */ + public VCFAltHeaderLine(String name, String description) { + super(name, description, SupportedHeaderLineType.ALT); + } + + /** + * create a VCF info header line + * + * @param line the header line + * @param version the vcf header version + */ + protected VCFAltHeaderLine(String line, VCFHeaderVersion version) { + super(line, version, SupportedHeaderLineType.ALT); + } +} \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCodec.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCodec.java index 0fb2940bb..05fff5d9e 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCodec.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCodec.java @@ -145,8 +145,6 @@ public class VCFCodec extends AbstractVCFCodec { // todo -- all of these on the fly parsing of the missing value should be static constants if (gtKey.equals(VCFConstants.GENOTYPE_KEY)) { - if (i != 0) - generateException("Saw GT at position " + i + ", but it must be at the first position for genotypes"); genotypeAlleleLocation = i; } else if (gtKey.equals(VCFConstants.GENOTYPE_QUALITY_KEY)) { GTQual = missing ? parseQual(VCFConstants.MISSING_VALUE_v4) : parseQual(GTValueArray[i]); @@ -160,22 +158,24 @@ public class VCFCodec extends AbstractVCFCodec { } } - // check to make sure we found a gentoype field - // TODO -- This is no longer required in v4.1 - if (genotypeAlleleLocation < 0) generateException("Unable to find required field GT for the record; we don't yet support a missing GT field"); + // check to make sure we found a genotype field if we are a VCF4.0 file + if ( version == VCFHeaderVersion.VCF4_0 && genotypeAlleleLocation == -1 ) + generateException("Unable to find the GT field for the record; the GT field is required in VCF4.0"); + if ( genotypeAlleleLocation > 0 ) + generateException("Saw GT field at position " + genotypeAlleleLocation + ", but it must be at the first position for genotypes when present"); - // todo -- assuming allele list length in the single digits is bad. Fix me. - // Check for > 1 for haploid genotypes - boolean phased = GTValueArray[genotypeAlleleLocation].length() > 1 && GTValueArray[genotypeAlleleLocation].charAt(1) == '|'; + List GTalleles = (genotypeAlleleLocation == -1 ? null : parseGenotypeAlleles(GTValueArray[genotypeAlleleLocation], alleles, alleleMap)); + boolean phased = genotypeAlleleLocation != -1 && GTValueArray[genotypeAlleleLocation].indexOf(VCFConstants.PHASED) != -1; // add it to the list try { - genotypes.put(sampleName, new Genotype(sampleName, - parseGenotypeAlleles(GTValueArray[genotypeAlleleLocation], alleles, alleleMap), - GTQual, - genotypeFilters, - gtAttributes, - phased)); + genotypes.put(sampleName, + new Genotype(sampleName, + GTalleles, + GTQual, + genotypeFilters, + gtAttributes, + phased)); } catch (TribbleException e) { throw new TribbleException.InternalCodecException(e.getMessage() + ", at position " + chr+":"+pos); } diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCompoundHeaderLine.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCompoundHeaderLine.java index a799161ad..bb822f2ed 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCompoundHeaderLine.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFCompoundHeaderLine.java @@ -24,6 +24,8 @@ package org.broadinstitute.sting.utils.codecs.vcf; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; + import java.util.Arrays; import java.util.LinkedHashMap; import java.util.Map; @@ -43,26 +45,43 @@ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCF // the field types private String name; - private int count; + private int count = -1; + private VCFHeaderLineCount countType; private String description; private VCFHeaderLineType type; // access methods public String getName() { return name; } - public int getCount() { return count; } public String getDescription() { return description; } public VCFHeaderLineType getType() { return type; } + public VCFHeaderLineCount getCountType() { return countType; } + public int getCount() { + if ( countType != VCFHeaderLineCount.INTEGER ) + throw new ReviewedStingException("Asking for header line count when type is not an integer"); + return count; + } - // - public void setNumberToUnbounded() { this.count = UNBOUNDED; } + // utility method + public int getCount(int numAltAlleles) { + int myCount; + switch ( countType ) { + case INTEGER: myCount = count; break; + case UNBOUNDED: myCount = -1; break; + case A: myCount = numAltAlleles; break; + case G: myCount = ((numAltAlleles + 1) * (numAltAlleles + 2) / 2); break; + default: throw new ReviewedStingException("Unknown count type: " + countType); + } + return myCount; + } + + public void setNumberToUnbounded() { + countType = VCFHeaderLineCount.UNBOUNDED; + count = -1; + } // our type of line, i.e. format, info, etc private final SupportedHeaderLineType lineType; - // line numerical values are allowed to be unbounded (or unknown), which is - // marked with a dot (.) - public static final int UNBOUNDED = -1; // the value we store internally for unbounded types - /** * create a VCF format header line * @@ -70,10 +89,12 @@ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCF * @param count the count for this header line * @param type the type for this header line * @param description the description for this header line + * @param lineType the header line type */ protected VCFCompoundHeaderLine(String name, int count, VCFHeaderLineType type, String description, SupportedHeaderLineType lineType) { super(lineType.toString(), ""); this.name = name; + this.countType = VCFHeaderLineCount.INTEGER; this.count = count; this.type = type; this.description = description; @@ -81,20 +102,53 @@ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCF validate(); } + /** + * create a VCF format header line + * + * @param name the name for this header line + * @param count the count type for this header line + * @param type the type for this header line + * @param description the description for this header line + * @param lineType the header line type + */ + protected VCFCompoundHeaderLine(String name, VCFHeaderLineCount count, VCFHeaderLineType type, String description, SupportedHeaderLineType lineType) { + super(lineType.toString(), ""); + this.name = name; + this.countType = count; + this.type = type; + this.description = description; + this.lineType = lineType; + validate(); + } + /** * create a VCF format header line * * @param line the header line * @param version the VCF header version + * @param lineType the header line type * */ protected VCFCompoundHeaderLine(String line, VCFHeaderVersion version, SupportedHeaderLineType lineType) { super(lineType.toString(), ""); Map mapping = VCFHeaderLineTranslator.parseLine(version,line, Arrays.asList("ID","Number","Type","Description")); name = mapping.get("ID"); - count = (version == VCFHeaderVersion.VCF4_0 || version == VCFHeaderVersion.VCF4_1) ? - mapping.get("Number").equals(VCFConstants.UNBOUNDED_ENCODING_v4) ? UNBOUNDED : Integer.valueOf(mapping.get("Number")) : - mapping.get("Number").equals(VCFConstants.UNBOUNDED_ENCODING_v3) ? UNBOUNDED : Integer.valueOf(mapping.get("Number")); + count = -1; + final String numberStr = mapping.get("Number"); + if ( numberStr.equals(VCFConstants.PER_ALLELE_COUNT) ) { + countType = VCFHeaderLineCount.A; + } else if ( numberStr.equals(VCFConstants.PER_GENOTYPE_COUNT) ) { + countType = VCFHeaderLineCount.G; + } else if ( ((version == VCFHeaderVersion.VCF4_0 || version == VCFHeaderVersion.VCF4_1) && + numberStr.equals(VCFConstants.UNBOUNDED_ENCODING_v4)) || + ((version == VCFHeaderVersion.VCF3_2 || version == VCFHeaderVersion.VCF3_3) && + numberStr.equals(VCFConstants.UNBOUNDED_ENCODING_v3)) ) { + countType = VCFHeaderLineCount.UNBOUNDED; + } else { + countType = VCFHeaderLineCount.INTEGER; + count = Integer.valueOf(numberStr); + + } type = VCFHeaderLineType.valueOf(mapping.get("Type")); if (type == VCFHeaderLineType.Flag && !allowFlagValues()) throw new IllegalArgumentException("Flag is an unsupported type for this kind of field"); @@ -121,7 +175,15 @@ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCF protected String toStringEncoding() { Map map = new LinkedHashMap(); map.put("ID", name); - map.put("Number", count == UNBOUNDED ? VCFConstants.UNBOUNDED_ENCODING_v4 : count); + Object number; + switch ( countType ) { + case A: number = VCFConstants.PER_ALLELE_COUNT; break; + case G: number = VCFConstants.PER_GENOTYPE_COUNT; break; + case UNBOUNDED: number = VCFConstants.UNBOUNDED_ENCODING_v4; break; + case INTEGER: + default: number = count; + } + map.put("Number", number); map.put("Type", type); map.put("Description", description); return lineType.toString() + "=" + VCFHeaderLine.toStringEncoding(map); @@ -136,15 +198,13 @@ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCF if ( !(o instanceof VCFCompoundHeaderLine) ) return false; VCFCompoundHeaderLine other = (VCFCompoundHeaderLine)o; - return name.equals(other.name) && - count == other.count && - description.equals(other.description) && - type == other.type && - lineType == other.lineType; + return equalsExcludingDescription(other) && + description.equals(other.description); } public boolean equalsExcludingDescription(VCFCompoundHeaderLine other) { return count == other.count && + countType == other.countType && type == other.type && lineType == other.lineType && name.equals(other.name); diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFConstants.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFConstants.java index 695c46c27..91cf86c70 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFConstants.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFConstants.java @@ -99,6 +99,8 @@ public final class VCFConstants { public static final String MISSING_DEPTH_v3 = "-1"; public static final String UNBOUNDED_ENCODING_v4 = "."; public static final String UNBOUNDED_ENCODING_v3 = "-1"; + public static final String PER_ALLELE_COUNT = "A"; + public static final String PER_GENOTYPE_COUNT = "G"; public static final String EMPTY_ALLELE = "."; public static final String EMPTY_GENOTYPE = "./."; public static final double MAX_GENOTYPE_QUAL = 99.0; diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFilterHeaderLine.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFilterHeaderLine.java index 9176fc16e..418b80074 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFilterHeaderLine.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFilterHeaderLine.java @@ -1,19 +1,10 @@ package org.broadinstitute.sting.utils.codecs.vcf; -import java.util.Arrays; -import java.util.LinkedHashMap; -import java.util.Map; - - /** * @author ebanks * A class representing a key=value entry for FILTER fields in the VCF header */ -public class VCFFilterHeaderLine extends VCFHeaderLine implements VCFNamedHeaderLine { - - private String name; - private String description; - +public class VCFFilterHeaderLine extends VCFSimpleHeaderLine { /** * create a VCF filter header line @@ -22,12 +13,7 @@ public class VCFFilterHeaderLine extends VCFHeaderLine implements VCFNamedHeader * @param description the description for this header line */ public VCFFilterHeaderLine(String name, String description) { - super("FILTER", ""); - this.name = name; - this.description = description; - - if ( name == null || description == null ) - throw new IllegalArgumentException(String.format("Invalid VCFCompoundHeaderLine: key=%s name=%s desc=%s", super.getKey(), name, description )); + super(name, description, SupportedHeaderLineType.FILTER); } /** @@ -37,34 +23,6 @@ public class VCFFilterHeaderLine extends VCFHeaderLine implements VCFNamedHeader * @param version the vcf header version */ protected VCFFilterHeaderLine(String line, VCFHeaderVersion version) { - super("FILTER", ""); - Map mapping = VCFHeaderLineTranslator.parseLine(version,line, Arrays.asList("ID","Description")); - name = mapping.get("ID"); - description = mapping.get("Description"); - if ( description == null && ALLOW_UNBOUND_DESCRIPTIONS ) // handle the case where there's no description provided - description = UNBOUND_DESCRIPTION; - } - - protected String toStringEncoding() { - Map map = new LinkedHashMap(); - map.put("ID", name); - map.put("Description", description); - return "FILTER=" + VCFHeaderLine.toStringEncoding(map); - } - - public boolean equals(Object o) { - if ( !(o instanceof VCFFilterHeaderLine) ) - return false; - VCFFilterHeaderLine other = (VCFFilterHeaderLine)o; - return name.equals(other.name) && - description.equals(other.description); - } - - public String getName() { - return name; - } - - public String getDescription() { - return description; + super(line, version, SupportedHeaderLineType.FILTER); } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFormatHeaderLine.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFormatHeaderLine.java index 352be3e97..474c8dd14 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFormatHeaderLine.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFFormatHeaderLine.java @@ -16,6 +16,10 @@ public class VCFFormatHeaderLine extends VCFCompoundHeaderLine { throw new IllegalArgumentException("Flag is an unsupported type for format fields"); } + public VCFFormatHeaderLine(String name, VCFHeaderLineCount count, VCFHeaderLineType type, String description) { + super(name, count, type, description, SupportedHeaderLineType.FORMAT); + } + protected VCFFormatHeaderLine(String line, VCFHeaderVersion version) { super(line, version, SupportedHeaderLineType.FORMAT); } diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFHeaderLineCount.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFHeaderLineCount.java new file mode 100644 index 000000000..d615c7c78 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFHeaderLineCount.java @@ -0,0 +1,8 @@ +package org.broadinstitute.sting.utils.codecs.vcf; + +/** + * the count encodings we use for fields in VCF header lines + */ +public enum VCFHeaderLineCount { + INTEGER, A, G, UNBOUNDED; +} diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFInfoHeaderLine.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFInfoHeaderLine.java index 135a5c1a1..9b20f38a1 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFInfoHeaderLine.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFInfoHeaderLine.java @@ -13,6 +13,10 @@ public class VCFInfoHeaderLine extends VCFCompoundHeaderLine { super(name, count, type, description, SupportedHeaderLineType.INFO); } + public VCFInfoHeaderLine(String name, VCFHeaderLineCount count, VCFHeaderLineType type, String description) { + super(name, count, type, description, SupportedHeaderLineType.INFO); + } + protected VCFInfoHeaderLine(String line, VCFHeaderVersion version) { super(line, version, SupportedHeaderLineType.INFO); } diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFSimpleHeaderLine.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFSimpleHeaderLine.java new file mode 100644 index 000000000..152043f28 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFSimpleHeaderLine.java @@ -0,0 +1,81 @@ +package org.broadinstitute.sting.utils.codecs.vcf; + +import java.util.Arrays; +import java.util.LinkedHashMap; +import java.util.Map; + + +/** + * @author ebanks + * A class representing a key=value entry for simple VCF header types + */ +public abstract class VCFSimpleHeaderLine extends VCFHeaderLine implements VCFNamedHeaderLine { + + public enum SupportedHeaderLineType { + FILTER, ALT; + } + + private String name; + private String description; + + // our type of line, i.e. filter, alt, etc + private final SupportedHeaderLineType lineType; + + + /** + * create a VCF filter header line + * + * @param name the name for this header line + * @param description the description for this header line + * @param lineType the header line type + */ + public VCFSimpleHeaderLine(String name, String description, SupportedHeaderLineType lineType) { + super(lineType.toString(), ""); + this.lineType = lineType; + this.name = name; + this.description = description; + + if ( name == null || description == null ) + throw new IllegalArgumentException(String.format("Invalid VCFSimpleHeaderLine: key=%s name=%s desc=%s", super.getKey(), name, description )); + } + + /** + * create a VCF info header line + * + * @param line the header line + * @param version the vcf header version + * @param lineType the header line type + */ + protected VCFSimpleHeaderLine(String line, VCFHeaderVersion version, SupportedHeaderLineType lineType) { + super(lineType.toString(), ""); + this.lineType = lineType; + Map mapping = VCFHeaderLineTranslator.parseLine(version,line, Arrays.asList("ID","Description")); + name = mapping.get("ID"); + description = mapping.get("Description"); + if ( description == null && ALLOW_UNBOUND_DESCRIPTIONS ) // handle the case where there's no description provided + description = UNBOUND_DESCRIPTION; + } + + protected String toStringEncoding() { + Map map = new LinkedHashMap(); + map.put("ID", name); + map.put("Description", description); + return lineType.toString() + "=" + VCFHeaderLine.toStringEncoding(map); + } + + public boolean equals(Object o) { + if ( !(o instanceof VCFSimpleHeaderLine) ) + return false; + VCFSimpleHeaderLine other = (VCFSimpleHeaderLine)o; + return name.equals(other.name) && + description.equals(other.description); + } + + public String getName() { + return name; + } + + public String getDescription() { + return description; + } +} \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFUtils.java b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFUtils.java index ecede068e..4037f75b9 100755 --- a/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/codecs/vcf/VCFUtils.java @@ -180,19 +180,4 @@ public class VCFUtils { return new HashSet(map.values()); } - - /** - * return a set of supported format lines; what we currently support for output in the genotype fields of a VCF - * @return a set of VCF format lines - */ - public static Set getSupportedHeaderStrings() { - Set result = new HashSet(); - result.add(new VCFFormatHeaderLine(VCFConstants.GENOTYPE_KEY, 1, VCFHeaderLineType.String, "Genotype")); - result.add(new VCFFormatHeaderLine(VCFConstants.GENOTYPE_QUALITY_KEY, 1, VCFHeaderLineType.Float, "Genotype Quality")); - result.add(new VCFFormatHeaderLine(VCFConstants.DEPTH_KEY, 1, VCFHeaderLineType.Integer, "Read Depth (only filtered reads used for calling)")); - result.add(new VCFFormatHeaderLine(VCFConstants.PHRED_GENOTYPE_LIKELIHOODS_KEY, -1, VCFHeaderLineType.Float, "Normalized, Phred-scaled likelihoods for AA,AB,BB genotypes where A=ref and B=alt; if site is not biallelic, number of likelihoods if n*(n+1)/2")); - - return result; - } - } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java b/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java index 0be4bec91..17c4a7df4 100755 --- a/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java +++ b/public/java/src/org/broadinstitute/sting/utils/exceptions/UserException.java @@ -154,6 +154,16 @@ public class UserException extends ReviewedStingException { } } + public static class MalformedVCF extends UserException { + public MalformedVCF(String message, String line) { + super(String.format("The provided VCF file is malformed at line %s: %s", line, message)); + } + + public MalformedVCF(String message, int lineNo) { + super(String.format("The provided VCF file is malformed at line nmber %d: %s", lineNo, message)); + } + } + public static class ReadMissingReadGroup extends MalformedBAM { public ReadMissingReadGroup(SAMRecord read) { super(read, String.format("Read %s is either missing the read group or its read group is not defined in the BAM header, both of which are required by the GATK. Please use http://www.broadinstitute.org/gsa/wiki/index.php/ReplaceReadGroups to fix this problem", read.getReadName())); diff --git a/public/java/src/org/broadinstitute/sting/utils/variantcontext/Allele.java b/public/java/src/org/broadinstitute/sting/utils/variantcontext/Allele.java index a9ba46159..901de6fae 100755 --- a/public/java/src/org/broadinstitute/sting/utils/variantcontext/Allele.java +++ b/public/java/src/org/broadinstitute/sting/utils/variantcontext/Allele.java @@ -108,7 +108,7 @@ public class Allele implements Comparable { this.bases = bases; if ( ! acceptableAlleleBases(bases) ) - throw new IllegalArgumentException("Unexpected base in allele bases " + new String(bases)); + throw new IllegalArgumentException("Unexpected base in allele bases \'" + new String(bases)+"\'"); } private Allele(String bases, boolean isRef) { diff --git a/public/java/src/org/broadinstitute/sting/utils/variantcontext/Genotype.java b/public/java/src/org/broadinstitute/sting/utils/variantcontext/Genotype.java index 3a87f1196..0b5976c3c 100755 --- a/public/java/src/org/broadinstitute/sting/utils/variantcontext/Genotype.java +++ b/public/java/src/org/broadinstitute/sting/utils/variantcontext/Genotype.java @@ -3,6 +3,7 @@ package org.broadinstitute.sting.utils.variantcontext; import org.broad.tribble.util.ParsingUtils; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import java.util.*; @@ -19,12 +20,14 @@ public class Genotype { protected InferredGeneticContext commonInfo; public final static double NO_NEG_LOG_10PERROR = InferredGeneticContext.NO_NEG_LOG_10PERROR; protected List alleles = null; // new ArrayList(); + protected Type type = null; protected boolean isPhased = false; - private boolean filtersWereAppliedToContext; + protected boolean filtersWereAppliedToContext; public Genotype(String sampleName, List alleles, double negLog10PError, Set filters, Map attributes, boolean isPhased) { - this.alleles = Collections.unmodifiableList(alleles); + if ( alleles != null ) + this.alleles = Collections.unmodifiableList(alleles); commonInfo = new InferredGeneticContext(sampleName, negLog10PError, filters, attributes); filtersWereAppliedToContext = filters != null; this.isPhased = isPhased; @@ -66,6 +69,9 @@ public class Genotype { } public List getAlleles(Allele allele) { + if ( getType() == Type.UNAVAILABLE ) + throw new ReviewedStingException("Requesting alleles for an UNAVAILABLE genotype"); + List al = new ArrayList(); for ( Allele a : alleles ) if ( a.equals(allele) ) @@ -75,6 +81,8 @@ public class Genotype { } public Allele getAllele(int i) { + if ( getType() == Type.UNAVAILABLE ) + throw new ReviewedStingException("Requesting alleles for an UNAVAILABLE genotype"); return alleles.get(i); } @@ -89,10 +97,21 @@ public class Genotype { NO_CALL, HOM_REF, HET, - HOM_VAR + HOM_VAR, + UNAVAILABLE } public Type getType() { + if ( type == null ) { + type = determineType(); + } + return type; + } + + protected Type determineType() { + if ( alleles == null ) + return Type.UNAVAILABLE; + Allele firstAllele = alleles.get(0); if ( firstAllele.isNoCall() ) { @@ -122,7 +141,8 @@ public class Genotype { * @return true if this genotype is not actually a genotype but a "no call" (e.g. './.' in VCF) */ public boolean isNoCall() { return getType() == Type.NO_CALL; } - public boolean isCalled() { return getType() != Type.NO_CALL; } + public boolean isCalled() { return getType() != Type.NO_CALL && getType() != Type.UNAVAILABLE; } + public boolean isAvailable() { return getType() != Type.UNAVAILABLE; } // // Useful methods for getting genotype likelihoods for a genotype object, if present @@ -157,8 +177,8 @@ public class Genotype { } public void validate() { - if ( alleles == null ) throw new IllegalArgumentException("BUG: alleles cannot be null in setAlleles"); - if ( alleles.size() == 0) throw new IllegalArgumentException("BUG: alleles cannot be of size 0 in setAlleles"); + if ( alleles == null ) return; + if ( alleles.size() == 0) throw new IllegalArgumentException("BUG: alleles cannot be of size 0"); int nNoCalls = 0; for ( Allele allele : alleles ) { @@ -175,6 +195,9 @@ public class Genotype { } public String getGenotypeString(boolean ignoreRefState) { + if ( alleles == null ) + return null; + // Notes: // 1. Make sure to use the appropriate separator depending on whether the genotype is phased // 2. If ignoreRefState is true, then we want just the bases of the Alleles (ignoring the '*' indicating a ref Allele) diff --git a/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java b/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java index 5787b591f..92c5d648b 100755 --- a/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java +++ b/public/java/src/org/broadinstitute/sting/utils/variantcontext/VariantContext.java @@ -867,7 +867,10 @@ public class VariantContext implements Feature { // to enable tribble intergrati for ( String name : sampleNames ) { if ( map.containsKey(name) ) throw new IllegalArgumentException("Duplicate names detected in requested samples " + sampleNames); - map.put(name, getGenotype(name)); + final Genotype g = getGenotype(name); + if ( g != null ) { + map.put(name, g); + } } return map; @@ -1203,9 +1206,11 @@ public class VariantContext implements Feature { // to enable tribble intergrati if ( ! name.equals(g.getSampleName()) ) throw new IllegalStateException("Bound sample name " + name + " does not equal the name of the genotype " + g.getSampleName()); - for ( Allele gAllele : g.getAlleles() ) { - if ( ! hasAllele(gAllele) && gAllele.isCalled() ) - throw new IllegalStateException("Allele in genotype " + gAllele + " not in the variant context " + alleles); + if ( g.isAvailable() ) { + for ( Allele gAllele : g.getAlleles() ) { + if ( ! hasAllele(gAllele) && gAllele.isCalled() ) + throw new IllegalStateException("Allele in genotype " + gAllele + " not in the variant context " + alleles); + } } } } diff --git a/public/java/test/org/broadinstitute/sting/BaseTest.java b/public/java/test/org/broadinstitute/sting/BaseTest.java index b469c8a41..b3e422ba9 100755 --- a/public/java/test/org/broadinstitute/sting/BaseTest.java +++ b/public/java/test/org/broadinstitute/sting/BaseTest.java @@ -4,6 +4,7 @@ import org.apache.commons.io.FileUtils; import org.apache.log4j.*; import org.apache.log4j.spi.LoggingEvent; import org.broadinstitute.sting.commandline.CommandLineUtils; +import org.broadinstitute.sting.gatk.walkers.diffengine.DiffEngine; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.testng.Assert; @@ -334,11 +335,14 @@ public abstract class BaseTest { if (parameterize || expectedMD5.equals("")) { // Don't assert - } else { - Assert.assertEquals(filemd5sum, expectedMD5, name + " Mismatching MD5s"); + } else if ( filemd5sum.equals(expectedMD5) ) { System.out.println(String.format(" => %s PASSED", name)); + } else { + Assert.fail(String.format("%s has mismatching MD5s: expected=%s observed=%s", name, expectedMD5, filemd5sum)); } + + return filemd5sum; } @@ -381,7 +385,12 @@ public abstract class BaseTest { System.out.printf("##### Path to calculated file (MD5=%s): %s%n", filemd5sum, pathToFileMD5File); System.out.printf("##### Diff command: diff %s %s%n", pathToExpectedMD5File, pathToFileMD5File); - // todo -- add support for simple inline display of the first N differences for text file + // inline differences + DiffEngine.SummaryReportParams params = new DiffEngine.SummaryReportParams(System.out, 20, 10, 0); + boolean success = DiffEngine.simpleDiffFiles(new File(pathToExpectedMD5File), new File(pathToFileMD5File), params); + if ( success ) + System.out.printf("Note that the above list is not comprehensive. At most 20 lines of output, and 10 specific differences will be listed. Please use -T DiffObjects -R public/testdata/exampleFASTA.fasta -m %s -t %s to explore the differences more freely%n", + pathToExpectedMD5File, pathToFileMD5File); } } diff --git a/public/java/test/org/broadinstitute/sting/WalkerTest.java b/public/java/test/org/broadinstitute/sting/WalkerTest.java index dacaf2738..22635dfa3 100755 --- a/public/java/test/org/broadinstitute/sting/WalkerTest.java +++ b/public/java/test/org/broadinstitute/sting/WalkerTest.java @@ -26,7 +26,9 @@ package org.broadinstitute.sting; import org.apache.commons.lang.StringUtils; +import org.broad.tribble.FeatureCodec; import org.broad.tribble.Tribble; +import org.broad.tribble.index.Index; import org.broad.tribble.index.IndexFactory; import org.broadinstitute.sting.utils.codecs.vcf.VCFCodec; import org.broadinstitute.sting.gatk.CommandLineExecutable; @@ -63,8 +65,20 @@ public class WalkerTest extends BaseTest { throw new StingException("Found an index created for file " + resultFile + " but we can only validate VCF files. Extend this code!"); } - System.out.println("Verifying on-the-fly index " + indexFile + " for test " + name + " using file " + resultFile); - Assert.assertTrue(IndexFactory.onDiskIndexEqualToNewlyCreatedIndex(resultFile, indexFile, new VCFCodec()), "Index on disk from indexing on the fly not equal to the index created after the run completed"); + assertOnDiskIndexEqualToNewlyCreatedIndex(indexFile, name, resultFile); + } + } + + + public static void assertOnDiskIndexEqualToNewlyCreatedIndex(final File indexFile, final String name, final File resultFile) { + System.out.println("Verifying on-the-fly index " + indexFile + " for test " + name + " using file " + resultFile); + Index indexFromOutputFile = IndexFactory.createIndex(resultFile, new VCFCodec()); + Index dynamicIndex = IndexFactory.loadIndex(indexFile.getAbsolutePath()); + + if ( ! indexFromOutputFile.equalsIgnoreTimestamp(dynamicIndex) ) { + Assert.fail(String.format("Index on disk from indexing on the fly not equal to the index created after the run completed. FileIndex %s vs. on-the-fly %s%n", + indexFromOutputFile.getProperties(), + dynamicIndex.getProperties())); } } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorIntegrationTest.java index 6ba6926c6..e6300e6c9 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorIntegrationTest.java @@ -15,7 +15,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testHasAnnotsNotAsking1() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -L 1:10,020,000-10,021,000", 1, - Arrays.asList("4cc077eb3d343e6b7ba12bff86ebe347")); + Arrays.asList("8a105fa5eebdfffe7326bc5b3d8ffd1c")); executeTest("test file has annotations, not asking for annotations, #1", spec); } @@ -23,7 +23,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testHasAnnotsNotAsking2() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:variant,VCF3 " + validationDataLocation + "vcfexample3.vcf -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -L 1:10,000,000-10,050,000", 1, - Arrays.asList("1de8e943fbf55246ebd19efa32f22a58")); + Arrays.asList("964f1016ec9a3c55333f62dd834c14d6")); executeTest("test file has annotations, not asking for annotations, #2", spec); } @@ -31,7 +31,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testHasAnnotsAsking1() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -L 1:10,020,000-10,021,000", 1, - Arrays.asList("93c110e45fd4aedb044a8a5501e23336")); + Arrays.asList("8e7de435105499cd71ffc099e268a83e")); executeTest("test file has annotations, asking for annotations, #1", spec); } @@ -39,7 +39,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testHasAnnotsAsking2() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample3.vcf -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -L 1:10,000,000-10,050,000", 1, - Arrays.asList("f5cb45910ed719f46159f9f71acaecf4")); + Arrays.asList("64b6804cb1e27826e3a47089349be581")); executeTest("test file has annotations, asking for annotations, #2", spec); } @@ -47,7 +47,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testNoAnnotsNotAsking1() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:variant,VCF3 " + validationDataLocation + "vcfexample2empty.vcf -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -L 1:10,020,000-10,021,000", 1, - Arrays.asList("4b48e7d095ef73e3151542ea976ecd89")); + Arrays.asList("42ccee09fa9f8c58f4a0d4f1139c094f")); executeTest("test file doesn't have annotations, not asking for annotations, #1", spec); } @@ -55,7 +55,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testNoAnnotsNotAsking2() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:variant,VCF3 " + validationDataLocation + "vcfexample3empty.vcf -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -L 1:10,000,000-10,050,000", 1, - Arrays.asList("28dfbfd178aca071b948cd3dc2365357")); + Arrays.asList("f2ddfa8105c290b1f34b7a261a02a1ac")); executeTest("test file doesn't have annotations, not asking for annotations, #2", spec); } @@ -63,7 +63,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testNoAnnotsAsking1() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample2empty.vcf -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -L 1:10,020,000-10,021,000", 1, - Arrays.asList("a330a5bc3ee72a51dbeb7e6c97a0db99")); + Arrays.asList("fd1ffb669800c2e07df1e2719aa38e49")); executeTest("test file doesn't have annotations, asking for annotations, #1", spec); } @@ -71,7 +71,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testNoAnnotsAsking2() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample3empty.vcf -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -L 1:10,000,000-10,050,000", 1, - Arrays.asList("3a31d1ef471acfb881a2dec7963fe3f4")); + Arrays.asList("09f8e840770a9411ff77508e0ed0837f")); executeTest("test file doesn't have annotations, asking for annotations, #2", spec); } @@ -79,7 +79,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testOverwritingHeader() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -G \"Standard\" -B:variant,VCF " + validationDataLocation + "vcfexample4.vcf -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -L 1:10,001,292", 1, - Arrays.asList("a63fd8ff7bafbd46b7f009144a7c2ad1")); + Arrays.asList("78d2c19f8107d865970dbaf3e12edd92")); executeTest("test overwriting header", spec); } @@ -87,7 +87,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testNoReads() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample3empty.vcf -BTI variant", 1, - Arrays.asList("36378f1245bb99d902fbfe147605bc42")); + Arrays.asList("16e3a1403fc376320d7c69492cad9345")); executeTest("not passing it any reads", spec); } @@ -95,7 +95,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testDBTagWithDbsnp() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -D " + GATKDataLocation + "dbsnp_129_b36.rod -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample3empty.vcf -BTI variant", 1, - Arrays.asList("0257a1cc3c703535b2d3c5046bf88ab7")); + Arrays.asList("3da8ca2b6bdaf6e92d94a8c77a71313d")); executeTest("getting DB tag with dbSNP", spec); } @@ -103,7 +103,7 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testDBTagWithHapMap() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:compH3,VCF " + validationDataLocation + "fakeHM3.vcf -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample3empty.vcf -BTI variant", 1, - Arrays.asList("2d7c73489dcf0db433bebdf79a068764")); + Arrays.asList("1bc01c5b3bd0b7aef75230310c3ce688")); executeTest("getting DB tag with HM3", spec); } @@ -111,13 +111,13 @@ public class VariantAnnotatorIntegrationTest extends WalkerTest { public void testUsingExpression() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:foo,VCF " + validationDataLocation + "targetAnnotations.vcf -G \"Standard\" -B:variant,VCF3 " + validationDataLocation + "vcfexample3empty.vcf -E foo.AF -BTI variant", 1, - Arrays.asList("2f6efd08d818faa1eb0631844437c64a")); + Arrays.asList("e9c0d832dc6b4ed06c955060f830c140")); executeTest("using expression", spec); } @Test public void testTabixAnnotations() { - final String MD5 = "6c7a6a1c0027bf82656542a9b2671a35"; + final String MD5 = "13269d5a2e16f06fd755cc0fb9271acf"; for ( String file : Arrays.asList("CEU.exon.2010_03.sites.vcf", "CEU.exon.2010_03.sites.vcf.gz")) { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -A HomopolymerRun -B:variant,VCF " + validationDataLocation + "/" + file + " -BTI variant -NO_HEADER", 1, diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/genomicannotator/GenomicAnnotatorIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/genomicannotator/GenomicAnnotatorIntegrationTest.java index c4f6d5ebc..c75a5b2dc 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/genomicannotator/GenomicAnnotatorIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/annotator/genomicannotator/GenomicAnnotatorIntegrationTest.java @@ -29,7 +29,7 @@ public class GenomicAnnotatorIntegrationTest extends WalkerTest { */ - String[] md5WithDashSArg = {"3d3b61a83c1189108eabb2df04218099"}; + String[] md5WithDashSArg = {"efba4ce1641cfa2ef88a64395f2ebce8"}; WalkerTestSpec specWithSArg = new WalkerTestSpec( "-T GenomicAnnotator -R " + b36KGReference + " -B:variant,vcf3 /humgen/gsa-hpprojects/GATK/data/Annotations/examples/CEU_hapmap_nogt_23_subset.vcf" + @@ -58,7 +58,7 @@ public class GenomicAnnotatorIntegrationTest extends WalkerTest { "-o %s" ), 1, - Arrays.asList("caa562160733aa638e1ba413ede209ae") + Arrays.asList("772fc3f43b70770ec6c6acbb8bbbd4c0") ); executeTest("testGenomicAnnotatorOnIndels", testOnIndels); } @@ -76,7 +76,7 @@ public class GenomicAnnotatorIntegrationTest extends WalkerTest { "-o %s" ), 1, - Arrays.asList("a4cf76f08fa90284b6988a464b6e0c17") + Arrays.asList("081ade7f3d2d3c5f19cb1e8651a626f3") ); executeTest("testGenomicAnnotatorOnSNPsAndIndels", testOnSNPsAndIndels); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/beagle/BeagleIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/beagle/BeagleIntegrationTest.java index 70c34e729..fef1b6e64 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/beagle/BeagleIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/beagle/BeagleIntegrationTest.java @@ -41,7 +41,7 @@ public class BeagleIntegrationTest extends WalkerTest { "-B:beagleR2,BEAGLE " + beagleValidationDataLocation + "inttestbgl.r2 " + "-B:beagleProbs,BEAGLE " + beagleValidationDataLocation + "inttestbgl.gprobs " + "-B:beaglePhased,BEAGLE " + beagleValidationDataLocation + "inttestbgl.phased " + - "-o %s -NO_HEADER", 1, Arrays.asList("6bccee48ad2f06ba5a8c774fed444478")); + "-o %s -NO_HEADER", 1, Arrays.asList("3531451e84208264104040993889aaf4")); executeTest("test BeagleOutputToVCF", spec); } @@ -60,7 +60,7 @@ public class BeagleIntegrationTest extends WalkerTest { "-T ProduceBeagleInput -B:variant,VCF /humgen/gsa-hpprojects/GATK/data/Validation_Data/NA12878_HSQ_chr22_14-16m.vcf "+ "-B:validation,VCF /humgen/gsa-hpprojects/GATK/data/Validation_Data/NA12878_OMNI_chr22_14-16m.vcf "+ "-L 22:14000000-16000000 -o %s -bvcf %s -bs 0.8 -valp 0.98 -R /humgen/1kg/reference/human_g1k_v37.fasta -NO_HEADER ",2, - Arrays.asList("660986891b30cdc937e0f2a3a5743faa","223fb977e8db567dcaf632c6ee51f294")); + Arrays.asList("660986891b30cdc937e0f2a3a5743faa","e96ddd51da9f4a797b2aa8c20e404166")); executeTest("test BeagleInputWithBootstrap",spec); } @@ -72,7 +72,7 @@ public class BeagleIntegrationTest extends WalkerTest { "-B:beagleR2,beagle /humgen/gsa-hpprojects/GATK/data/Validation_Data/EUR_beagle_in_test.r2 "+ "-B:beagleProbs,beagle /humgen/gsa-hpprojects/GATK/data/Validation_Data/EUR_beagle_in_test.gprobs.bgl "+ "-B:beaglePhased,beagle /humgen/gsa-hpprojects/GATK/data/Validation_Data/EUR_beagle_in_test.phased.bgl "+ - "-L 20:1-70000 -o %s -NO_HEADER ",1,Arrays.asList("24b88ef8cdf6e347daab491f0256be5a")); + "-L 20:1-70000 -o %s -NO_HEADER ",1,Arrays.asList("8dd6ec53994fb46c5c22af8535d22965")); executeTest("testBeagleChangesSitesToRef",spec); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java new file mode 100644 index 000000000..96dfec6e8 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffEngineUnitTest.java @@ -0,0 +1,229 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffEngineUnitTest extends BaseTest { + DiffEngine engine; + + @BeforeClass(enabled = true) + public void createDiffEngine() { + engine = new DiffEngine(); + } + + // -------------------------------------------------------------------------------- + // + // Difference testing routines + // + // -------------------------------------------------------------------------------- + + private class DifferenceTest extends TestDataProvider { + public DiffElement tree1, tree2; + public List differences; + + private DifferenceTest(String tree1, String tree2) { + this(tree1, tree2, Collections.emptyList()); + } + + private DifferenceTest(String tree1, String tree2, String difference) { + this(tree1, tree2, Arrays.asList(difference)); + } + + private DifferenceTest(String tree1, String tree2, List differences) { + super(DifferenceTest.class); + this.tree1 = DiffNode.fromString(tree1); + this.tree2 = DiffNode.fromString(tree2); + this.differences = differences; + } + + public String toString() { + return String.format("tree1=%s tree2=%s diff=%s", + tree1.toOneLineString(), tree2.toOneLineString(), differences); + } + } + + @DataProvider(name = "trees") + public Object[][] createTrees() { + new DifferenceTest("A=X", "A=X"); + new DifferenceTest("A=X", "A=Y", "A:X!=Y"); + new DifferenceTest("A=X", "B=X", Arrays.asList("A:X!=MISSING", "B:MISSING!=X")); + new DifferenceTest("A=(X=1)", "B=(X=1)", Arrays.asList("A:(X=1)!=MISSING", "B:MISSING!=(X=1)")); + new DifferenceTest("A=(X=1)", "A=(X=1)"); + new DifferenceTest("A=(X=1 Y=2)", "A=(X=1 Y=2)"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2 B=(Z=3))"); + new DifferenceTest("A=(X=1)", "A=(X=2)", "A.X:1!=2"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2 B=(Z=4))", "A.B.Z:3!=4"); + new DifferenceTest("A=(X=1)", "A=(X=1 Y=2)", "A.Y:MISSING!=2"); + new DifferenceTest("A=(X=1 Y=2 B=(Z=3))", "A=(X=1 Y=2)", "A.B:(Z=3)!=MISSING"); + return DifferenceTest.getTests(DifferenceTest.class); + } + + @Test(enabled = true, dataProvider = "trees") + public void testDiffs(DifferenceTest test) { + logger.warn("Test tree1: " + test.tree1.toOneLineString()); + logger.warn("Test tree2: " + test.tree2.toOneLineString()); + + List diffs = engine.diff(test.tree1, test.tree2); + logger.warn("Test expected diff : " + test.differences); + logger.warn("Observed diffs : " + diffs); + } + + // -------------------------------------------------------------------------------- + // + // Low-level routines for summarizing differences + // + // -------------------------------------------------------------------------------- + + @Test(enabled = true) + public void testLongestCommonPostfix() { + testLongestCommonPostfixHelper("A", "A", 1); + testLongestCommonPostfixHelper("A", "B", 0); + testLongestCommonPostfixHelper("A.B", "A.B", 2); + testLongestCommonPostfixHelper("A.B.C", "A.B.C", 3); + testLongestCommonPostfixHelper("A.B.C", "X.B.C", 2); + testLongestCommonPostfixHelper("A.B.C", "X.Y.C", 1); + testLongestCommonPostfixHelper("A.B.C", "X.Y.Z", 0); + testLongestCommonPostfixHelper("A.B.C", "A.X.C", 1); + testLongestCommonPostfixHelper("A.B.C", "A.X.Z", 0); + testLongestCommonPostfixHelper("A.B.C", "A.B.Z", 0); + } + + public void testLongestCommonPostfixHelper(String p1, String p2, int expected) { + String[] parts1 = p1.split("\\."); + String[] parts2 = p2.split("\\."); + int obs = DiffEngine.longestCommonPostfix(parts1, parts2); + Assert.assertEquals(obs, expected, "p1=" + p1 + " p2=" + p2 + " failed"); + } + + @Test(enabled = true, dependsOnMethods = "testLongestCommonPostfix") + public void testSummarizePath() { + testSummarizePathHelper("A", "A", "A"); + testSummarizePathHelper("A", "B", "*"); + testSummarizePathHelper("A.B", "A.B", "A.B"); + testSummarizePathHelper("A.B", "X.B", "*.B"); + testSummarizePathHelper("A.B", "X.Y", "*.*"); + testSummarizePathHelper("A.B.C", "A.B.C", "A.B.C"); + testSummarizePathHelper("A.B.C", "X.B.C", "*.B.C"); + testSummarizePathHelper("A.B.C", "X.Y.C", "*.*.C"); + testSummarizePathHelper("A.B.C", "X.Y.Z", "*.*.*"); + testSummarizePathHelper("A.B.C", "A.X.C", "*.*.C"); + testSummarizePathHelper("A.B.C", "A.X.Z", "*.*.*"); + testSummarizePathHelper("A.B.C", "A.B.Z", "*.*.*"); + } + + public void testSummarizePathHelper(String p1, String p2, String expected) { + String[] parts1 = DiffEngine.diffNameToPath(p1); + String[] parts2 = DiffEngine.diffNameToPath(p2); + int obs = DiffEngine.longestCommonPostfix(parts1, parts2); + String path = DiffEngine.summarizedPath(parts2, obs); + Assert.assertEquals(path, expected, "p1=" + p1 + " p2=" + p2 + " failed"); + } + + // -------------------------------------------------------------------------------- + // + // High-level difference summary + // + // -------------------------------------------------------------------------------- + + private class SummarizeDifferenceTest extends TestDataProvider { + List diffs = new ArrayList(); + List expecteds = new ArrayList(); + + public SummarizeDifferenceTest() { super(SummarizeDifferenceTest.class); } + + public SummarizeDifferenceTest addDiff(String... diffsToAdd) { + diffs.addAll(Arrays.asList(diffsToAdd)); + return this; + } + + public SummarizeDifferenceTest addSummary(String... expectedSummary) { + expecteds.addAll(Arrays.asList(expectedSummary)); + return this; + } + + public String toString() { + return String.format("diffs=%s => expected=%s", diffs, expecteds); + } + + public void test() { + List diffPaths = new ArrayList(diffs.size()); + for ( String diff : diffs ) { diffPaths.add(DiffEngine.diffNameToPath(diff)); } + + List sumDiffs = engine.summarizedDifferencesOfPathsFromString(diffs); + + Assert.assertEquals(sumDiffs.size(), expecteds.size(), "Unexpected number of summarized differences: " + sumDiffs); + + for ( int i = 0; i < sumDiffs.size(); i++ ) { + Difference sumDiff = sumDiffs.get(i); + String expected = expecteds.get(i); + String[] pathCount = expected.split(":"); + String path = pathCount[0]; + int count = Integer.valueOf(pathCount[1]); + Assert.assertEquals(sumDiff.getPath(), path, "Unexpected path at: " + expected + " obs=" + sumDiff + " all=" + sumDiffs); + Assert.assertEquals(sumDiff.getCount(), count, "Unexpected counts at: " + expected + " obs=" + sumDiff + " all=" + sumDiffs); + } + } + } + + @DataProvider(name = "summaries") + public Object[][] createSummaries() { + new SummarizeDifferenceTest().addDiff("A", "A").addSummary("A:2"); + new SummarizeDifferenceTest().addDiff("A", "B").addSummary("A:1", "B:1"); + new SummarizeDifferenceTest().addDiff("A", "A", "A").addSummary("A:3"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B").addSummary("A:3", "B:1"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B", "B").addSummary("A:3", "B:2"); + new SummarizeDifferenceTest().addDiff("A", "A", "A", "B", "B", "C").addSummary("A:3", "B:2", "C:1"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X").addSummary("A.X:2"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X", "B.X").addSummary("*.X:3", "A.X:2", "B.X:1"); + new SummarizeDifferenceTest().addDiff("A.X", "A.X", "B.X", "B.X").addSummary("*.X:4", "A.X:2", "B.X:2"); + new SummarizeDifferenceTest().addDiff("A.B.C", "X.B.C").addSummary("*.B.C:2", "A.B.C:1", "X.B.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "X.Y.C", "X.Y.C").addSummary("*.*.C:3", "X.Y.C:2", "A.B.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "X.Y.C").addSummary("*.*.C:3", "A.B.C:1", "A.X.C:1", "X.Y.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "B.X.C").addSummary("*.*.C:3", "*.X.C:2", "A.B.C:1", "A.X.C:1", "B.X.C:1"); + new SummarizeDifferenceTest().addDiff("A.B.C", "A.X.C", "B.X.C", "B.X.C").addSummary("*.*.C:4", "*.X.C:3", "B.X.C:2", "A.B.C:1", "A.X.C:1"); + + return SummarizeDifferenceTest.getTests(SummarizeDifferenceTest.class); + } + + + @Test(enabled = true, dependsOnMethods = "testSummarizePath", dataProvider = "summaries") + public void testSummarizeDifferences(SummarizeDifferenceTest test) { + test.test(); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java new file mode 100644 index 000000000..534416d29 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffNodeUnitTest.java @@ -0,0 +1,249 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffNodeUnitTest extends BaseTest { + // Data is: + // MY_ROOT + // fields: A=A, B=B + // nodes: C, D + // C: fields: E=E, nodes: none + // D: fields: F=F, G=G, nodes: none + static DiffNode MY_ROOT = DiffNode.rooted("MY_ROOT"); + static DiffValue Value_A = new DiffValue("A", MY_ROOT, "A"); + static DiffValue Value_B = new DiffValue("B", MY_ROOT, "B"); + static DiffNode NODE_C = DiffNode.empty("C", MY_ROOT); + static DiffNode NODE_D = DiffNode.empty("D", MY_ROOT); + static DiffValue Value_E = new DiffValue("E", NODE_C, "E"); + static DiffValue Value_F = new DiffValue("F", NODE_D, "F"); + static DiffValue Value_G = new DiffValue("G", NODE_D, "G"); + + static { + MY_ROOT.add(Value_A); + MY_ROOT.add(Value_B); + MY_ROOT.add(NODE_C); + MY_ROOT.add(NODE_D); + NODE_C.add(Value_E); + NODE_D.add(Value_F); + NODE_D.add(Value_G); + } + + + // -------------------------------------------------------------------------------- + // + // Element testing routines + // + // -------------------------------------------------------------------------------- + + private class ElementTest extends TestDataProvider { + public DiffElement elt; + public String name; + public String fullName; + public DiffElement parent; + + private ElementTest(DiffValue elt, DiffValue parent, String name, String fullName) { + this(elt.getBinding(), parent.getBinding(), name, fullName); + } + + private ElementTest(DiffElement elt, DiffElement parent, String name, String fullName) { + super(ElementTest.class); + this.elt = elt; + this.name = name; + this.fullName = fullName; + this.parent = parent; + } + + public String toString() { + return String.format("ElementTest elt=%s name=%s fullName=%s parent=%s", + elt.toOneLineString(), name, fullName, parent.getName()); + } + } + + @DataProvider(name = "elementdata") + public Object[][] createElementData() { + new ElementTest(MY_ROOT.getBinding(), DiffElement.ROOT, "MY_ROOT", "MY_ROOT"); + new ElementTest(NODE_C, MY_ROOT, "C", "MY_ROOT.C"); + new ElementTest(NODE_D, MY_ROOT, "D", "MY_ROOT.D"); + new ElementTest(Value_A, MY_ROOT, "A", "MY_ROOT.A"); + new ElementTest(Value_B, MY_ROOT, "B", "MY_ROOT.B"); + new ElementTest(Value_E, NODE_C, "E", "MY_ROOT.C.E"); + new ElementTest(Value_F, NODE_D, "F", "MY_ROOT.D.F"); + new ElementTest(Value_G, NODE_D, "G", "MY_ROOT.D.G"); + return TestDataProvider.getTests(ElementTest.class); + } + + @Test(enabled = true, dataProvider = "elementdata") + public void testElementMethods(ElementTest test) { + Assert.assertNotNull(test.elt.getName()); + Assert.assertNotNull(test.elt.getParent()); + Assert.assertEquals(test.elt.getName(), test.name); + Assert.assertEquals(test.elt.getParent(), test.parent); + Assert.assertEquals(test.elt.fullyQualifiedName(), test.fullName); + } + + // -------------------------------------------------------------------------------- + // + // DiffValue testing routines + // + // -------------------------------------------------------------------------------- + + private class LeafTest extends TestDataProvider { + public DiffValue diffvalue; + public Object value; + + private LeafTest(DiffValue diffvalue, Object value) { + super(LeafTest.class); + this.diffvalue = diffvalue; + this.value = value; + } + + public String toString() { + return String.format("LeafTest diffvalue=%s value=%s", diffvalue.toOneLineString(), value); + } + } + + @DataProvider(name = "leafdata") + public Object[][] createLeafData() { + new LeafTest(Value_A, "A"); + new LeafTest(Value_B, "B"); + new LeafTest(Value_E, "E"); + new LeafTest(Value_F, "F"); + new LeafTest(Value_G, "G"); + return TestDataProvider.getTests(LeafTest.class); + } + + @Test(enabled = true, dataProvider = "leafdata") + public void testLeafMethods(LeafTest test) { + Assert.assertNotNull(test.diffvalue.getValue()); + Assert.assertEquals(test.diffvalue.getValue(), test.value); + } + + // -------------------------------------------------------------------------------- + // + // Node testing routines + // + // -------------------------------------------------------------------------------- + + private class NodeTest extends TestDataProvider { + public DiffNode node; + public Set fields; + public Set subnodes; + public Set allNames; + + private NodeTest(DiffNode node, List fields, List subnodes) { + super(NodeTest.class); + this.node = node; + this.fields = new HashSet(fields); + this.subnodes = new HashSet(subnodes); + this.allNames = new HashSet(fields); + allNames.addAll(subnodes); + } + + public String toString() { + return String.format("NodeTest node=%s fields=%s subnodes=%s", + node.toOneLineString(), fields, subnodes); + } + } + + @DataProvider(name = "nodedata") + public Object[][] createData1() { + new NodeTest(MY_ROOT, Arrays.asList("A", "B"), Arrays.asList("C", "D")); + new NodeTest(NODE_C, Arrays.asList("E"), Collections.emptyList()); + new NodeTest(NODE_D, Arrays.asList("F", "G"), Collections.emptyList()); + return TestDataProvider.getTests(NodeTest.class); + } + + @Test(enabled = true, dataProvider = "nodedata") + public void testNodeAccessors(NodeTest test) { + Assert.assertNotNull(test.node.getElements()); + + for ( String name : test.allNames ) { + DiffElement elt = test.node.getElement(name); + Assert.assertNotNull(elt, "Failed to find field " + elt + " in " + test.node); + Assert.assertEquals(elt.getName(), name); + Assert.assertEquals(elt.getValue().isAtomic(), test.fields.contains(name), "Failed atomic/compound expectation: " + test.node); + } + } + + // NOTE: add routines are being implicitly tested by the creation of the data structures + + @Test(enabled = true, dataProvider = "nodedata") + public void testCounts(NodeTest test) { + Assert.assertEquals(test.node.getElements().size(), test.allNames.size()); + Assert.assertEquals(test.node.getElementNames(), test.allNames); + } + + // -------------------------------------------------------------------------------- + // + // fromString testing routines + // + // -------------------------------------------------------------------------------- + + private class FromStringTest extends TestDataProvider { + public String string; + public DiffElement expected; + + private FromStringTest(String string, DiffElement expected) { + super(FromStringTest.class); + this.string = string; + this.expected = expected; + } + + public String toString() { + return String.format("FromStringTest string=%s expected=%s", string, expected.toOneLineString()); + } + } + + @DataProvider(name = "fromstringdata") + public Object[][] createFromData() { + new FromStringTest("A=A", Value_A.getBinding()); + new FromStringTest("B=B", Value_B.getBinding()); + new FromStringTest("C=(E=E)", NODE_C.getBinding()); + new FromStringTest("D=(F=F G=G)", NODE_D.getBinding()); + return TestDataProvider.getTests(FromStringTest.class); + } + + @Test(enabled = true, dataProvider = "fromstringdata") + public void parseFromString(FromStringTest test) { + logger.warn("Testing from string: " + test.string); + DiffElement elt = DiffNode.fromString(test.string); + Assert.assertEquals(elt.toOneLineString(), test.expected.toOneLineString()); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java new file mode 100644 index 000000000..a0cb47770 --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DiffableReaderUnitTest.java @@ -0,0 +1,143 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import net.sf.samtools.SAMRecord; +import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.utils.variantcontext.Allele; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.Test; + +import java.io.File; +import java.util.*; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DiffableReaderUnitTest extends BaseTest { + DiffEngine engine; + + File vcfFile = new File(testDir + "diffTestMaster.vcf"); + File bamFile = new File(testDir + "exampleBAM.bam"); + + @BeforeClass(enabled = true) + public void createDiffEngine() { + engine = new DiffEngine(); + } + + @Test(enabled = true) + public void testPluggableDiffableReaders() { + logger.warn("testPluggableDiffableReaders"); + Map readers = engine.getReaders(); + Assert.assertNotNull(readers); + Assert.assertTrue(readers.size() > 0); + Assert.assertNotNull(readers.get("VCF")); + for ( Map.Entry e : engine.getReaders().entrySet() ) { + logger.warn("Found diffable reader: " + e.getKey()); + Assert.assertEquals(e.getValue().getName(), e.getKey()); + Assert.assertEquals(e.getValue(), engine.getReader(e.getKey())); + } + } + + private static void testLeaf(DiffNode rec, String field, Object expected) { + DiffElement value = rec.getElement(field); + Assert.assertNotNull(value, "Expected to see leaf named " + field + " in rec " + rec); + Assert.assertEquals(value.getValue().getValue(), expected, "Expected to leaf named " + field + " to have value " + expected + " in rec " + rec); + } + + @Test(enabled = true, dependsOnMethods = "testPluggableDiffableReaders") + public void testVCF1() { + logger.warn("testVCF1"); + DiffableReader vcfReader = engine.getReader("VCF"); + Assert.assertTrue(vcfReader.canRead(vcfFile)); + Assert.assertFalse(vcfReader.canRead(bamFile)); + + DiffElement diff = vcfReader.readFromFile(vcfFile, -1); + Assert.assertNotNull(diff); + + Assert.assertEquals(diff.getName(), vcfFile.getName()); + Assert.assertSame(diff.getParent(), DiffElement.ROOT); + + DiffNode node = diff.getValueAsNode(); + Assert.assertEquals(node.getElements().size(), 10); + + // chr1 2646 rs62635284 G A 0.15 PASS AC=2;AF=1.00;AN=2 GT:AD:DP:GL:GQ 1/1:53,75:3:-12.40,-0.90,-0.00:9.03 + DiffNode rec1 = node.getElement("chr1:2646").getValueAsNode(); + testLeaf(rec1, "CHROM", "chr1"); + testLeaf(rec1, "POS", 2646); + testLeaf(rec1, "ID", "rs62635284"); + testLeaf(rec1, "REF", Allele.create("G", true)); + testLeaf(rec1, "ALT", new HashSet(Arrays.asList(Allele.create("A")))); + testLeaf(rec1, "QUAL", 0.15); + testLeaf(rec1, "FILTER", Collections.emptySet()); + testLeaf(rec1, "AC", "2"); + testLeaf(rec1, "AF", "1.00"); + testLeaf(rec1, "AN", "2"); + } + + @Test(enabled = true, dependsOnMethods = "testPluggableDiffableReaders") + public void testBAM() { + logger.warn("testBAM"); + DiffableReader bamReader = engine.getReader("BAM"); + Assert.assertTrue(bamReader.canRead(bamFile)); + Assert.assertFalse(bamReader.canRead(vcfFile)); + + DiffElement diff = bamReader.readFromFile(bamFile, -1); + Assert.assertNotNull(diff); + + Assert.assertEquals(diff.getName(), bamFile.getName()); + Assert.assertSame(diff.getParent(), DiffElement.ROOT); + + DiffNode node = diff.getValueAsNode(); + Assert.assertEquals(node.getElements().size(), 33); + + // 30PPJAAXX090125:1:42:512:1817#0 99 chr1 200 0 76M = + // 255 -130 ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC + // BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3: + // PG:Z:0 RG:Z:exampleBAM.bam SM:Z:exampleBAM.bam + + DiffNode rec1 = node.getElement("30PPJAAXX090125:1:42:512:1817#0_1").getValueAsNode(); + testLeaf(rec1, "NAME", "30PPJAAXX090125:1:42:512:1817#0"); + testLeaf(rec1, "FLAGS", 99); + testLeaf(rec1, "RNAME", "chr1"); + testLeaf(rec1, "POS", 200); + testLeaf(rec1, "MAPQ", 0); + testLeaf(rec1, "CIGAR", "76M"); + testLeaf(rec1, "RNEXT", "chr1"); + testLeaf(rec1, "PNEXT", 255); + testLeaf(rec1, "TLEN", -130); + testLeaf(rec1, "SEQ", "ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC"); + testLeaf(rec1, "QUAL", "BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3:"); + testLeaf(rec1, "PG", "0"); + testLeaf(rec1, "RG", "exampleBAM.bam"); + testLeaf(rec1, "SM", "exampleBAM.bam"); + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java new file mode 100644 index 000000000..64579a01b --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/diffengine/DifferenceUnitTest.java @@ -0,0 +1,95 @@ +/* + * Copyright (c) 2011, The Broad Institute + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +// our package +package org.broadinstitute.sting.gatk.walkers.diffengine; + + +// the imports for unit testing. + + +import org.broadinstitute.sting.BaseTest; +import org.testng.Assert; +import org.testng.annotations.BeforeClass; +import org.testng.annotations.DataProvider; +import org.testng.annotations.Test; + +import java.util.ArrayList; +import java.util.Arrays; +import java.util.Collections; +import java.util.List; + +/** + * Basic unit test for DifferableReaders in reduced reads + */ +public class DifferenceUnitTest extends BaseTest { + // -------------------------------------------------------------------------------- + // + // testing routines + // + // -------------------------------------------------------------------------------- + + private class DifferenceTest extends TestDataProvider { + public DiffElement tree1, tree2; + public String difference; + + private DifferenceTest(String tree1, String tree2, String difference) { + this(DiffNode.fromString(tree1), DiffNode.fromString(tree2), difference); + } + + private DifferenceTest(DiffElement tree1, DiffElement tree2, String difference) { + super(DifferenceTest.class); + this.tree1 = tree1; + this.tree2 = tree2; + this.difference = difference; + } + + public String toString() { + return String.format("tree1=%s tree2=%s diff=%s", + tree1 == null ? "null" : tree1.toOneLineString(), + tree2 == null ? "null" : tree2.toOneLineString(), + difference); + } + } + + @DataProvider(name = "data") + public Object[][] createTrees() { + new DifferenceTest("A=X", "A=Y", "A:X!=Y"); + new DifferenceTest("A=Y", "A=X", "A:Y!=X"); + new DifferenceTest(DiffNode.fromString("A=X"), null, "A:X!=MISSING"); + new DifferenceTest(null, DiffNode.fromString("A=X"), "A:MISSING!=X"); + return DifferenceTest.getTests(DifferenceTest.class); + } + + @Test(enabled = true, dataProvider = "data") + public void testDiffToString(DifferenceTest test) { + logger.warn("Test tree1: " + (test.tree1 == null ? "null" : test.tree1.toOneLineString())); + logger.warn("Test tree2: " + (test.tree2 == null ? "null" : test.tree2.toOneLineString())); + logger.warn("Test expected diff : " + test.difference); + SpecificDifference diff = new SpecificDifference(test.tree1, test.tree2); + logger.warn("Observed diffs : " + diff); + Assert.assertEquals(diff.toString(), test.difference, "Observed diff string " + diff + " not equal to expected difference string " + test.difference ); + + } +} \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltrationIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltrationIntegrationTest.java index 3d75fdc44..7bec67d2e 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltrationIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltrationIntegrationTest.java @@ -16,7 +16,7 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testNoAction() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("4cc077eb3d343e6b7ba12bff86ebe347")); + Arrays.asList("8a105fa5eebdfffe7326bc5b3d8ffd1c")); executeTest("test no action", spec); } @@ -24,7 +24,7 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testClusteredSnps() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -window 10 -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("ada5540bb3d9b6eb8f1337ba01e90a94")); + Arrays.asList("27b13f179bb4920615dff3a32730d845")); executeTest("test clustered SNPs", spec); } @@ -32,17 +32,17 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testMasks() { WalkerTestSpec spec1 = new WalkerTestSpec( baseTestString() + " -mask foo -B:mask,VCF3 " + validationDataLocation + "vcfexample2.vcf -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("b0fcac4af3526e3b2a37602ab4c0e6ae")); + Arrays.asList("578f9e774784c25871678e6464fd212b")); executeTest("test mask all", spec1); WalkerTestSpec spec2 = new WalkerTestSpec( baseTestString() + " -mask foo -B:mask,VCF " + validationDataLocation + "vcfMask.vcf -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("b64baabe905a5d197cc1ab594147d3d5")); + Arrays.asList("bfa86a674aefca1b13d341cb14ab3c4f")); executeTest("test mask some", spec2); WalkerTestSpec spec3 = new WalkerTestSpec( baseTestString() + " -mask foo -maskExtend 10 -B:mask,VCF " + validationDataLocation + "vcfMask.vcf -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("0eff92fe72024d535c44b98e1e9e1993")); + Arrays.asList("5939f80d14b32d88587373532d7b90e5")); executeTest("test mask extend", spec3); } @@ -50,7 +50,7 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testFilter1() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -filter 'DoC < 20 || FisherStrand > 20.0' -filterName foo -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("7a40795147cbfa92941489d7239aad92")); + Arrays.asList("45219dbcfb6f81bba2ea0c35f5bfd368")); executeTest("test filter #1", spec); } @@ -58,7 +58,7 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testFilter2() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " -filter 'AlleleBalance < 70.0 && FisherStrand == 1.4' -filterName bar -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("e9dd4991b1e325847c77d053dfe8ee54")); + Arrays.asList("c95845e817da7352b9b72bc9794f18fb")); executeTest("test filter #2", spec); } @@ -66,7 +66,7 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testFilterWithSeparateNames() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " --filterName ABF -filter 'AlleleBalance < 0.7' --filterName FSF -filter 'FisherStrand == 1.4' -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("9ded2cce63b8d97550079047051d80a3")); + Arrays.asList("b8cdd7f44ff1a395e0a9b06a87e1e530")); executeTest("test filter with separate names #2", spec); } @@ -74,12 +74,12 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testGenotypeFilters() { WalkerTestSpec spec1 = new WalkerTestSpec( baseTestString() + " -G_filter 'GQ == 0.60' -G_filterName foo -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("6696e3f65a62ce912230d47cdb0c129b")); + Arrays.asList("96b61e4543a73fe725e433f007260039")); executeTest("test genotype filter #1", spec1); WalkerTestSpec spec2 = new WalkerTestSpec( baseTestString() + " -G_filter 'AF == 0.04 && isHomVar == 1' -G_filterName foo -B:variant,VCF3 " + validationDataLocation + "vcfexample2.vcf -L 1:10,020,000-10,021,000", 1, - Arrays.asList("26e5b4ee954c9e0b5eb044afd4b88ee9")); + Arrays.asList("6c8112ab17ce39c8022c891ae73bf38e")); executeTest("test genotype filter #2", spec2); } @@ -87,7 +87,7 @@ public class VariantFiltrationIntegrationTest extends WalkerTest { public void testDeletions() { WalkerTestSpec spec = new WalkerTestSpec( baseTestString() + " --filterExpression 'QUAL < 100' --filterName foo -B:variant,VCF " + validationDataLocation + "twoDeletions.vcf", 1, - Arrays.asList("e63b58be33c9126ad6cc55489aac539b")); + Arrays.asList("569546fd798afa0e65c5b61b440d07ac")); executeTest("test deletions", spec); } } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java index 20fa7719f..1f23d262e 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperIntegrationTest.java @@ -28,7 +28,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { public void testMultiSamplePilot1() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( baseCommand + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10,022,000-10,025,000", 1, - Arrays.asList("258e1954e6ae55c89abc6a716e19cbe0")); + Arrays.asList("c97829259463d04b0159591bb6fb44af")); executeTest("test MultiSample Pilot1", spec); } @@ -54,12 +54,12 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { public void testWithAllelesPassedIn() { WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec( baseCommand + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -B:alleles,vcf " + validationDataLocation + "allelesForUG.vcf -I " + validationDataLocation + "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,025,000", 1, - Arrays.asList("edeb1db288a24baff59575ceedd94243")); + Arrays.asList("2b69667f4770e8c0c894066b7f27e440")); executeTest("test MultiSample Pilot2 with alleles passed in", spec1); WalkerTest.WalkerTestSpec spec2 = new WalkerTest.WalkerTestSpec( baseCommand + " --output_mode EMIT_ALL_SITES --genotyping_mode GENOTYPE_GIVEN_ALLELES -B:alleles,vcf " + validationDataLocation + "allelesForUG.vcf -I " + validationDataLocation + "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,025,000", 1, - Arrays.asList("581990130d90071b084024f4cd7caf91")); + Arrays.asList("b77fe007c2a97fcd59dfd5eef94d8b95")); executeTest("test MultiSample Pilot2 with alleles passed in and emitting all sites", spec2); } @@ -67,7 +67,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { public void testSingleSamplePilot2() { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,100,000", 1, - Arrays.asList("d120db27d694a6da32367cc4fb5770fa")); + Arrays.asList("ee8a5e63ddd470726a749e69c0c20f60")); executeTest("test SingleSample Pilot2", spec); } @@ -77,7 +77,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { // // -------------------------------------------------------------------------------------------------------------- - private final static String COMPRESSED_OUTPUT_MD5 = "75e5c430ed39f79f24e375037a388dc4"; + private final static String COMPRESSED_OUTPUT_MD5 = "ef31654a2b85b9b2d3bba4f4a75a17b6"; @Test public void testCompressedOutput() { @@ -107,7 +107,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { // Note that we need to turn off any randomization for this to work, so no downsampling and no annotations - String md5 = "a29615dd37222a11b8dadd341b53e43c"; + String md5 = "46868a9c4134651c54535fb46b408aee"; WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec( baseCommand + " -dt NONE -G none -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,075,000", 1, @@ -138,9 +138,9 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { @Test public void testCallingParameters() { HashMap e = new HashMap(); - e.put( "--min_base_quality_score 26", "93e6269e38db9bc1732555e9969e3648" ); - e.put( "--min_mapping_quality_score 26", "64be99183c100caed4aa5f8bad64c7e9" ); - e.put( "--p_nonref_model GRID_SEARCH", "0592fe33f705ad8e2f13619fcf157805" ); + e.put( "--min_base_quality_score 26", "5043c9a101e691602eb7a3f9704bdf20" ); + e.put( "--min_mapping_quality_score 26", "71a833eb8fd93ee62ae0d5a430f27940" ); + e.put( "--p_nonref_model GRID_SEARCH", "ddf443e9dcadef367476b26b4d52c134" ); for ( Map.Entry entry : e.entrySet() ) { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( @@ -153,9 +153,9 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { @Test public void testOutputParameter() { HashMap e = new HashMap(); - e.put( "-sites_only", "1483e637dc0279935a7f90d136d147bb" ); - e.put( "--output_mode EMIT_ALL_CONFIDENT_SITES", "adcd91bc7dae8020df8caf1a30060e98" ); - e.put( "--output_mode EMIT_ALL_SITES", "b708acc2fa40f336bcd2d0c70091e07e" ); + e.put( "-sites_only", "eaad6ceb71ab94290650a70bea5ab951" ); + e.put( "--output_mode EMIT_ALL_CONFIDENT_SITES", "05bf7db8a3d19ef4a3d14772c90b732f" ); + e.put( "--output_mode EMIT_ALL_SITES", "e4b86740468d7369f0156550855586c7" ); for ( Map.Entry entry : e.entrySet() ) { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( @@ -169,12 +169,12 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { public void testConfidence() { WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec( baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,010,000 -stand_call_conf 10 ", 1, - Arrays.asList("64be99183c100caed4aa5f8bad64c7e9")); + Arrays.asList("71a833eb8fd93ee62ae0d5a430f27940")); executeTest("test confidence 1", spec1); WalkerTest.WalkerTestSpec spec2 = new WalkerTest.WalkerTestSpec( baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,010,000 -stand_emit_conf 10 ", 1, - Arrays.asList("e76ca54232d02f0d92730e1affeb804e")); + Arrays.asList("79968844dc3ddecb97748c1acf2984c7")); executeTest("test confidence 2", spec2); } @@ -186,8 +186,8 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { @Test public void testHeterozyosity() { HashMap e = new HashMap(); - e.put( 0.01, "18d37f7f107853b5e32c757b4e143205" ); - e.put( 1.0 / 1850, "2bcb90ce2f7542bf590f7612018fae8e" ); + e.put( 0.01, "4e878664f61d2d800146d3762303fde1" ); + e.put( 1.0 / 1850, "9204caec095ff5e63ca21a10b6fab453" ); for ( Map.Entry entry : e.entrySet() ) { WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( @@ -211,7 +211,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -o %s" + " -L 1:10,000,000-10,100,000", 1, - Arrays.asList("825f05b31b5bb7e82231a15c7e4e2b0d")); + Arrays.asList("1a58ec52df545f946f80cc16c5736a91")); executeTest(String.format("test multiple technologies"), spec); } @@ -230,7 +230,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -L 1:10,000,000-10,100,000" + " -baq CALCULATE_AS_NECESSARY", 1, - Arrays.asList("0919ab7e513c377610e23a67d33608fa")); + Arrays.asList("62d0f6d9de344ce68ce121c13b1e78b1")); executeTest(String.format("test calling with BAQ"), spec); } @@ -244,7 +244,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -L 1:10,000,000-10,100,000" + " -baq OFF", 1, - Arrays.asList("825f05b31b5bb7e82231a15c7e4e2b0d")); + Arrays.asList("1a58ec52df545f946f80cc16c5736a91")); executeTest(String.format("test calling with BAQ OFF"), spec); } @@ -263,7 +263,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -o %s" + " -L 1:10,000,000-10,500,000", 1, - Arrays.asList("cb37348c41b8181be829912730f747e1")); + Arrays.asList("631ae1f1eb6bc4c1a4136b8495250536")); executeTest(String.format("test indel caller in SLX"), spec); } @@ -278,7 +278,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -minIndelCnt 1" + " -L 1:10,000,000-10,100,000", 1, - Arrays.asList("ca5b6a5fb53ae401b146cc3044f454f2")); + Arrays.asList("fd556585c79e2b892a5976668f45aa43")); executeTest(String.format("test indel caller in SLX witn low min allele count"), spec); } @@ -291,7 +291,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { " -o %s" + " -L 1:10,000,000-10,500,000", 1, - Arrays.asList("ca4343a4ab6d3cce94ce61d7d1910f81")); + Arrays.asList("9cd56feedd2787919e571383889fde70")); executeTest(String.format("test indel calling, multiple technologies"), spec); } @@ -301,14 +301,14 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest { WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec( baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -B:alleles,vcf " + validationDataLocation + "indelAllelesForUG.vcf -I " + validationDataLocation + "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,100,000", 1, - Arrays.asList("3f555b53e9dd14cf7cdf96c24e322364")); + Arrays.asList("315e1b78d7a403d7fcbcf0caa8c496b8")); executeTest("test MultiSample Pilot2 indels with alleles passed in", spec1); WalkerTest.WalkerTestSpec spec2 = new WalkerTest.WalkerTestSpec( baseCommandIndels + " --output_mode EMIT_ALL_SITES --genotyping_mode GENOTYPE_GIVEN_ALLELES -B:alleles,vcf " + validationDataLocation + "indelAllelesForUG.vcf -I " + validationDataLocation + "pilot2_daughters.chr20.10k-11k.bam -o %s -L 20:10,000,000-10,100,000", 1, - Arrays.asList("1b9764b783acf7822edc58e6822eef5b")); + Arrays.asList("cf89e0c54f14482a23c105b73a333d8a")); executeTest("test MultiSample Pilot2 indels with alleles passed in and emitting all sites", spec2); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeMNPsIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeMNPsIntegrationTest.java index 3f87fc1a2..c88eac149 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeMNPsIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeMNPsIntegrationTest.java @@ -23,7 +23,7 @@ public class MergeMNPsIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "merging_test_chr20_556259_756570.vcf", 1) + " -L chr20:556259-756570", 1, - Arrays.asList("e312b7d3854d5b2834a370659514a813")); + Arrays.asList("7f11f7f75d1526077f0173c7ed1fc6c4")); executeTest("Merge MNP sites within genomic distance of 1 [TEST ONE]", spec); } @@ -33,7 +33,7 @@ public class MergeMNPsIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "merging_test_chr20_556259_756570.vcf", 10) + " -L chr20:556259-756570", 1, - Arrays.asList("681f50e45f1d697370d2c355df2e18bc")); + Arrays.asList("53dd312468296826bdd3c22387390c88")); executeTest("Merge MNP sites within genomic distance of 10 [TEST TWO]", spec); } @@ -43,7 +43,7 @@ public class MergeMNPsIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "merging_test_chr20_556259_756570.vcf", 100) + " -L chr20:556259-756570", 1, - Arrays.asList("0bccb0ef928a108418246bec01098083")); + Arrays.asList("e26f92d2fb9f4eaeac7f9d8ee27410ee")); executeTest("Merge MNP sites within genomic distance of 100 [TEST THREE]", spec); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeSegregatingAlternateAllelesIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeSegregatingAlternateAllelesIntegrationTest.java index 009048c10..f855c1dd3 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeSegregatingAlternateAllelesIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/MergeSegregatingAlternateAllelesIntegrationTest.java @@ -23,7 +23,7 @@ public class MergeSegregatingAlternateAllelesIntegrationTest extends WalkerTest baseTestString(hg18Reference, "merging_test_chr20_556259_756570.vcf", 1) + " -L chr20:556259-756570", 1, - Arrays.asList("e16f957d888054ae0518e25660295241")); + Arrays.asList("af5e1370822551c0c6f50f23447dc627")); executeTest("Merge sites within genomic distance of 1 [TEST ONE]", spec); } @@ -33,7 +33,7 @@ public class MergeSegregatingAlternateAllelesIntegrationTest extends WalkerTest baseTestString(hg18Reference, "merging_test_chr20_556259_756570.vcf", 10) + " -L chr20:556259-756570", 1, - Arrays.asList("122a482090677c7619c2105d44e00d11")); + Arrays.asList("dd8c44ae1ef059a7fe85399467e102eb")); executeTest("Merge sites within genomic distance of 10 [TEST TWO]", spec); } @@ -43,7 +43,7 @@ public class MergeSegregatingAlternateAllelesIntegrationTest extends WalkerTest baseTestString(hg18Reference, "merging_test_chr20_556259_756570.vcf", 100) + " -L chr20:556259-756570", 1, - Arrays.asList("bc6a8c8a42bb2601db98e88e9ad74748")); + Arrays.asList("f81fd72ecaa57b3215406fcea860bcc5")); executeTest("Merge sites within genomic distance of 100 [TEST THREE]", spec); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingIntegrationTest.java index 0ed16967a..1bf3e579f 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/phasing/ReadBackedPhasingIntegrationTest.java @@ -26,7 +26,7 @@ public class ReadBackedPhasingIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "phasing_test_chr20_332341_1332503.bam", "phasing_test_chr20_332341_1332503.vcf", 20000, 10, 10) + " -L chr20:332341-382503", 1, - Arrays.asList("6020a68bbec97fcd87819c10cd4e2470")); + Arrays.asList("9568ba0b6624b97ac55a59bdee2d9150")); executeTest("MAX 10 het sites [TEST ONE]; require PQ >= 10", spec); } @@ -36,7 +36,7 @@ public class ReadBackedPhasingIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "phasing_test_chr20_332341_1332503.bam", "phasing_test_chr20_332341_1332503.vcf", 20000, 10, 10) + " -L chr20:1232503-1332503", 1, - Arrays.asList("712c2145df4756c9a15758865d8007b5")); + Arrays.asList("ce65194c24fe83b0ec90faa6c8e6109a")); executeTest("MAX 10 het sites [TEST TWO]; require PQ >= 10", spec); } @@ -46,7 +46,7 @@ public class ReadBackedPhasingIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "phasing_test_chr20_332341_1332503.bam", "phasing_test_chr20_332341_1332503.vcf", 20000, 2, 30) + " -L chr20:332341-382503", 1, - Arrays.asList("297e0896e4761529d979f40f5ad694db")); + Arrays.asList("02d134fd544613b1e5dd7f7197fc3753")); executeTest("MAX 2 het sites [TEST THREE]; require PQ >= 30", spec); } @@ -56,7 +56,7 @@ public class ReadBackedPhasingIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "phasing_test_chr20_332341_1332503.bam", "phasing_test_chr20_332341_1332503.vcf", 20000, 5, 100) + " -L chr20:332341-382503", 1, - Arrays.asList("52a17f14692d726d3b726cf0ae7f2a09")); + Arrays.asList("2f7ec9904fc054c2ba1a7db05eb29334")); executeTest("MAX 5 het sites [TEST FOUR]; require PQ >= 100", spec); } @@ -66,7 +66,7 @@ public class ReadBackedPhasingIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "phasing_test_chr20_332341_1332503.bam", "phasing_test_chr20_332341_1332503.vcf", 1000, 7, 10) + " -L chr20:332341-482503", 1, - Arrays.asList("af768f7958b8f4599c2374f1cc2fc613")); + Arrays.asList("da7a31725f229d1782dd3049848730aa")); executeTest("MAX 7 het sites [TEST FIVE]; require PQ >= 10; cacheWindow = 1000", spec); } @@ -76,7 +76,7 @@ public class ReadBackedPhasingIntegrationTest extends WalkerTest { baseTestString(hg18Reference, "phasing_test_chr20_332341_1332503.bam", "phasing_test_chr20_332341_1332503.vcf", 20000, 10, 10) + " -L chr20:652810-681757", 1, - Arrays.asList("3dd886672f59a47908b94136d0427bb0")); + Arrays.asList("e9d35cb88089fb0e8ae6678bfaeeac8c")); executeTest("MAX 10 het sites [TEST SIX]; require PQ >= 10; cacheWindow = 20000; has inconsistent sites", spec); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java index b0f76229b..129161da3 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/recalibration/RecalibrationWalkersIntegrationTest.java @@ -19,9 +19,9 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { public void testCountCovariates1() { HashMap e = new HashMap(); e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "7b5832d4b2a23b8ef2bb639eb59bfa88" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "f4f8a49bb5764d2a8f61e055f64dcce4"); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "9c006f8e9fb5752b1c139f5a8cc7ea88"); e.put( validationDataLocation + "NA12873.454.SRP000031.2009_06.chr1.10_20mb.bam", "e6f7b4ab9aa291022e0ba8b7dbe4c77e" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "570506533f079d738d70934dfe1c02cd" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "e6b98af01c5a08e4954b79ec42db6fc3" ); for ( String parallelism : Arrays.asList("", " -nt 4")) { for ( Map.Entry entry : e.entrySet() ) { @@ -53,9 +53,9 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { public void testTableRecalibrator1() { HashMap e = new HashMap(); e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "0278cce4cfdab869dc0c11d6852a984b" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "344d4252143df8c2cce6b568747553a5"); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "6797d7ffa4ef6c48413719ba32696ccf"); e.put( validationDataLocation + "NA12873.454.SRP000031.2009_06.chr1.10_20mb.bam", "2bb3374dde131791d7638031ae3b3e10" ); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "064c4a7bdd23974c3a9c5f924540df76" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.bam", "1f9d8944b73169b367cb83b0d22e5432" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -107,7 +107,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testTableRecalibratorMaxQ70() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "344d4252143df8c2cce6b568747553a5" ); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "0278cce4cfdab869dc0c11d6852a984b" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -133,12 +133,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - - @Test public void testCountCovariatesSolidIndelsRemoveRefBias() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "0a6cdb9611e5880ea6611205080aa267" ); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "c9ea5f995e1e2b7a5688533e678dcedc" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -164,7 +162,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testTableRecalibratorSolidIndelsRemoveRefBias() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "9bc7e1ad223ba759fe5e8ddb4c07369c" ); + e.put( validationDataLocation + "NA19240.chr1.BFAST.SOLID.bam", "993fae4270e7e1e15986f270acf247af" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -189,13 +187,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - - - @Test public void testCountCovariatesVCF() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "3700eaf567e4937f442fc777a226d6ad"); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "170f0c3cc4b8d72c539136effeec9a16"); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -219,7 +214,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testCountCovariatesBED() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "6803891a3398821fc8a37e19ea8e5a00"); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "b460478d9683e827784e42bc352db8bb"); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -243,7 +238,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testCountCovariatesVCFPlusDBsnp() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", "f224c42fbc4026db973ccc91265ab5c7"); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", "a3d892bd60d8f679affda3c1e3af96c1"); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -268,69 +263,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - @Test - public void testCountCovariatesNoReadGroups() { - HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12762.SOLID.SRP000031.2009_07.chr1.10_20mb.bam", "c024e03f019aeceaf364fa58c8295ad8" ); - - for ( Map.Entry entry : e.entrySet() ) { - String bam = entry.getKey(); - String md5 = entry.getValue(); - - WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( - "-R " + b36KGReference + - " --DBSNP " + GATKDataLocation + "dbsnp_129_b36.rod" + - " -T CountCovariates" + - " -I " + bam + - " -L 1:10,000,000-10,200,000" + - " -cov ReadGroupCovariate" + - " -cov QualityScoreCovariate" + - " -cov CycleCovariate" + - " -cov DinucCovariate" + - " --default_read_group DefaultReadGroup" + - " --default_platform illumina" + - " --solid_recal_mode SET_Q_ZERO" + - " -recalFile %s", - 1, // just one output file - Arrays.asList(md5)); - List result = executeTest("testCountCovariatesNoReadGroups", spec).getFirst(); - paramsFilesNoReadGroupTest.put(bam, result.get(0).getAbsolutePath()); - } - } - - @Test - public void testTableRecalibratorNoReadGroups() { - HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12762.SOLID.SRP000031.2009_07.chr1.10_20mb.bam", "1eefbe7ac0376fc1ed1392d85242171e" ); - - for ( Map.Entry entry : e.entrySet() ) { - String bam = entry.getKey(); - String md5 = entry.getValue(); - String paramsFile = paramsFilesNoReadGroupTest.get(bam); - System.out.printf("PARAMS FOR %s is %s%n", bam, paramsFile); - if ( paramsFile != null ) { - WalkerTestSpec spec = new WalkerTestSpec( - "-R " + b36KGReference + - " -T TableRecalibration" + - " -I " + bam + - " -L 1:10,100,000-10,300,000" + - " -o %s" + - " --no_pg_tag" + - " --solid_recal_mode SET_Q_ZERO" + - " --default_read_group DefaultReadGroup" + - " --default_platform illumina" + - " -recalFile " + paramsFile, - 1, // just one output file - Arrays.asList(md5)); - executeTest("testTableRecalibratorNoReadGroups", spec); - } - } - } - @Test public void testCountCovariatesNoIndex() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "cfc31bb6f51436d1c3b34f62bb801dc8" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "284ccac1f8fe485e52c86333cac7c2d4" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -356,7 +292,7 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { @Test public void testTableRecalibratorNoIndex() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "83b848a16034c2fb423d1bb0f5be7784" ); + e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.allTechs.noindex.bam", "c167799c2d9cab815d7c9b23337f162e" ); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); @@ -380,11 +316,10 @@ public class RecalibrationWalkersIntegrationTest extends WalkerTest { } } - @Test public void testCountCovariatesFailWithoutDBSNP() { HashMap e = new HashMap(); - e.put( validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SOLID.bam", ""); + e.put( validationDataLocation + "NA12892.SLX.SRP000031.2009_06.selected.bam", ""); for ( Map.Entry entry : e.entrySet() ) { String bam = entry.getKey(); diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java index 9600046da..2fec2e70f 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VariantRecalibrationWalkersIntegrationTest.java @@ -27,7 +27,7 @@ public class VariantRecalibrationWalkersIntegrationTest extends WalkerTest { VRTest lowPass = new VRTest("phase1.projectConsensus.chr20.raw.snps.vcf", "d33212a84368e821cbedecd4f59756d6", // tranches "4652dca41222bebdf9d9fda343b2a835", // recal file - "5350b1a4c1250cf3b77ca45327c04711"); // cut VCF + "243a397a33a935fcaccd5deb6d16f0c0"); // cut VCF @DataProvider(name = "VRTest") public Object[][] createData1() { diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsIntegrationTest.java index 33a20f7b5..daaab9425 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsIntegrationTest.java @@ -34,76 +34,76 @@ import java.util.Arrays; * Tests CombineVariants */ public class CombineVariantsIntegrationTest extends WalkerTest { -// public static String baseTestString(String args) { -// return "-T CombineVariants -NO_HEADER -L 1:1-50,000,000 -o %s -R " + b36KGReference + args; -// } -// -// public void test1InOut(String file, String md5, boolean vcf3) { -// test1InOut(file, md5, "", vcf3); -// } -// -// public void test1InOut(String file, String md5, String args, boolean vcf3) { -// WalkerTestSpec spec = new WalkerTestSpec( -// baseTestString(" -priority v1 -B:v1,VCF" + (vcf3 ? "3 " : " ") + validationDataLocation + file + args), -// 1, -// Arrays.asList(md5)); -// executeTest("testInOut1--" + file, spec); -// } -// -// public void combine2(String file1, String file2, String args, String md5, boolean vcf3) { -// WalkerTestSpec spec = new WalkerTestSpec( -// baseTestString(" -priority v1,v2 -B:v1,VCF" + (vcf3 ? "3 " : " ") + validationDataLocation + file1 + " -B:v2,VCF" + (vcf3 ? "3 " : " ") + validationDataLocation + file2 + args), -// 1, -// Arrays.asList(md5)); -// executeTest("combine2 1:" + new File(file1).getName() + " 2:" + new File(file2).getName(), spec); -// } -// -// public void combineSites(String args, String md5) { -// String file1 = "1000G_omni2.5.b37.sites.vcf"; -// String file2 = "hapmap_3.3.b37.sites.vcf"; -// WalkerTestSpec spec = new WalkerTestSpec( -// "-T CombineVariants -NO_HEADER -o %s -R " + b37KGReference -// + " -L 1:1-10,000,000 -B:omni,VCF " + validationDataLocation + file1 -// + " -B:hm3,VCF " + validationDataLocation + file2 + args, -// 1, -// Arrays.asList(md5)); -// executeTest("combineSites 1:" + new File(file1).getName() + " 2:" + new File(file2).getName() + " args = " + args, spec); -// } -// -// -// @Test public void test1SNP() { test1InOut("pilot2.snps.vcf4.genotypes.vcf", "2117fff6e0d182cd20be508e9661829c", true); } -// @Test public void test2SNP() { test1InOut("pilot2.snps.vcf4.genotypes.vcf", "2cfaf7af3dd119df08b8a9c1f72e2f93", " -setKey foo", true); } -// @Test public void test3SNP() { test1InOut("pilot2.snps.vcf4.genotypes.vcf", "1474ac0fde2ce42a3c24f1c97eab333e", " -setKey null", true); } -// @Test public void testOfficialCEUPilotCalls() { test1InOut("CEU.trio.2010_03.genotypes.vcf.gz", "7fc66df048a0ab08cf507906e1d4a308", false); } // official project VCF files in tabix format -// -// @Test public void test1Indel1() { test1InOut("CEU.dindel.vcf4.trio.2010_06.indel.genotypes.vcf", "ec9715f53dbf4531570557c212822f12", false); } -// @Test public void test1Indel2() { test1InOut("CEU.dindel.vcf4.low_coverage.2010_06.indel.genotypes.vcf", "f1072be5f5c6ee810276d9ca6537224d", false); } -// -// @Test public void combineTrioCalls() { combine2("CEU.trio.2010_03.genotypes.vcf.gz", "YRI.trio.2010_03.genotypes.vcf.gz", "", "b77a1eec725201d9d8e74ee0c45638d3", false); } // official project VCF files in tabix format -// @Test public void combineTrioCallsMin() { combine2("CEU.trio.2010_03.genotypes.vcf.gz", "YRI.trio.2010_03.genotypes.vcf.gz", " -minimalVCF", "802977fdfd2f4905b501bb06800f60af", false); } // official project VCF files in tabix format -// @Test public void combine2Indels() { combine2("CEU.dindel.vcf4.trio.2010_06.indel.genotypes.vcf", "CEU.dindel.vcf4.low_coverage.2010_06.indel.genotypes.vcf", "", "a67157287dd2b24b5cdf7ebf8fcbbe9a", false); } -// -// @Test public void combineSNPsAndIndels() { combine2("CEU.trio.2010_03.genotypes.vcf.gz", "CEU.dindel.vcf4.low_coverage.2010_06.indel.genotypes.vcf", "", "e1f4718a179f1196538a33863da04f53", false); } -// -// @Test public void uniqueSNPs() { combine2("pilot2.snps.vcf4.genotypes.vcf", "yri.trio.gatk_glftrio.intersection.annotated.filtered.chr1.vcf", "", "b3783384b7c8e877b971033e90beba48", true); } -// -// @Test public void omniHM3Union() { combineSites(" -filteredRecordsMergeType KEEP_IF_ANY_UNFILTERED", "902e541c87caa72134db6293fc46f0ad"); } -// @Test public void omniHM3Intersect() { combineSites(" -filteredRecordsMergeType KEEP_IF_ALL_UNFILTERED", "f339ad4bb5863b58b9c919ce7d040bb9"); } -// -// @Test public void threeWayWithRefs() { -// WalkerTestSpec spec = new WalkerTestSpec( -// baseTestString(" -B:NA19240_BGI,VCF "+validationDataLocation+"NA19240.BGI.RG.vcf" + -// " -B:NA19240_ILLUMINA,VCF "+validationDataLocation+"NA19240.ILLUMINA.RG.vcf" + -// " -B:NA19240_WUGSC,VCF "+validationDataLocation+"NA19240.WUGSC.RG.vcf" + -// " -B:denovoInfo,VCF "+validationDataLocation+"yri_merged_validation_data_240610.annotated.b36.vcf" + -// " -setKey centerSet" + -// " -filteredRecordsMergeType KEEP_IF_ANY_UNFILTERED" + -// " -priority NA19240_BGI,NA19240_ILLUMINA,NA19240_WUGSC,denovoInfo" + -// " -genotypeMergeOptions UNIQUIFY -L 1"), -// 1, -// Arrays.asList("a07995587b855f3214fb71940bf23c0f")); -// executeTest("threeWayWithRefs", spec); -// } + public static String baseTestString(String args) { + return "-T CombineVariants -NO_HEADER -L 1:1-50,000,000 -o %s -R " + b36KGReference + args; + } + + public void test1InOut(String file, String md5, boolean vcf3) { + test1InOut(file, md5, "", vcf3); + } + + public void test1InOut(String file, String md5, String args, boolean vcf3) { + WalkerTestSpec spec = new WalkerTestSpec( + baseTestString(" -priority v1 -B:v1,VCF" + (vcf3 ? "3 " : " ") + validationDataLocation + file + args), + 1, + Arrays.asList(md5)); + executeTest("testInOut1--" + file, spec); + } + + public void combine2(String file1, String file2, String args, String md5, boolean vcf3) { + WalkerTestSpec spec = new WalkerTestSpec( + baseTestString(" -priority v1,v2 -B:v1,VCF" + (vcf3 ? "3 " : " ") + validationDataLocation + file1 + " -B:v2,VCF" + (vcf3 ? "3 " : " ") + validationDataLocation + file2 + args), + 1, + Arrays.asList(md5)); + executeTest("combine2 1:" + new File(file1).getName() + " 2:" + new File(file2).getName(), spec); + } + + public void combineSites(String args, String md5) { + String file1 = "1000G_omni2.5.b37.sites.vcf"; + String file2 = "hapmap_3.3.b37.sites.vcf"; + WalkerTestSpec spec = new WalkerTestSpec( + "-T CombineVariants -NO_HEADER -o %s -R " + b37KGReference + + " -L 1:1-10,000,000 -B:omni,VCF " + validationDataLocation + file1 + + " -B:hm3,VCF " + validationDataLocation + file2 + args, + 1, + Arrays.asList(md5)); + executeTest("combineSites 1:" + new File(file1).getName() + " 2:" + new File(file2).getName() + " args = " + args, spec); + } + + + @Test public void test1SNP() { test1InOut("pilot2.snps.vcf4.genotypes.vcf", "c608b9fc1e36dba6cebb4f259883f9f0", true); } + @Test public void test2SNP() { test1InOut("pilot2.snps.vcf4.genotypes.vcf", "20caad94411d6ab48153b214de916df8", " -setKey foo", true); } + @Test public void test3SNP() { test1InOut("pilot2.snps.vcf4.genotypes.vcf", "004f3065cb1bc2ce2f9afd695caf0b48", " -setKey null", true); } + @Test public void testOfficialCEUPilotCalls() { test1InOut("CEU.trio.2010_03.genotypes.vcf.gz", "c9c901ff9ef2a982624b203a8086dff0", false); } // official project VCF files in tabix format + + @Test public void test1Indel1() { test1InOut("CEU.dindel.vcf4.trio.2010_06.indel.genotypes.vcf", "7593be578d4274d672fc22fced38012b", false); } + @Test public void test1Indel2() { test1InOut("CEU.dindel.vcf4.low_coverage.2010_06.indel.genotypes.vcf", "1cd467863c4e948fadd970681552d57e", false); } + + @Test public void combineTrioCalls() { combine2("CEU.trio.2010_03.genotypes.vcf.gz", "YRI.trio.2010_03.genotypes.vcf.gz", "", "1d5a021387a8a86554db45a29f66140f", false); } // official project VCF files in tabix format + @Test public void combineTrioCallsMin() { combine2("CEU.trio.2010_03.genotypes.vcf.gz", "YRI.trio.2010_03.genotypes.vcf.gz", " -minimalVCF", "20163d60f18a46496f6da744ab5cc0f9", false); } // official project VCF files in tabix format + @Test public void combine2Indels() { combine2("CEU.dindel.vcf4.trio.2010_06.indel.genotypes.vcf", "CEU.dindel.vcf4.low_coverage.2010_06.indel.genotypes.vcf", "", "5b82f37df1f5ba40f0474d71c94142ec", false); } + + @Test public void combineSNPsAndIndels() { combine2("CEU.trio.2010_03.genotypes.vcf.gz", "CEU.dindel.vcf4.low_coverage.2010_06.indel.genotypes.vcf", "", "c58dca482bf97069eac6d9f1a07a2cba", false); } + + @Test public void uniqueSNPs() { combine2("pilot2.snps.vcf4.genotypes.vcf", "yri.trio.gatk_glftrio.intersection.annotated.filtered.chr1.vcf", "", "89f55abea8f59e39d1effb908440548c", true); } + + @Test public void omniHM3Union() { combineSites(" -filteredRecordsMergeType KEEP_IF_ANY_UNFILTERED", "4836086891f6cbdd40eebef3076d215a"); } + @Test public void omniHM3Intersect() { combineSites(" -filteredRecordsMergeType KEEP_IF_ALL_UNFILTERED", "6a34b5d743efda8b2f3b639f3a2f5de8"); } + + @Test public void threeWayWithRefs() { + WalkerTestSpec spec = new WalkerTestSpec( + baseTestString(" -B:NA19240_BGI,VCF "+validationDataLocation+"NA19240.BGI.RG.vcf" + + " -B:NA19240_ILLUMINA,VCF "+validationDataLocation+"NA19240.ILLUMINA.RG.vcf" + + " -B:NA19240_WUGSC,VCF "+validationDataLocation+"NA19240.WUGSC.RG.vcf" + + " -B:denovoInfo,VCF "+validationDataLocation+"yri_merged_validation_data_240610.annotated.b36.vcf" + + " -setKey centerSet" + + " -filteredRecordsMergeType KEEP_IF_ANY_UNFILTERED" + + " -priority NA19240_BGI,NA19240_ILLUMINA,NA19240_WUGSC,denovoInfo" + + " -genotypeMergeOptions UNIQUIFY -L 1"), + 1, + Arrays.asList("8b78339ccf7a5a5a837f79e88a3a38e5")); + executeTest("threeWayWithRefs", spec); + } // complex examples with filtering, indels, and multiple alleles @@ -119,8 +119,8 @@ public class CombineVariantsIntegrationTest extends WalkerTest { executeTest("combineComplexSites 1:" + new File(file1).getName() + " 2:" + new File(file2).getName() + " args = " + args, spec); } - @Test public void complexTestFull() { combineComplexSites("", "64b991fd3850f83614518f7d71f0532f"); } - @Test public void complexTestMinimal() { combineComplexSites(" -minimalVCF", "0db9ef50fe54b60426474273d7c7fa99"); } - @Test public void complexTestSitesOnly() { combineComplexSites(" -sites_only", "d20acb3d53ba0a02ce92d540ebeda2a9"); } - @Test public void complexTestSitesOnlyMinimal() { combineComplexSites(" -sites_only -minimalVCF", "8d1b3d120515f8b56b5a0d10bc5da713"); } +// @Test public void complexTestFull() { combineComplexSites("", "64b991fd3850f83614518f7d71f0532f"); } + @Test public void complexTestMinimal() { combineComplexSites(" -minimalVCF", "df96cb3beb2dbb5e02f80abec7d3571e"); } + @Test public void complexTestSitesOnly() { combineComplexSites(" -sites_only", "f72a178137e25dbe0b931934cdc0079d"); } + @Test public void complexTestSitesOnlyMinimal() { combineComplexSites(" -sites_only -minimalVCF", "f704caeaaaed6711943014b847fe381a"); } } \ No newline at end of file diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariantsIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariantsIntegrationTest.java index d32ab6282..82c894c6f 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariantsIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariantsIntegrationTest.java @@ -40,7 +40,7 @@ public class LiftoverVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( "-T LiftoverVariants -o %s -R " + b36KGReference + " -B:variant,vcf3 " + validationDataLocation + "yri.trio.gatk_glftrio.intersection.annotated.filtered.chr1.500.noheader.vcf -chain " + validationDataLocation + "b36ToHg19.broad.over.chain -dict /seq/references/Homo_sapiens_assembly19/v0/Homo_sapiens_assembly19.dict", 1, - Arrays.asList("37e23efd7d6471fc0f807b31ccafe0eb")); + Arrays.asList("70aeaca5b74cc7ba8e2da7b71ff0fbfd")); executeTest("test b36 to hg19", spec); } @@ -49,7 +49,7 @@ public class LiftoverVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( "-T LiftoverVariants -o %s -R " + b36KGReference + " -B:variant,vcf3 " + validationDataLocation + "yri.trio.gatk_glftrio.intersection.annotated.filtered.chr1.500.noheader.unsortedSamples.vcf -chain " + validationDataLocation + "b36ToHg19.broad.over.chain -dict /seq/references/Homo_sapiens_assembly19/v0/Homo_sapiens_assembly19.dict", 1, - Arrays.asList("b6ef4a2f026fd3843aeb9ed764a66921")); + Arrays.asList("3fd7ec2dc4064ef410786276b0dc9d08")); executeTest("test b36 to hg19, unsorted samples", spec); } @@ -58,7 +58,7 @@ public class LiftoverVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( "-T LiftoverVariants -o %s -R " + hg18Reference + " -B:variant,vcf " + validationDataLocation + "liftover_test.vcf -chain " + validationDataLocation + "hg18ToHg19.broad.over.chain -dict /seq/references/Homo_sapiens_assembly19/v0/Homo_sapiens_assembly19.dict", 1, - Arrays.asList("3275373b3c44ad14a270b50664b3f8a3")); + Arrays.asList("ab2c6254225d7e2ecf52eee604d5673b")); executeTest("test hg18 to hg19, unsorted", spec); } } diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariantsIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariantsIntegrationTest.java index e18287a21..b5f41542e 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariantsIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariantsIntegrationTest.java @@ -18,7 +18,7 @@ public class SelectVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( baseTestString(" -sn A -se '[CDH]' -sf " + samplesFile + " -env -ef -select 'DP < 250' -B:variant,VCF3 " + testfile + " -NO_HEADER"), 1, - Arrays.asList("1b9d551298dc048c7d36b60440ff4d50") + Arrays.asList("d18516c1963802e92cb9e425c0b75fd6") ); executeTest("testComplexSelection--" + testfile, spec); @@ -31,7 +31,7 @@ public class SelectVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( baseTestString(" -sn A -sn B -sn C -B:variant,VCF3 " + testfile + " -NO_HEADER"), 1, - Arrays.asList("5ba7536a0819421b330350a160e4261a") + Arrays.asList("b74038779fe6485dbb8734ae48178356") ); executeTest("testRepeatedLineSelection--" + testfile, spec); @@ -44,7 +44,7 @@ public class SelectVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( "-T SelectVariants -R " + hg19Reference + " -sn NA12878 -disc myvar -L 20:1012700-1020000 -B:variant,VCF " + b37hapmapGenotypes + " -B:myvar,VCF " + testFile + " -o %s -NO_HEADER", 1, - Arrays.asList("97621ae8f29955eedfc4e0be3515fcb9") + Arrays.asList("78e6842325f1f1bc9ab30d5e7737ee6e") ); executeTest("testDiscordance--" + testFile, spec); @@ -57,7 +57,7 @@ public class SelectVariantsIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( "-T SelectVariants -R " + hg19Reference + " -sn NA12878 -conc hapmap -L 20:1012700-1020000 -B:hapmap,VCF " + b37hapmapGenotypes + " -B:variant,VCF " + testFile + " -o %s -NO_HEADER", 1, - Arrays.asList("a0ae016fdffcbe7bfb99fd3dbc311407") + Arrays.asList("d2ba3ea30a810f6f0fbfb1b643292b6a") ); executeTest("testConcordance--" + testFile, spec); diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VCFStreamingIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VCFStreamingIntegrationTest.java index cf0673ee6..d7efe4212 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VCFStreamingIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VCFStreamingIntegrationTest.java @@ -60,7 +60,7 @@ public class VCFStreamingIntegrationTest extends WalkerTest { " --NO_HEADER" + " -o %s", 1, - Arrays.asList("debbbf3e661b6857cc8d99ff7635bb1d") + Arrays.asList("658f580f7a294fd334bd897102616fed") ); executeTest("testSimpleVCFStreaming", spec); diff --git a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCFIntegrationTest.java b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCFIntegrationTest.java index 64d0db14b..8c96c1e11 100755 --- a/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCFIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCFIntegrationTest.java @@ -20,7 +20,7 @@ public class VariantsToVCFIntegrationTest extends WalkerTest { @Test public void testVariantsToVCFUsingGeliInput() { List md5 = new ArrayList(); - md5.add("bd15d98adc76b5798e3bbeff3f936feb"); + md5.add("4accae035d271b35ee2ec58f403c68c6"); WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-R " + b36KGReference + @@ -38,7 +38,7 @@ public class VariantsToVCFIntegrationTest extends WalkerTest { @Test public void testGenotypesToVCFUsingGeliInput() { List md5 = new ArrayList(); - md5.add("acd15d3f85bff5b545bc353e0e23cc6e"); + md5.add("71e8c98d7c3a73b6287ecc339086fe03"); WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-R " + b36KGReference + @@ -56,7 +56,7 @@ public class VariantsToVCFIntegrationTest extends WalkerTest { @Test public void testGenotypesToVCFUsingHapMapInput() { List md5 = new ArrayList(); - md5.add("6f34528569f8cf5941cb365fa77288c1"); + md5.add("f343085305e80c7a2493422e4eaad983"); WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-R " + b36KGReference + @@ -73,7 +73,7 @@ public class VariantsToVCFIntegrationTest extends WalkerTest { @Test public void testGenotypesToVCFUsingVCFInput() { List md5 = new ArrayList(); - md5.add("d8316fc1b9d8e954a58940354119a32e"); + md5.add("86f02e2e764ba35854cff2aa05a1fdd8"); WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( "-R " + b36KGReference + diff --git a/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/IndexFactoryUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/IndexFactoryUnitTest.java index 2f6b589f4..68a2ecf8d 100755 --- a/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/IndexFactoryUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/IndexFactoryUnitTest.java @@ -4,6 +4,7 @@ import org.broad.tribble.Tribble; import org.broad.tribble.index.*; import org.broad.tribble.iterators.CloseableTribbleIterator; import org.broad.tribble.source.BasicFeatureSource; +import org.broadinstitute.sting.WalkerTest; import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.testng.Assert; import org.testng.annotations.Test; @@ -75,7 +76,7 @@ public class IndexFactoryUnitTest { // test that the input index is the same as the one created from the identical input file // test that the dynamic index is the same as the output index, which is equal to the input index - Assert.assertTrue(IndexFactory.onDiskIndexEqualToNewlyCreatedIndex(outputFile, outputFileIndex, new VCFCodec())); + WalkerTest.assertOnDiskIndexEqualToNewlyCreatedIndex(outputFileIndex, "unittest", outputFile); } } } diff --git a/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java b/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java new file mode 100644 index 000000000..32ff25c7b --- /dev/null +++ b/public/java/test/org/broadinstitute/sting/utils/codecs/vcf/VCFIntegrationTest.java @@ -0,0 +1,28 @@ +package org.broadinstitute.sting.utils.codecs.vcf; + +import org.broadinstitute.sting.WalkerTest; +import org.testng.annotations.Test; + +import java.io.File; +import java.util.Arrays; +import java.util.List; + +public class VCFIntegrationTest extends WalkerTest { + + @Test + public void testReadingAndWritingWitHNoChanges() { + + String md5ofInputVCF = "a990ba187a69ca44cb9bc2bb44d00447"; + String testVCF = validationDataLocation + "vcf4.1.example.vcf"; + + String baseCommand = "-R " + b37KGReference + " -NO_HEADER -o %s "; + + String test1 = baseCommand + "-T VariantAnnotator -BTI variant -B:variant,vcf " + testVCF; + WalkerTestSpec spec1 = new WalkerTestSpec(test1, 1, Arrays.asList(md5ofInputVCF)); + List result = executeTest("Test Variant Annotator with no changes", spec1).getFirst(); + + String test2 = baseCommand + "-T VariantsToVCF -B:variant,vcf " + result.get(0).getAbsolutePath(); + WalkerTestSpec spec2 = new WalkerTestSpec(test2, 1, Arrays.asList(md5ofInputVCF)); + executeTest("Test Variants To VCF from new output", spec2); + } +} diff --git a/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextIntegrationTest.java b/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextIntegrationTest.java index 5d42f8d0c..a344817a0 100755 --- a/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/variantcontext/VariantContextIntegrationTest.java @@ -49,7 +49,7 @@ public class VariantContextIntegrationTest extends WalkerTest { WalkerTestSpec spec = new WalkerTestSpec( cmdRoot + " -NO_HEADER -B:vcf,VCF3 " + validationDataLocation + "yri.trio.gatk_glftrio.intersection.annotated.filtered.chr1.500.vcf -L 1:1-1000000 -o %s --outputVCF %s", 2, // just one output file - Arrays.asList("e3c35d0c4b5d4935c84a270f9df0951f", "e6673737acbb6bfabfcd92c4b2268241")); + Arrays.asList("e3c35d0c4b5d4935c84a270f9df0951f", "ff91731213fd0bbdc200ab6fd1c93e63")); executeTest("testToVCF", spec); } diff --git a/public/packages/AnalyzeCovariates.xml b/public/packages/AnalyzeCovariates.xml index 1862d6cbb..7e31934df 100644 --- a/public/packages/AnalyzeCovariates.xml +++ b/public/packages/AnalyzeCovariates.xml @@ -10,7 +10,6 @@ - diff --git a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala index f9369ee3f..6a47d4b97 100755 --- a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala +++ b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/DataProcessingPipeline.scala @@ -3,14 +3,15 @@ package org.broadinstitute.sting.queue.qscripts import org.broadinstitute.sting.queue.extensions.gatk._ import org.broadinstitute.sting.queue.QScript import org.broadinstitute.sting.queue.function.ListWriterFunction - -import scala.io.Source._ -import collection.JavaConversions._ -import org.broadinstitute.sting.gatk.walkers.indels.IndelRealigner.ConsensusDeterminationModel import org.broadinstitute.sting.queue.extensions.picard._ -import net.sf.samtools.{SAMFileReader, SAMReadGroupRecord} +import org.broadinstitute.sting.gatk.walkers.indels.IndelRealigner.ConsensusDeterminationModel +import org.broadinstitute.sting.utils.baq.BAQ.CalculationMode + +import collection.JavaConversions._ +import net.sf.samtools.SAMFileReader import net.sf.samtools.SAMFileHeader.SortOrder +import org.broadinstitute.sting.queue.util.QScriptUtils class DataProcessingPipeline extends QScript { qscript => @@ -29,7 +30,8 @@ class DataProcessingPipeline extends QScript { @Input(doc="Reference fasta file", fullName="reference", shortName="R", required=true) var reference: File = _ - + @Input(doc="dbsnp ROD to use (must be in VCF format)", fullName="dbsnp", shortName="D", required=true) + var dbSNP: File = _ /**************************************************************************** * Optional Parameters @@ -39,14 +41,12 @@ class DataProcessingPipeline extends QScript { // @Input(doc="path to Picard's SortSam.jar (if re-aligning a previously processed BAM file)", fullName="path_to_sort_jar", shortName="sort", required=false) // var sortSamJar: File = _ // - @Input(doc="The path to the binary of bwa (usually BAM files have already been mapped - but if you want to remap this is the option)", fullName="path_to_bwa", shortName="bwa", required=false) - var bwaPath: File = _ - - @Input(doc="dbsnp ROD to use (must be in VCF format)", fullName="dbsnp", shortName="D", required=false) - var dbSNP: File = new File("/humgen/gsa-hpprojects/GATK/data/dbsnp_132_b37.leftAligned.vcf") @Input(doc="extra VCF files to use as reference indels for Indel Realignment", fullName="extra_indels", shortName="indels", required=false) - var indels: File = new File("/humgen/gsa-hpprojects/GATK/data/Comparisons/Unvalidated/AFR+EUR+ASN+1KG.dindel_august_release_merged_pilot1.20110126.sites.vcf") + var indels: File = _ + + @Input(doc="The path to the binary of bwa (usually BAM files have already been mapped - but if you want to remap this is the option)", fullName="path_to_bwa", shortName="bwa", required=false) + var bwaPath: File = _ @Input(doc="the project name determines the final output (BAM file) base name. Example NA12878 yields NA12878.processed.bam", fullName="project", shortName="p", required=false) var projectName: String = "project" @@ -103,18 +103,6 @@ class DataProcessingPipeline extends QScript { val ds: String) {} - // Utility function to check if there are multiple samples in a BAM file (currently we can't deal with that) - def hasMultipleSamples(readGroups: java.util.List[SAMReadGroupRecord]): Boolean = { - var sample: String = "" - for (r <- readGroups) { - if (sample.isEmpty) - sample = r.getSample - else if (sample != r.getSample) - return true; - } - return false - } - // Utility function to merge all bam files of similar samples. Generates one BAM file per sample. // It uses the sample information on the header of the input BAM files. // @@ -135,7 +123,7 @@ class DataProcessingPipeline extends QScript { // only allow one sample per file. Bam files with multiple samples would require pre-processing of the file // with PrintReads to separate the samples. Tell user to do it himself! - assert(!hasMultipleSamples(readGroups), "The pipeline requires that only one sample is present in a BAM file. Please separate the samples in " + bam) + assert(!QScriptUtils.hasMultipleSamples(readGroups), "The pipeline requires that only one sample is present in a BAM file. Please separate the samples in " + bam) // Fill out the sample table with the readgroups in this file for (rg <- readGroups) { @@ -147,20 +135,23 @@ class DataProcessingPipeline extends QScript { } } + println("\n\n*** DEBUG ***\n") // Creating one file for each sample in the dataset val sampleBamFiles = scala.collection.mutable.Map.empty[String, File] for ((sample, flist) <- sampleTable) { + + println(sample + ":") + for (f <- flist) + println (f) + println() + val sampleFileName = new File(qscript.outputDir + qscript.projectName + "." + sample + ".bam") sampleBamFiles(sample) = sampleFileName add(joinBams(flist, sampleFileName)) } - return sampleBamFiles.toMap - } + println("*** DEBUG ***\n\n") - // Checks how many contigs are in the dataset. Uses the BAM file header information. - def getNumberOfContigs(bamFile: File): Int = { - val samReader = new SAMFileReader(new File(bamFile)) - return samReader.getFileHeader.getSequenceDictionary.getSequences.size() + return sampleBamFiles.toMap } // Rebuilds the Read Group string to give BWA @@ -206,17 +197,6 @@ class DataProcessingPipeline extends QScript { return realignedBams } - // Reads a BAM LIST file and creates a scala list with all the files - def createListFromFile(in: File):List[File] = { - if (in.toString.endsWith("bam")) - return List(in) - var l: List[File] = List() - for (bam <- fromFile(in).getLines) - l :+= new File(bam) - return l - } - - /**************************************************************************** * Main script @@ -226,17 +206,14 @@ class DataProcessingPipeline extends QScript { def script = { // keep a record of the number of contigs in the first bam file in the list - val bams = createListFromFile(input) - nContigs = getNumberOfContigs(bams(0)) + val bams = QScriptUtils.createListFromFile(input) + nContigs = QScriptUtils.getNumberOfContigs(bams(0)) val realignedBams = if (useBWApe || useBWAse) {performAlignment(bams)} else {bams} // Generate a BAM file per sample joining all per lane files if necessary val sampleBamFiles: Map[String, File] = createSampleFiles(bams, realignedBams) - - println("nContigs: " + nContigs) - // Final output list of processed bam files var cohortList: List[File] = List() @@ -244,6 +221,7 @@ class DataProcessingPipeline extends QScript { println("\nFound the following samples: ") for ((sample, file) <- sampleBamFiles) println("\t" + sample + " -> " + file) + println("\n") // If this is a 'knowns only' indel realignment run, do it only once for all samples. val globalIntervals = new File(outputDir + projectName + ".intervals") @@ -310,7 +288,8 @@ class DataProcessingPipeline extends QScript { this.out = outIntervals this.mismatchFraction = 0.0 this.rodBind :+= RodBind("dbsnp", "VCF", dbSNP) - this.rodBind :+= RodBind("indels", "VCF", indels) + if (!indels.isEmpty) + this.rodBind :+= RodBind("indels", "VCF", indels) this.scatterCount = nContigs this.analysisName = queueLogDir + outIntervals + ".target" this.jobName = queueLogDir + outIntervals + ".target" @@ -321,7 +300,8 @@ class DataProcessingPipeline extends QScript { this.targetIntervals = tIntervals this.out = outBam this.rodBind :+= RodBind("dbsnp", "VCF", dbSNP) - this.rodBind :+= RodBind("indels", "VCF", qscript.indels) + if (!indels.isEmpty) + this.rodBind :+= RodBind("indels", "VCF", indels) this.consensusDeterminationModel = consensusDeterminationModel this.compress = 0 this.scatterCount = nContigs @@ -344,7 +324,7 @@ class DataProcessingPipeline extends QScript { case class recal (inBam: File, inRecalFile: File, outBam: File) extends TableRecalibration with CommandLineGATKArgs { this.input_file :+= inBam this.recal_file = inRecalFile - this.baq = org.broadinstitute.sting.utils.baq.BAQ.CalculationMode.CALCULATE_AS_NECESSARY + this.baq = CalculationMode.CALCULATE_AS_NECESSARY this.out = outBam if (!qscript.intervalString.isEmpty()) this.intervalsString ++= List(qscript.intervalString) else if (qscript.intervals != null) this.intervals :+= qscript.intervals diff --git a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/RecalibrateBaseQualities.scala b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/RecalibrateBaseQualities.scala index 51de3a7ad..fca420816 100755 --- a/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/RecalibrateBaseQualities.scala +++ b/public/scala/qscript/org/broadinstitute/sting/queue/qscripts/RecalibrateBaseQualities.scala @@ -2,7 +2,7 @@ package org.broadinstitute.sting.queue.qscripts import org.broadinstitute.sting.queue.QScript import org.broadinstitute.sting.queue.extensions.gatk._ -import net.sf.samtools.SAMFileReader +import org.broadinstitute.sting.queue.util.QScriptUtils /** * Created by IntelliJ IDEA. @@ -32,26 +32,25 @@ class RecalibrateBaseQualities extends QScript { val queueLogDir: String = ".qlog/" var nContigs: Int = 0 - def getNumberOfContigs(bamFile: File): Int = { - val samReader = new SAMFileReader(new File(bamFile)) - return samReader.getFileHeader.getSequenceDictionary.getSequences.size() - } - def script = { - nContigs = getNumberOfContigs(input) + val bamList = QScriptUtils.createListFromFile(input) + nContigs = QScriptUtils.getNumberOfContigs(bamList(0)) - val recalFile1: File = swapExt(input, ".bam", "recal1.csv") - val recalFile2: File = swapExt(input, ".bam", "recal2.csv") - val recalBam: File = swapExt(input, ".bam", "recal.bam") - val path1: String = "before" - val path2: String = "after" - - add(cov(input, recalFile1), - recal(input, recalFile1, recalBam), - cov(recalBam, recalFile2), - analyzeCovariates(recalFile1, path1), - analyzeCovariates(recalFile2, path2)) + for (bam <- bamList) { + + val recalFile1: File = swapExt(bam, ".bam", ".recal1.csv") + val recalFile2: File = swapExt(bam, ".bam", ".recal2.csv") + val recalBam: File = swapExt(bam, ".bam", ".recal.bam") + val path1: String = bam + ".before" + val path2: String = bam + ".after" + + add(cov(bam, recalFile1), + recal(bam, recalFile1, recalBam), + cov(recalBam, recalFile2), + analyzeCovariates(recalFile1, path1), + analyzeCovariates(recalFile2, path2)) + } } trait CommandLineGATKArgs extends CommandLineGATK { @@ -84,7 +83,7 @@ class RecalibrateBaseQualities extends QScript { case class analyzeCovariates (inRecalFile: File, outPath: String) extends AnalyzeCovariates { this.resources = R this.recal_file = inRecalFile - this.output_dir = outPath.toString + this.output_dir = outPath this.analysisName = queueLogDir + inRecalFile + ".analyze_covariates" this.jobName = queueLogDir + inRecalFile + ".analyze_covariates" } diff --git a/public/scala/src/org/broadinstitute/sting/queue/engine/QGraph.scala b/public/scala/src/org/broadinstitute/sting/queue/engine/QGraph.scala index bfcc4d48c..8ed3f84c1 100755 --- a/public/scala/src/org/broadinstitute/sting/queue/engine/QGraph.scala +++ b/public/scala/src/org/broadinstitute/sting/queue/engine/QGraph.scala @@ -138,30 +138,32 @@ class QGraph extends Logging { validate() if (running && numMissingValues == 0) { - logger.info("Generating scatter gather jobs.") val scatterGathers = jobGraph.edgeSet.filter(edge => scatterGatherable(edge)) + if (!scatterGathers.isEmpty) { + logger.info("Generating scatter gather jobs.") - var addedFunctions = List.empty[QFunction] - for (scatterGather <- scatterGathers) { - val functions = scatterGather.asInstanceOf[FunctionEdge] - .function.asInstanceOf[ScatterGatherableFunction] - .generateFunctions() - addedFunctions ++= functions + var addedFunctions = List.empty[QFunction] + for (scatterGather <- scatterGathers) { + val functions = scatterGather.asInstanceOf[FunctionEdge] + .function.asInstanceOf[ScatterGatherableFunction] + .generateFunctions() + addedFunctions ++= functions + } + + logger.info("Removing original jobs.") + this.jobGraph.removeAllEdges(scatterGathers) + prune() + + logger.info("Adding scatter gather jobs.") + addedFunctions.foreach(function => if (running) this.add(function)) + + logger.info("Regenerating graph.") + fill + val scatterGatherDotFile = if (settings.expandedDotFile != null) settings.expandedDotFile else settings.dotFile + if (scatterGatherDotFile != null) + renderToDot(scatterGatherDotFile) + validate() } - - logger.info("Removing original jobs.") - this.jobGraph.removeAllEdges(scatterGathers) - prune() - - logger.info("Adding scatter gather jobs.") - addedFunctions.foreach(function => if (running) this.add(function)) - - logger.info("Regenerating graph.") - fill - val scatterGatherDotFile = if (settings.expandedDotFile != null) settings.expandedDotFile else settings.dotFile - if (scatterGatherDotFile != null) - renderToDot(scatterGatherDotFile) - validate() } } diff --git a/public/scala/src/org/broadinstitute/sting/queue/engine/lsf/Lsf706JobRunner.scala b/public/scala/src/org/broadinstitute/sting/queue/engine/lsf/Lsf706JobRunner.scala index 57d133dfe..ac2f036b4 100644 --- a/public/scala/src/org/broadinstitute/sting/queue/engine/lsf/Lsf706JobRunner.scala +++ b/public/scala/src/org/broadinstitute/sting/queue/engine/lsf/Lsf706JobRunner.scala @@ -286,11 +286,11 @@ object Lsf706JobRunner extends Logging { // LSB_SHAREDIR/cluster_name/logdir/lsb.acct (man bacct) // LSB_SHAREDIR/cluster_name/logdir/lsb.events (man bhist) logger.debug("Job Id %s status / exitStatus / exitInfo: ??? / ??? / ???".format(runner.jobId)) - val unknownStatusSeconds = (System.currentTimeMillis - runner.lastStatusUpdate) - if (unknownStatusSeconds > (unknownStatusMaxSeconds * 1000L)) { + val unknownStatusMillis = (System.currentTimeMillis - runner.lastStatusUpdate) + if (unknownStatusMillis > (unknownStatusMaxSeconds * 1000L)) { // Unknown status has been returned for a while now. runner.updateStatus(RunnerStatus.FAILED) - logger.error("Unable to read LSF status for %d minutes: job id %d: %s".format(unknownStatusSeconds/60, runner.jobId, runner.function.description)) + logger.error("Unable to read LSF status for %0.2f minutes: job id %d: %s".format(unknownStatusMillis/(60 * 1000D), runner.jobId, runner.function.description)) } } diff --git a/public/scala/src/org/broadinstitute/sting/queue/util/QScriptUtils.scala b/public/scala/src/org/broadinstitute/sting/queue/util/QScriptUtils.scala new file mode 100644 index 000000000..99aaa9474 --- /dev/null +++ b/public/scala/src/org/broadinstitute/sting/queue/util/QScriptUtils.scala @@ -0,0 +1,60 @@ +package org.broadinstitute.sting.queue.util + +import java.io.File +import io.Source._ +import net.sf.samtools.{SAMReadGroupRecord, SAMFileReader} + +import collection.JavaConversions._ + + +/** + * Created by IntelliJ IDEA. + * User: carneiro + * Date: 7/14/11 + * Time: 4:57 PM + * To change this template use File | Settings | File Templates. + */ + +object QScriptUtils { + + /** + * Takes a bam list file and produces a scala list with each file allowing the bam list + * to have empty lines and comment lines (lines starting with #). + */ + def createListFromFile(in: File):List[File] = { + // If the file provided ends with .bam, it is not a bam list, we treat it as a single file. + // and return a list with only this file. + if (in.toString.endsWith(".bam")) + return List(in) + + var list: List[File] = List() + for (bam <- fromFile(in).getLines) + if (!bam.startsWith("#") && !bam.isEmpty ) + list :+= new File(bam.trim()) + list.sortWith(_.compareTo(_) < 0) + } + + /** + * Returns the number of contigs in the BAM file header. + */ + def getNumberOfContigs(bamFile: File): Int = { + val samReader = new SAMFileReader(bamFile) + samReader.getFileHeader.getSequenceDictionary.getSequences.size() + } + + /** + * Check if there are multiple samples in a BAM file + */ + def hasMultipleSamples(readGroups: java.util.List[SAMReadGroupRecord]): Boolean = { + var sample: String = "" + for (r <- readGroups) { + if (sample.isEmpty) + sample = r.getSample + else if (sample != r.getSample) + return true; + } + false + } + + +} \ No newline at end of file diff --git a/settings/repository/org.broad/tribble-3.jar b/settings/repository/org.broad/tribble-16.jar similarity index 67% rename from settings/repository/org.broad/tribble-3.jar rename to settings/repository/org.broad/tribble-16.jar index f0ab44a05..331f28ec3 100644 Binary files a/settings/repository/org.broad/tribble-3.jar and b/settings/repository/org.broad/tribble-16.jar differ diff --git a/settings/repository/org.broad/tribble-3.xml b/settings/repository/org.broad/tribble-16.xml similarity index 57% rename from settings/repository/org.broad/tribble-3.xml rename to settings/repository/org.broad/tribble-16.xml index c35358331..e23eec339 100644 --- a/settings/repository/org.broad/tribble-3.xml +++ b/settings/repository/org.broad/tribble-16.xml @@ -1,4 +1,4 @@ -