Merge branch 'master' of gsa2:/humgen/gsa-scr1/chartl/dev/unstable

This commit is contained in:
Christopher Hartl 2012-10-22 08:21:43 -04:00
commit 5640661368
48 changed files with 1700 additions and 1278 deletions

View File

@ -227,7 +227,7 @@ import com.google.java.contract.Requires;
* @param base base * @param base base
* @return the proportion of this base over all other bases except indels * @return the proportion of this base over all other bases except indels
*/ */
@Requires("index.isNucleotide()") @Requires("base.isNucleotide()")
@Ensures({"result >=0.0", "result<= 1.0"}) @Ensures({"result >=0.0", "result<= 1.0"})
public double baseCountProportionWithoutIndels(final BaseIndex base) { public double baseCountProportionWithoutIndels(final BaseIndex base) {
final int total = totalCountWithoutIndels(); final int total = totalCountWithoutIndels();

View File

@ -72,7 +72,7 @@ public class ErrorModel {
haplotypeMap = new LinkedHashMap<Allele, Haplotype>(); haplotypeMap = new LinkedHashMap<Allele, Haplotype>();
if (refSampleVC.isIndel()) { if (refSampleVC.isIndel()) {
pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY, pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY,
UAC.OUTPUT_DEBUG_INDEL_INFO, !UAC.DONT_DO_BANDED_INDEL_COMPUTATION); UAC.OUTPUT_DEBUG_INDEL_INFO, UAC.pairHMM);
IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles(refSampleVC.getAlleles(), refContext, refContext.getLocus(), haplotypeMap); // will update haplotypeMap adding elements IndelGenotypeLikelihoodsCalculationModel.getHaplotypeMapFromAlleles(refSampleVC.getAlleles(), refContext, refContext.getLocus(), haplotypeMap); // will update haplotypeMap adding elements
} }
} }

View File

@ -245,7 +245,7 @@ public abstract class GeneralPloidyGenotypeLikelihoodsCalculationModel extends G
// find the alternate allele(s) that we should be using // find the alternate allele(s) that we should be using
final List<Allele> alleles = getFinalAllelesToUse(tracker, ref, allAllelesToUse, GLs); final List<Allele> alleles = getFinalAllelesToUse(tracker, ref, allAllelesToUse, GLs);
if (alleles == null || alleles.isEmpty()) if (alleles == null || alleles.isEmpty() || (alleles.size() == 1 && alleles.get(0).isReference()))
return null; return null;
// start making the VariantContext // start making the VariantContext
final GenomeLoc loc = ref.getLocus(); final GenomeLoc loc = ref.getLocus();

View File

@ -62,7 +62,7 @@ public class GeneralPloidyIndelGenotypeLikelihoodsCalculationModel extends Gener
pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY, pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY,
UAC.OUTPUT_DEBUG_INDEL_INFO, !UAC.DONT_DO_BANDED_INDEL_COMPUTATION); UAC.OUTPUT_DEBUG_INDEL_INFO, UAC.pairHMM);
haplotypeMap = new LinkedHashMap<Allele, Haplotype>(); haplotypeMap = new LinkedHashMap<Allele, Haplotype>();
} }

View File

@ -26,7 +26,6 @@
package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc;
import org.broadinstitute.sting.gatk.walkers.genotyper.GeneralPloidyGenotypeLikelihoods; import org.broadinstitute.sting.gatk.walkers.genotyper.GeneralPloidyGenotypeLikelihoods;
import org.broadinstitute.sting.gatk.walkers.genotyper.ProbabilityVector;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants; import org.broadinstitute.sting.utils.codecs.vcf.VCFConstants;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
@ -69,8 +68,8 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
@Override @Override
public AFCalcResult computeLog10PNonRef(final VariantContext vc, final double[] log10AlleleFrequencyPriors) { public AFCalcResult computeLog10PNonRef(final VariantContext vc, final double[] log10AlleleFrequencyPriors) {
combineSinglePools(vc.getGenotypes(), vc.getNAlleles(), ploidy, log10AlleleFrequencyPriors, getResultTracker()); combineSinglePools(vc.getGenotypes(), vc.getNAlleles(), ploidy, log10AlleleFrequencyPriors);
return resultFromTracker(vc, log10AlleleFrequencyPriors); return getResultFromFinalState(vc, log10AlleleFrequencyPriors);
} }
/** /**
@ -171,13 +170,11 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
* @param numAlleles Number of alternate alleles * @param numAlleles Number of alternate alleles
* @param ploidyPerPool Number of samples per pool * @param ploidyPerPool Number of samples per pool
* @param log10AlleleFrequencyPriors Frequency priors * @param log10AlleleFrequencyPriors Frequency priors
* @param resultTracker object to fill with output values
*/ */
protected static void combineSinglePools(final GenotypesContext GLs, protected void combineSinglePools(final GenotypesContext GLs,
final int numAlleles, final int numAlleles,
final int ploidyPerPool, final int ploidyPerPool,
final double[] log10AlleleFrequencyPriors, final double[] log10AlleleFrequencyPriors) {
final AFCalcResultTracker resultTracker) {
final ArrayList<double[]> genotypeLikelihoods = getGLs(GLs, true); final ArrayList<double[]> genotypeLikelihoods = getGLs(GLs, true);
@ -196,24 +193,24 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
if ( genotypeLikelihoods.size() <= 1 ) { if ( genotypeLikelihoods.size() <= 1 ) {
// no meaningful GLs at all, just set the tracker to non poly values // no meaningful GLs at all, just set the tracker to non poly values
resultTracker.reset(); // just mimic-ing call below getStateTracker().reset(); // just mimic-ing call below
resultTracker.setLog10LikelihoodOfAFzero(0.0); getStateTracker().setLog10LikelihoodOfAFzero(0.0);
} else { } else {
for (int p=1; p<genotypeLikelihoods.size(); p++) { for (int p=1; p<genotypeLikelihoods.size(); p++) {
resultTracker.reset(); // TODO -- why is this here? It makes it hard to track the n evaluation getStateTracker().reset(); // TODO -- why is this here? It makes it hard to track the n evaluation
combinedPoolLikelihoods = fastCombineMultiallelicPool(combinedPoolLikelihoods, genotypeLikelihoods.get(p), combinedPloidy, ploidyPerPool, combinedPoolLikelihoods = fastCombineMultiallelicPool(combinedPoolLikelihoods, genotypeLikelihoods.get(p),
numAlleles, log10AlleleFrequencyPriors, resultTracker); combinedPloidy, ploidyPerPool, numAlleles, log10AlleleFrequencyPriors);
combinedPloidy = ploidyPerPool + combinedPloidy; // total number of chromosomes in combinedLikelihoods combinedPloidy = ploidyPerPool + combinedPloidy; // total number of chromosomes in combinedLikelihoods
} }
} }
} }
public static CombinedPoolLikelihoods fastCombineMultiallelicPool(final CombinedPoolLikelihoods originalPool, double[] newGL, int originalPloidy, int newGLPloidy, int numAlleles, public CombinedPoolLikelihoods fastCombineMultiallelicPool(final CombinedPoolLikelihoods originalPool,
final double[] log10AlleleFrequencyPriors, double[] newGL,
final AFCalcResultTracker resultTracker) { int originalPloidy,
int newGLPloidy,
int numAlleles,
final double[] log10AlleleFrequencyPriors) {
final LinkedList<ExactACset> ACqueue = new LinkedList<ExactACset>(); final LinkedList<ExactACset> ACqueue = new LinkedList<ExactACset>();
// mapping of ExactACset indexes to the objects // mapping of ExactACset indexes to the objects
final HashMap<ExactACcounts, ExactACset> indexesToACset = new HashMap<ExactACcounts, ExactACset>(); final HashMap<ExactACcounts, ExactACset> indexesToACset = new HashMap<ExactACcounts, ExactACset>();
@ -230,16 +227,11 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
indexesToACset.put(zeroSet.getACcounts(), zeroSet); indexesToACset.put(zeroSet.getACcounts(), zeroSet);
// keep processing while we have AC conformations that need to be calculated // keep processing while we have AC conformations that need to be calculated
StateTracker stateTracker = new StateTracker();
while ( !ACqueue.isEmpty() ) { while ( !ACqueue.isEmpty() ) {
resultTracker.incNEvaluations(); getStateTracker().incNEvaluations();
// compute log10Likelihoods // compute log10Likelihoods
final ExactACset ACset = ACqueue.remove(); final ExactACset ACset = ACqueue.remove();
final double log10LofKs = calculateACConformationAndUpdateQueue(ACset, newPool, originalPool, newGL, log10AlleleFrequencyPriors, originalPloidy, newGLPloidy, resultTracker, stateTracker, ACqueue, indexesToACset); final double log10LofKs = calculateACConformationAndUpdateQueue(ACset, newPool, originalPool, newGL, log10AlleleFrequencyPriors, originalPloidy, newGLPloidy, ACqueue, indexesToACset);
// adjust max likelihood seen if needed
if ( log10LofKs > stateTracker.getMaxLog10L())
stateTracker.update(log10LofKs, ACset.getACcounts());
// clean up memory // clean up memory
indexesToACset.remove(ACset.getACcounts()); indexesToACset.remove(ACset.getACcounts());
@ -260,39 +252,32 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
* @param log10AlleleFrequencyPriors Prior object * @param log10AlleleFrequencyPriors Prior object
* @param originalPloidy Total ploidy of original combined pool * @param originalPloidy Total ploidy of original combined pool
* @param newGLPloidy Ploidy of GL vector * @param newGLPloidy Ploidy of GL vector
* @param resultTracker AFResult object
* @param stateTracker max likelihood observed so far
* @param ACqueue Queue of conformations to compute * @param ACqueue Queue of conformations to compute
* @param indexesToACset AC indices of objects in queue * @param indexesToACset AC indices of objects in queue
* @return max log likelihood * @return max log likelihood
*/ */
private static double calculateACConformationAndUpdateQueue(final ExactACset set, private double calculateACConformationAndUpdateQueue(final ExactACset set,
final CombinedPoolLikelihoods newPool, final CombinedPoolLikelihoods newPool,
final CombinedPoolLikelihoods originalPool, final CombinedPoolLikelihoods originalPool,
final double[] newGL, final double[] newGL,
final double[] log10AlleleFrequencyPriors, final double[] log10AlleleFrequencyPriors,
final int originalPloidy, final int originalPloidy,
final int newGLPloidy, final int newGLPloidy,
final AFCalcResultTracker resultTracker,
final StateTracker stateTracker,
final LinkedList<ExactACset> ACqueue, final LinkedList<ExactACset> ACqueue,
final HashMap<ExactACcounts, ExactACset> indexesToACset) { final HashMap<ExactACcounts, ExactACset> indexesToACset) {
// compute likeihood in "set" of new set based on original likelihoods // compute likeihood in "set" of new set based on original likelihoods
final int numAlleles = set.getACcounts().getCounts().length; final int numAlleles = set.getACcounts().getCounts().length;
final int newPloidy = set.getACsum(); final int newPloidy = set.getACsum();
final double log10LofK = computeLofK(set, originalPool, newGL, log10AlleleFrequencyPriors, numAlleles, originalPloidy, newGLPloidy, resultTracker); final double log10LofK = computeLofK(set, originalPool, newGL, log10AlleleFrequencyPriors, numAlleles, originalPloidy, newGLPloidy);
// add to new pool // add to new pool
if (!Double.isInfinite(log10LofK)) if (!Double.isInfinite(log10LofK))
newPool.add(set); newPool.add(set);
// TODO -- uncomment this correct line when the implementation of this model is optimized (it's too slow now to handle this fix) // TODO -- change false to true this correct line when the implementation of this model is optimized (it's too slow now to handle this fix)
//if ( log10LofK < stateTracker.maxLog10L - MAX_LOG10_ERROR_TO_STOP_EARLY && stateTracker.isLowerAC(set.ACcounts) ) { if ( getStateTracker().abort(log10LofK, set.getACcounts(), false) ) {
if ( log10LofK < stateTracker.getMaxLog10L() - MAX_LOG10_ERROR_TO_STOP_EARLY ) {
if ( VERBOSE )
System.out.printf(" *** breaking early set=%s log10L=%.2f maxLog10L=%.2f%n", set.getACcounts(), log10LofK, stateTracker.getMaxLog10L());
return log10LofK; return log10LofK;
} }
@ -323,67 +308,67 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
} }
/** // /**
* Naive combiner of two multiallelic pools - number of alt alleles must be the same. // * Naive combiner of two multiallelic pools - number of alt alleles must be the same.
* Math is generalization of biallelic combiner. // * Math is generalization of biallelic combiner.
* // *
* For vector K representing an allele count conformation, // * For vector K representing an allele count conformation,
* Pr(D | AC = K) = Sum_G Pr(D|AC1 = G) Pr (D|AC2=K-G) * F(G,K) // * Pr(D | AC = K) = Sum_G Pr(D|AC1 = G) Pr (D|AC2=K-G) * F(G,K)
* where F(G,K) = choose(m1,[g0 g1 ...])*choose(m2,[...]) / choose(m1+m2,[k1 k2 ...]) // * where F(G,K) = choose(m1,[g0 g1 ...])*choose(m2,[...]) / choose(m1+m2,[k1 k2 ...])
* @param originalPool First log-likelihood pool GL vector // * @param originalPool First log-likelihood pool GL vector
* @param yy Second pool GL vector // * @param yy Second pool GL vector
* @param ploidy1 Ploidy of first pool (# of chromosomes in it) // * @param ploidy1 Ploidy of first pool (# of chromosomes in it)
* @param ploidy2 Ploidy of second pool // * @param ploidy2 Ploidy of second pool
* @param numAlleles Number of alleles // * @param numAlleles Number of alleles
* @param log10AlleleFrequencyPriors Array of biallelic priors // * @param log10AlleleFrequencyPriors Array of biallelic priors
* @param resultTracker Af calculation result object // * @param resultTracker Af calculation result object
*/ // */
public static void combineMultiallelicPoolNaively(CombinedPoolLikelihoods originalPool, double[] yy, int ploidy1, int ploidy2, int numAlleles, // public static void combineMultiallelicPoolNaively(CombinedPoolLikelihoods originalPool, double[] yy, int ploidy1, int ploidy2, int numAlleles,
final double[] log10AlleleFrequencyPriors, // final double[] log10AlleleFrequencyPriors,
final AFCalcResultTracker resultTracker) { // final AFCalcResultTracker resultTracker) {
/* ///*
final int dim1 = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy1); // final int dim1 = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy1);
final int dim2 = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy2); // final int dim2 = GenotypeLikelihoods.numLikelihoods(numAlleles, ploidy2);
//
if (dim1 != originalPool.getLength() || dim2 != yy.length) // if (dim1 != originalPool.getLength() || dim2 != yy.length)
throw new ReviewedStingException("BUG: Inconsistent vector length"); // throw new ReviewedStingException("BUG: Inconsistent vector length");
//
if (ploidy2 == 0) // if (ploidy2 == 0)
return; // return;
//
final int newPloidy = ploidy1 + ploidy2; // final int newPloidy = ploidy1 + ploidy2;
//
// Say L1(K) = Pr(D|AC1=K) * choose(m1,K) // // Say L1(K) = Pr(D|AC1=K) * choose(m1,K)
// and L2(K) = Pr(D|AC2=K) * choose(m2,K) // // and L2(K) = Pr(D|AC2=K) * choose(m2,K)
GeneralPloidyGenotypeLikelihoods.SumIterator firstIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy1); // GeneralPloidyGenotypeLikelihoods.SumIterator firstIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy1);
final double[] x = originalPool.getLikelihoodsAsVector(true); // final double[] x = originalPool.getLikelihoodsAsVector(true);
while(firstIterator.hasNext()) { // while(firstIterator.hasNext()) {
x[firstIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy1,firstIterator.getCurrentVector()); // x[firstIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy1,firstIterator.getCurrentVector());
firstIterator.next(); // firstIterator.next();
} // }
//
GeneralPloidyGenotypeLikelihoods.SumIterator secondIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy2); // GeneralPloidyGenotypeLikelihoods.SumIterator secondIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,ploidy2);
final double[] y = yy.clone(); // final double[] y = yy.clone();
while(secondIterator.hasNext()) { // while(secondIterator.hasNext()) {
y[secondIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy2,secondIterator.getCurrentVector()); // y[secondIterator.getLinearIndex()] += MathUtils.log10MultinomialCoefficient(ploidy2,secondIterator.getCurrentVector());
secondIterator.next(); // secondIterator.next();
} // }
//
// initialize output to -log10(choose(m1+m2,[k1 k2...]) // // initialize output to -log10(choose(m1+m2,[k1 k2...])
final int outputDim = GenotypeLikelihoods.numLikelihoods(numAlleles, newPloidy); // final int outputDim = GenotypeLikelihoods.numLikelihoods(numAlleles, newPloidy);
final GeneralPloidyGenotypeLikelihoods.SumIterator outputIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,newPloidy); // final GeneralPloidyGenotypeLikelihoods.SumIterator outputIterator = new GeneralPloidyGenotypeLikelihoods.SumIterator(numAlleles,newPloidy);
//
//
// Now, result(K) = logSum_G (L1(G)+L2(K-G)) where G are all possible vectors that sum UP to K // // Now, result(K) = logSum_G (L1(G)+L2(K-G)) where G are all possible vectors that sum UP to K
while(outputIterator.hasNext()) { // while(outputIterator.hasNext()) {
final ExactACset set = new ExactACset(1, new ExactACcounts(outputIterator.getCurrentAltVector())); // final ExactACset set = new ExactACset(1, new ExactACcounts(outputIterator.getCurrentAltVector()));
double likelihood = computeLofK(set, x,y, log10AlleleFrequencyPriors, numAlleles, ploidy1, ploidy2, result); // double likelihood = computeLofK(set, x,y, log10AlleleFrequencyPriors, numAlleles, ploidy1, ploidy2, result);
//
originalPool.add(likelihood, set, outputIterator.getLinearIndex()); // originalPool.add(likelihood, set, outputIterator.getLinearIndex());
outputIterator.next(); // outputIterator.next();
} // }
*/ //*/
} // }
/** /**
* Compute likelihood of a particular AC conformation and update AFresult object * Compute likelihood of a particular AC conformation and update AFresult object
@ -394,15 +379,13 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
* @param numAlleles Number of alleles (including ref) * @param numAlleles Number of alleles (including ref)
* @param ploidy1 Ploidy of original pool (combined) * @param ploidy1 Ploidy of original pool (combined)
* @param ploidy2 Ploidy of new pool * @param ploidy2 Ploidy of new pool
* @param resultTracker AFResult object
* @return log-likehood of requested conformation * @return log-likehood of requested conformation
*/ */
private static double computeLofK(final ExactACset set, private double computeLofK(final ExactACset set,
final CombinedPoolLikelihoods firstGLs, final CombinedPoolLikelihoods firstGLs,
final double[] secondGL, final double[] secondGL,
final double[] log10AlleleFrequencyPriors, final double[] log10AlleleFrequencyPriors,
final int numAlleles, final int ploidy1, final int ploidy2, final int numAlleles, final int ploidy1, final int ploidy2) {
final AFCalcResultTracker resultTracker) {
final int newPloidy = ploidy1 + ploidy2; final int newPloidy = ploidy1 + ploidy2;
@ -420,8 +403,8 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
final double log10Lof0 = firstGLs.getGLOfACZero() + secondGL[HOM_REF_INDEX]; final double log10Lof0 = firstGLs.getGLOfACZero() + secondGL[HOM_REF_INDEX];
set.getLog10Likelihoods()[0] = log10Lof0; set.getLog10Likelihoods()[0] = log10Lof0;
resultTracker.setLog10LikelihoodOfAFzero(log10Lof0); getStateTracker().setLog10LikelihoodOfAFzero(log10Lof0);
resultTracker.setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]); getStateTracker().setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]);
return log10Lof0; return log10Lof0;
} else { } else {
@ -464,14 +447,16 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
// update the MLE if necessary // update the MLE if necessary
final int altCounts[] = Arrays.copyOfRange(set.getACcounts().getCounts(),1, set.getACcounts().getCounts().length); final int altCounts[] = Arrays.copyOfRange(set.getACcounts().getCounts(),1, set.getACcounts().getCounts().length);
resultTracker.updateMLEifNeeded(log10LofK, altCounts); // TODO -- GUILLERMO THIS CODE MAY PRODUCE POSITIVE LIKELIHOODS OR -INFINITY
getStateTracker().updateMLEifNeeded(Math.max(log10LofK, -Double.MAX_VALUE), altCounts);
// apply the priors over each alternate allele // apply the priors over each alternate allele
for (final int ACcount : altCounts ) { for (final int ACcount : altCounts ) {
if ( ACcount > 0 ) if ( ACcount > 0 )
log10LofK += log10AlleleFrequencyPriors[ACcount]; log10LofK += log10AlleleFrequencyPriors[ACcount];
} }
resultTracker.updateMAPifNeeded(log10LofK, altCounts); // TODO -- GUILLERMO THIS CODE MAY PRODUCE POSITIVE LIKELIHOODS OR -INFINITY
getStateTracker().updateMAPifNeeded(Math.max(log10LofK, -Double.MAX_VALUE), altCounts);
return log10LofK; return log10LofK;
} }
@ -494,99 +479,6 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
return (sum == ploidy); return (sum == ploidy);
} }
/**
* Combines naively two biallelic pools (of arbitrary size).
* For two pools of size m1 and m2, we can compute the combined likelihood as:
* Pr(D|AC=k) = Sum_{j=0}^k Pr(D|AC1=j) Pr(D|AC2=k-j) * choose(m1,j)*choose(m2,k-j)/choose(m1+m2,k)
* @param originalPool Pool likelihood vector, x[k] = Pr(AC_i = k) for alt allele i
* @param newPLVector Second GL vector
* @param ploidy1 Ploidy of first pool (# of chromosomes in it)
* @param ploidy2 Ploidy of second pool
* @param log10AlleleFrequencyPriors Array of biallelic priors
* @param resultTracker Af calculation result object
* @return Combined likelihood vector
*/
public static ProbabilityVector combineBiallelicPoolsNaively(final ProbabilityVector originalPool, final double[] newPLVector,
final int ploidy1, final int ploidy2, final double[] log10AlleleFrequencyPriors,
final AFCalcResultTracker resultTracker) {
final int newPloidy = ploidy1 + ploidy2;
final double[] combinedLikelihoods = new double[1+newPloidy];
/** Pre-fill result array and incorporate weights into input vectors
* Say L1(k) = Pr(D|AC1=k) * choose(m1,k)
* and L2(k) = Pr(D|AC2=k) * choose(m2,k)
* equation reduces to
* Pr(D|AC=k) = 1/choose(m1+m2,k) * Sum_{j=0}^k L1(k) L2(k-j)
* which is just plain convolution of L1 and L2 (with pre-existing vector)
*/
// intialize result vector to -infinity
Arrays.fill(combinedLikelihoods,Double.NEGATIVE_INFINITY);
final double[] x = Arrays.copyOf(originalPool.getProbabilityVector(),1+ploidy1);
for (int k=originalPool.getProbabilityVector().length; k< x.length; k++)
x[k] = Double.NEGATIVE_INFINITY;
final double[] y = newPLVector.clone();
final double log10Lof0 = x[0]+y[0];
resultTracker.setLog10LikelihoodOfAFzero(log10Lof0);
resultTracker.setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]);
double maxElement = log10Lof0;
int maxElementIdx = 0;
int[] alleleCounts = new int[1];
for (int k= originalPool.getMinVal() ; k <= newPloidy; k++) {
double[] acc = new double[k+1];
Arrays.fill(acc,Double.NEGATIVE_INFINITY);
double innerMax = Double.NEGATIVE_INFINITY;
for (int j=0; j <=k; j++) {
double x1,y1;
if (k-j>=0 && k-j < y.length)
y1 = y[k-j] + MathUtils.log10BinomialCoefficient(ploidy2,k-j);
else
continue;
if (j < x.length)
x1 = x[j] + MathUtils.log10BinomialCoefficient(ploidy1,j);
else
continue;
if (Double.isInfinite(x1) || Double.isInfinite(y1))
continue;
acc[j] = x1 + y1;
if (acc[j] > innerMax)
innerMax = acc[j];
else if (acc[j] < innerMax - MAX_LOG10_ERROR_TO_STOP_EARLY)
break;
}
combinedLikelihoods[k] = MathUtils.log10sumLog10(acc) - MathUtils.log10BinomialCoefficient(newPloidy,k);
maxElementIdx = k;
double maxDiff = combinedLikelihoods[k] - maxElement;
if (maxDiff > 0)
maxElement = combinedLikelihoods[k];
else if (maxDiff < maxElement - MAX_LOG10_ERROR_TO_STOP_EARLY) {
break;
}
alleleCounts[0] = k;
resultTracker.updateMLEifNeeded(combinedLikelihoods[k],alleleCounts);
resultTracker.updateMAPifNeeded(combinedLikelihoods[k] + log10AlleleFrequencyPriors[k],alleleCounts);
}
return new ProbabilityVector(MathUtils.normalizeFromLog10(Arrays.copyOf(combinedLikelihoods,maxElementIdx+1),false, true));
}
/** /**
* From a given variant context, extract a given subset of alleles, and update genotype context accordingly, * From a given variant context, extract a given subset of alleles, and update genotype context accordingly,
* including updating the PL's, and assign genotypes accordingly * including updating the PL's, and assign genotypes accordingly
@ -675,7 +567,7 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc {
* *
* @return genotype * @return genotype
*/ */
private static void assignGenotype(final GenotypeBuilder gb, private void assignGenotype(final GenotypeBuilder gb,
final double[] newLikelihoods, final double[] newLikelihoods,
final List<Allele> allelesToUse, final List<Allele> allelesToUse,
final int numChromosomes) { final int numChromosomes) {

View File

@ -52,6 +52,7 @@ import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile;
import org.broadinstitute.sting.utils.fragments.FragmentCollection; import org.broadinstitute.sting.utils.fragments.FragmentCollection;
import org.broadinstitute.sting.utils.fragments.FragmentUtils; import org.broadinstitute.sting.utils.fragments.FragmentUtils;
import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature;
import org.broadinstitute.sting.utils.pairhmm.PairHMM;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.sam.AlignmentUtils; import org.broadinstitute.sting.utils.sam.AlignmentUtils;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
@ -114,6 +115,12 @@ public class HaplotypeCaller extends ActiveRegionWalker<Integer, Integer> implem
@Output(fullName="graphOutput", shortName="graph", doc="File to which debug assembly graph information should be written", required = false) @Output(fullName="graphOutput", shortName="graph", doc="File to which debug assembly graph information should be written", required = false)
protected PrintStream graphWriter = null; protected PrintStream graphWriter = null;
/**
* The PairHMM implementation to use for genotype likelihood calculations. The various implementations balance a tradeoff of accuracy and runtime.
*/
@Argument(fullName = "pair_hmm_implementation", shortName = "pairHMM", doc = "The PairHMM implementation to use for genotype likelihood calculations", required = false)
public PairHMM.HMM_IMPLEMENTATION pairHMM = PairHMM.HMM_IMPLEMENTATION.LOGLESS_CACHING;
@Hidden @Hidden
@Argument(fullName="keepRG", shortName="keepRG", doc="Only use read from this read group when making calls (but use all reads to build the assembly)", required = false) @Argument(fullName="keepRG", shortName="keepRG", doc="Only use read from this read group when making calls (but use all reads to build the assembly)", required = false)
protected String keepRG = null; protected String keepRG = null;
@ -234,14 +241,14 @@ public class HaplotypeCaller extends ActiveRegionWalker<Integer, Integer> implem
samplesList.addAll( samples ); samplesList.addAll( samples );
// initialize the UnifiedGenotyper Engine which is used to call into the exact model // initialize the UnifiedGenotyper Engine which is used to call into the exact model
final UnifiedArgumentCollection UAC = new UnifiedArgumentCollection( SCAC ); // this adapter is used so that the full set of unused UG arguments aren't exposed to the HC user final UnifiedArgumentCollection UAC = new UnifiedArgumentCollection( SCAC ); // this adapter is used so that the full set of unused UG arguments aren't exposed to the HC user
UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC.clone(), logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY); UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY);
UAC.OutputMode = UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY; // low values used for isActive determination only, default/user-specified values used for actual calling
UAC.GenotypingMode = GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.DISCOVERY; // low values used for isActive determination only, default/user-specified values used for actual calling
UAC.STANDARD_CONFIDENCE_FOR_CALLING = Math.max( 4.0, UAC.STANDARD_CONFIDENCE_FOR_CALLING );
UAC.STANDARD_CONFIDENCE_FOR_EMITTING = Math.max( 4.0, UAC.STANDARD_CONFIDENCE_FOR_EMITTING );
// create a UAC but with the exactCallsLog = null, so we only output the log for the HC caller itself, if requested // create a UAC but with the exactCallsLog = null, so we only output the log for the HC caller itself, if requested
UnifiedArgumentCollection simpleUAC = UAC.clone(); UnifiedArgumentCollection simpleUAC = new UnifiedArgumentCollection(UAC);
simpleUAC.OutputMode = UnifiedGenotyperEngine.OUTPUT_MODE.EMIT_VARIANTS_ONLY; // low values used for isActive determination only, default/user-specified values used for actual calling
simpleUAC.GenotypingMode = GenotypeLikelihoodsCalculationModel.GENOTYPING_MODE.DISCOVERY; // low values used for isActive determination only, default/user-specified values used for actual calling
simpleUAC.STANDARD_CONFIDENCE_FOR_CALLING = Math.max( 4.0, UAC.STANDARD_CONFIDENCE_FOR_CALLING );
simpleUAC.STANDARD_CONFIDENCE_FOR_EMITTING = Math.max( 4.0, UAC.STANDARD_CONFIDENCE_FOR_EMITTING );
simpleUAC.exactCallsLog = null; simpleUAC.exactCallsLog = null;
UG_engine_simple_genotyper = new UnifiedGenotyperEngine(getToolkit(), simpleUAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY); UG_engine_simple_genotyper = new UnifiedGenotyperEngine(getToolkit(), simpleUAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY);
@ -287,7 +294,7 @@ public class HaplotypeCaller extends ActiveRegionWalker<Integer, Integer> implem
} }
assemblyEngine = new SimpleDeBruijnAssembler( DEBUG, graphWriter ); assemblyEngine = new SimpleDeBruijnAssembler( DEBUG, graphWriter );
likelihoodCalculationEngine = new LikelihoodCalculationEngine( (byte)gcpHMM, DEBUG, false ); likelihoodCalculationEngine = new LikelihoodCalculationEngine( (byte)gcpHMM, DEBUG, pairHMM );
genotypingEngine = new GenotypingEngine( DEBUG, OUTPUT_FULL_HAPLOTYPE_SEQUENCE ); genotypingEngine = new GenotypingEngine( DEBUG, OUTPUT_FULL_HAPLOTYPE_SEQUENCE );
} }
@ -400,6 +407,9 @@ public class HaplotypeCaller extends ActiveRegionWalker<Integer, Integer> implem
final List<GATKSAMRecord> filteredReads = filterNonPassingReads( activeRegion ); // filter out reads from genotyping which fail mapping quality based criteria final List<GATKSAMRecord> filteredReads = filterNonPassingReads( activeRegion ); // filter out reads from genotyping which fail mapping quality based criteria
if( activeRegion.size() == 0 ) { return 1; } // no reads remain after filtering so nothing else to do! if( activeRegion.size() == 0 ) { return 1; } // no reads remain after filtering so nothing else to do!
// sort haplotypes to take full advantage of haplotype start offset optimizations in PairHMM
Collections.sort( haplotypes, new Haplotype.HaplotypeBaseComparator() );
// evaluate each sample's reads against all haplotypes // evaluate each sample's reads against all haplotypes
final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList = splitReadsBySample( activeRegion.getReads() ); final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList = splitReadsBySample( activeRegion.getReads() );
final HashMap<String, ArrayList<GATKSAMRecord>> perSampleFilteredReadList = splitReadsBySample( filteredReads ); final HashMap<String, ArrayList<GATKSAMRecord>> perSampleFilteredReadList = splitReadsBySample( filteredReads );

View File

@ -30,6 +30,9 @@ import com.google.java.contract.Requires;
import org.broadinstitute.sting.gatk.walkers.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.sting.gatk.walkers.genotyper.PerReadAlleleLikelihoodMap;
import org.broadinstitute.sting.utils.*; import org.broadinstitute.sting.utils.*;
import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.pairhmm.*;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils; import org.broadinstitute.sting.utils.sam.ReadUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
@ -44,8 +47,25 @@ public class LikelihoodCalculationEngine {
private final boolean DEBUG; private final boolean DEBUG;
private final PairHMM pairHMM; private final PairHMM pairHMM;
public LikelihoodCalculationEngine( final byte constantGCP, final boolean debug, final boolean noBanded ) { public LikelihoodCalculationEngine( final byte constantGCP, final boolean debug, final PairHMM.HMM_IMPLEMENTATION hmmType ) {
pairHMM = new PairHMM( noBanded );
switch (hmmType) {
case EXACT:
pairHMM = new ExactPairHMM();
break;
case ORIGINAL:
pairHMM = new OriginalPairHMM();
break;
case CACHING:
pairHMM = new CachingPairHMM();
break;
case LOGLESS_CACHING:
pairHMM = new LoglessCachingPairHMM();
break;
default:
throw new UserException.BadArgumentValue("pairHMM", "Specified pairHMM implementation is unrecognized or incompatible with the HaplotypeCaller. Acceptable options are ORIGINAL, EXACT, CACHING, and LOGLESS_CACHING.");
}
this.constantGCP = constantGCP; this.constantGCP = constantGCP;
DEBUG = debug; DEBUG = debug;
} }
@ -69,23 +89,18 @@ public class LikelihoodCalculationEngine {
X_METRIC_LENGTH += 2; X_METRIC_LENGTH += 2;
Y_METRIC_LENGTH += 2; Y_METRIC_LENGTH += 2;
// initial arrays to hold the probabilities of being in the match, insertion and deletion cases // initialize arrays to hold the probabilities of being in the match, insertion and deletion cases
final double[][] matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; pairHMM.initialize(X_METRIC_LENGTH, Y_METRIC_LENGTH);
final double[][] XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
final double[][] YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
PairHMM.initializeArrays(matchMetricArray, XMetricArray, YMetricArray, X_METRIC_LENGTH);
// for each sample's reads // for each sample's reads
for( final Map.Entry<String, ArrayList<GATKSAMRecord>> sampleEntry : perSampleReadList.entrySet() ) { for( final Map.Entry<String, ArrayList<GATKSAMRecord>> sampleEntry : perSampleReadList.entrySet() ) {
//if( DEBUG ) { System.out.println("Evaluating sample " + sample + " with " + perSampleReadList.get( sample ).size() + " passing reads"); } //if( DEBUG ) { System.out.println("Evaluating sample " + sample + " with " + perSampleReadList.get( sample ).size() + " passing reads"); }
// evaluate the likelihood of the reads given those haplotypes // evaluate the likelihood of the reads given those haplotypes
computeReadLikelihoods( haplotypes, sampleEntry.getValue(), sampleEntry.getKey(), matchMetricArray, XMetricArray, YMetricArray ); computeReadLikelihoods( haplotypes, sampleEntry.getValue(), sampleEntry.getKey() );
} }
} }
private void computeReadLikelihoods( final ArrayList<Haplotype> haplotypes, final ArrayList<GATKSAMRecord> reads, final String sample, private void computeReadLikelihoods( final ArrayList<Haplotype> haplotypes, final ArrayList<GATKSAMRecord> reads, final String sample ) {
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
final int numHaplotypes = haplotypes.size(); final int numHaplotypes = haplotypes.size();
final int numReads = reads.size(); final int numReads = reads.size();
@ -113,9 +128,8 @@ public class LikelihoodCalculationEngine {
final int haplotypeStart = ( previousHaplotypeSeen == null ? 0 : computeFirstDifferingPosition(haplotype.getBases(), previousHaplotypeSeen.getBases()) ); final int haplotypeStart = ( previousHaplotypeSeen == null ? 0 : computeFirstDifferingPosition(haplotype.getBases(), previousHaplotypeSeen.getBases()) );
previousHaplotypeSeen = haplotype; previousHaplotypeSeen = haplotype;
readLikelihoods[jjj][iii] = pairHMM.computeReadLikelihoodGivenHaplotype(haplotype.getBases(), read.getReadBases(), readLikelihoods[jjj][iii] = pairHMM.computeReadLikelihoodGivenHaplotypeLog10(haplotype.getBases(), read.getReadBases(),
readQuals, readInsQuals, readDelQuals, overallGCP, readQuals, readInsQuals, readDelQuals, overallGCP, haplotypeStart, jjj == 0);
haplotypeStart, matchMetricArray, XMetricArray, YMetricArray);
readCounts[jjj][iii] = readCount; readCounts[jjj][iii] = readCount;
} }
} }
@ -130,7 +144,7 @@ public class LikelihoodCalculationEngine {
return iii; return iii;
} }
} }
return b1.length; return Math.min(b1.length, b2.length);
} }
@Requires({"haplotypes.size() > 0"}) @Requires({"haplotypes.size() > 0"})
@ -280,7 +294,7 @@ public class LikelihoodCalculationEngine {
final int numHaplotypes = haplotypes.size(); final int numHaplotypes = haplotypes.size();
final Set<String> sampleKeySet = haplotypes.get(0).getSampleKeySet(); // BUGBUG: assume all haplotypes saw the same samples final Set<String> sampleKeySet = haplotypes.get(0).getSampleKeySet(); // BUGBUG: assume all haplotypes saw the same samples
final ArrayList<Integer> bestHaplotypesIndexList = new ArrayList<Integer>(); final ArrayList<Integer> bestHaplotypesIndexList = new ArrayList<Integer>();
bestHaplotypesIndexList.add(0); // always start with the reference haplotype bestHaplotypesIndexList.add( findReferenceIndex(haplotypes) ); // always start with the reference haplotype
// set up the default 1-to-1 haplotype mapping object // set up the default 1-to-1 haplotype mapping object
final ArrayList<ArrayList<Haplotype>> haplotypeMapping = new ArrayList<ArrayList<Haplotype>>(); final ArrayList<ArrayList<Haplotype>> haplotypeMapping = new ArrayList<ArrayList<Haplotype>>();
for( final Haplotype h : haplotypes ) { for( final Haplotype h : haplotypes ) {
@ -322,6 +336,13 @@ public class LikelihoodCalculationEngine {
return bestHaplotypes; return bestHaplotypes;
} }
public static int findReferenceIndex( final List<Haplotype> haplotypes ) {
for( final Haplotype h : haplotypes ) {
if( h.isReference() ) { return haplotypes.indexOf(h); }
}
throw new ReviewedStingException( "No reference haplotype found in the list of haplotypes!" );
}
public static Map<String, PerReadAlleleLikelihoodMap> partitionReadsBasedOnLikelihoods( final GenomeLocParser parser, public static Map<String, PerReadAlleleLikelihoodMap> partitionReadsBasedOnLikelihoods( final GenomeLocParser parser,
final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList, final HashMap<String, ArrayList<GATKSAMRecord>> perSampleReadList,
final HashMap<String, ArrayList<GATKSAMRecord>> perSampleFilteredReadList, final HashMap<String, ArrayList<GATKSAMRecord>> perSampleFilteredReadList,

View File

@ -0,0 +1,181 @@
/*
* Copyright (c) 2012, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.utils.pairhmm;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.QualityUtils;
import java.util.Arrays;
/**
* Created with IntelliJ IDEA.
* User: rpoplin, carneiro
* Date: 10/16/12
*/
public class CachingPairHMM extends OriginalPairHMM {
double[][] constantMatrix = null; // The cache in the CachingPairHMM
double[][] distanceMatrix = null; // The cache in the CachingPairHMM
protected static final double [] firstRowConstantMatrix = {
QualityUtils.qualToProbLog10((byte) (DEFAULT_GOP + DEFAULT_GOP)),
QualityUtils.qualToProbLog10(DEFAULT_GCP),
QualityUtils.qualToErrorProbLog10(DEFAULT_GOP),
QualityUtils.qualToErrorProbLog10(DEFAULT_GCP),
0.0,
0.0
};
@Override
public void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH ) {
super.initialize(READ_MAX_LENGTH, HAPLOTYPE_MAX_LENGTH);
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = READ_MAX_LENGTH + 2;
final int Y_METRIC_LENGTH = HAPLOTYPE_MAX_LENGTH + 2;
constantMatrix = new double[X_METRIC_LENGTH][6];
distanceMatrix = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
// fill in the first row
for( int jjj = 2; jjj < Y_METRIC_LENGTH; jjj++ ) {
updateCell(1, jjj, 0.0, firstRowConstantMatrix, matchMetricArray, XMetricArray, YMetricArray);
}
}
@Override
public double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
if( recacheReadValues ) {
initializeConstants( insertionGOP, deletionGOP, overallGCP );
}
initializeDistanceMatrix( haplotypeBases, readBases, readQuals, hapStartIndex );
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
final int Y_METRIC_LENGTH = haplotypeBases.length + 2;
for (int i = 2; i < X_METRIC_LENGTH; i++) {
for (int j = hapStartIndex+1; j < Y_METRIC_LENGTH; j++) {
updateCell(i, j, distanceMatrix[i][j], constantMatrix[i], matchMetricArray, XMetricArray, YMetricArray);
}
}
// final probability is the log10 sum of the last element in all three state arrays
final int endI = X_METRIC_LENGTH - 1;
final int endJ = Y_METRIC_LENGTH - 1;
return MathUtils.approximateLog10SumLog10(matchMetricArray[endI][endJ], XMetricArray[endI][endJ], YMetricArray[endI][endJ]);
}
/**
* Initializes the matrix that holds all the constants related to the editing
* distance between the read and the haplotype.
*
* @param haplotypeBases the bases of the haplotype
* @param readBases the bases of the read
* @param readQuals the base quality scores of the read
* @param startIndex where to start updating the distanceMatrix (in case this read is similar to the previous read)
*/
public void initializeDistanceMatrix( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final int startIndex ) {
// initialize the pBaseReadLog10 matrix for all combinations of read x haplotype bases
// Abusing the fact that java initializes arrays with 0.0, so no need to fill in rows and columns below 2.
for (int i = 0; i < readBases.length; i++) {
final byte x = readBases[i];
final byte qual = readQuals[i];
for (int j = startIndex; j < haplotypeBases.length; j++) {
final byte y = haplotypeBases[j];
distanceMatrix[i+2][j+2] = ( x == y || x == (byte) 'N' || y == (byte) 'N' ?
QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) );
}
}
}
/**
* Initializes the matrix that holds all the constants related to quality scores.
*
* @param insertionGOP insertion quality scores of the read
* @param deletionGOP deletion quality scores of the read
* @param overallGCP overall gap continuation penalty
*/
public void initializeConstants( final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP ) {
final int l = insertionGOP.length;
constantMatrix[1] = firstRowConstantMatrix;
for (int i = 0; i < l; i++) {
final int qualIndexGOP = Math.min(insertionGOP[i] + deletionGOP[i], Byte.MAX_VALUE);
constantMatrix[i+2][0] = QualityUtils.qualToProbLog10((byte) qualIndexGOP);
constantMatrix[i+2][1] = QualityUtils.qualToProbLog10(overallGCP[i]);
constantMatrix[i+2][2] = QualityUtils.qualToErrorProbLog10(insertionGOP[i]);
constantMatrix[i+2][3] = QualityUtils.qualToErrorProbLog10(overallGCP[i]);
constantMatrix[i+2][4] = QualityUtils.qualToErrorProbLog10(deletionGOP[i]);
constantMatrix[i+2][5] = QualityUtils.qualToErrorProbLog10(overallGCP[i]);
}
constantMatrix[l+1][4] = 0.0;
constantMatrix[l+1][5] = 0.0;
}
/**
* Updates a cell in the HMM matrix
*
* The read and haplotype indices are offset by one because the state arrays have an extra column to hold the
* initial conditions
* @param indI row index in the matrices to update
* @param indJ column index in the matrices to update
* @param prior the likelihood editing distance matrix for the read x haplotype
* @param constants an array with the six constants relevant to this location
* @param matchMetricArray the matches likelihood matrix
* @param XMetricArray the insertions likelihood matrix
* @param YMetricArray the deletions likelihood matrix
*/
private void updateCell( final int indI, final int indJ, final double prior, final double[] constants,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
matchMetricArray[indI][indJ] = prior +
MathUtils.approximateLog10SumLog10( matchMetricArray[indI - 1][indJ - 1] + constants[0],
XMetricArray[indI - 1][indJ - 1] + constants[1],
YMetricArray[indI - 1][indJ - 1] + constants[1] );
XMetricArray[indI][indJ] = MathUtils.approximateLog10SumLog10( matchMetricArray[indI - 1][indJ] + constants[2],
XMetricArray[indI - 1][indJ] + constants[3]);
YMetricArray[indI][indJ] = MathUtils.approximateLog10SumLog10( matchMetricArray[indI][indJ - 1] + constants[4],
YMetricArray[indI][indJ - 1] + constants[5]);
}
}

View File

@ -0,0 +1,187 @@
/*
* Copyright (c) 2012, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.utils.pairhmm;
import org.broadinstitute.sting.utils.QualityUtils;
import java.util.Arrays;
/**
* Created with IntelliJ IDEA.
* User: rpoplin, carneiro
* Date: 10/16/12
*/
public class LoglessCachingPairHMM extends CachingPairHMM {
protected static final double SCALE_FACTOR_LOG10 = 300.0;
protected static final double [] firstRowConstantMatrix = {
QualityUtils.qualToProb((byte) (DEFAULT_GOP + DEFAULT_GOP)),
QualityUtils.qualToProb(DEFAULT_GCP),
QualityUtils.qualToErrorProb(DEFAULT_GOP),
QualityUtils.qualToErrorProb(DEFAULT_GCP),
1.0,
1.0
};
@Override
public void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = READ_MAX_LENGTH + 2;
final int Y_METRIC_LENGTH = HAPLOTYPE_MAX_LENGTH + 2;
matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
for( int iii=0; iii < X_METRIC_LENGTH; iii++ ) {
Arrays.fill(matchMetricArray[iii], 0.0);
Arrays.fill(XMetricArray[iii], 0.0);
Arrays.fill(YMetricArray[iii], 0.0);
}
// the initial condition
matchMetricArray[1][1] = Math.pow(10.0, SCALE_FACTOR_LOG10); // Math.log10(1.0);
constantMatrix = new double[X_METRIC_LENGTH][6];
distanceMatrix = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
// fill in the first row
for( int jjj = 2; jjj < Y_METRIC_LENGTH; jjj++ ) {
updateCell(1, jjj, 1.0, firstRowConstantMatrix, matchMetricArray, XMetricArray, YMetricArray);
}
}
@Override
public double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
if( recacheReadValues ) {
initializeConstants( insertionGOP, deletionGOP, overallGCP );
}
initializeDistanceMatrix( haplotypeBases, readBases, readQuals, hapStartIndex );
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
final int Y_METRIC_LENGTH = haplotypeBases.length + 2;
for (int i = 2; i < X_METRIC_LENGTH; i++) {
for (int j = hapStartIndex+1; j < Y_METRIC_LENGTH; j++) {
updateCell(i, j, distanceMatrix[i][j], constantMatrix[i], matchMetricArray, XMetricArray, YMetricArray);
}
}
// final probability is the log10 sum of the last element in all three state arrays
final int endI = X_METRIC_LENGTH - 1;
final int endJ = Y_METRIC_LENGTH - 1;
return Math.log10( matchMetricArray[endI][endJ] + XMetricArray[endI][endJ] + YMetricArray[endI][endJ] ) - SCALE_FACTOR_LOG10;
}
/**
* Initializes the matrix that holds all the constants related to the editing
* distance between the read and the haplotype.
*
* @param haplotypeBases the bases of the haplotype
* @param readBases the bases of the read
* @param readQuals the base quality scores of the read
* @param startIndex where to start updating the distanceMatrix (in case this read is similar to the previous read)
*/
public void initializeDistanceMatrix( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final int startIndex ) {
// initialize the pBaseReadLog10 matrix for all combinations of read x haplotype bases
// Abusing the fact that java initializes arrays with 0.0, so no need to fill in rows and columns below 2.
for (int i = 0; i < readBases.length; i++) {
final byte x = readBases[i];
final byte qual = readQuals[i];
for (int j = startIndex; j < haplotypeBases.length; j++) {
final byte y = haplotypeBases[j];
distanceMatrix[i+2][j+2] = ( x == y || x == (byte) 'N' || y == (byte) 'N' ?
QualityUtils.qualToProb(qual) : QualityUtils.qualToErrorProb(qual) );
}
}
}
/**
* Initializes the matrix that holds all the constants related to quality scores.
*
* @param insertionGOP insertion quality scores of the read
* @param deletionGOP deletion quality scores of the read
* @param overallGCP overall gap continuation penalty
*/
public void initializeConstants( final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP ) {
final int l = insertionGOP.length;
constantMatrix[1] = firstRowConstantMatrix;
for (int i = 0; i < l; i++) {
final int qualIndexGOP = Math.min(insertionGOP[i] + deletionGOP[i], Byte.MAX_VALUE);
constantMatrix[i+2][0] = QualityUtils.qualToProb((byte) qualIndexGOP);
constantMatrix[i+2][1] = QualityUtils.qualToProb(overallGCP[i]);
constantMatrix[i+2][2] = QualityUtils.qualToErrorProb(insertionGOP[i]);
constantMatrix[i+2][3] = QualityUtils.qualToErrorProb(overallGCP[i]);
constantMatrix[i+2][4] = QualityUtils.qualToErrorProb(deletionGOP[i]);
constantMatrix[i+2][5] = QualityUtils.qualToErrorProb(overallGCP[i]);
}
constantMatrix[l+1][4] = 1.0;
constantMatrix[l+1][5] = 1.0;
}
/**
* Updates a cell in the HMM matrix
*
* The read and haplotype indices are offset by one because the state arrays have an extra column to hold the
* initial conditions
* @param indI row index in the matrices to update
* @param indJ column index in the matrices to update
* @param prior the likelihood editing distance matrix for the read x haplotype
* @param constants an array with the six constants relevant to this location
* @param matchMetricArray the matches likelihood matrix
* @param XMetricArray the insertions likelihood matrix
* @param YMetricArray the deletions likelihood matrix
*/
private void updateCell( final int indI, final int indJ, final double prior, final double[] constants,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
matchMetricArray[indI][indJ] = prior * ( matchMetricArray[indI - 1][indJ - 1] * constants[0] +
XMetricArray[indI - 1][indJ - 1] * constants[1] +
YMetricArray[indI - 1][indJ - 1] * constants[1] );
XMetricArray[indI][indJ] = matchMetricArray[indI - 1][indJ] * constants[2] + XMetricArray[indI - 1][indJ] * constants[3];
YMetricArray[indI][indJ] = matchMetricArray[indI][indJ - 1] * constants[4] + YMetricArray[indI][indJ - 1] * constants[5];
}
}

View File

@ -60,27 +60,27 @@ public class UnifiedGenotyperGeneralPloidyIntegrationTest extends WalkerTest {
@Test(enabled = true) @Test(enabled = true)
public void testBOTH_GGA_Pools() { public void testBOTH_GGA_Pools() {
PC_LSV_Test(String.format(" -maxAltAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_BOTH_GGA","BOTH","67dabdbf1e6ed8a83d2e85766558a20a"); PC_LSV_Test(String.format(" -maxAltAlleles 2 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_BOTH_GGA","BOTH","9ce24f4ff787aed9d3754519a60ef49f");
} }
@Test(enabled = true) @Test(enabled = true)
public void testINDEL_GGA_Pools() { public void testINDEL_GGA_Pools() {
PC_LSV_Test(String.format(" -maxAltAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_INDEL_GGA","INDEL","d4bfae27f1b07923f381d708d8a34cf4"); PC_LSV_Test(String.format(" -maxAltAlleles 1 -ploidy 24 -gt_mode GENOTYPE_GIVEN_ALLELES -out_mode EMIT_ALL_SITES -alleles %s",LSV_ALLELES),"LSV_INDEL_GGA","INDEL","492c8ba9a80a902097ff15bbeb031592");
} }
@Test(enabled = true) @Test(enabled = true)
public void testINDEL_maxAltAlleles2_ploidy3_Pools_noRef() { public void testINDEL_maxAltAlleles2_ploidy3_Pools_noRef() {
PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","INDEL","9acfe0019efdc91217ee070acb071228"); PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 3","LSV_INDEL_DISC_NOREF_p3","INDEL","848e1092b5cd57b0da5f1187e67134e7");
} }
@Test(enabled = true) @Test(enabled = true)
public void testINDEL_maxAltAlleles2_ploidy1_Pools_noRef() { public void testINDEL_maxAltAlleles2_ploidy1_Pools_noRef() {
PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 1","LSV_INDEL_DISC_NOREF_p1","INDEL","c1d4dd793f61710a1b1fc5d82803210f"); PC_LSV_Test_NoRef(" -maxAltAlleles 2 -ploidy 1","LSV_INDEL_DISC_NOREF_p1","INDEL","51a7b51d82a341adec0e6510f5dfadd8");
} }
@Test(enabled = true) @Test(enabled = true)
public void testMT_SNP_DISCOVERY_sp4() { public void testMT_SNP_DISCOVERY_sp4() {
PC_MT_Test(CEUTRIO_BAM, " -maxAltAlleles 1 -ploidy 8", "MT_SNP_DISCOVERY_sp4","da84bf45f7080a46a7a78542b3a0629d"); PC_MT_Test(CEUTRIO_BAM, " -maxAltAlleles 1 -ploidy 8", "MT_SNP_DISCOVERY_sp4","0a8c3b06243040b743dd90d497bb3f83");
} }
@Test(enabled = true) @Test(enabled = true)

View File

@ -56,6 +56,11 @@ public class AFCalcResultUnitTest extends BaseTest {
tests.add(new Object[]{new MyTest(new double[]{-1e-9, badL}, new double[]{0.0, badL})}); tests.add(new Object[]{new MyTest(new double[]{-1e-9, badL}, new double[]{0.0, badL})});
} }
// test that a non-ref site gets reasonable posteriors with an ~0.0 value doesn't get lost
for ( final double nonRefL : Arrays.asList(-100.0, -50.0, -10.0, -9.0, -8.0, -7.0, -6.0, -5.0)) {
tests.add(new Object[]{new MyTest(new double[]{0.0, nonRefL}, new double[]{0.0, nonRefL})});
}
return tests.toArray(new Object[][]{}); return tests.toArray(new Object[][]{});
} }

View File

@ -1,5 +1,6 @@
package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc;
import org.apache.commons.lang.ArrayUtils;
import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine; import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
@ -124,12 +125,7 @@ public class AFCalcUnitTest extends BaseTest {
final List<Genotype> triAllelicSamples = Arrays.asList(AA2, AB2, BB2, AC2, BC2, CC2); final List<Genotype> triAllelicSamples = Arrays.asList(AA2, AB2, BB2, AC2, BC2, CC2);
for ( final int nSamples : Arrays.asList(1, 2, 3, 4) ) { for ( final int nSamples : Arrays.asList(1, 2, 3, 4) ) {
List<AFCalc> calcs = AFCalcFactory.createAFCalcs( List<AFCalc> calcs = AFCalcFactory.createAFCalcs( Arrays.asList( AFCalcFactory.Calculation.values() ), 4, 2, 2, 2);
Arrays.asList(
AFCalcFactory.Calculation.EXACT_REFERENCE,
AFCalcFactory.Calculation.EXACT_INDEPENDENT,
AFCalcFactory.Calculation.EXACT_GENERAL_PLOIDY
), 4, 2, 2, 2);
final int nPriorValues = 2*nSamples+1; final int nPriorValues = 2*nSamples+1;
final double[] flatPriors = MathUtils.normalizeFromLog10(new double[nPriorValues], true); // flat priors final double[] flatPriors = MathUtils.normalizeFromLog10(new double[nPriorValues], true); // flat priors
@ -146,7 +142,7 @@ public class AFCalcUnitTest extends BaseTest {
new GetGLsTest(model, 1, genotypes, priors, priorName); new GetGLsTest(model, 1, genotypes, priors, priorName);
// tri-allelic // tri-allelic
if ( INCLUDE_TRIALLELIC && ( ! priorName.equals("human") || Guillermo_FIXME ) ) // || model != generalCalc ) ) if ( INCLUDE_TRIALLELIC && ( ! priorName.equals("human") || Guillermo_FIXME ) && ! ( model instanceof OriginalDiploidExactAFCalc) ) // || model != generalCalc ) )
for ( List<Genotype> genotypes : Utils.makePermutations(triAllelicSamples, nSamples, true) ) for ( List<Genotype> genotypes : Utils.makePermutations(triAllelicSamples, nSamples, true) )
new GetGLsTest(model, 2, genotypes, priors, priorName); new GetGLsTest(model, 2, genotypes, priors, priorName);
} }
@ -156,22 +152,28 @@ public class AFCalcUnitTest extends BaseTest {
return GetGLsTest.getTests(GetGLsTest.class); return GetGLsTest.getTests(GetGLsTest.class);
} }
@DataProvider(name = "badGLs") // @DataProvider(name = "badGLs")
public Object[][] createBadGLs() { // public Object[][] createBadGLs() {
final List<Genotype> genotypes = Arrays.asList(AB2, BB2, CC2, CC2); // final List<Genotype> genotypes = Arrays.asList(AB2, BB2, CC2, CC2);
final int nSamples = genotypes.size(); // final int nSamples = genotypes.size();
//
// final AFCalc indCalc = AFCalcFactory.createAFCalc(AFCalcFactory.Calculation.EXACT_INDEPENDENT, nSamples, 4);
//
// final int nPriorValues = 2*nSamples+1;
// final double[] priors = MathUtils.normalizeFromLog10(new double[nPriorValues], true); // flat priors
// for ( AFCalc model : Arrays.asList(indCalc) ) {
// final String priorName = "flat";
// new GetGLsTest(model, 2, genotypes, priors, priorName);
// }
//
// return GetGLsTest.getTests(GetGLsTest.class);
// }
final AFCalc indCalc = AFCalcFactory.createAFCalc(AFCalcFactory.Calculation.EXACT_INDEPENDENT, nSamples, 4); //
// @Test(enabled = true && !DEBUG_ONLY, dataProvider = "badGLs")
final int nPriorValues = 2*nSamples+1; // public void testBadGLs(GetGLsTest cfg) {
final double[] priors = MathUtils.normalizeFromLog10(new double[nPriorValues], true); // flat priors // testResultSimple(cfg);
for ( AFCalc model : Arrays.asList(indCalc) ) { // }
final String priorName = "flat";
new GetGLsTest(model, 2, genotypes, priors, priorName);
}
return GetGLsTest.getTests(GetGLsTest.class);
}
@Test(enabled = true && ! DEBUG_ONLY, dataProvider = "wellFormedGLs") @Test(enabled = true && ! DEBUG_ONLY, dataProvider = "wellFormedGLs")
public void testBiallelicGLs(GetGLsTest cfg) { public void testBiallelicGLs(GetGLsTest cfg) {
@ -185,11 +187,6 @@ public class AFCalcUnitTest extends BaseTest {
testResultSimple(cfg); testResultSimple(cfg);
} }
@Test(enabled = true, dataProvider = "badGLs")
public void testBadGLs(GetGLsTest cfg) {
testResultSimple(cfg);
}
private static class NonInformativeData { private static class NonInformativeData {
final Genotype nonInformative; final Genotype nonInformative;
final List<Genotype> called; final List<Genotype> called;
@ -218,16 +215,14 @@ public class AFCalcUnitTest extends BaseTest {
samples.addAll(Collections.nCopies(nNonInformative, testData.nonInformative)); samples.addAll(Collections.nCopies(nNonInformative, testData.nonInformative));
final int nSamples = samples.size(); final int nSamples = samples.size();
List<AFCalc> calcs = AFCalcFactory.createAFCalcs( List<AFCalc> calcs = AFCalcFactory.createAFCalcs(Arrays.asList(AFCalcFactory.Calculation.values()), 4, 2, 2, 2);
Arrays.asList(
AFCalcFactory.Calculation.EXACT_REFERENCE,
AFCalcFactory.Calculation.EXACT_INDEPENDENT,
AFCalcFactory.Calculation.EXACT_GENERAL_PLOIDY
), 4, 2, 2, 2);
final double[] priors = MathUtils.normalizeFromLog10(new double[2*nSamples+1], true); // flat priors final double[] priors = MathUtils.normalizeFromLog10(new double[2*nSamples+1], true); // flat priors
for ( AFCalc model : calcs ) { for ( AFCalc model : calcs ) {
if ( testData.nAltAlleles > 1 && model instanceof OriginalDiploidExactAFCalc )
continue;
final GetGLsTest onlyInformative = new GetGLsTest(model, testData.nAltAlleles, testData.called, priors, "flat"); final GetGLsTest onlyInformative = new GetGLsTest(model, testData.nAltAlleles, testData.called, priors, "flat");
for ( int rotation = 0; rotation < nSamples; rotation++ ) { for ( int rotation = 0; rotation < nSamples; rotation++ ) {
@ -428,6 +423,94 @@ public class AFCalcUnitTest extends BaseTest {
"Actual pNonRef not within tolerance " + tolerance + " of expected"); "Actual pNonRef not within tolerance " + tolerance + " of expected");
} }
@DataProvider(name = "PNonRefBiallelicSystematic")
public Object[][] makePNonRefBiallelicSystematic() {
List<Object[]> tests = new ArrayList<Object[]>();
final List<Integer> bigNonRefPLs = Arrays.asList(0, 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, 100, 1000);
final List<List<Integer>> bigDiploidPLs = removeBadPLs(Utils.makePermutations(bigNonRefPLs, 3, true));
for ( AFCalcFactory.Calculation modelType : AFCalcFactory.Calculation.values() ) {
if ( false ) { // for testing only
tests.add(new Object[]{modelType, toGenotypes(Arrays.asList(Arrays.asList(0,100,0)))});
} else {
if ( modelType == AFCalcFactory.Calculation.EXACT_GENERAL_PLOIDY ) continue; // TODO -- GENERAL_PLOIDY DOESN'T WORK
// test all combinations of PLs for 1 sample
for ( final List<List<Integer>> PLsPerSample : Utils.makePermutations(bigDiploidPLs, 1, true) ) {
tests.add(new Object[]{modelType, toGenotypes(PLsPerSample)});
}
final List<List<Integer>> smallDiploidPLs = new LinkedList<List<Integer>>();
for ( final int nonRefPL : Arrays.asList(5, 10, 20, 30) ) {
for ( int i = 0; i < 2; i++ ) {
List<Integer> pls = new ArrayList<Integer>(Collections.nCopies(3, nonRefPL));
pls.set(i, 0);
smallDiploidPLs.add(pls);
}
}
for ( final List<List<Integer>> PLsPerSample : Utils.makePermutations(smallDiploidPLs, 5, false) ) {
tests.add(new Object[]{modelType, toGenotypes(PLsPerSample)});
}
}
}
return tests.toArray(new Object[][]{});
}
final List<List<Integer>> removeBadPLs(List<List<Integer>> listOfPLs) {
List<List<Integer>> clean = new LinkedList<List<Integer>>();
for ( final List<Integer> PLs : listOfPLs ) {
int x = PLs.get(0);
boolean bad = false;
for ( int pl1 : PLs )
if ( pl1 > x )
bad = true;
else
x = pl1;
if ( ! bad ) clean.add(PLs);
}
return clean;
}
private List<Genotype> toGenotypes(final List<List<Integer>> PLsPerSample) {
final List<Allele> nocall = Arrays.asList(Allele.NO_CALL, Allele.NO_CALL);
final List<Genotype> genotypes = new ArrayList<Genotype>(PLsPerSample.size());
for ( final List<Integer> PLs : PLsPerSample ) {
final int[] pls = ArrayUtils.toPrimitive(PLs.toArray(new Integer[3]));
final int min = MathUtils.arrayMin(pls);
for ( int i = 0; i < pls.length; i++ ) pls[i] -= min;
genotypes.add(makePL(nocall, pls));
}
return genotypes;
}
@Test(enabled = true && ! DEBUG_ONLY, dataProvider = "PNonRefBiallelicSystematic")
private void PNonRefBiallelicSystematic(AFCalcFactory.Calculation modelType, final List<Genotype> genotypes) {
//logger.warn("Running " + modelType + " with " + genotypes);
final AFCalcTestBuilder refBuilder = new AFCalcTestBuilder(genotypes.size(), 1, AFCalcFactory.Calculation.EXACT_REFERENCE, AFCalcTestBuilder.PriorType.human);
final AFCalcTestBuilder testBuilder = new AFCalcTestBuilder(genotypes.size(), 1, modelType, AFCalcTestBuilder.PriorType.human);
final VariantContextBuilder vcb = new VariantContextBuilder("x", "1", 1, 1, Arrays.asList(A, C));
vcb.genotypes(genotypes);
final AFCalcResult refResult = refBuilder.makeModel().getLog10PNonRef(vcb.make(), testBuilder.makePriors());
final AFCalcResult testResult = testBuilder.makeModel().getLog10PNonRef(vcb.make(), testBuilder.makePriors());
final double tolerance = 1e-3;
Assert.assertEquals(testResult.getLog10PosteriorOfAFGT0(), refResult.getLog10PosteriorOfAFGT0(), tolerance,
"Actual pNonRef not within tolerance " + tolerance + " of expected");
Assert.assertEquals(testResult.getAlleleCountsOfMLE(), refResult.getAlleleCountsOfMLE(),
"Actual MLE " + Utils.join(",", testResult.getAlleleCountsOfMLE()) + " not equal to expected " + Utils.join(",", refResult.getAlleleCountsOfMLE()));
}
// -------------------------------------------------------------------------------- // --------------------------------------------------------------------------------
// //
// Test priors // Test priors
@ -495,7 +578,7 @@ public class AFCalcUnitTest extends BaseTest {
// list of all high-quality models in the system // list of all high-quality models in the system
final List<AFCalcFactory.Calculation> models = Arrays.asList( final List<AFCalcFactory.Calculation> models = Arrays.asList(
AFCalcFactory.Calculation.EXACT, AFCalcFactory.Calculation.getDefaultModel(),
AFCalcFactory.Calculation.EXACT_REFERENCE, AFCalcFactory.Calculation.EXACT_REFERENCE,
AFCalcFactory.Calculation.EXACT_INDEPENDENT); AFCalcFactory.Calculation.EXACT_INDEPENDENT);

View File

@ -137,18 +137,15 @@ public class GeneralPloidyAFCalculationModelUnitTest extends BaseTest {
@Test(dataProvider = "getGLs") @Test(dataProvider = "getGLs")
public void testGLs(GetGLsTest cfg) { public void testGLs(GetGLsTest cfg) {
final AFCalcResultTracker resultTracker = new AFCalcResultTracker(cfg.numAltAlleles);
final int len = GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(1 + cfg.numAltAlleles, cfg.ploidy * cfg.GLs.size()); final int len = GeneralPloidyGenotypeLikelihoods.getNumLikelihoodElements(1 + cfg.numAltAlleles, cfg.ploidy * cfg.GLs.size());
double[] priors = new double[len]; // flat priors double[] priors = new double[len]; // flat priors
GeneralPloidyExactAFCalc.combineSinglePools(cfg.GLs, 1 + cfg.numAltAlleles, cfg.ploidy, priors, resultTracker); final GeneralPloidyExactAFCalc calc = new GeneralPloidyExactAFCalc(cfg.GLs.size(), 1 + cfg.numAltAlleles, 1 + cfg.numAltAlleles, cfg.ploidy);
calc.combineSinglePools(cfg.GLs, 1 + cfg.numAltAlleles, cfg.ploidy, priors);
int nameIndex = 1; int nameIndex = 1;
for ( int allele = 0; allele < cfg.numAltAlleles; allele++, nameIndex+=2 ) { for ( int allele = 0; allele < cfg.numAltAlleles; allele++, nameIndex+=2 ) {
int expectedAlleleCount = Integer.valueOf(cfg.name.substring(nameIndex, nameIndex+1)); int expectedAlleleCount = Integer.valueOf(cfg.name.substring(nameIndex, nameIndex+1));
int calculatedAlleleCount = resultTracker.getAlleleCountsOfMAP()[allele]; int calculatedAlleleCount = calc.getStateTracker().getAlleleCountsOfMAP()[allele];
// System.out.format( "%s Expected:%d Calc:%d\n",cfg.toString(),expectedAlleleCount, calculatedAlleleCount);
Assert.assertEquals(calculatedAlleleCount, expectedAlleleCount); Assert.assertEquals(calculatedAlleleCount, expectedAlleleCount);
} }
} }

View File

@ -21,7 +21,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest {
@Test @Test
public void testHaplotypeCallerMultiSample() { public void testHaplotypeCallerMultiSample() {
HCTest(CEUTRIO_BAM, "", "75013fa6a884104f0b1797502b636698"); HCTest(CEUTRIO_BAM, "", "ee866a8694a6f6c77242041275350ab9");
} }
@Test @Test
@ -31,7 +31,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest {
@Test @Test
public void testHaplotypeCallerMultiSampleGGA() { public void testHaplotypeCallerMultiSampleGGA() {
HCTest(CEUTRIO_BAM, "--max_alternate_alleles_for_indels 3 -gt_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "combined.phase1.chr20.raw.indels.sites.vcf", "3cd3363976b1937d801f9f82996f4abe"); HCTest(CEUTRIO_BAM, "--max_alternate_alleles_for_indels 3 -gt_mode GENOTYPE_GIVEN_ALLELES -alleles " + validationDataLocation + "combined.phase1.chr20.raw.indels.sites.vcf", "53caa950535749f99d3c5b9bb61c7b60");
} }
private void HCTestComplexVariants(String bam, String args, String md5) { private void HCTestComplexVariants(String bam, String args, String md5) {
@ -53,7 +53,7 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest {
@Test @Test
public void testHaplotypeCallerSingleSampleSymbolic() { public void testHaplotypeCallerSingleSampleSymbolic() {
HCTestSymbolicVariants(NA12878_CHR20_BAM, "", "6eb9c1026225b38ba7bd3c4c218f8269"); HCTestSymbolicVariants(NA12878_CHR20_BAM, "", "b4ea70a446e4782bd3700ca14dd726ff");
} }
private void HCTestIndelQualityScores(String bam, String args, String md5) { private void HCTestIndelQualityScores(String bam, String args, String md5) {
@ -64,13 +64,13 @@ public class HaplotypeCallerIntegrationTest extends WalkerTest {
@Test @Test
public void testHaplotypeCallerSingleSampleIndelQualityScores() { public void testHaplotypeCallerSingleSampleIndelQualityScores() {
HCTestIndelQualityScores(NA12878_RECALIBRATED_BAM, "", "98d82d74e8d6a778290bee6c0df6d092"); HCTestIndelQualityScores(NA12878_RECALIBRATED_BAM, "", "2581e760279291a3901a506d060bfac8");
} }
@Test @Test
public void HCTestProblematicReadsModifiedInActiveRegions() { public void HCTestProblematicReadsModifiedInActiveRegions() {
final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, privateTestDir + "haplotype-problem-4.bam") + " --no_cmdline_in_header -o %s -minPruning 3"; final String base = String.format("-T HaplotypeCaller -R %s -I %s", REF, privateTestDir + "haplotype-problem-4.bam") + " --no_cmdline_in_header -o %s -minPruning 3";
final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("fa5c5eb996e95aed12c50d70e6dd74d7")); final WalkerTestSpec spec = new WalkerTestSpec(base, Arrays.asList("c54c0c9411054bf629bfd98b616e53fc"));
executeTest("HCTestProblematicReadsModifiedInActiveRegions: ", spec); executeTest("HCTestProblematicReadsModifiedInActiveRegions: ", spec);
} }

View File

@ -23,24 +23,26 @@
*/ */
// our package // our package
package org.broadinstitute.sting.utils; package org.broadinstitute.sting.utils.pairhmm;
// the imports for unit testing. // the imports for unit testing.
import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.Utils;
import org.testng.Assert; import org.testng.Assert;
import org.testng.annotations.DataProvider; import org.testng.annotations.DataProvider;
import org.testng.annotations.Test; import org.testng.annotations.Test;
import java.util.*; import java.util.*;
public class PairHMMUnitTest extends BaseTest { public class PairHMMUnitTest extends BaseTest {
final static boolean EXTENSIVE_TESTING = true; final static boolean EXTENSIVE_TESTING = true;
PairHMM hmm = new PairHMM( false ); // reference implementation PairHMM exactHMM = new ExactPairHMM(); // the log truth implementation
PairHMM bandedHMM = new PairHMM( true ); // algorithm with banding PairHMM originalHMM = new OriginalPairHMM(); // the reference implementation
PairHMM cachingHMM = new CachingPairHMM();
PairHMM loglessHMM = new LoglessCachingPairHMM();
// -------------------------------------------------------------------------------- // --------------------------------------------------------------------------------
// //
@ -76,29 +78,37 @@ public class PairHMMUnitTest extends BaseTest {
} }
public double expectedLogL() { public double expectedLogL() {
return expectedQual / -10.0; return (expectedQual / -10.0) + 0.03 ;
} }
public double tolerance() { public double toleranceFromTheoretical() {
return 0.1; // TODO FIXME arbitrary return 0.2;
} }
public double calcLogL() { public double toleranceFromReference() {
return 1E-4;
}
double logL = hmm.computeReadLikelihoodGivenHaplotype( public double toleranceFromExact() {
return 1E-9;
}
public double calcLogL( final PairHMM pairHMM, boolean anchorIndel ) {
pairHMM.initialize(readBasesWithContext.length, refBasesWithContext.length);
return pairHMM.computeReadLikelihoodGivenHaplotypeLog10(
refBasesWithContext, readBasesWithContext, refBasesWithContext, readBasesWithContext,
qualAsBytes(baseQual, false), qualAsBytes(insQual, true), qualAsBytes(delQual, true), qualAsBytes(baseQual, false, anchorIndel), qualAsBytes(insQual, true, anchorIndel), qualAsBytes(delQual, true, anchorIndel),
qualAsBytes(gcp, false)); qualAsBytes(gcp, false, anchorIndel), 0, true);
return logL;
} }
private final byte[] asBytes(final String bases, final boolean left, final boolean right) { private final byte[] asBytes(final String bases, final boolean left, final boolean right) {
return ( (left ? LEFT_FLANK : "") + CONTEXT + bases + CONTEXT + (right ? RIGHT_FLANK : "")).getBytes(); return ( (left ? LEFT_FLANK : "") + CONTEXT + bases + CONTEXT + (right ? RIGHT_FLANK : "")).getBytes();
} }
private byte[] qualAsBytes(final int phredQual, final boolean doGOP) { private byte[] qualAsBytes(final int phredQual, final boolean doGOP, final boolean anchorIndel) {
final byte phredQuals[] = new byte[readBasesWithContext.length]; final byte phredQuals[] = new byte[readBasesWithContext.length];
if( anchorIndel ) {
// initialize everything to MASSIVE_QUAL so it cannot be moved by HMM // initialize everything to MASSIVE_QUAL so it cannot be moved by HMM
Arrays.fill(phredQuals, (byte)100); Arrays.fill(phredQuals, (byte)100);
@ -109,82 +119,10 @@ public class PairHMMUnitTest extends BaseTest {
for ( int i = 0; i < read.length(); i++) for ( int i = 0; i < read.length(); i++)
phredQuals[i + CONTEXT.length()] = (byte)phredQual; phredQuals[i + CONTEXT.length()] = (byte)phredQual;
} }
} else {
return phredQuals;
}
}
final Random random = new Random(87865573);
private class BandedLikelihoodTestProvider extends TestDataProvider {
final String ref, read;
final byte[] refBasesWithContext, readBasesWithContext;
final int baseQual, insQual, delQual, gcp;
final int expectedQual;
final static String LEFT_CONTEXT = "ACGTAATGACGCTACATGTCGCCAACCGTC";
final static String RIGHT_CONTEXT = "TACGGCTTCATATAGGGCAATGTGTGTGGCAAAA";
final static String LEFT_FLANK = "GATTTATCATCGAGTCTGTT";
final static String RIGHT_FLANK = "CATGGATCGTTATCAGCTATCTCGAGGGATTCACTTAACAGTTTCCGTA";
final byte[] baseQuals, insQuals, delQuals, gcps;
public BandedLikelihoodTestProvider(final String ref, final String read, final int baseQual, final int insQual, final int delQual, final int expectedQual, final int gcp) {
this(ref, read, baseQual, insQual, delQual, expectedQual, gcp, false, false);
}
public BandedLikelihoodTestProvider(final String ref, final String read, final int baseQual, final int insQual, final int delQual, final int expectedQual, final int gcp, final boolean left, final boolean right) {
super(BandedLikelihoodTestProvider.class, String.format("BANDED: ref=%s read=%s b/i/d/c quals = %d/%d/%d/%d l/r flank = %b/%b e[qual]=%d", ref, read, baseQual, insQual, delQual, gcp, left, right, expectedQual));
this.baseQual = baseQual;
this.delQual = delQual;
this.insQual = insQual;
this.gcp = gcp;
this.read = read;
this.ref = ref;
this.expectedQual = expectedQual;
refBasesWithContext = asBytes(ref, left, right);
readBasesWithContext = asBytes(read, false, false);
baseQuals = qualAsBytes(baseQual);
insQuals = qualAsBytes(insQual);
delQuals = qualAsBytes(delQual);
gcps = qualAsBytes(gcp, false);
}
public double expectedLogL() {
double logL = hmm.computeReadLikelihoodGivenHaplotype(
refBasesWithContext, readBasesWithContext,
baseQuals, insQuals, delQuals, gcps);
return logL;
}
public double tolerance() {
return 0.2; // TODO FIXME arbitrary
}
public double calcLogL() {
double logL = bandedHMM.computeReadLikelihoodGivenHaplotype(
refBasesWithContext, readBasesWithContext,
baseQuals, insQuals, delQuals, gcps);
return logL;
}
private final byte[] asBytes(final String bases, final boolean left, final boolean right) {
return ( (left ? LEFT_FLANK : "") + LEFT_CONTEXT + bases + RIGHT_CONTEXT + (right ? RIGHT_FLANK : "")).getBytes();
}
private byte[] qualAsBytes(final int phredQual) {
return qualAsBytes(phredQual, true);
}
private byte[] qualAsBytes(final int phredQual, final boolean addRandom) {
final byte phredQuals[] = new byte[readBasesWithContext.length];
Arrays.fill(phredQuals, (byte)phredQual); Arrays.fill(phredQuals, (byte)phredQual);
if(addRandom) {
for( int iii = 0; iii < phredQuals.length; iii++) {
phredQuals[iii] = (byte) ((int) phredQuals[iii] + (random.nextInt(7) - 3));
}
} }
return phredQuals; return phredQuals;
} }
} }
@ -195,8 +133,8 @@ public class PairHMMUnitTest extends BaseTest {
// test all combinations // test all combinations
final List<Integer> baseQuals = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30, 40, 50) : Arrays.asList(30); final List<Integer> baseQuals = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30, 40, 50) : Arrays.asList(30);
final List<Integer> indelQuals = EXTENSIVE_TESTING ? Arrays.asList(20, 30, 40, 50) : Arrays.asList(40); final List<Integer> indelQuals = EXTENSIVE_TESTING ? Arrays.asList(20, 30, 40, 50) : Arrays.asList(40);
final List<Integer> gcps = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30) : Arrays.asList(10); final List<Integer> gcps = EXTENSIVE_TESTING ? Arrays.asList(8, 10, 20) : Arrays.asList(10);
final List<Integer> sizes = EXTENSIVE_TESTING ? Arrays.asList(2,3,4,5,7,8,9,10,20) : Arrays.asList(2); final List<Integer> sizes = EXTENSIVE_TESTING ? Arrays.asList(2,3,4,5,7,8,9,10,20,30,35) : Arrays.asList(2);
for ( final int baseQual : baseQuals ) { for ( final int baseQual : baseQuals ) {
for ( final int indelQual : indelQuals ) { for ( final int indelQual : indelQuals ) {
@ -238,69 +176,65 @@ public class PairHMMUnitTest extends BaseTest {
return BasicLikelihoodTestProvider.getTests(BasicLikelihoodTestProvider.class); return BasicLikelihoodTestProvider.getTests(BasicLikelihoodTestProvider.class);
} }
@Test(dataProvider = "BasicLikelihoodTestProvider", enabled = true) final Random random = new Random(87860573);
public void testBasicLikelihoods(BasicLikelihoodTestProvider cfg) { @DataProvider(name = "OptimizedLikelihoodTestProvider")
double calculatedLogL = cfg.calcLogL(); public Object[][] makeOptimizedLikelihoodTests() {
double expectedLogL = cfg.expectedLogL();
logger.warn(String.format("Test: logL calc=%.2f expected=%.2f for %s", calculatedLogL, expectedLogL, cfg.toString()));
Assert.assertEquals(calculatedLogL, expectedLogL, cfg.tolerance());
}
@DataProvider(name = "BandedLikelihoodTestProvider")
public Object[][] makeBandedLikelihoodTests() {
// context on either side is ACGTTGCA REF ACGTTGCA // context on either side is ACGTTGCA REF ACGTTGCA
// test all combinations // test all combinations
final List<Integer> baseQuals = EXTENSIVE_TESTING ? Arrays.asList(25, 30, 40, 50) : Arrays.asList(30); final List<Integer> baseQuals = EXTENSIVE_TESTING ? Arrays.asList(10, 30, 40, 60) : Arrays.asList(30);
final List<Integer> indelQuals = EXTENSIVE_TESTING ? Arrays.asList(30, 40, 50) : Arrays.asList(40); final List<Integer> indelQuals = EXTENSIVE_TESTING ? Arrays.asList(20, 40, 60) : Arrays.asList(40);
final List<Integer> gcps = EXTENSIVE_TESTING ? Arrays.asList(10, 12) : Arrays.asList(10); final List<Integer> gcps = EXTENSIVE_TESTING ? Arrays.asList(10, 20, 30) : Arrays.asList(10);
final List<Integer> sizes = EXTENSIVE_TESTING ? Arrays.asList(2,3,4,5,7,8,9,10,20) : Arrays.asList(2); final List<Integer> sizes = EXTENSIVE_TESTING ? Arrays.asList(3, 20, 50, 90, 160) : Arrays.asList(2);
for ( final int baseQual : baseQuals ) { for ( final int baseQual : baseQuals ) {
for ( final int indelQual : indelQuals ) { for ( final int indelQual : indelQuals ) {
for ( final int gcp : gcps ) { for ( final int gcp : gcps ) {
for ( final int refSize : sizes ) {
// test substitutions for ( final int readSize : sizes ) {
for ( final byte refBase : BaseUtils.BASES ) { String ref = "";
for ( final byte readBase : BaseUtils.BASES ) { String read = "";
final String ref = new String(new byte[]{refBase}); for( int iii = 0; iii < refSize; iii++) {
final String read = new String(new byte[]{readBase}); ref += (char) BaseUtils.BASES[random.nextInt(4)];
final int expected = refBase == readBase ? 0 : baseQual;
new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp);
} }
for( int iii = 0; iii < readSize; iii++) {
read += (char) BaseUtils.BASES[random.nextInt(4)];
} }
new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp);
// test insertions and deletions new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, true, false);
for ( final int size : sizes ) { new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, false, true);
for ( final byte base : BaseUtils.BASES ) { new BasicLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, -0, gcp, true, true);
final int expected = indelQual + (size - 2) * gcp;
for ( boolean insertionP : Arrays.asList(true, false)) {
final String small = Utils.dupString((char)base, 1);
final String big = Utils.dupString((char)base, size);
final String ref = insertionP ? small : big;
final String read = insertionP ? big : small;
new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp);
new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, true, false);
new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, false, true);
new BandedLikelihoodTestProvider(ref, read, baseQual, indelQual, indelQual, expected, gcp, true, true);
}
} }
} }
} }
} }
} }
return BandedLikelihoodTestProvider.getTests(BandedLikelihoodTestProvider.class); return BasicLikelihoodTestProvider.getTests(BasicLikelihoodTestProvider.class);
} }
@Test(dataProvider = "BandedLikelihoodTestProvider", enabled = true) @Test(dataProvider = "BasicLikelihoodTestProvider", enabled = true)
public void testBandedLikelihoods(BandedLikelihoodTestProvider cfg) { public void testBasicLikelihoods(BasicLikelihoodTestProvider cfg) {
double calculatedLogL = cfg.calcLogL(); double exactLogL = cfg.calcLogL( exactHMM, true );
double calculatedLogL = cfg.calcLogL( originalHMM, true );
double optimizedLogL = cfg.calcLogL( cachingHMM, true );
double loglessLogL = cfg.calcLogL( loglessHMM, true );
double expectedLogL = cfg.expectedLogL(); double expectedLogL = cfg.expectedLogL();
logger.warn(String.format("Test: logL calc=%.2f expected=%.2f for %s", calculatedLogL, expectedLogL, cfg.toString())); //logger.warn(String.format("Test: logL calc=%.2f optimized=%.2f logless=%.2f expected=%.2f for %s", calculatedLogL, optimizedLogL, loglessLogL, expectedLogL, cfg.toString()));
Assert.assertEquals(calculatedLogL, expectedLogL, cfg.tolerance()); Assert.assertEquals(exactLogL, expectedLogL, cfg.toleranceFromTheoretical());
Assert.assertEquals(calculatedLogL, expectedLogL, cfg.toleranceFromTheoretical());
Assert.assertEquals(optimizedLogL, calculatedLogL, cfg.toleranceFromReference());
Assert.assertEquals(loglessLogL, exactLogL, cfg.toleranceFromExact());
}
@Test(dataProvider = "OptimizedLikelihoodTestProvider", enabled = true)
public void testOptimizedLikelihoods(BasicLikelihoodTestProvider cfg) {
double exactLogL = cfg.calcLogL( exactHMM, false );
double calculatedLogL = cfg.calcLogL( originalHMM, false );
double optimizedLogL = cfg.calcLogL( cachingHMM, false );
double loglessLogL = cfg.calcLogL( loglessHMM, false );
//logger.warn(String.format("Test: logL calc=%.2f optimized=%.2f logless=%.2f expected=%.2f for %s", calculatedLogL, optimizedLogL, loglessLogL, expectedLogL, cfg.toString()));
Assert.assertEquals(optimizedLogL, calculatedLogL, cfg.toleranceFromReference());
Assert.assertEquals(loglessLogL, exactLogL, cfg.toleranceFromExact());
} }
@Test @Test
@ -322,11 +256,11 @@ public class PairHMMUnitTest extends BaseTest {
byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length-offset); byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length-offset);
// change single base at position k to C. If it's a C, change to T // change single base at position k to C. If it's a C, change to T
mread[k] = ( mread[k] == (byte)'C' ? (byte)'T' : (byte)'C'); mread[k] = ( mread[k] == (byte)'C' ? (byte)'T' : (byte)'C');
double res1 = hmm.computeReadLikelihoodGivenHaplotype( originalHMM.initialize(mread.length, haplotype1.length);
double res1 = originalHMM.computeReadLikelihoodGivenHaplotypeLog10(
haplotype1, mread, haplotype1, mread,
quals, gop, gop, quals, gop, gop,
gcp); gcp, 0, false);
System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1); System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1);
@ -353,11 +287,11 @@ public class PairHMMUnitTest extends BaseTest {
byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length); byte[] mread = Arrays.copyOfRange(haplotype1,offset,haplotype1.length);
// change single base at position k to C. If it's a C, change to T // change single base at position k to C. If it's a C, change to T
mread[k] = ( mread[k] == (byte)'C' ? (byte)'T' : (byte)'C'); mread[k] = ( mread[k] == (byte)'C' ? (byte)'T' : (byte)'C');
double res1 = hmm.computeReadLikelihoodGivenHaplotype( originalHMM.initialize(mread.length, haplotype1.length);
double res1 = originalHMM.computeReadLikelihoodGivenHaplotypeLog10(
haplotype1, mread, haplotype1, mread,
quals, gop, gop, quals, gop, gop,
gcp); gcp, 0, false);
System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1); System.out.format("H:%s\nR: %s\n Pos:%d Result:%4.2f\n",new String(haplotype1), new String(mread), k,res1);

View File

@ -62,7 +62,7 @@ public @interface Argument {
* --help argument is specified. * --help argument is specified.
* @return Doc string associated with this command-line argument. * @return Doc string associated with this command-line argument.
*/ */
String doc(); String doc() default "Undocumented option";
/** /**
* Is this argument required. If true, the command-line argument system will * Is this argument required. If true, the command-line argument system will

View File

@ -3,6 +3,7 @@ package org.broadinstitute.sting.gatk.arguments;
import org.broadinstitute.sting.commandline.*; import org.broadinstitute.sting.commandline.*;
import org.broadinstitute.sting.gatk.walkers.genotyper.GenotypeLikelihoodsCalculationModel; import org.broadinstitute.sting.gatk.walkers.genotyper.GenotypeLikelihoodsCalculationModel;
import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine; import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine;
import org.broadinstitute.sting.gatk.walkers.genotyper.afcalc.AFCalcFactory;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.io.File; import java.io.File;
@ -69,7 +70,40 @@ public class StandardCallerArgumentCollection {
@Argument(fullName = "max_alternate_alleles_for_indels", shortName = "maxAltAllelesForIndels", doc = "Maximum number of alternate alleles to genotype for indels only", required = false) @Argument(fullName = "max_alternate_alleles_for_indels", shortName = "maxAltAllelesForIndels", doc = "Maximum number of alternate alleles to genotype for indels only", required = false)
public int MAX_ALTERNATE_ALLELES_FOR_INDELS = 2; public int MAX_ALTERNATE_ALLELES_FOR_INDELS = 2;
/**
* If this fraction is greater is than zero, the caller will aggressively attempt to remove contamination through biased down-sampling of reads.
* Basically, it will ignore the contamination fraction of reads for each alternate allele. So if the pileup contains N total bases, then we
* will try to remove (N * contamination fraction) bases for each alternate allele.
*/
@Hidden
@Argument(fullName = "contamination_percentage_to_filter", shortName = "contamination", doc = "Fraction of contamination in sequencing data (for all samples) to aggressively remove", required = false)
public double CONTAMINATION_PERCENTAGE = 0.0;
@Hidden @Hidden
@Argument(shortName = "logExactCalls", doc="x", required=false) @Argument(shortName = "logExactCalls", doc="x", required=false)
public File exactCallsLog = null; public File exactCallsLog = null;
public StandardCallerArgumentCollection() { }
// Developers must remember to add any newly added arguments to the list here as well otherwise they won't get changed from their default value!
public StandardCallerArgumentCollection(final StandardCallerArgumentCollection SCAC) {
this.alleles = SCAC.alleles;
this.GenotypingMode = SCAC.GenotypingMode;
this.heterozygosity = SCAC.heterozygosity;
this.MAX_ALTERNATE_ALLELES = SCAC.MAX_ALTERNATE_ALLELES;
this.MAX_ALTERNATE_ALLELES_FOR_INDELS = SCAC.MAX_ALTERNATE_ALLELES_FOR_INDELS;
this.OutputMode = SCAC.OutputMode;
this.STANDARD_CONFIDENCE_FOR_CALLING = SCAC.STANDARD_CONFIDENCE_FOR_CALLING;
this.STANDARD_CONFIDENCE_FOR_EMITTING = SCAC.STANDARD_CONFIDENCE_FOR_EMITTING;
this.CONTAMINATION_PERCENTAGE = SCAC.CONTAMINATION_PERCENTAGE;
this.exactCallsLog = SCAC.exactCallsLog;
this.AFmodel = SCAC.AFmodel;
}
/**
* Controls the model used to calculate the probability that a site is variant plus the various sample genotypes in the data at a given locus.
*/
@Advanced
@Argument(fullName = "p_nonref_model", shortName = "pnrm", doc = "Non-reference probability calculation model to employ", required = false)
public AFCalcFactory.Calculation AFmodel = AFCalcFactory.Calculation.getDefaultModel();
} }

View File

@ -104,10 +104,11 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
prevLoc = location; prevLoc = location;
updateCumulativeMetrics(dataProvider.getShard());
printProgress(locus.getLocation()); printProgress(locus.getLocation());
} }
updateCumulativeMetrics(dataProvider.getShard());
// Take the individual isActive calls and integrate them into contiguous active regions and // Take the individual isActive calls and integrate them into contiguous active regions and
// add these blocks of work to the work queue // add these blocks of work to the work queue
// band-pass filter the list of isActive probabilities and turn into active regions // band-pass filter the list of isActive probabilities and turn into active regions

View File

@ -57,7 +57,7 @@ public class IndelGenotypeLikelihoodsCalculationModel extends GenotypeLikelihood
protected IndelGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) { protected IndelGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) {
super(UAC, logger); super(UAC, logger);
pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY, pairModel = new PairHMMIndelErrorModel(UAC.INDEL_GAP_OPEN_PENALTY, UAC.INDEL_GAP_CONTINUATION_PENALTY,
UAC.OUTPUT_DEBUG_INDEL_INFO, !UAC.DONT_DO_BANDED_INDEL_COMPUTATION); UAC.OUTPUT_DEBUG_INDEL_INFO, UAC.pairHMM);
DEBUG = UAC.OUTPUT_DEBUG_INDEL_INFO; DEBUG = UAC.OUTPUT_DEBUG_INDEL_INFO;
haplotypeMap = new LinkedHashMap<Allele, Haplotype>(); haplotypeMap = new LinkedHashMap<Allele, Haplotype>();
ignoreSNPAllelesWhenGenotypingIndels = UAC.IGNORE_SNP_ALLELES; ignoreSNPAllelesWhenGenotypingIndels = UAC.IGNORE_SNP_ALLELES;
@ -231,7 +231,7 @@ public class IndelGenotypeLikelihoodsCalculationModel extends GenotypeLikelihood
int count = 0; int count = 0;
for (PileupElement p : pileup) { for (PileupElement p : pileup) {
if (p.isDeletion() || p.isInsertionAtBeginningOfRead() || BaseUtils.isRegularBase(p.getBase())) if (p.isDeletion() || p.isInsertionAtBeginningOfRead() || BaseUtils.isRegularBase(p.getBase()))
count++; count += p.getRepresentativeCount();
} }
return count; return count;

View File

@ -41,19 +41,20 @@ import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileupImpl; import org.broadinstitute.sting.utils.pileup.ReadBackedPileupImpl;
import org.broadinstitute.sting.utils.variantcontext.*; import org.broadinstitute.sting.utils.variantcontext.*;
import java.util.ArrayList; import java.util.*;
import java.util.List;
import java.util.Map;
public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel { public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsCalculationModel {
private final boolean useAlleleFromVCF; private final boolean useAlleleFromVCF;
private final double[] likelihoodSums = new double[4]; private final double[] likelihoodSums = new double[4];
private final ArrayList<PileupElement>[] alleleStratifiedElements = new ArrayList[4];
protected SNPGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) { protected SNPGenotypeLikelihoodsCalculationModel(UnifiedArgumentCollection UAC, Logger logger) {
super(UAC, logger); super(UAC, logger);
useAlleleFromVCF = UAC.GenotypingMode == GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES; useAlleleFromVCF = UAC.GenotypingMode == GENOTYPING_MODE.GENOTYPE_GIVEN_ALLELES;
for ( int i = 0; i < 4; i++ )
alleleStratifiedElements[i] = new ArrayList<PileupElement>();
} }
public VariantContext getLikelihoods(final RefMetaDataTracker tracker, public VariantContext getLikelihoods(final RefMetaDataTracker tracker,
@ -78,6 +79,8 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
ArrayList<SampleGenotypeData> GLs = new ArrayList<SampleGenotypeData>(contexts.size()); ArrayList<SampleGenotypeData> GLs = new ArrayList<SampleGenotypeData>(contexts.size());
for ( Map.Entry<String, AlignmentContext> sample : contexts.entrySet() ) { for ( Map.Entry<String, AlignmentContext> sample : contexts.entrySet() ) {
ReadBackedPileup pileup = AlignmentContextUtils.stratify(sample.getValue(), contextType).getBasePileup(); ReadBackedPileup pileup = AlignmentContextUtils.stratify(sample.getValue(), contextType).getBasePileup();
if ( UAC.CONTAMINATION_PERCENTAGE > 0.0 )
pileup = createDecontaminatedPileup(pileup, UAC.CONTAMINATION_PERCENTAGE);
if ( useBAQedPileup ) if ( useBAQedPileup )
pileup = createBAQedPileup(pileup); pileup = createBAQedPileup(pileup);
@ -150,8 +153,6 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
// create the genotypes; no-call everyone for now // create the genotypes; no-call everyone for now
final GenotypesContext genotypes = GenotypesContext.create(); final GenotypesContext genotypes = GenotypesContext.create();
final List<Allele> noCall = new ArrayList<Allele>();
noCall.add(Allele.NO_CALL);
for ( SampleGenotypeData sampleData : GLs ) { for ( SampleGenotypeData sampleData : GLs ) {
final double[] allLikelihoods = sampleData.GL.getLikelihoods(); final double[] allLikelihoods = sampleData.GL.getLikelihoods();
@ -202,6 +203,42 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
return allelesToUse; return allelesToUse;
} }
public ReadBackedPileup createDecontaminatedPileup(final ReadBackedPileup pileup, final double contaminationPercentage) {
// special case removal of all reads
if ( contaminationPercentage >= 1.0 )
return new ReadBackedPileupImpl(pileup.getLocation(), new ArrayList<PileupElement>());
// start by stratifying the reads by the alleles they represent at this position
for( final PileupElement pe : pileup ) {
final int baseIndex = BaseUtils.simpleBaseToBaseIndex(pe.getBase());
if ( baseIndex != -1 )
alleleStratifiedElements[baseIndex].add(pe);
}
// Down-sample *each* allele by the contamination fraction applied to the entire pileup.
// Unfortunately, we need to maintain the original pileup ordering of reads or FragmentUtils will complain later.
int numReadsToRemove = (int)Math.ceil((double)pileup.getNumberOfElements() * contaminationPercentage);
final TreeSet<PileupElement> elementsToKeep = new TreeSet<PileupElement>(new Comparator<PileupElement>() {
@Override
public int compare(PileupElement element1, PileupElement element2) {
final int difference = element1.getRead().getAlignmentStart() - element2.getRead().getAlignmentStart();
return difference != 0 ? difference : element1.getRead().getReadName().compareTo(element2.getRead().getReadName());
}
});
for ( int i = 0; i < 4; i++ ) {
final ArrayList<PileupElement> alleleList = alleleStratifiedElements[i];
if ( alleleList.size() > numReadsToRemove )
elementsToKeep.addAll(downsampleElements(alleleList, numReadsToRemove));
}
// clean up pointers so memory can be garbage collected if needed
for ( int i = 0; i < 4; i++ )
alleleStratifiedElements[i].clear();
return new ReadBackedPileupImpl(pileup.getLocation(), new ArrayList<PileupElement>(elementsToKeep));
}
public ReadBackedPileup createBAQedPileup( final ReadBackedPileup pileup ) { public ReadBackedPileup createBAQedPileup( final ReadBackedPileup pileup ) {
final List<PileupElement> BAQedElements = new ArrayList<PileupElement>(); final List<PileupElement> BAQedElements = new ArrayList<PileupElement>();
for( final PileupElement PE : pileup ) { for( final PileupElement PE : pileup ) {
@ -220,6 +257,22 @@ public class SNPGenotypeLikelihoodsCalculationModel extends GenotypeLikelihoodsC
public byte getQual( final int offset ) { return BAQ.calcBAQFromTag(getRead(), offset, true); } public byte getQual( final int offset ) { return BAQ.calcBAQFromTag(getRead(), offset, true); }
} }
private List<PileupElement> downsampleElements(final ArrayList<PileupElement> elements, final int numElementsToRemove) {
final int pileupSize = elements.size();
final BitSet itemsToRemove = new BitSet(pileupSize);
for ( Integer selectedIndex : MathUtils.sampleIndicesWithoutReplacement(pileupSize, numElementsToRemove) ) {
itemsToRemove.set(selectedIndex);
}
ArrayList<PileupElement> elementsToKeep = new ArrayList<PileupElement>(pileupSize - numElementsToRemove);
for ( int i = 0; i < pileupSize; i++ ) {
if ( !itemsToRemove.get(i) )
elementsToKeep.add(elements.get(i));
}
return elementsToKeep;
}
private static class SampleGenotypeData { private static class SampleGenotypeData {
public final String name; public final String name;

View File

@ -27,23 +27,15 @@ package org.broadinstitute.sting.gatk.walkers.genotyper;
import org.broadinstitute.sting.commandline.*; import org.broadinstitute.sting.commandline.*;
import org.broadinstitute.sting.gatk.arguments.StandardCallerArgumentCollection; import org.broadinstitute.sting.gatk.arguments.StandardCallerArgumentCollection;
import org.broadinstitute.sting.gatk.walkers.genotyper.afcalc.AFCalcFactory; import org.broadinstitute.sting.utils.pairhmm.PairHMM;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils; import org.broadinstitute.sting.utils.variantcontext.VariantContextUtils;
public class UnifiedArgumentCollection extends StandardCallerArgumentCollection { public class UnifiedArgumentCollection extends StandardCallerArgumentCollection {
@Argument(fullName = "genotype_likelihoods_model", shortName = "glm", doc = "Genotype likelihoods calculation model to employ -- SNP is the default option, while INDEL is also available for calling indels and BOTH is available for calling both together", required = false) @Argument(fullName = "genotype_likelihoods_model", shortName = "glm", doc = "Genotype likelihoods calculation model to employ -- SNP is the default option, while INDEL is also available for calling indels and BOTH is available for calling both together", required = false)
public GenotypeLikelihoodsCalculationModel.Model GLmodel = GenotypeLikelihoodsCalculationModel.Model.SNP; public GenotypeLikelihoodsCalculationModel.Model GLmodel = GenotypeLikelihoodsCalculationModel.Model.SNP;
/**
* Controls the model used to calculate the probability that a site is variant plus the various sample genotypes in the data at a given locus.
*/
@Advanced
@Argument(fullName = "p_nonref_model", shortName = "pnrm", doc = "Non-reference probability calculation model to employ", required = false)
public AFCalcFactory.Calculation AFmodel = AFCalcFactory.Calculation.EXACT;
/** /**
* The PCR error rate is independent of the sequencing error rate, which is necessary because we cannot necessarily * The PCR error rate is independent of the sequencing error rate, which is necessary because we cannot necessarily
* distinguish between PCR errors vs. sequencing errors. The practical implication for this value is that it * distinguish between PCR errors vs. sequencing errors. The practical implication for this value is that it
@ -65,6 +57,12 @@ public class UnifiedArgumentCollection extends StandardCallerArgumentCollection
@Argument(fullName = "annotateNDA", shortName = "nda", doc = "If provided, we will annotate records with the number of alternate alleles that were discovered (but not necessarily genotyped) at a given site", required = false) @Argument(fullName = "annotateNDA", shortName = "nda", doc = "If provided, we will annotate records with the number of alternate alleles that were discovered (but not necessarily genotyped) at a given site", required = false)
public boolean ANNOTATE_NUMBER_OF_ALLELES_DISCOVERED = false; public boolean ANNOTATE_NUMBER_OF_ALLELES_DISCOVERED = false;
/**
* The PairHMM implementation to use for -glm INDEL genotype likelihood calculations. The various implementations balance a tradeoff of accuracy and runtime.
*/
@Argument(fullName = "pair_hmm_implementation", shortName = "pairHMM", doc = "The PairHMM implementation to use for -glm INDEL genotype likelihood calculations", required = false)
public PairHMM.HMM_IMPLEMENTATION pairHMM = PairHMM.HMM_IMPLEMENTATION.ORIGINAL;
/** /**
* The minimum confidence needed in a given base for it to be used in variant calling. Note that the base quality of a base * The minimum confidence needed in a given base for it to be used in variant calling. Note that the base quality of a base
* is capped by the mapping quality so that bases on reads with low mapping quality may get filtered out depending on this value. * is capped by the mapping quality so that bases on reads with low mapping quality may get filtered out depending on this value.
@ -112,10 +110,6 @@ public class UnifiedArgumentCollection extends StandardCallerArgumentCollection
@Argument(fullName = "indelHaplotypeSize", shortName = "indelHSize", doc = "Indel haplotype size", required = false) @Argument(fullName = "indelHaplotypeSize", shortName = "indelHSize", doc = "Indel haplotype size", required = false)
public int INDEL_HAPLOTYPE_SIZE = 80; public int INDEL_HAPLOTYPE_SIZE = 80;
@Hidden
@Argument(fullName = "noBandedIndel", shortName = "noBandedIndel", doc = "Don't do Banded Indel likelihood computation", required = false)
public boolean DONT_DO_BANDED_INDEL_COMPUTATION = false;
@Hidden @Hidden
@Argument(fullName = "indelDebug", shortName = "indelDebug", doc = "Output indel debug info", required = false) @Argument(fullName = "indelDebug", shortName = "indelDebug", doc = "Output indel debug info", required = false)
public boolean OUTPUT_DEBUG_INDEL_INFO = false; public boolean OUTPUT_DEBUG_INDEL_INFO = false;
@ -183,63 +177,57 @@ public class UnifiedArgumentCollection extends StandardCallerArgumentCollection
@Argument(shortName="ef", fullName="exclude_filtered_reference_sites", doc="Don't include in the analysis sites where the reference sample VCF is filtered. Default: false.", required=false) @Argument(shortName="ef", fullName="exclude_filtered_reference_sites", doc="Don't include in the analysis sites where the reference sample VCF is filtered. Default: false.", required=false)
boolean EXCLUDE_FILTERED_REFERENCE_SITES = false; boolean EXCLUDE_FILTERED_REFERENCE_SITES = false;
// Developers must remember to add any newly added arguments to the list here as well otherwise they won't get changed from their default value! /**
public UnifiedArgumentCollection clone() { * Create a new UAC with defaults for all UAC arguments
UnifiedArgumentCollection uac = new UnifiedArgumentCollection(); */
public UnifiedArgumentCollection() {
super();
}
uac.GLmodel = GLmodel; /**
uac.AFmodel = AFmodel; * Create a new UAC based on the information only our in super-class scac and defaults for all UAC arguments
uac.heterozygosity = heterozygosity; * @param scac
uac.PCR_error = PCR_error; */
uac.GenotypingMode = GenotypingMode; public UnifiedArgumentCollection(final StandardCallerArgumentCollection scac) {
uac.OutputMode = OutputMode; super(scac);
uac.NO_SLOD = NO_SLOD; }
uac.ANNOTATE_NUMBER_OF_ALLELES_DISCOVERED = ANNOTATE_NUMBER_OF_ALLELES_DISCOVERED;
uac.STANDARD_CONFIDENCE_FOR_CALLING = STANDARD_CONFIDENCE_FOR_CALLING; /**
uac.STANDARD_CONFIDENCE_FOR_EMITTING = STANDARD_CONFIDENCE_FOR_EMITTING; * Create a new UAC with all parameters having the values in uac
uac.MIN_BASE_QUALTY_SCORE = MIN_BASE_QUALTY_SCORE; *
uac.MAX_DELETION_FRACTION = MAX_DELETION_FRACTION; * @param uac
uac.MIN_INDEL_COUNT_FOR_GENOTYPING = MIN_INDEL_COUNT_FOR_GENOTYPING; */
uac.MIN_INDEL_FRACTION_PER_SAMPLE = MIN_INDEL_FRACTION_PER_SAMPLE; public UnifiedArgumentCollection(final UnifiedArgumentCollection uac) {
uac.INDEL_HETEROZYGOSITY = INDEL_HETEROZYGOSITY; // Developers must remember to add any newly added arguments to the list here as well otherwise they won't get changed from their default value!
uac.INDEL_GAP_OPEN_PENALTY = INDEL_GAP_OPEN_PENALTY; super(uac);
uac.INDEL_GAP_CONTINUATION_PENALTY = INDEL_GAP_CONTINUATION_PENALTY;
uac.OUTPUT_DEBUG_INDEL_INFO = OUTPUT_DEBUG_INDEL_INFO; this.GLmodel = uac.GLmodel;
uac.INDEL_HAPLOTYPE_SIZE = INDEL_HAPLOTYPE_SIZE; this.AFmodel = uac.AFmodel;
uac.alleles = alleles; this.PCR_error = uac.PCR_error;
uac.MAX_ALTERNATE_ALLELES = MAX_ALTERNATE_ALLELES; this.NO_SLOD = uac.NO_SLOD;
uac.MAX_ALTERNATE_ALLELES_FOR_INDELS = MAX_ALTERNATE_ALLELES_FOR_INDELS; this.ANNOTATE_NUMBER_OF_ALLELES_DISCOVERED = uac.ANNOTATE_NUMBER_OF_ALLELES_DISCOVERED;
uac.GLmodel = GLmodel; this.MIN_BASE_QUALTY_SCORE = uac.MIN_BASE_QUALTY_SCORE;
uac.TREAT_ALL_READS_AS_SINGLE_POOL = TREAT_ALL_READS_AS_SINGLE_POOL; this.MAX_DELETION_FRACTION = uac.MAX_DELETION_FRACTION;
uac.referenceSampleRod = referenceSampleRod; this.MIN_INDEL_COUNT_FOR_GENOTYPING = uac.MIN_INDEL_COUNT_FOR_GENOTYPING;
uac.referenceSampleName = referenceSampleName; this.MIN_INDEL_FRACTION_PER_SAMPLE = uac.MIN_INDEL_FRACTION_PER_SAMPLE;
uac.samplePloidy = samplePloidy; this.INDEL_HETEROZYGOSITY = uac.INDEL_HETEROZYGOSITY;
uac.maxQualityScore = minQualityScore; this.INDEL_GAP_OPEN_PENALTY = uac.INDEL_GAP_OPEN_PENALTY;
uac.phredScaledPrior = phredScaledPrior; this.INDEL_GAP_CONTINUATION_PENALTY = uac.INDEL_GAP_CONTINUATION_PENALTY;
uac.minPower = minPower; this.OUTPUT_DEBUG_INDEL_INFO = uac.OUTPUT_DEBUG_INDEL_INFO;
uac.minReferenceDepth = minReferenceDepth; this.INDEL_HAPLOTYPE_SIZE = uac.INDEL_HAPLOTYPE_SIZE;
uac.EXCLUDE_FILTERED_REFERENCE_SITES = EXCLUDE_FILTERED_REFERENCE_SITES; this.TREAT_ALL_READS_AS_SINGLE_POOL = uac.TREAT_ALL_READS_AS_SINGLE_POOL;
uac.IGNORE_LANE_INFO = IGNORE_LANE_INFO; this.referenceSampleRod = uac.referenceSampleRod;
uac.exactCallsLog = exactCallsLog; this.referenceSampleName = uac.referenceSampleName;
this.samplePloidy = uac.samplePloidy;
this.maxQualityScore = uac.minQualityScore;
this.phredScaledPrior = uac.phredScaledPrior;
this.minPower = uac.minPower;
this.minReferenceDepth = uac.minReferenceDepth;
this.EXCLUDE_FILTERED_REFERENCE_SITES = uac.EXCLUDE_FILTERED_REFERENCE_SITES;
this.IGNORE_LANE_INFO = uac.IGNORE_LANE_INFO;
this.pairHMM = uac.pairHMM;
// todo- arguments to remove // todo- arguments to remove
uac.IGNORE_SNP_ALLELES = IGNORE_SNP_ALLELES; this.IGNORE_SNP_ALLELES = uac.IGNORE_SNP_ALLELES;
uac.DONT_DO_BANDED_INDEL_COMPUTATION = DONT_DO_BANDED_INDEL_COMPUTATION;
return uac;
}
public UnifiedArgumentCollection() { }
public UnifiedArgumentCollection( final StandardCallerArgumentCollection SCAC ) {
super();
this.alleles = SCAC.alleles;
this.GenotypingMode = SCAC.GenotypingMode;
this.heterozygosity = SCAC.heterozygosity;
this.MAX_ALTERNATE_ALLELES = SCAC.MAX_ALTERNATE_ALLELES;
this.MAX_ALTERNATE_ALLELES_FOR_INDELS = SCAC.MAX_ALTERNATE_ALLELES_FOR_INDELS;
this.OutputMode = SCAC.OutputMode;
this.STANDARD_CONFIDENCE_FOR_CALLING = SCAC.STANDARD_CONFIDENCE_FOR_CALLING;
this.STANDARD_CONFIDENCE_FOR_EMITTING = SCAC.STANDARD_CONFIDENCE_FOR_EMITTING;
this.exactCallsLog = SCAC.exactCallsLog;
} }
} }

View File

@ -50,9 +50,19 @@ public abstract class AFCalc implements Cloneable {
protected Logger logger = defaultLogger; protected Logger logger = defaultLogger;
private SimpleTimer callTimer = new SimpleTimer(); private SimpleTimer callTimer = new SimpleTimer();
private final AFCalcResultTracker resultTracker; private final StateTracker stateTracker;
private ExactCallLogger exactCallLogger = null; private ExactCallLogger exactCallLogger = null;
/**
* Create a new AFCalc object capable of calculating the prob. that alleles are
* segregating among nSamples with up to maxAltAlleles for SNPs and maxAltAllelesForIndels
* for indels for samples with ploidy
*
* @param nSamples number of samples, must be > 0
* @param maxAltAlleles maxAltAlleles for SNPs
* @param maxAltAllelesForIndels for indels
* @param ploidy the ploidy, must be > 0
*/
protected AFCalc(final int nSamples, final int maxAltAlleles, final int maxAltAllelesForIndels, final int ploidy) { protected AFCalc(final int nSamples, final int maxAltAlleles, final int maxAltAllelesForIndels, final int ploidy) {
if ( nSamples < 0 ) throw new IllegalArgumentException("nSamples must be greater than zero " + nSamples); if ( nSamples < 0 ) throw new IllegalArgumentException("nSamples must be greater than zero " + nSamples);
if ( maxAltAlleles < 1 ) throw new IllegalArgumentException("maxAltAlleles must be greater than zero " + maxAltAlleles); if ( maxAltAlleles < 1 ) throw new IllegalArgumentException("maxAltAlleles must be greater than zero " + maxAltAlleles);
@ -62,13 +72,23 @@ public abstract class AFCalc implements Cloneable {
this.nSamples = nSamples; this.nSamples = nSamples;
this.maxAlternateAllelesToGenotype = maxAltAlleles; this.maxAlternateAllelesToGenotype = maxAltAlleles;
this.maxAlternateAllelesForIndels = maxAltAllelesForIndels; this.maxAlternateAllelesForIndels = maxAltAllelesForIndels;
this.resultTracker = new AFCalcResultTracker(Math.max(maxAltAlleles, maxAltAllelesForIndels)); this.stateTracker = new StateTracker(Math.max(maxAltAlleles, maxAltAllelesForIndels));
} }
/**
* Enable exact call logging to file
*
* @param exactCallsLog the destination file
*/
public void enableProcessLog(final File exactCallsLog) { public void enableProcessLog(final File exactCallsLog) {
exactCallLogger = new ExactCallLogger(exactCallsLog); exactCallLogger = new ExactCallLogger(exactCallsLog);
} }
/**
* Use this logger instead of the default logger
*
* @param logger
*/
public void setLogger(Logger logger) { public void setLogger(Logger logger) {
this.logger = logger; this.logger = logger;
} }
@ -83,10 +103,10 @@ public abstract class AFCalc implements Cloneable {
public AFCalcResult getLog10PNonRef(final VariantContext vc, final double[] log10AlleleFrequencyPriors) { public AFCalcResult getLog10PNonRef(final VariantContext vc, final double[] log10AlleleFrequencyPriors) {
if ( vc == null ) throw new IllegalArgumentException("VariantContext cannot be null"); if ( vc == null ) throw new IllegalArgumentException("VariantContext cannot be null");
if ( log10AlleleFrequencyPriors == null ) throw new IllegalArgumentException("priors vector cannot be null"); if ( log10AlleleFrequencyPriors == null ) throw new IllegalArgumentException("priors vector cannot be null");
if ( resultTracker == null ) throw new IllegalArgumentException("Results object cannot be null"); if ( stateTracker == null ) throw new IllegalArgumentException("Results object cannot be null");
// reset the result, so we can store our new result there // reset the result, so we can store our new result there
resultTracker.reset(); stateTracker.reset();
final VariantContext vcWorking = reduceScope(vc); final VariantContext vcWorking = reduceScope(vc);
@ -100,10 +120,20 @@ public abstract class AFCalc implements Cloneable {
return result; return result;
} }
@Deprecated /**
protected AFCalcResult resultFromTracker(final VariantContext vcWorking, final double[] log10AlleleFrequencyPriors) { * Convert the final state of the state tracker into our result as an AFCalcResult
resultTracker.setAllelesUsedInGenotyping(vcWorking.getAlleles()); *
return resultTracker.toAFCalcResult(log10AlleleFrequencyPriors); * Assumes that stateTracker has been updated accordingly
*
* @param vcWorking the VariantContext we actually used as input to the calc model (after reduction)
* @param log10AlleleFrequencyPriors the priors by AC vector
* @return a AFCalcResult describing the result of this calculation
*/
@Requires("stateTracker.getnEvaluations() >= 0")
@Ensures("result != null")
protected AFCalcResult getResultFromFinalState(final VariantContext vcWorking, final double[] log10AlleleFrequencyPriors) {
stateTracker.setAllelesUsedInGenotyping(vcWorking.getAlleles());
return stateTracker.toAFCalcResult(log10AlleleFrequencyPriors);
} }
// --------------------------------------------------------------------------- // ---------------------------------------------------------------------------
@ -134,11 +164,13 @@ public abstract class AFCalc implements Cloneable {
* @param log10AlleleFrequencyPriors priors * @param log10AlleleFrequencyPriors priors
* @return a AFCalcResult object describing the results of this calculation * @return a AFCalcResult object describing the results of this calculation
*/ */
// TODO -- add consistent requires among args @Requires({"vc != null", "log10AlleleFrequencyPriors != null"})
protected abstract AFCalcResult computeLog10PNonRef(final VariantContext vc, protected abstract AFCalcResult computeLog10PNonRef(final VariantContext vc,
final double[] log10AlleleFrequencyPriors); final double[] log10AlleleFrequencyPriors);
/** /**
* Subset VC to the just allelesToUse, updating genotype likelihoods
*
* Must be overridden by concrete subclasses * Must be overridden by concrete subclasses
* *
* @param vc variant context with alleles and genotype likelihoods * @param vc variant context with alleles and genotype likelihoods
@ -162,8 +194,8 @@ public abstract class AFCalc implements Cloneable {
return Math.max(maxAlternateAllelesToGenotype, maxAlternateAllelesForIndels); return Math.max(maxAlternateAllelesToGenotype, maxAlternateAllelesForIndels);
} }
public AFCalcResultTracker getResultTracker() { protected StateTracker getStateTracker() {
return resultTracker; return stateTracker;
} }
} }

View File

@ -24,15 +24,12 @@ public class AFCalcFactory {
* the needs of the request (i.e., considering ploidy). * the needs of the request (i.e., considering ploidy).
*/ */
public enum Calculation { public enum Calculation {
/** The default implementation */
EXACT(ReferenceDiploidExactAFCalc.class, 2, -1),
/** reference implementation of multi-allelic EXACT model */
EXACT_REFERENCE(ReferenceDiploidExactAFCalc.class, 2, -1),
/** expt. implementation -- for testing only */ /** expt. implementation -- for testing only */
EXACT_INDEPENDENT(IndependentAllelesDiploidExactAFCalc.class, 2, -1), EXACT_INDEPENDENT(IndependentAllelesDiploidExactAFCalc.class, 2, -1),
/** reference implementation of multi-allelic EXACT model. Extremely slow for many alternate alleles */
EXACT_REFERENCE(ReferenceDiploidExactAFCalc.class, 2, -1),
/** original biallelic exact model, for testing only */ /** original biallelic exact model, for testing only */
EXACT_ORIGINAL(OriginalDiploidExactAFCalc.class, 2, 2), EXACT_ORIGINAL(OriginalDiploidExactAFCalc.class, 2, 2),
@ -60,6 +57,8 @@ public class AFCalcFactory {
return (requiredPloidy == -1 || requiredPloidy == requestedPloidy) return (requiredPloidy == -1 || requiredPloidy == requestedPloidy)
&& (maxAltAlleles == -1 || maxAltAlleles >= requestedMaxAltAlleles); && (maxAltAlleles == -1 || maxAltAlleles >= requestedMaxAltAlleles);
} }
public static Calculation getDefaultModel() { return EXACT_INDEPENDENT; }
} }
private static final Map<String, Class<? extends AFCalc>> afClasses; private static final Map<String, Class<? extends AFCalc>> afClasses;

View File

@ -83,8 +83,8 @@ public class AFCalcResult {
if ( log10pNonRefByAllele == null ) throw new IllegalArgumentException("log10pNonRefByAllele cannot be null"); if ( log10pNonRefByAllele == null ) throw new IllegalArgumentException("log10pNonRefByAllele cannot be null");
if ( log10pNonRefByAllele.size() != allelesUsedInGenotyping.size() - 1 ) throw new IllegalArgumentException("log10pNonRefByAllele has the wrong number of elements: log10pNonRefByAllele " + log10pNonRefByAllele + " but allelesUsedInGenotyping " + allelesUsedInGenotyping); if ( log10pNonRefByAllele.size() != allelesUsedInGenotyping.size() - 1 ) throw new IllegalArgumentException("log10pNonRefByAllele has the wrong number of elements: log10pNonRefByAllele " + log10pNonRefByAllele + " but allelesUsedInGenotyping " + allelesUsedInGenotyping);
if ( ! allelesUsedInGenotyping.containsAll(log10pNonRefByAllele.keySet()) ) throw new IllegalArgumentException("log10pNonRefByAllele doesn't contain all of the alleles used in genotyping: log10pNonRefByAllele " + log10pNonRefByAllele + " but allelesUsedInGenotyping " + allelesUsedInGenotyping); if ( ! allelesUsedInGenotyping.containsAll(log10pNonRefByAllele.keySet()) ) throw new IllegalArgumentException("log10pNonRefByAllele doesn't contain all of the alleles used in genotyping: log10pNonRefByAllele " + log10pNonRefByAllele + " but allelesUsedInGenotyping " + allelesUsedInGenotyping);
if ( ! goodLog10ProbVector(log10LikelihoodsOfAC, LOG_10_ARRAY_SIZES, false) ) throw new IllegalArgumentException("log10LikelihoodsOfAC are bad " + Utils.join(",", log10LikelihoodsOfAC)); if ( ! MathUtils.goodLog10ProbVector(log10LikelihoodsOfAC, LOG_10_ARRAY_SIZES, false) ) throw new IllegalArgumentException("log10LikelihoodsOfAC are bad " + Utils.join(",", log10LikelihoodsOfAC));
if ( ! goodLog10ProbVector(log10PriorsOfAC, LOG_10_ARRAY_SIZES, true) ) throw new IllegalArgumentException("log10priors are bad " + Utils.join(",", log10PriorsOfAC)); if ( ! MathUtils.goodLog10ProbVector(log10PriorsOfAC, LOG_10_ARRAY_SIZES, true) ) throw new IllegalArgumentException("log10priors are bad " + Utils.join(",", log10PriorsOfAC));
this.alleleCountsOfMLE = alleleCountsOfMLE; this.alleleCountsOfMLE = alleleCountsOfMLE;
this.nEvaluations = nEvaluations; this.nEvaluations = nEvaluations;
@ -147,7 +147,7 @@ public class AFCalcResult {
* Due to computational / implementation constraints this may be smaller than * Due to computational / implementation constraints this may be smaller than
* the actual list of alleles requested * the actual list of alleles requested
* *
* @return a non-empty list of alleles used during genotyping * @return a non-empty list of alleles used during genotyping, the first of which is the reference allele
*/ */
@Ensures({"result != null", "! result.isEmpty()"}) @Ensures({"result != null", "! result.isEmpty()"})
public List<Allele> getAllelesUsedInGenotyping() { public List<Allele> getAllelesUsedInGenotyping() {
@ -159,7 +159,7 @@ public class AFCalcResult {
* *
* @return * @return
*/ */
@Ensures({"goodLog10Probability(result)"}) @Ensures({"MathUtils.goodLog10Probability(result)"})
public double getLog10PosteriorOfAFEq0() { public double getLog10PosteriorOfAFEq0() {
return log10PosteriorsOfAC[AF0]; return log10PosteriorsOfAC[AF0];
} }
@ -169,7 +169,7 @@ public class AFCalcResult {
* *
* @return * @return
*/ */
@Ensures({"goodLog10Probability(result)"}) @Ensures({"MathUtils.goodLog10Probability(result)"})
public double getLog10PosteriorOfAFGT0() { public double getLog10PosteriorOfAFGT0() {
return log10PosteriorsOfAC[AF1p]; return log10PosteriorsOfAC[AF1p];
} }
@ -179,7 +179,7 @@ public class AFCalcResult {
* *
* @return * @return
*/ */
@Ensures({"goodLog10Probability(result)"}) @Ensures({"MathUtils.goodLog10Probability(result)"})
public double getLog10LikelihoodOfAFEq0() { public double getLog10LikelihoodOfAFEq0() {
return log10LikelihoodsOfAC[AF0]; return log10LikelihoodsOfAC[AF0];
} }
@ -189,7 +189,7 @@ public class AFCalcResult {
* *
* @return * @return
*/ */
@Ensures({"goodLog10Probability(result)"}) @Ensures({"MathUtils.goodLog10Probability(result)"})
public double getLog10LikelihoodOfAFGT0() { public double getLog10LikelihoodOfAFGT0() {
return log10LikelihoodsOfAC[AF1p]; return log10LikelihoodsOfAC[AF1p];
} }
@ -199,7 +199,7 @@ public class AFCalcResult {
* *
* @return * @return
*/ */
@Ensures({"goodLog10Probability(result)"}) @Ensures({"MathUtils.goodLog10Probability(result)"})
public double getLog10PriorOfAFEq0() { public double getLog10PriorOfAFEq0() {
return log10PriorsOfAC[AF0]; return log10PriorsOfAC[AF0];
} }
@ -209,7 +209,7 @@ public class AFCalcResult {
* *
* @return * @return
*/ */
@Ensures({"goodLog10Probability(result)"}) @Ensures({"MathUtils.goodLog10Probability(result)"})
public double getLog10PriorOfAFGT0() { public double getLog10PriorOfAFGT0() {
return log10PriorsOfAC[AF1p]; return log10PriorsOfAC[AF1p];
} }
@ -263,7 +263,7 @@ public class AFCalcResult {
* @param allele the allele we're interested in, must be in getAllelesUsedInGenotyping * @param allele the allele we're interested in, must be in getAllelesUsedInGenotyping
* @return the log10 probability that allele is segregating at this site * @return the log10 probability that allele is segregating at this site
*/ */
@Ensures("goodLog10Probability(result)") @Ensures("MathUtils.goodLog10Probability(result)")
public double getLog10PosteriorOfAFGt0ForAllele(final Allele allele) { public double getLog10PosteriorOfAFGt0ForAllele(final Allele allele) {
final Double log10pNonRef = log10pNonRefByAllele.get(allele); final Double log10pNonRef = log10pNonRefByAllele.get(allele);
if ( log10pNonRef == null ) throw new IllegalArgumentException("Unknown allele " + allele); if ( log10pNonRef == null ) throw new IllegalArgumentException("Unknown allele " + allele);
@ -279,7 +279,7 @@ public class AFCalcResult {
* @return freshly allocated log10 normalized posteriors vector * @return freshly allocated log10 normalized posteriors vector
*/ */
@Requires("log10LikelihoodsOfAC.length == log10PriorsOfAC.length") @Requires("log10LikelihoodsOfAC.length == log10PriorsOfAC.length")
@Ensures("goodLog10ProbVector(result, LOG_10_ARRAY_SIZES, true)") @Ensures("MathUtils.goodLog10ProbVector(result, LOG_10_ARRAY_SIZES, true)")
private static double[] computePosteriors(final double[] log10LikelihoodsOfAC, final double[] log10PriorsOfAC) { private static double[] computePosteriors(final double[] log10LikelihoodsOfAC, final double[] log10PriorsOfAC) {
final double[] log10UnnormalizedPosteriors = new double[log10LikelihoodsOfAC.length]; final double[] log10UnnormalizedPosteriors = new double[log10LikelihoodsOfAC.length];
for ( int i = 0; i < log10LikelihoodsOfAC.length; i++ ) for ( int i = 0; i < log10LikelihoodsOfAC.length; i++ )
@ -287,29 +287,6 @@ public class AFCalcResult {
return MathUtils.normalizeFromLog10(log10UnnormalizedPosteriors, true, false); return MathUtils.normalizeFromLog10(log10UnnormalizedPosteriors, true, false);
} }
/**
* Check that the log10 prob vector vector is well formed
*
* @param vector
* @param expectedSize
* @param shouldSumToOne
*
* @return true if vector is well-formed, false otherwise
*/
private static boolean goodLog10ProbVector(final double[] vector, final int expectedSize, final boolean shouldSumToOne) {
if ( vector.length != expectedSize ) return false;
for ( final double pr : vector ) {
if ( ! goodLog10Probability(pr) )
return false;
}
if ( shouldSumToOne && MathUtils.compareDoubles(MathUtils.sumLog10(vector), 1.0, 1e-4) != 0 )
return false;
return true; // everything is good
}
/** /**
* Computes the offset into linear vectors indexed by alt allele for allele * Computes the offset into linear vectors indexed by alt allele for allele
* *
@ -331,14 +308,4 @@ public class AFCalcResult {
else else
return index - 1; return index - 1;
} }
/**
* Checks that the result is a well-formed log10 probability
*
* @param result a supposedly well-formed log10 probability value
* @return true if result is really well formed
*/
private static boolean goodLog10Probability(final double result) {
return result <= 0.0 && ! Double.isInfinite(result) && ! Double.isNaN(result);
}
} }

View File

@ -1,256 +0,0 @@
/*
* Copyright (c) 2010.
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc;
import com.google.java.contract.Ensures;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import java.util.Arrays;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
/**
* Created by IntelliJ IDEA.
* User: ebanks
* Date: Dec 14, 2011
*
* Useful helper class to communicate the results of the allele frequency calculation
*
* TODO -- WHAT IS THE CONTRACT ON MAP AC AND P NON REF?
*/
class AFCalcResultTracker {
protected static final double VALUE_NOT_CALCULATED = Double.NEGATIVE_INFINITY;
// These variables are intended to contain the MLE and MAP (and their corresponding allele counts) of the site over all alternate alleles
protected double log10MLE;
protected double log10MAP;
private final int[] alleleCountsOfMLE;
private final int[] alleleCountsOfMAP;
// The posteriors seen, not including that of AF=0
private static final int LIKELIHOODS_CACHE_SIZE = 5000;
private final double[] log10LikelihoodsMatrixValues = new double[LIKELIHOODS_CACHE_SIZE];
private int currentLikelihoodsCacheIndex = 0;
protected Double log10LikelihoodsMatrixSum = null;
// These variables are intended to contain the likelihood/posterior probability for the site's being monomorphic (i.e. AF=0 for all alternate alleles)
private double log10LikelihoodOfAFzero;
private double log10PosteriorOfAFzero;
private int[] AClimits;
int nEvaluations = 0;
/**
* The list of alleles actually used in computing the AF
*/
private List<Allele> allelesUsedInGenotyping = null;
/**
* Create a results object capability of storing results for calls with up to maxAltAlleles
*
* @param maxAltAlleles an integer >= 1
*/
public AFCalcResultTracker(final int maxAltAlleles) {
if ( maxAltAlleles < 1 ) throw new IllegalArgumentException("maxAltAlleles must be >= 0, saw " + maxAltAlleles);
alleleCountsOfMLE = new int[maxAltAlleles];
alleleCountsOfMAP = new int[maxAltAlleles];
reset();
}
/**
* Returns a vector with maxAltAlleles values containing AC values at the MLE
*
* The values of the ACs for this call are stored in the getAllelesUsedInGenotyping order,
* starting from index 0 (i.e., the first alt allele is at 0). The vector is always
* maxAltAlleles in length, and so only the first getAllelesUsedInGenotyping.size() - 1 values
* are meaningful.
*
* @return a vector with allele counts, not all of which may be meaningful
*/
@Ensures("result != null")
public int[] getAlleleCountsOfMLE() {
return alleleCountsOfMLE;
}
/**
* Returns a vector with maxAltAlleles values containing AC values at the MAP
*
* @see #getAlleleCountsOfMLE() for the encoding of results in this vector
*
* @return a non-null vector of ints
*/
@Ensures("result != null")
public int[] getAlleleCountsOfMAP() {
return alleleCountsOfMAP;
}
/**
* Returns the likelihoods summed across all AC values for AC > 0
*
* @return
*/
public double getLog10LikelihoodOfAFNotZero() {
if ( log10LikelihoodsMatrixSum == null ) {
if ( currentLikelihoodsCacheIndex == 0 ) // there's nothing to sum up, so make the sum equal to the smallest thing we have
log10LikelihoodsMatrixSum = MathUtils.LOG10_P_OF_ZERO;
else
log10LikelihoodsMatrixSum = MathUtils.log10sumLog10(log10LikelihoodsMatrixValues, 0, currentLikelihoodsCacheIndex);
}
return log10LikelihoodsMatrixSum;
}
public double getLog10LikelihoodOfAFNotZero(final boolean capAt0) {
return Math.min(getLog10LikelihoodOfAFNotZero(), capAt0 ? 0.0 : Double.POSITIVE_INFINITY);
}
/**
* TODO -- eric what is this supposed to return? my unit tests don't do what I think they should
*
* @return
*/
public double getLog10LikelihoodOfAFzero() {
return log10LikelihoodOfAFzero;
}
/**
* TODO -- eric what is this supposed to return? my unit tests don't do what I think they should
*
* @return
*/
public double getLog10PosteriorOfAFzero() {
return log10PosteriorOfAFzero;
}
protected AFCalcResult toAFCalcResult(final double[] log10PriorsByAC) {
final int [] subACOfMLE = Arrays.copyOf(alleleCountsOfMLE, allelesUsedInGenotyping.size() - 1);
final double[] log10Likelihoods = new double[]{getLog10LikelihoodOfAFzero(), getLog10LikelihoodOfAFNotZero(true)};
final double[] log10Priors = MathUtils.normalizeFromLog10(new double[]{log10PriorsByAC[0], MathUtils.log10sumLog10(log10PriorsByAC, 1)}, true);
// TODO -- replace with more meaningful computation
// TODO -- refactor this calculation into the ref calculation
final Map<Allele, Double> log10pNonRefByAllele = new HashMap<Allele, Double>(allelesUsedInGenotyping.size());
for ( int i = 0; i < subACOfMLE.length; i++ ) {
final Allele allele = allelesUsedInGenotyping.get(i+1);
final double log10PNonRef = getAlleleCountsOfMAP()[i] > 0 ? 0 : -10000; // TODO -- a total hack but in effect what the old behavior was
log10pNonRefByAllele.put(allele, log10PNonRef);
}
return new AFCalcResult(subACOfMLE, nEvaluations, allelesUsedInGenotyping, log10Likelihoods, log10Priors, log10pNonRefByAllele);
}
// --------------------------------------------------------------------------------
//
// Protected mutational methods only for use within the calculation models themselves
//
// --------------------------------------------------------------------------------
/**
* Reset the data in this results object, so that it can be used in a subsequent AF calculation
*
* Resetting of the data is done by the calculation model itself, so shouldn't be done by callers any longer
*/
protected void reset() {
log10MLE = log10MAP = log10LikelihoodOfAFzero = log10PosteriorOfAFzero = VALUE_NOT_CALCULATED;
for ( int i = 0; i < alleleCountsOfMLE.length; i++ ) {
alleleCountsOfMLE[i] = 0;
alleleCountsOfMAP[i] = 0;
}
currentLikelihoodsCacheIndex = 0;
log10LikelihoodsMatrixSum = null;
allelesUsedInGenotyping = null;
nEvaluations = 0;
Arrays.fill(log10LikelihoodsMatrixValues, Double.POSITIVE_INFINITY);
}
/**
* Tell this result we used one more evaluation cycle
*/
protected void incNEvaluations() {
nEvaluations++;
}
protected void updateMLEifNeeded(final double log10LofK, final int[] alleleCountsForK) {
addToLikelihoodsCache(log10LofK);
if ( log10LofK > log10MLE ) {
log10MLE = log10LofK;
for ( int i = 0; i < alleleCountsForK.length; i++ )
alleleCountsOfMLE[i] = alleleCountsForK[i];
}
}
protected void updateMAPifNeeded(final double log10LofK, final int[] alleleCountsForK) {
if ( log10LofK > log10MAP ) {
log10MAP = log10LofK;
for ( int i = 0; i < alleleCountsForK.length; i++ )
alleleCountsOfMAP[i] = alleleCountsForK[i];
}
}
private void addToLikelihoodsCache(final double log10LofK) {
// add to the cache
log10LikelihoodsMatrixValues[currentLikelihoodsCacheIndex++] = log10LofK;
// if we've filled up the cache, then condense by summing up all of the values and placing the sum back into the first cell
if ( currentLikelihoodsCacheIndex == LIKELIHOODS_CACHE_SIZE) {
final double temporarySum = MathUtils.log10sumLog10(log10LikelihoodsMatrixValues, 0, currentLikelihoodsCacheIndex);
Arrays.fill(log10LikelihoodsMatrixValues, Double.POSITIVE_INFINITY);
log10LikelihoodsMatrixValues[0] = temporarySum;
currentLikelihoodsCacheIndex = 1;
}
}
protected void setLog10LikelihoodOfAFzero(final double log10LikelihoodOfAFzero) {
this.log10LikelihoodOfAFzero = log10LikelihoodOfAFzero;
if ( log10LikelihoodOfAFzero > log10MLE ) {
log10MLE = log10LikelihoodOfAFzero;
Arrays.fill(alleleCountsOfMLE, 0);
}
}
protected void setLog10PosteriorOfAFzero(final double log10PosteriorOfAFzero) {
this.log10PosteriorOfAFzero = log10PosteriorOfAFzero;
if ( log10PosteriorOfAFzero > log10MAP ) {
log10MAP = log10PosteriorOfAFzero;
Arrays.fill(alleleCountsOfMAP, 0);
}
}
protected void setAllelesUsedInGenotyping(List<Allele> allelesUsedInGenotyping) {
if ( allelesUsedInGenotyping == null || allelesUsedInGenotyping.isEmpty() )
throw new IllegalArgumentException("allelesUsedInGenotyping cannot be null or empty");
this.allelesUsedInGenotyping = allelesUsedInGenotyping;
}
protected void setAClimits(int[] AClimits) {
this.AClimits = AClimits;
}
}

View File

@ -36,10 +36,6 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
if ( ploidy != 2 ) throw new IllegalArgumentException("ploidy must be two for DiploidExactAFCalc and subclasses but saw " + ploidy); if ( ploidy != 2 ) throw new IllegalArgumentException("ploidy must be two for DiploidExactAFCalc and subclasses but saw " + ploidy);
} }
protected StateTracker makeMaxLikelihood(VariantContext vc, AFCalcResultTracker resultTracker) {
return new StateTracker();
}
@Override @Override
protected AFCalcResult computeLog10PNonRef(final VariantContext vc, protected AFCalcResult computeLog10PNonRef(final VariantContext vc,
final double[] log10AlleleFrequencyPriors) { final double[] log10AlleleFrequencyPriors) {
@ -60,29 +56,21 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
ACqueue.add(zeroSet); ACqueue.add(zeroSet);
indexesToACset.put(zeroSet.getACcounts(), zeroSet); indexesToACset.put(zeroSet.getACcounts(), zeroSet);
// keep processing while we have AC conformations that need to be calculated
final StateTracker stateTracker = makeMaxLikelihood(vc, getResultTracker());
while ( !ACqueue.isEmpty() ) { while ( !ACqueue.isEmpty() ) {
getResultTracker().incNEvaluations(); // keep track of the number of evaluations getStateTracker().incNEvaluations(); // keep track of the number of evaluations
// compute log10Likelihoods // compute log10Likelihoods
final ExactACset set = ACqueue.remove(); final ExactACset set = ACqueue.remove();
if ( stateTracker.withinMaxACs(set.getACcounts()) ) { final double log10LofKs = calculateAlleleCountConformation(set, genotypeLikelihoods, numChr, ACqueue, indexesToACset, log10AlleleFrequencyPriors);
final double log10LofKs = calculateAlleleCountConformation(set, genotypeLikelihoods, stateTracker, numChr, ACqueue, indexesToACset, log10AlleleFrequencyPriors, getResultTracker());
// adjust max likelihood seen if needed
stateTracker.update(log10LofKs, set.getACcounts());
// clean up memory // clean up memory
indexesToACset.remove(set.getACcounts()); indexesToACset.remove(set.getACcounts());
//if ( DEBUG ) //if ( DEBUG )
// System.out.printf(" *** removing used set=%s%n", set.ACcounts); // System.out.printf(" *** removing used set=%s%n", set.ACcounts);
} }
}
return resultFromTracker(vc, log10AlleleFrequencyPriors); return getResultFromFinalState(vc, log10AlleleFrequencyPriors);
} }
@Override @Override
@ -153,23 +141,21 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
private double calculateAlleleCountConformation(final ExactACset set, private double calculateAlleleCountConformation(final ExactACset set,
final ArrayList<double[]> genotypeLikelihoods, final ArrayList<double[]> genotypeLikelihoods,
final StateTracker stateTracker,
final int numChr, final int numChr,
final LinkedList<ExactACset> ACqueue, final LinkedList<ExactACset> ACqueue,
final HashMap<ExactACcounts, ExactACset> indexesToACset, final HashMap<ExactACcounts, ExactACset> indexesToACset,
final double[] log10AlleleFrequencyPriors, final double[] log10AlleleFrequencyPriors) {
final AFCalcResultTracker resultTracker) {
//if ( DEBUG ) //if ( DEBUG )
// System.out.printf(" *** computing LofK for set=%s%n", set.ACcounts); // System.out.printf(" *** computing LofK for set=%s%n", set.ACcounts);
// compute the log10Likelihoods // compute the log10Likelihoods
computeLofK(set, genotypeLikelihoods, log10AlleleFrequencyPriors, resultTracker); computeLofK(set, genotypeLikelihoods, log10AlleleFrequencyPriors);
final double log10LofK = set.getLog10Likelihoods()[set.getLog10Likelihoods().length-1]; final double log10LofK = set.getLog10Likelihoods()[set.getLog10Likelihoods().length-1];
// can we abort early because the log10Likelihoods are so small? // can we abort early because the log10Likelihoods are so small?
if ( stateTracker.abort(log10LofK, set.getACcounts()) ) { if ( getStateTracker().abort(log10LofK, set.getACcounts(), true) ) {
//if ( DEBUG ) //if ( DEBUG )
// System.out.printf(" *** breaking early set=%s log10L=%.2f maxLog10L=%.2f%n", set.ACcounts, log10LofK, maxLog10L); // System.out.printf(" *** breaking early set=%s log10L=%.2f maxLog10L=%.2f%n", set.ACcounts, log10LofK, maxLog10L);
return log10LofK; return log10LofK;
@ -188,7 +174,7 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
ACcountsClone[allele]++; ACcountsClone[allele]++;
// to get to this conformation, a sample would need to be AB (remember that ref=0) // to get to this conformation, a sample would need to be AB (remember that ref=0)
final int PLindex = GenotypeLikelihoods.calculatePLindex(0, allele+1); final int PLindex = GenotypeLikelihoods.calculatePLindex(0, allele+1);
updateACset(stateTracker, ACcountsClone, numChr, set, PLindex, ACqueue, indexesToACset, genotypeLikelihoods); updateACset(ACcountsClone, numChr, set, PLindex, ACqueue, indexesToACset, genotypeLikelihoods);
} }
// add conformations for the k+2 case if it makes sense; note that the 2 new alleles may be the same or different // add conformations for the k+2 case if it makes sense; note that the 2 new alleles may be the same or different
@ -213,9 +199,9 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
// IMPORTANT: we must first add the cases where the 2 new alleles are different so that the queue maintains its ordering // IMPORTANT: we must first add the cases where the 2 new alleles are different so that the queue maintains its ordering
for ( DependentSet dependent : differentAlleles ) for ( DependentSet dependent : differentAlleles )
updateACset(stateTracker, dependent.ACcounts, numChr, set, dependent.PLindex, ACqueue, indexesToACset, genotypeLikelihoods); updateACset(dependent.ACcounts, numChr, set, dependent.PLindex, ACqueue, indexesToACset, genotypeLikelihoods);
for ( DependentSet dependent : sameAlleles ) for ( DependentSet dependent : sameAlleles )
updateACset(stateTracker, dependent.ACcounts, numChr, set, dependent.PLindex, ACqueue, indexesToACset, genotypeLikelihoods); updateACset(dependent.ACcounts, numChr, set, dependent.PLindex, ACqueue, indexesToACset, genotypeLikelihoods);
} }
return log10LofK; return log10LofK;
@ -223,8 +209,7 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
// adds the ExactACset represented by the ACcounts to the ACqueue if not already there (creating it if needed) and // adds the ExactACset represented by the ACcounts to the ACqueue if not already there (creating it if needed) and
// also pushes its value to the given callingSetIndex. // also pushes its value to the given callingSetIndex.
private void updateACset(final StateTracker stateTracker, private void updateACset(final int[] newSetCounts,
final int[] newSetCounts,
final int numChr, final int numChr,
final ExactACset dependentSet, final ExactACset dependentSet,
final int PLsetIndex, final int PLsetIndex,
@ -246,8 +231,7 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
private void computeLofK(final ExactACset set, private void computeLofK(final ExactACset set,
final ArrayList<double[]> genotypeLikelihoods, final ArrayList<double[]> genotypeLikelihoods,
final double[] log10AlleleFrequencyPriors, final double[] log10AlleleFrequencyPriors) {
final AFCalcResultTracker resultTracker) {
set.getLog10Likelihoods()[0] = 0.0; // the zero case set.getLog10Likelihoods()[0] = 0.0; // the zero case
final int totalK = set.getACsum(); final int totalK = set.getACsum();
@ -258,8 +242,8 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
set.getLog10Likelihoods()[j] = set.getLog10Likelihoods()[j-1] + genotypeLikelihoods.get(j)[HOM_REF_INDEX]; set.getLog10Likelihoods()[j] = set.getLog10Likelihoods()[j-1] + genotypeLikelihoods.get(j)[HOM_REF_INDEX];
final double log10Lof0 = set.getLog10Likelihoods()[set.getLog10Likelihoods().length-1]; final double log10Lof0 = set.getLog10Likelihoods()[set.getLog10Likelihoods().length-1];
resultTracker.setLog10LikelihoodOfAFzero(log10Lof0); getStateTracker().setLog10LikelihoodOfAFzero(log10Lof0);
resultTracker.setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]); getStateTracker().setLog10PosteriorOfAFzero(log10Lof0 + log10AlleleFrequencyPriors[0]);
return; return;
} }
@ -281,14 +265,15 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc {
double log10LofK = set.getLog10Likelihoods()[set.getLog10Likelihoods().length-1]; double log10LofK = set.getLog10Likelihoods()[set.getLog10Likelihoods().length-1];
// update the MLE if necessary // update the MLE if necessary
resultTracker.updateMLEifNeeded(log10LofK, set.getACcounts().getCounts()); getStateTracker().updateMLEifNeeded(log10LofK, set.getACcounts().getCounts());
// apply the priors over each alternate allele // apply the priors over each alternate allele
for ( final int ACcount : set.getACcounts().getCounts() ) { for ( final int ACcount : set.getACcounts().getCounts() ) {
if ( ACcount > 0 ) if ( ACcount > 0 )
log10LofK += log10AlleleFrequencyPriors[ACcount]; log10LofK += log10AlleleFrequencyPriors[ACcount];
} }
resultTracker.updateMAPifNeeded(log10LofK, set.getACcounts().getCounts());
getStateTracker().updateMAPifNeeded(log10LofK, set.getACcounts().getCounts());
} }
private void pushData(final ExactACset targetSet, private void pushData(final ExactACset targetSet,

View File

@ -100,7 +100,7 @@ import java.util.*;
private final static class CompareAFCalcResultsByPNonRef implements Comparator<AFCalcResult> { private final static class CompareAFCalcResultsByPNonRef implements Comparator<AFCalcResult> {
@Override @Override
public int compare(AFCalcResult o1, AFCalcResult o2) { public int compare(AFCalcResult o1, AFCalcResult o2) {
return Double.compare(o1.getLog10PosteriorOfAFGT0(), o2.getLog10PosteriorOfAFGT0()); return -1 * Double.compare(o1.getLog10PosteriorOfAFGT0(), o2.getLog10PosteriorOfAFGT0());
} }
} }
@ -285,9 +285,13 @@ import java.util.*;
// sort the results, so the most likely allele is first // sort the results, so the most likely allele is first
Collections.sort(sorted, compareAFCalcResultsByPNonRef); Collections.sort(sorted, compareAFCalcResultsByPNonRef);
double lastPosteriorGt0 = sorted.get(0).getLog10PosteriorOfAFGT0();
final double log10SingleAllelePriorOfAFGt0 = conditionalPNonRefResults.get(0).getLog10PriorOfAFGT0(); final double log10SingleAllelePriorOfAFGt0 = conditionalPNonRefResults.get(0).getLog10PriorOfAFGT0();
for ( int i = 0; i < sorted.size(); i++ ) { for ( int i = 0; i < sorted.size(); i++ ) {
if ( sorted.get(i).getLog10PosteriorOfAFGT0() > lastPosteriorGt0 )
throw new IllegalStateException("pNonRefResults not sorted: lastPosteriorGt0 " + lastPosteriorGt0 + " but current is " + sorted.get(i).getLog10PosteriorOfAFGT0());
final double log10PriorAFGt0 = (i + 1) * log10SingleAllelePriorOfAFGt0; final double log10PriorAFGt0 = (i + 1) * log10SingleAllelePriorOfAFGt0;
final double log10PriorAFEq0 = Math.log10(1 - Math.pow(10, log10PriorAFGt0)); final double log10PriorAFEq0 = Math.log10(1 - Math.pow(10, log10PriorAFGt0));
final double[] thetaTONPriors = new double[] { log10PriorAFEq0, log10PriorAFGt0 }; final double[] thetaTONPriors = new double[] { log10PriorAFEq0, log10PriorAFGt0 };
@ -303,7 +307,13 @@ import java.util.*;
/** /**
* Take the independent estimates of pNonRef for each alt allele and combine them into a single result * Take the independent estimates of pNonRef for each alt allele and combine them into a single result
* *
* TODO -- add more docs * Given n independent calculations for each of n alternate alleles create a single
* combined AFCalcResult with:
*
* priors for AF == 0 equal to theta^N for the nth least likely allele
* posteriors that reflect the combined chance that any alleles are segregating and corresponding
* likelihoods
* combined MLEs in the order of the alt alleles in vc
* *
* @param sortedResultsWithThetaNPriors the pNonRef result for each allele independently * @param sortedResultsWithThetaNPriors the pNonRef result for each allele independently
*/ */
@ -315,8 +325,9 @@ import java.util.*;
final double[] log10PriorsOfAC = new double[2]; final double[] log10PriorsOfAC = new double[2];
final Map<Allele, Double> log10pNonRefByAllele = new HashMap<Allele, Double>(nAltAlleles); final Map<Allele, Double> log10pNonRefByAllele = new HashMap<Allele, Double>(nAltAlleles);
// this value is a sum in log space // the sum of the log10 posteriors for AF == 0 and AF > 0 to determine joint probs
double log10PosteriorOfACEq0Sum = 0.0; double log10PosteriorOfACEq0Sum = 0.0;
double log10PosteriorOfACGt0Sum = 0.0;
for ( final AFCalcResult sortedResultWithThetaNPriors : sortedResultsWithThetaNPriors ) { for ( final AFCalcResult sortedResultWithThetaNPriors : sortedResultsWithThetaNPriors ) {
final Allele altAllele = sortedResultWithThetaNPriors.getAllelesUsedInGenotyping().get(1); final Allele altAllele = sortedResultWithThetaNPriors.getAllelesUsedInGenotyping().get(1);
@ -331,6 +342,7 @@ import java.util.*;
// the AF > 0 case requires us to store the normalized likelihood for later summation // the AF > 0 case requires us to store the normalized likelihood for later summation
if ( sortedResultWithThetaNPriors.getLog10PosteriorOfAFGT0() > MIN_LOG10_CONFIDENCE_TO_INCLUDE_ALLELE_IN_POSTERIOR ) if ( sortedResultWithThetaNPriors.getLog10PosteriorOfAFGT0() > MIN_LOG10_CONFIDENCE_TO_INCLUDE_ALLELE_IN_POSTERIOR )
log10PosteriorOfACEq0Sum += sortedResultWithThetaNPriors.getLog10PosteriorOfAFEq0(); log10PosteriorOfACEq0Sum += sortedResultWithThetaNPriors.getLog10PosteriorOfAFEq0();
log10PosteriorOfACGt0Sum += sortedResultWithThetaNPriors.getLog10PosteriorOfAFGT0();
// bind pNonRef for allele to the posterior value of the AF > 0 with the new adjusted prior // bind pNonRef for allele to the posterior value of the AF > 0 with the new adjusted prior
log10pNonRefByAllele.put(altAllele, sortedResultWithThetaNPriors.getLog10PosteriorOfAFGT0()); log10pNonRefByAllele.put(altAllele, sortedResultWithThetaNPriors.getLog10PosteriorOfAFGT0());
@ -342,7 +354,16 @@ import java.util.*;
// In principle, if B_p = x and C_p = y are the probabilities of being poly for alleles B and C, // In principle, if B_p = x and C_p = y are the probabilities of being poly for alleles B and C,
// the probability of being poly is (1 - B_p) * (1 - C_p) = (1 - x) * (1 - y). We want to estimate confidently // the probability of being poly is (1 - B_p) * (1 - C_p) = (1 - x) * (1 - y). We want to estimate confidently
// log10((1 - x) * (1 - y)) which is log10(1 - x) + log10(1 - y). This sum is log10PosteriorOfACEq0 // log10((1 - x) * (1 - y)) which is log10(1 - x) + log10(1 - y). This sum is log10PosteriorOfACEq0
final double log10PosteriorOfACGt0 = Math.max(Math.log10(1 - Math.pow(10, log10PosteriorOfACEq0Sum)), MathUtils.LOG10_P_OF_ZERO); //
// note we need to handle the case where the posterior of AF == 0 is 0.0, in which case we
// use the summed log10PosteriorOfACGt0Sum directly. This happens in cases where
// AF > 0 : 0.0 and AF == 0 : -16, and if you use the inverse calculation you get 0.0 and MathUtils.LOG10_P_OF_ZERO
final double log10PosteriorOfACGt0;
if ( log10PosteriorOfACEq0Sum == 0.0 )
log10PosteriorOfACGt0 = log10PosteriorOfACGt0Sum;
else
log10PosteriorOfACGt0 = Math.max(Math.log10(1 - Math.pow(10, log10PosteriorOfACEq0Sum)), MathUtils.LOG10_P_OF_ZERO);
final double[] log10LikelihoodsOfAC = new double[] { final double[] log10LikelihoodsOfAC = new double[] {
// L + prior = posterior => L = poster - prior // L + prior = posterior => L = poster - prior
log10PosteriorOfACEq0Sum - log10PriorsOfAC[0], log10PosteriorOfACEq0Sum - log10PriorsOfAC[0],
@ -350,8 +371,10 @@ import java.util.*;
}; };
return new MyAFCalcResult(alleleCountsOfMLE, nEvaluations, vc.getAlleles(), return new MyAFCalcResult(alleleCountsOfMLE, nEvaluations, vc.getAlleles(),
MathUtils.normalizeFromLog10(log10LikelihoodsOfAC, true), // necessary to ensure all values < 0 // necessary to ensure all values < 0
MathUtils.normalizeFromLog10(log10PriorsOfAC, true), // priors incorporate multiple alt alleles, must be normalized MathUtils.normalizeFromLog10(log10LikelihoodsOfAC, true),
// priors incorporate multiple alt alleles, must be normalized
MathUtils.normalizeFromLog10(log10PriorsOfAC, true),
log10pNonRefByAllele, sortedResultsWithThetaNPriors); log10pNonRefByAllele, sortedResultsWithThetaNPriors);
} }
} }

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.collections.Pair;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
@ -11,28 +12,31 @@ import java.util.Map;
/** /**
* Original bi-allelic ~O(N) implementation. Kept here for posterity and reference * Original bi-allelic ~O(N) implementation. Kept here for posterity and reference
*/ */
public class OriginalDiploidExactAFCalc extends DiploidExactAFCalc { class OriginalDiploidExactAFCalc extends DiploidExactAFCalc {
protected OriginalDiploidExactAFCalc(int nSamples, int maxAltAlleles, int maxAltAllelesForIndels, final int ploidy) { protected OriginalDiploidExactAFCalc(int nSamples, int maxAltAlleles, int maxAltAllelesForIndels, final int ploidy) {
super(nSamples, maxAltAlleles, maxAltAllelesForIndels, ploidy); super(nSamples, maxAltAlleles, maxAltAllelesForIndels, ploidy);
} }
protected StateTracker makeMaxLikelihood(final VariantContext vc, final AFCalcResultTracker resultTracker) {
return new StateTracker();
}
@Override @Override
protected AFCalcResult computeLog10PNonRef(VariantContext vc, double[] log10AlleleFrequencyPriors) { protected AFCalcResult computeLog10PNonRef(VariantContext vc, double[] log10AlleleFrequencyPriors) {
final double[] log10AlleleFrequencyLikelihoods = new double[log10AlleleFrequencyPriors.length]; final double[] log10AlleleFrequencyLikelihoods = new double[log10AlleleFrequencyPriors.length];
final double[] log10AlleleFrequencyPosteriors = new double[log10AlleleFrequencyPriors.length]; final double[] log10AlleleFrequencyPosteriors = new double[log10AlleleFrequencyPriors.length];
final int lastK = linearExact(vc, log10AlleleFrequencyPriors, log10AlleleFrequencyLikelihoods, log10AlleleFrequencyPosteriors); final Pair<Integer, Integer> result = linearExact(vc, log10AlleleFrequencyPriors, log10AlleleFrequencyLikelihoods, log10AlleleFrequencyPosteriors);
final int lastK = result.getFirst();
final int mleK = result.getSecond();
final double[] log10Likelihoods = new double[]{log10AlleleFrequencyLikelihoods[0], MathUtils.log10sumLog10(log10AlleleFrequencyLikelihoods, 1)}; final double log10LikelihoodAFGt0 = lastK == 0 ? MathUtils.LOG10_P_OF_ZERO : MathUtils.log10sumLog10(log10AlleleFrequencyLikelihoods, 1, lastK+1);
final double[] log10Likelihoods = new double[]{log10AlleleFrequencyLikelihoods[0], log10LikelihoodAFGt0};
final double[] log10Priors = new double[]{log10AlleleFrequencyPriors[0], MathUtils.log10sumLog10(log10AlleleFrequencyPriors, 1)}; final double[] log10Priors = new double[]{log10AlleleFrequencyPriors[0], MathUtils.log10sumLog10(log10AlleleFrequencyPriors, 1)};
final double[] log10Posteriors = MathUtils.vectorSum(log10Likelihoods, log10Priors);
final double pNonRef = lastK > 0 ? 0.0 : -1000.0; final double log10PNonRef = log10Posteriors[1] > log10Posteriors[0] ? 0.0 : MathUtils.LOG10_P_OF_ZERO;
final Map<Allele, Double> log10pNonRefByAllele = Collections.singletonMap(vc.getAlternateAllele(0), pNonRef); final Map<Allele, Double> log10pNonRefByAllele = Collections.singletonMap(vc.getAlternateAllele(0), log10PNonRef);
return new AFCalcResult(new int[]{lastK}, 0, vc.getAlleles(), log10Likelihoods, log10Priors, log10pNonRefByAllele); return new AFCalcResult(new int[]{mleK}, 0, vc.getAlleles(),
MathUtils.normalizeFromLog10(log10Likelihoods, true),
MathUtils.normalizeFromLog10(log10Priors, true),
log10pNonRefByAllele);
} }
/** /**
@ -72,11 +76,11 @@ public class OriginalDiploidExactAFCalc extends DiploidExactAFCalc {
} }
} }
public int linearExact(final VariantContext vc, public Pair<Integer, Integer> linearExact(final VariantContext vc,
double[] log10AlleleFrequencyPriors, double[] log10AlleleFrequencyPriors,
double[] log10AlleleFrequencyLikelihoods, double[] log10AlleleFrequencyLikelihoods,
double[] log10AlleleFrequencyPosteriors) { double[] log10AlleleFrequencyPosteriors) {
final ArrayList<double[]> genotypeLikelihoods = getGLs(vc.getGenotypes(), false); final ArrayList<double[]> genotypeLikelihoods = getGLs(vc.getGenotypes(), true);
final int numSamples = genotypeLikelihoods.size()-1; final int numSamples = genotypeLikelihoods.size()-1;
final int numChr = 2*numSamples; final int numChr = 2*numSamples;
@ -85,7 +89,7 @@ public class OriginalDiploidExactAFCalc extends DiploidExactAFCalc {
double maxLog10L = Double.NEGATIVE_INFINITY; double maxLog10L = Double.NEGATIVE_INFINITY;
boolean done = false; boolean done = false;
int lastK = -1; int lastK = -1, mleK = -1;
for (int k=0; k <= numChr && ! done; k++ ) { for (int k=0; k <= numChr && ! done; k++ ) {
final double[] kMinus0 = logY.getkMinus0(); final double[] kMinus0 = logY.getkMinus0();
@ -131,7 +135,11 @@ public class OriginalDiploidExactAFCalc extends DiploidExactAFCalc {
// can we abort early? // can we abort early?
lastK = k; lastK = k;
maxLog10L = Math.max(maxLog10L, log10LofK); if ( log10LofK > maxLog10L ) {
maxLog10L = log10LofK;
mleK = k;
}
if ( log10LofK < maxLog10L - StateTracker.MAX_LOG10_ERROR_TO_STOP_EARLY ) { if ( log10LofK < maxLog10L - StateTracker.MAX_LOG10_ERROR_TO_STOP_EARLY ) {
//if ( DEBUG ) System.out.printf(" *** breaking early k=%d log10L=%.2f maxLog10L=%.2f%n", k, log10LofK, maxLog10L); //if ( DEBUG ) System.out.printf(" *** breaking early k=%d log10L=%.2f maxLog10L=%.2f%n", k, log10LofK, maxLog10L);
done = true; done = true;
@ -140,6 +148,6 @@ public class OriginalDiploidExactAFCalc extends DiploidExactAFCalc {
logY.rotate(); logY.rotate();
} }
return lastK; return new Pair<Integer, Integer>(lastK, mleK);
} }
} }

View File

@ -1,35 +1,85 @@
package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele;
import java.util.Arrays;
import java.util.HashMap;
import java.util.List;
import java.util.Map;
/** /**
* Keeps track of the best state seen by the exact model and the max states to visit * Keeps track of the state information during the exact model AF calculation.
* allowing us to abort the search before we visit the entire matrix of AC x samples *
* Tracks things like the MLE and MAP AC values, their corresponding likelhood and posterior
* values, the likelihood of the AF == 0 state, and the number of evaluations needed
* by the calculation to compute the P(AF == 0)
*/ */
final class StateTracker { final class StateTracker {
public final static double MAX_LOG10_ERROR_TO_STOP_EARLY = 6; // we want the calculation to be accurate to 1 / 10^6 protected static final double VALUE_NOT_CALCULATED = Double.NEGATIVE_INFINITY;
protected final static double MAX_LOG10_ERROR_TO_STOP_EARLY = 6; // we want the calculation to be accurate to 1 / 10^6
final private int[] maxACsToConsider;
private ExactACcounts ACsAtMax = null;
private double maxLog10L = Double.NEGATIVE_INFINITY;
public StateTracker() {
this(null);
}
public StateTracker(final int[] maxACsToConsider) {
this.maxACsToConsider = maxACsToConsider;
}
/** /**
* Update the maximum log10L seen, if log10LofKs is higher, and the corresponding ACs of this state * These variables are intended to contain the MLE and MAP (and their corresponding allele counts)
* * of the site over all alternate alleles
* @param log10LofKs the likelihood of our current configuration state
*/ */
public void update(final double log10LofKs, final ExactACcounts ACs) { protected double log10MLE;
if ( log10LofKs > getMaxLog10L()) { protected double log10MAP;
this.setMaxLog10L(log10LofKs);
this.ACsAtMax = ACs; /**
} * Returns a vector with maxAltAlleles values containing AC values at the MLE
*
* The values of the ACs for this call are stored in the getAllelesUsedInGenotyping order,
* starting from index 0 (i.e., the first alt allele is at 0). The vector is always
* maxAltAlleles in length, and so only the first getAllelesUsedInGenotyping.size() - 1 values
* are meaningful.
*/
private final int[] alleleCountsOfMLE;
private final int[] alleleCountsOfMAP;
/**
* A vector of log10 likelihood values seen, for future summation. When the size of the
* vector is exceeed -- because we've pushed more posteriors than there's space to hold
* -- we simply sum up the existing values, make that the first value, and continue.
*/
private final double[] log10LikelihoodsForAFGt0 = new double[LIKELIHOODS_CACHE_SIZE];
private static final int LIKELIHOODS_CACHE_SIZE = 5000;
private int log10LikelihoodsForAFGt0CacheIndex = 0;
/**
* The actual sum of the likelihoods. Null if the sum hasn't been computed yet
*/
protected Double log10LikelihoodsForAFGt0Sum = null;
/**
* Contains the likelihood for the site's being monomorphic (i.e. AF=0 for all alternate alleles)
*/
private double log10LikelihoodOfAFzero = 0.0;
/**
* The number of evaluates we've gone through in the AFCalc
*/
private int nEvaluations = 0;
/**
* The list of alleles actually used in computing the AF
*/
private List<Allele> allelesUsedInGenotyping = null;
/**
* Create a results object capability of storing results for calls with up to maxAltAlleles
*
* @param maxAltAlleles an integer >= 1
*/
public StateTracker(final int maxAltAlleles) {
if ( maxAltAlleles < 1 ) throw new IllegalArgumentException("maxAltAlleles must be >= 0, saw " + maxAltAlleles);
alleleCountsOfMLE = new int[maxAltAlleles];
alleleCountsOfMAP = new int[maxAltAlleles];
reset();
} }
/** /**
@ -39,58 +89,194 @@ final class StateTracker {
* @param log10LofK the log10 likelihood of the configuration we're considering analyzing * @param log10LofK the log10 likelihood of the configuration we're considering analyzing
* @return true if the configuration cannot meaningfully contribute to our likelihood sum * @return true if the configuration cannot meaningfully contribute to our likelihood sum
*/ */
public boolean tooLowLikelihood(final double log10LofK) { private boolean tooLowLikelihood(final double log10LofK) {
return log10LofK < getMaxLog10L() - MAX_LOG10_ERROR_TO_STOP_EARLY; return log10LofK < log10MLE - MAX_LOG10_ERROR_TO_STOP_EARLY;
} }
/** /**
* Are all ACs in otherACs less than or equal to their corresponding ACs in the maxACsToConsider? * @return true iff all ACs in this object are less than or equal to their corresponding ACs in the provided set
*/
private boolean isLowerAC(final ExactACcounts otherACs) {
final int[] otherACcounts = otherACs.getCounts();
for ( int i = 0; i < otherACcounts.length; i++ ) {
if ( alleleCountsOfMLE[i] > otherACcounts[i] )
return false;
}
return true;
}
/**
* Should we stop exploring paths from ACs, given it's log10LofK
* *
* @param otherACs the set of otherACs that we want to know if we should consider analyzing * @param log10LofK the log10LofK of these ACs
* @return true if otherACs is a state worth considering, or false otherwise * @param ACs the ACs of this state
* @return return true if there's no reason to continue with subpaths of AC, or false otherwise
*/ */
public boolean withinMaxACs(final ExactACcounts otherACs) { protected boolean abort( final double log10LofK, final ExactACcounts ACs, final boolean enforceLowerACs ) {
if ( maxACsToConsider == null ) return tooLowLikelihood(log10LofK) && (!enforceLowerACs || isLowerAC(ACs));
return true;
final int[] otherACcounts = otherACs.getCounts();
for ( int i = 0; i < maxACsToConsider.length; i++ ) {
// consider one more than the max AC to collect a bit more likelihood mass
if ( otherACcounts[i] > maxACsToConsider[i] + 1 )
return false;
} }
return true; @Ensures("result != null")
protected int[] getAlleleCountsOfMAP() {
return alleleCountsOfMAP;
}
@Ensures("result >= 0")
protected int getnEvaluations() {
return nEvaluations;
} }
/** /**
* returns true iff all ACs in this object are less than or equal to their corresponding ACs in the provided set * @return the likelihoods summed across all AC values for AC > 0
*/ */
public boolean isLowerAC(final ExactACcounts otherACs) { private double getLog10LikelihoodOfAFNotZero() {
if ( ACsAtMax == null ) if ( log10LikelihoodsForAFGt0Sum == null ) {
return true; if ( log10LikelihoodsForAFGt0CacheIndex == 0 ) // there's nothing to sum up, so make the sum equal to the smallest thing we have
log10LikelihoodsForAFGt0Sum = MathUtils.LOG10_P_OF_ZERO;
final int[] myACcounts = this.ACsAtMax.getCounts(); else
final int[] otherACcounts = otherACs.getCounts(); log10LikelihoodsForAFGt0Sum = MathUtils.log10sumLog10(log10LikelihoodsForAFGt0, 0, log10LikelihoodsForAFGt0CacheIndex);
}
for ( int i = 0; i < myACcounts.length; i++ ) { return log10LikelihoodsForAFGt0Sum;
if ( myACcounts[i] > otherACcounts[i] )
return false;
} }
return true; /**
* @return the log10 likelihood of AF == 0
*/
private double getLog10LikelihoodOfAFzero() {
return log10LikelihoodOfAFzero;
} }
public boolean abort( final double log10LofK, final ExactACcounts ACs ) { /**
return tooLowLikelihood(log10LofK) && isLowerAC(ACs); * Convert this state to an corresponding AFCalcResult.
*
* Assumes that the values in this state have been filled in with meaningful values during the calculation.
* For example, that the allelesUsedInGenotyping has been set, that the alleleCountsOfMLE contains meaningful
* values, etc.
*
* @param log10PriorsByAC the priors by AC
*
* @return an AFCalcResult summarizing the final results of this calculation
*/
@Requires("allelesUsedInGenotyping != null")
protected AFCalcResult toAFCalcResult(final double[] log10PriorsByAC) {
final int [] subACOfMLE = Arrays.copyOf(alleleCountsOfMLE, allelesUsedInGenotyping.size() - 1);
final double[] log10Likelihoods = MathUtils.normalizeFromLog10(new double[]{getLog10LikelihoodOfAFzero(), getLog10LikelihoodOfAFNotZero()}, true);
final double[] log10Priors = MathUtils.normalizeFromLog10(new double[]{log10PriorsByAC[0], MathUtils.log10sumLog10(log10PriorsByAC, 1)}, true);
final Map<Allele, Double> log10pNonRefByAllele = new HashMap<Allele, Double>(allelesUsedInGenotyping.size());
for ( int i = 0; i < subACOfMLE.length; i++ ) {
final Allele allele = allelesUsedInGenotyping.get(i+1);
final double log10PNonRef = alleleCountsOfMAP[i] > 0 ? 0 : -10000; // TODO -- a total hack but in effect what the old behavior was
log10pNonRefByAllele.put(allele, log10PNonRef);
} }
public double getMaxLog10L() { return new AFCalcResult(subACOfMLE, nEvaluations, allelesUsedInGenotyping, log10Likelihoods, log10Priors, log10pNonRefByAllele);
return maxLog10L;
} }
public void setMaxLog10L(double maxLog10L) { // --------------------------------------------------------------------------------
this.maxLog10L = maxLog10L; //
// Protected mutational methods only for use within the calculation models themselves
//
// --------------------------------------------------------------------------------
/**
* Reset the data in this results object, so that it can be used in a subsequent AF calculation
*
* Resetting of the data is done by the calculation model itself, so shouldn't be done by callers any longer
*/
protected void reset() {
log10MLE = log10MAP = log10LikelihoodOfAFzero = VALUE_NOT_CALCULATED;
log10LikelihoodsForAFGt0CacheIndex = 0;
log10LikelihoodsForAFGt0Sum = null;
allelesUsedInGenotyping = null;
nEvaluations = 0;
Arrays.fill(alleleCountsOfMLE, 0);
Arrays.fill(alleleCountsOfMAP, 0);
Arrays.fill(log10LikelihoodsForAFGt0, Double.POSITIVE_INFINITY);
}
/**
* Tell this result we used one more evaluation cycle
*/
protected void incNEvaluations() {
nEvaluations++;
}
/**
* Update the maximum log10 likelihoods seen, if log10LofKs is higher, and the corresponding ACs of this state
*
* @param log10LofK the likelihood of our current configuration state, cannot be the 0 state
* @param alleleCountsForK the allele counts for this state
*/
@Requires({"alleleCountsForK != null", "MathUtils.sum(alleleCountsForK) >= 0"})
@Ensures("log10MLE == Math.max(log10LofK, log10MLE)")
protected void updateMLEifNeeded(final double log10LofK, final int[] alleleCountsForK) {
addToLikelihoodsCache(log10LofK);
if ( log10LofK > log10MLE ) {
log10MLE = log10LofK;
System.arraycopy(alleleCountsForK, 0, alleleCountsOfMLE, 0, alleleCountsForK.length);
}
}
/**
* Update the maximum log10 posterior seen, if log10PofKs is higher, and the corresponding ACs of this state
*
* @param log10PofK the posterior of our current configuration state
* @param alleleCountsForK the allele counts for this state
*/
@Requires({"alleleCountsForK != null", "MathUtils.sum(alleleCountsForK) >= 0"})
@Ensures("log10MAP == Math.max(log10PofK, log10MAP)")
protected void updateMAPifNeeded(final double log10PofK, final int[] alleleCountsForK) {
if ( log10PofK > log10MAP ) {
log10MAP = log10PofK;
System.arraycopy(alleleCountsForK, 0, alleleCountsOfMAP, 0, alleleCountsForK.length);
}
}
private void addToLikelihoodsCache(final double log10LofK) {
// add to the cache
log10LikelihoodsForAFGt0[log10LikelihoodsForAFGt0CacheIndex++] = log10LofK;
// if we've filled up the cache, then condense by summing up all of the values and placing the sum back into the first cell
if ( log10LikelihoodsForAFGt0CacheIndex == LIKELIHOODS_CACHE_SIZE) {
final double temporarySum = MathUtils.log10sumLog10(log10LikelihoodsForAFGt0, 0, log10LikelihoodsForAFGt0CacheIndex);
Arrays.fill(log10LikelihoodsForAFGt0, Double.POSITIVE_INFINITY);
log10LikelihoodsForAFGt0[0] = temporarySum;
log10LikelihoodsForAFGt0CacheIndex = 1;
}
}
protected void setLog10LikelihoodOfAFzero(final double log10LikelihoodOfAFzero) {
this.log10LikelihoodOfAFzero = log10LikelihoodOfAFzero;
if ( log10LikelihoodOfAFzero > log10MLE ) {
log10MLE = log10LikelihoodOfAFzero;
Arrays.fill(alleleCountsOfMLE, 0);
}
}
@Requires({"MathUtils.goodLog10Probability(log10PosteriorOfAFzero)"})
protected void setLog10PosteriorOfAFzero(final double log10PosteriorOfAFzero) {
if ( log10PosteriorOfAFzero > log10MAP ) {
log10MAP = log10PosteriorOfAFzero;
Arrays.fill(alleleCountsOfMAP, 0);
}
}
/**
* Set the list of alleles used in genotyping
*
* @param allelesUsedInGenotyping the list of alleles, where the first allele is reference
*/
@Requires({"allelesUsedInGenotyping != null", "allelesUsedInGenotyping.size() > 1"})
protected void setAllelesUsedInGenotyping(List<Allele> allelesUsedInGenotyping) {
if ( allelesUsedInGenotyping == null || allelesUsedInGenotyping.isEmpty() )
throw new IllegalArgumentException("allelesUsedInGenotyping cannot be null or empty");
if ( allelesUsedInGenotyping.get(0).isNonReference() )
throw new IllegalArgumentException("The first element of allelesUsedInGenotyping must be the reference allele");
this.allelesUsedInGenotyping = allelesUsedInGenotyping;
} }
} }

View File

@ -30,8 +30,11 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.walkers.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.sting.gatk.walkers.genotyper.PerReadAlleleLikelihoodMap;
import org.broadinstitute.sting.utils.Haplotype; import org.broadinstitute.sting.utils.Haplotype;
import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.PairHMM;
import org.broadinstitute.sting.utils.clipping.ReadClipper; import org.broadinstitute.sting.utils.clipping.ReadClipper;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.pairhmm.ExactPairHMM;
import org.broadinstitute.sting.utils.pairhmm.OriginalPairHMM;
import org.broadinstitute.sting.utils.pairhmm.PairHMM;
import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord; import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
@ -48,7 +51,6 @@ public class PairHMMIndelErrorModel {
public static final int BASE_QUAL_THRESHOLD = 20; public static final int BASE_QUAL_THRESHOLD = 20;
private boolean DEBUG = false; private boolean DEBUG = false;
private boolean bandedLikelihoods = false;
private static final int MAX_CACHED_QUAL = 127; private static final int MAX_CACHED_QUAL = 127;
@ -67,6 +69,8 @@ public class PairHMMIndelErrorModel {
private final byte[] GAP_OPEN_PROB_TABLE; private final byte[] GAP_OPEN_PROB_TABLE;
private final byte[] GAP_CONT_PROB_TABLE; private final byte[] GAP_CONT_PROB_TABLE;
private final PairHMM pairHMM;
///////////////////////////// /////////////////////////////
// Private Member Variables // Private Member Variables
///////////////////////////// /////////////////////////////
@ -85,15 +89,26 @@ public class PairHMMIndelErrorModel {
} }
} }
public PairHMMIndelErrorModel(byte indelGOP, byte indelGCP, boolean deb, boolean bandedLikelihoods) { public PairHMMIndelErrorModel(byte indelGOP, byte indelGCP, boolean deb, final PairHMM.HMM_IMPLEMENTATION hmmType ) {
this.DEBUG = deb; this.DEBUG = deb;
this.bandedLikelihoods = bandedLikelihoods;
switch (hmmType) {
case EXACT:
pairHMM = new ExactPairHMM();
break;
case ORIGINAL:
pairHMM = new OriginalPairHMM();
break;
case CACHING:
case LOGLESS_CACHING:
default:
throw new UserException.BadArgumentValue("pairHMM", "Specified pairHMM implementation is unrecognized or incompatible with the UnifiedGenotyper. Acceptable options are ORIGINAL and EXACT.");
}
// fill gap penalty table, affine naive model: // fill gap penalty table, affine naive model:
this.GAP_CONT_PROB_TABLE = new byte[MAX_HRUN_GAP_IDX]; this.GAP_CONT_PROB_TABLE = new byte[MAX_HRUN_GAP_IDX];
this.GAP_OPEN_PROB_TABLE = new byte[MAX_HRUN_GAP_IDX]; this.GAP_OPEN_PROB_TABLE = new byte[MAX_HRUN_GAP_IDX];
for (int i = 0; i < START_HRUN_GAP_IDX; i++) { for (int i = 0; i < START_HRUN_GAP_IDX; i++) {
GAP_OPEN_PROB_TABLE[i] = indelGOP; GAP_OPEN_PROB_TABLE[i] = indelGOP;
GAP_CONT_PROB_TABLE[i] = indelGCP; GAP_CONT_PROB_TABLE[i] = indelGCP;
@ -190,7 +205,6 @@ public class PairHMMIndelErrorModel {
final PerReadAlleleLikelihoodMap perReadAlleleLikelihoodMap, final PerReadAlleleLikelihoodMap perReadAlleleLikelihoodMap,
final int[] readCounts) { final int[] readCounts) {
final double readLikelihoods[][] = new double[pileup.getNumberOfElements()][haplotypeMap.size()]; final double readLikelihoods[][] = new double[pileup.getNumberOfElements()][haplotypeMap.size()];
final PairHMM pairHMM = new PairHMM(bandedLikelihoods);
int readIdx=0; int readIdx=0;
for (PileupElement p: pileup) { for (PileupElement p: pileup) {
@ -303,8 +317,6 @@ public class PairHMMIndelErrorModel {
final byte[] readQuals = Arrays.copyOfRange(unclippedReadQuals,numStartSoftClippedBases, unclippedReadBases.length-numEndSoftClippedBases); final byte[] readQuals = Arrays.copyOfRange(unclippedReadQuals,numStartSoftClippedBases, unclippedReadBases.length-numEndSoftClippedBases);
int j=0; int j=0;
// initialize path metric and traceback memories for likelihood computation
double[][] matchMetricArray = null, XMetricArray = null, YMetricArray = null;
byte[] previousHaplotypeSeen = null; byte[] previousHaplotypeSeen = null;
final byte[] contextLogGapOpenProbabilities = new byte[readBases.length]; final byte[] contextLogGapOpenProbabilities = new byte[readBases.length];
final byte[] contextLogGapContinuationProbabilities = new byte[readBases.length]; final byte[] contextLogGapContinuationProbabilities = new byte[readBases.length];
@ -341,14 +353,9 @@ public class PairHMMIndelErrorModel {
final int X_METRIC_LENGTH = readBases.length+2; final int X_METRIC_LENGTH = readBases.length+2;
final int Y_METRIC_LENGTH = haplotypeBases.length+2; final int Y_METRIC_LENGTH = haplotypeBases.length+2;
if (matchMetricArray == null) { if (previousHaplotypeSeen == null) {
//no need to reallocate arrays for each new haplotype, as length won't change //no need to reallocate arrays for each new haplotype, as length won't change
matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH]; pairHMM.initialize(X_METRIC_LENGTH, Y_METRIC_LENGTH);
XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
PairHMM.initializeArrays(matchMetricArray, XMetricArray, YMetricArray, X_METRIC_LENGTH);
} }
int startIndexInHaplotype = 0; int startIndexInHaplotype = 0;
@ -356,11 +363,10 @@ public class PairHMMIndelErrorModel {
startIndexInHaplotype = computeFirstDifferingPosition(haplotypeBases, previousHaplotypeSeen); startIndexInHaplotype = computeFirstDifferingPosition(haplotypeBases, previousHaplotypeSeen);
previousHaplotypeSeen = haplotypeBases.clone(); previousHaplotypeSeen = haplotypeBases.clone();
readLikelihood = pairHMM.computeReadLikelihoodGivenHaplotype(haplotypeBases, readBases, readQuals, readLikelihood = pairHMM.computeReadLikelihoodGivenHaplotypeLog10(haplotypeBases, readBases, readQuals,
(read.hasBaseIndelQualities() ? read.getBaseInsertionQualities() : contextLogGapOpenProbabilities), (read.hasBaseIndelQualities() ? read.getBaseInsertionQualities() : contextLogGapOpenProbabilities),
(read.hasBaseIndelQualities() ? read.getBaseDeletionQualities() : contextLogGapOpenProbabilities), (read.hasBaseIndelQualities() ? read.getBaseDeletionQualities() : contextLogGapOpenProbabilities),
contextLogGapContinuationProbabilities, contextLogGapContinuationProbabilities, startIndexInHaplotype, false);
startIndexInHaplotype, matchMetricArray, XMetricArray, YMetricArray);
if (DEBUG) { if (DEBUG) {

View File

@ -33,7 +33,6 @@ import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
* java -Xmx2g -jar GenomeAnalysisTK.jar \ * java -Xmx2g -jar GenomeAnalysisTK.jar \
* -R ref.fasta \ * -R ref.fasta \
* -T CountReads \ * -T CountReads \
* -o output.txt \
* -I input.bam \ * -I input.bam \
* [-L input.intervals] * [-L input.intervals]
* </pre> * </pre>

View File

@ -48,6 +48,9 @@ public class GLBasedSampleSelector extends SampleSelector {
// first subset to the samples // first subset to the samples
VariantContext subContext = vc.subContextFromSamples(samples); VariantContext subContext = vc.subContextFromSamples(samples);
if ( ! subContext.isPolymorphicInSamples() )
return false;
// now check to see (using EXACT model) whether this should be variant // now check to see (using EXACT model) whether this should be variant
// do we want to apply a prior? maybe user-spec? // do we want to apply a prior? maybe user-spec?
if ( flatPriors == null ) { if ( flatPriors == null ) {

View File

@ -34,6 +34,7 @@ import org.broadinstitute.sting.utils.sam.ReadUtils;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import java.io.Serializable;
import java.util.*; import java.util.*;
public class Haplotype { public class Haplotype {
@ -184,6 +185,21 @@ public class Haplotype {
return new Haplotype(newHaplotypeBases); return new Haplotype(newHaplotypeBases);
} }
public static class HaplotypeBaseComparator implements Comparator<Haplotype>, Serializable {
@Override
public int compare( final Haplotype hap1, final Haplotype hap2 ) {
final byte[] arr1 = hap1.getBases();
final byte[] arr2 = hap2.getBases();
// compares byte arrays using lexical ordering
final int len = Math.min(arr1.length, arr2.length);
for( int iii = 0; iii < len; iii++ ) {
final int cmp = arr1[iii] - arr2[iii];
if (cmp != 0) { return cmp; }
}
return arr2.length - arr1.length;
}
}
public static LinkedHashMap<Allele,Haplotype> makeHaplotypeListFromAlleles(final List<Allele> alleleList, public static LinkedHashMap<Allele,Haplotype> makeHaplotypeListFromAlleles(final List<Allele> alleleList,
final int startPos, final int startPos,
final ReferenceContext ref, final ReferenceContext ref,

View File

@ -1194,6 +1194,39 @@ public class MathUtils {
return getQScoreOrderStatistic(reads, offsets, (int) Math.floor(reads.size() / 2.)); return getQScoreOrderStatistic(reads, offsets, (int) Math.floor(reads.size() / 2.));
} }
/**
* Check that the log10 prob vector vector is well formed
*
* @param vector
* @param expectedSize
* @param shouldSumToOne
*
* @return true if vector is well-formed, false otherwise
*/
public static boolean goodLog10ProbVector(final double[] vector, final int expectedSize, final boolean shouldSumToOne) {
if ( vector.length != expectedSize ) return false;
for ( final double pr : vector ) {
if ( ! goodLog10Probability(pr) )
return false;
}
if ( shouldSumToOne && compareDoubles(sumLog10(vector), 1.0, 1e-4) != 0 )
return false;
return true; // everything is good
}
/**
* Checks that the result is a well-formed log10 probability
*
* @param result a supposedly well-formed log10 probability value
* @return true if result is really well formed
*/
public static boolean goodLog10Probability(final double result) {
return result <= 0.0 && ! Double.isInfinite(result) && ! Double.isNaN(result);
}
/** /**
* A utility class that computes on the fly average and standard deviation for a stream of numbers. * A utility class that computes on the fly average and standard deviation for a stream of numbers.
* The number of observations does not have to be known in advance, and can be also very big (so that * The number of observations does not have to be known in advance, and can be also very big (so that

View File

@ -1,259 +0,0 @@
/*
* Copyright (c) 2012, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.utils;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import java.util.*;
/**
* Util class for performing the pair HMM for local alignment. Figure 4.3 in Durbin 1998 book.
* User: rpoplin
* Date: 3/1/12
*/
public class PairHMM {
private static final Byte MAX_CACHED_QUAL = Byte.MAX_VALUE;
private static final byte DEFAULT_GOP = (byte) 45;
private static final byte DEFAULT_GCP = (byte) 10;
private static final double BANDING_TOLERANCE = 22.0;
private static final int BANDING_CLUSTER_WINDOW = 12;
private final boolean noBanded;
public PairHMM() {
noBanded = false;
}
public PairHMM( final boolean noBanded ) {
this.noBanded = noBanded;
}
public static void initializeArrays(final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray,
final int X_METRIC_LENGTH) {
for( int iii=0; iii < X_METRIC_LENGTH; iii++ ) {
Arrays.fill(matchMetricArray[iii], Double.NEGATIVE_INFINITY);
Arrays.fill(XMetricArray[iii], Double.NEGATIVE_INFINITY);
Arrays.fill(YMetricArray[iii], Double.NEGATIVE_INFINITY);
}
// the initial condition
matchMetricArray[1][1] = 0.0; // Math.log10(1.0);
}
@Requires({"readBases.length == readQuals.length","readBases.length == insertionGOP.length","readBases.length == deletionGOP.length","readBases.length == overallGCP.length"})
@Ensures({"!Double.isInfinite(result)", "!Double.isNaN(result)"}) // Result should be a proper log10 probability
public double computeReadLikelihoodGivenHaplotype( final byte[] haplotypeBases, final byte[] readBases, final byte[] readQuals,
final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
final int Y_METRIC_LENGTH = haplotypeBases.length + 2;
// initial arrays to hold the probabilities of being in the match, insertion and deletion cases
final double[][] matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
final double[][] XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
final double[][] YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
initializeArrays(matchMetricArray, XMetricArray, YMetricArray, X_METRIC_LENGTH);
return computeReadLikelihoodGivenHaplotype(haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP, 0, matchMetricArray, XMetricArray, YMetricArray);
}
@Requires({"readBases.length == readQuals.length","readBases.length == insertionGOP.length","readBases.length == deletionGOP.length","readBases.length == overallGCP.length"})
@Ensures({"!Double.isInfinite(result)", "!Double.isNaN(result)"}) // Result should be a proper log10 probability
public double computeReadLikelihoodGivenHaplotype( final byte[] haplotypeBases, final byte[] readBases, final byte[] readQuals,
final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP, final int hapStartIndex,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
final int Y_METRIC_LENGTH = haplotypeBases.length + 2;
// ensure that all the qual scores have valid values
for( int iii = 0; iii < readQuals.length; iii++ ) {
readQuals[iii] = ( readQuals[iii] < QualityUtils.MIN_USABLE_Q_SCORE ? QualityUtils.MIN_USABLE_Q_SCORE : (readQuals[iii] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : readQuals[iii]) );
}
if( false ) {
final ArrayList<Integer> workQueue = new ArrayList<Integer>(); // holds a queue of starting work location (indices along the diagonal). Will be sorted each step
final ArrayList<Integer> workToBeAdded = new ArrayList<Integer>();
final ArrayList<Double> calculatedValues = new ArrayList<Double>();
final int numDiags = X_METRIC_LENGTH + Y_METRIC_LENGTH - 1;
workQueue.add( 1 ); // Always start a new thread at the baseline because of partially repeating sequences that match better in the latter half of the haplotype
for(int diag = 3; diag < numDiags; diag++) { // diag = 3 is the (1,2) element of the metric arrays. (1,1) is the initial condition and is purposefully skipped over
//Collections.sort(workQueue); // no need to sort because elements are guaranteed to be in ascending order
int el = 1;
for( int work : workQueue ) {
// choose the appropriate diagonal baseline location
int iii = 0;
int jjj = diag;
if( diag > Y_METRIC_LENGTH ) {
iii = diag - Y_METRIC_LENGTH;
jjj = Y_METRIC_LENGTH;
}
// move to the starting work location along the diagonal
iii += work;
jjj -= work;
while( iii >= X_METRIC_LENGTH || jjj <= 0 ) {
iii--;
jjj++;
work--;
}
if( !detectClusteredStartLocations(workToBeAdded, work ) ) {
workToBeAdded.add(work); // keep this thread going once it has started
}
if( work >= el - 3 ) {
// step along the diagonal in the forward direction, updating the match matrices and looking for a drop off from the maximum observed value
double maxElement = Double.NEGATIVE_INFINITY;
for( el = work; el < numDiags + 1; el++ ) {
updateCell(iii, jjj, haplotypeBases, readBases, readQuals,
insertionGOP, deletionGOP, overallGCP, matchMetricArray, XMetricArray, YMetricArray);
final double bestMetric = MathUtils.max(matchMetricArray[iii][jjj], XMetricArray[iii][jjj], YMetricArray[iii][jjj]);
calculatedValues.add(bestMetric);
if( bestMetric > maxElement ) {
maxElement = bestMetric;
} else if( maxElement - bestMetric > BANDING_TOLERANCE ) {
break;
}
if( ++iii >= X_METRIC_LENGTH ) { // don't walk off the edge of the matrix
break;
}
if( --jjj <= 0 ) { // don't walk off the edge of the matrix
break;
}
}
// find a local maximum to start a new band in the work queue
double localMaxElement = Double.NEGATIVE_INFINITY;
int localMaxElementIndex = 0;
for(int kkk = calculatedValues.size()-1; kkk >= 1; kkk--) {
final double bestMetric = calculatedValues.get(kkk);
if( bestMetric > localMaxElement ) {
localMaxElement = bestMetric;
localMaxElementIndex = kkk;
} else if( localMaxElement - bestMetric > BANDING_TOLERANCE * 0.5 ) { // find a local maximum
if( !detectClusteredStartLocations(workToBeAdded, work + localMaxElementIndex ) ) {
workToBeAdded.add( work + localMaxElementIndex );
}
break;
}
}
calculatedValues.clear();
// reset iii and jjj to the appropriate diagonal baseline location
iii = 0;
jjj = diag;
if( diag > Y_METRIC_LENGTH ) {
iii = diag - Y_METRIC_LENGTH;
jjj = Y_METRIC_LENGTH;
}
// move to the starting work location along the diagonal
iii += work-1;
jjj -= work-1;
// step along the diagonal in the reverse direction, updating the match matrices and looking for a drop off from the maximum observed value
for( int traceBack = work - 1; traceBack > 0 && iii > 0 && jjj < Y_METRIC_LENGTH; traceBack--,iii--,jjj++ ) {
updateCell(iii, jjj, haplotypeBases, readBases, readQuals,
insertionGOP, deletionGOP, overallGCP, matchMetricArray, XMetricArray, YMetricArray);
final double bestMetric = MathUtils.max(matchMetricArray[iii][jjj], XMetricArray[iii][jjj], YMetricArray[iii][jjj]);
if( bestMetric > maxElement ) {
maxElement = bestMetric;
} else if( maxElement - bestMetric > BANDING_TOLERANCE ) {
break;
}
}
}
}
workQueue.clear();
workQueue.addAll(workToBeAdded);
workToBeAdded.clear();
}
} else {
// simple rectangular version of update loop, slow
for( int iii = 1; iii < X_METRIC_LENGTH; iii++ ) {
for( int jjj = hapStartIndex + 1; jjj < Y_METRIC_LENGTH; jjj++ ) {
if( (iii == 1 && jjj == 1) ) { continue; }
updateCell(iii, jjj, haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP,
matchMetricArray, XMetricArray, YMetricArray);
}
}
}
// final probability is the log10 sum of the last element in all three state arrays
final int endI = X_METRIC_LENGTH - 1;
final int endJ = Y_METRIC_LENGTH - 1;
return MathUtils.approximateLog10SumLog10(matchMetricArray[endI][endJ], XMetricArray[endI][endJ], YMetricArray[endI][endJ]);
}
private void updateCell( final int indI, final int indJ, final byte[] haplotypeBases, final byte[] readBases,
final byte[] readQuals, final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
// the read and haplotype indices are offset by one because the state arrays have an extra column to hold the initial conditions
final int im1 = indI - 1;
final int jm1 = indJ - 1;
// update the match array
double pBaseReadLog10 = 0.0; // Math.log10(1.0);
if( im1 > 0 && jm1 > 0 ) { // the emission probability is applied when leaving the state
final byte x = readBases[im1-1];
final byte y = haplotypeBases[jm1-1];
final byte qual = readQuals[im1-1];
pBaseReadLog10 = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) );
}
final int qualIndexGOP = ( im1 == 0 ? DEFAULT_GOP + DEFAULT_GOP : ( insertionGOP[im1-1] + deletionGOP[im1-1] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : insertionGOP[im1-1] + deletionGOP[im1-1]) );
final double d0 = QualityUtils.qualToProbLog10((byte)qualIndexGOP);
final double e0 = ( im1 == 0 ? QualityUtils.qualToProbLog10(DEFAULT_GCP) : QualityUtils.qualToProbLog10(overallGCP[im1-1]) );
matchMetricArray[indI][indJ] = pBaseReadLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI-1][indJ-1] + d0, XMetricArray[indI-1][indJ-1] + e0, YMetricArray[indI-1][indJ-1] + e0);
// update the X (insertion) array
final double d1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GOP) : QualityUtils.qualToErrorProbLog10(insertionGOP[im1-1]) );
final double e1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GCP) : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) );
final double qBaseReadLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0
XMetricArray[indI][indJ] = qBaseReadLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI-1][indJ] + d1, XMetricArray[indI-1][indJ] + e1);
// update the Y (deletion) array, with penalty of zero on the left and right flanks to allow for a local alignment within the haplotype
final double d2 = ( im1 == 0 || im1 == readBases.length ? 0.0 : QualityUtils.qualToErrorProbLog10(deletionGOP[im1-1]) );
final double e2 = ( im1 == 0 || im1 == readBases.length ? 0.0 : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) );
final double qBaseRefLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0
YMetricArray[indI][indJ] = qBaseRefLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI][indJ-1] + d2, YMetricArray[indI][indJ-1] + e2);
}
// private function used by the banded approach to ensure the proposed bands are sufficiently distinct from each other
private boolean detectClusteredStartLocations( final ArrayList<Integer> list, int loc ) {
for(int x : list) {
if( Math.abs(x-loc) <= BANDING_CLUSTER_WINDOW ) {
return true;
}
}
return false;
}
}

View File

@ -25,8 +25,11 @@
package org.broadinstitute.sting.utils.codecs.hapmap; package org.broadinstitute.sting.utils.codecs.hapmap;
import org.broad.tribble.AsciiFeatureCodec; import org.broad.tribble.AsciiFeatureCodec;
import org.broad.tribble.FeatureCodecHeader;
import org.broad.tribble.annotation.Strand; import org.broad.tribble.annotation.Strand;
import org.broad.tribble.readers.AsciiLineReader;
import org.broad.tribble.readers.LineReader; import org.broad.tribble.readers.LineReader;
import org.broad.tribble.readers.PositionalBufferedStream;
import java.io.IOException; import java.io.IOException;
import java.util.Arrays; import java.util.Arrays;
@ -116,4 +119,10 @@ public class RawHapMapCodec extends AsciiFeatureCodec<RawHapMapFeature> {
} }
return headerLine; return headerLine;
} }
@Override
public FeatureCodecHeader readHeader(final PositionalBufferedStream stream) throws IOException {
final AsciiLineReader br = new AsciiLineReader(stream);
return new FeatureCodecHeader(readHeader(br), br.getPosition());
}
} }

View File

@ -2,8 +2,6 @@ package org.broadinstitute.sting.utils.codecs.vcf;
import org.broad.tribble.TribbleException; import org.broad.tribble.TribbleException;
import org.broad.tribble.readers.LineReader; import org.broad.tribble.readers.LineReader;
import org.broad.tribble.util.ParsingUtils;
import org.broadinstitute.sting.utils.variantcontext.*;
import java.io.IOException; import java.io.IOException;
import java.util.*; import java.util.*;
@ -119,7 +117,7 @@ public class VCFCodec extends AbstractVCFCodec {
// empty set for passes filters // empty set for passes filters
List<String> fFields = new LinkedList<String>(); List<String> fFields = new LinkedList<String>();
// otherwise we have to parse and cache the value // otherwise we have to parse and cache the value
if ( filterString.indexOf(VCFConstants.FILTER_CODE_SEPARATOR) == -1 ) if ( !filterString.contains(VCFConstants.FILTER_CODE_SEPARATOR) )
fFields.add(filterString); fFields.add(filterString);
else else
fFields.addAll(Arrays.asList(filterString.split(VCFConstants.FILTER_CODE_SEPARATOR))); fFields.addAll(Arrays.asList(filterString.split(VCFConstants.FILTER_CODE_SEPARATOR)));

View File

@ -0,0 +1,107 @@
package org.broadinstitute.sting.utils.pairhmm;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.QualityUtils;
import java.util.ArrayList;
import java.util.Arrays;
/**
* Created with IntelliJ IDEA.
* User: rpoplin
* Date: 10/16/12
*/
public class ExactPairHMM extends PairHMM {
@Override
public void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = READ_MAX_LENGTH + 2;
final int Y_METRIC_LENGTH = HAPLOTYPE_MAX_LENGTH + 2;
matchMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
XMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
YMetricArray = new double[X_METRIC_LENGTH][Y_METRIC_LENGTH];
for( int iii=0; iii < X_METRIC_LENGTH; iii++ ) {
Arrays.fill(matchMetricArray[iii], Double.NEGATIVE_INFINITY);
Arrays.fill(XMetricArray[iii], Double.NEGATIVE_INFINITY);
Arrays.fill(YMetricArray[iii], Double.NEGATIVE_INFINITY);
}
// the initial condition
matchMetricArray[1][1] = 0.0; // Math.log10(1.0);
}
@Override
public double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
final int Y_METRIC_LENGTH = haplotypeBases.length + 2;
// ensure that all the qual scores have valid values
for( int iii = 0; iii < readQuals.length; iii++ ) {
readQuals[iii] = ( readQuals[iii] < QualityUtils.MIN_USABLE_Q_SCORE ? QualityUtils.MIN_USABLE_Q_SCORE : (readQuals[iii] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : readQuals[iii]) );
}
// simple rectangular version of update loop, slow
for( int iii = 1; iii < X_METRIC_LENGTH; iii++ ) {
for( int jjj = hapStartIndex + 1; jjj < Y_METRIC_LENGTH; jjj++ ) {
if( (iii == 1 && jjj == 1) ) { continue; }
updateCell(iii, jjj, haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP,
matchMetricArray, XMetricArray, YMetricArray);
}
}
// final probability is the log10 sum of the last element in all three state arrays
final int endI = X_METRIC_LENGTH - 1;
final int endJ = Y_METRIC_LENGTH - 1;
return MathUtils.log10sumLog10(new double[]{matchMetricArray[endI][endJ], XMetricArray[endI][endJ], YMetricArray[endI][endJ]});
}
private void updateCell( final int indI, final int indJ, final byte[] haplotypeBases, final byte[] readBases,
final byte[] readQuals, final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
// the read and haplotype indices are offset by one because the state arrays have an extra column to hold the initial conditions
final int im1 = indI - 1;
final int jm1 = indJ - 1;
// update the match array
double pBaseReadLog10 = 0.0; // Math.log10(1.0);
if( im1 > 0 && jm1 > 0 ) { // the emission probability is applied when leaving the state
final byte x = readBases[im1-1];
final byte y = haplotypeBases[jm1-1];
final byte qual = readQuals[im1-1];
pBaseReadLog10 = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) );
}
final int qualIndexGOP = ( im1 == 0 ? DEFAULT_GOP + DEFAULT_GOP : ( insertionGOP[im1-1] + deletionGOP[im1-1] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : insertionGOP[im1-1] + deletionGOP[im1-1]) );
final double d0 = QualityUtils.qualToProbLog10((byte)qualIndexGOP);
final double e0 = ( im1 == 0 ? QualityUtils.qualToProbLog10(DEFAULT_GCP) : QualityUtils.qualToProbLog10(overallGCP[im1-1]) );
matchMetricArray[indI][indJ] = pBaseReadLog10 + MathUtils.log10sumLog10(new double[]{matchMetricArray[indI-1][indJ-1] + d0, XMetricArray[indI-1][indJ-1] + e0, YMetricArray[indI-1][indJ-1] + e0});
// update the X (insertion) array
final double d1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GOP) : QualityUtils.qualToErrorProbLog10(insertionGOP[im1-1]) );
final double e1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GCP) : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) );
final double qBaseReadLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0
XMetricArray[indI][indJ] = qBaseReadLog10 + MathUtils.log10sumLog10(new double[]{matchMetricArray[indI-1][indJ] + d1, XMetricArray[indI-1][indJ] + e1});
// update the Y (deletion) array, with penalty of zero on the left and right flanks to allow for a local alignment within the haplotype
final double d2 = ( im1 == 0 || im1 == readBases.length ? 0.0 : QualityUtils.qualToErrorProbLog10(deletionGOP[im1-1]) );
final double e2 = ( im1 == 0 || im1 == readBases.length ? 0.0 : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) );
final double qBaseRefLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0
YMetricArray[indI][indJ] = qBaseRefLog10 + MathUtils.log10sumLog10(new double[]{matchMetricArray[indI][indJ-1] + d2, YMetricArray[indI][indJ-1] + e2});
}
}

View File

@ -0,0 +1,105 @@
/*
* Copyright (c) 2012, The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
* OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.utils.pairhmm;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.QualityUtils;
/**
* Util class for performing the pair HMM for local alignment. Figure 4.3 in Durbin 1998 book.
* User: rpoplin
* Date: 3/1/12
*/
public class OriginalPairHMM extends ExactPairHMM {
@Override
public double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues ) {
// M, X, and Y arrays are of size read and haplotype + 1 because of an extra column for initial conditions and + 1 to consider the final base in a non-global alignment
final int X_METRIC_LENGTH = readBases.length + 2;
final int Y_METRIC_LENGTH = haplotypeBases.length + 2;
// ensure that all the qual scores have valid values
for( int iii = 0; iii < readQuals.length; iii++ ) {
readQuals[iii] = ( readQuals[iii] < QualityUtils.MIN_USABLE_Q_SCORE ? QualityUtils.MIN_USABLE_Q_SCORE : (readQuals[iii] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : readQuals[iii]) );
}
// simple rectangular version of update loop, slow
for( int iii = 1; iii < X_METRIC_LENGTH; iii++ ) {
for( int jjj = hapStartIndex + 1; jjj < Y_METRIC_LENGTH; jjj++ ) {
if( (iii == 1 && jjj == 1) ) { continue; }
updateCell(iii, jjj, haplotypeBases, readBases, readQuals, insertionGOP, deletionGOP, overallGCP,
matchMetricArray, XMetricArray, YMetricArray);
}
}
// final probability is the log10 sum of the last element in all three state arrays
final int endI = X_METRIC_LENGTH - 1;
final int endJ = Y_METRIC_LENGTH - 1;
return MathUtils.approximateLog10SumLog10(matchMetricArray[endI][endJ], XMetricArray[endI][endJ], YMetricArray[endI][endJ]);
}
private void updateCell( final int indI, final int indJ, final byte[] haplotypeBases, final byte[] readBases,
final byte[] readQuals, final byte[] insertionGOP, final byte[] deletionGOP, final byte[] overallGCP,
final double[][] matchMetricArray, final double[][] XMetricArray, final double[][] YMetricArray ) {
// the read and haplotype indices are offset by one because the state arrays have an extra column to hold the initial conditions
final int im1 = indI - 1;
final int jm1 = indJ - 1;
// update the match array
double pBaseReadLog10 = 0.0; // Math.log10(1.0);
if( im1 > 0 && jm1 > 0 ) { // the emission probability is applied when leaving the state
final byte x = readBases[im1-1];
final byte y = haplotypeBases[jm1-1];
final byte qual = readQuals[im1-1];
pBaseReadLog10 = ( x == y || x == (byte) 'N' || y == (byte) 'N' ? QualityUtils.qualToProbLog10(qual) : QualityUtils.qualToErrorProbLog10(qual) );
}
final int qualIndexGOP = ( im1 == 0 ? DEFAULT_GOP + DEFAULT_GOP : ( insertionGOP[im1-1] + deletionGOP[im1-1] > MAX_CACHED_QUAL ? MAX_CACHED_QUAL : insertionGOP[im1-1] + deletionGOP[im1-1]) );
final double d0 = QualityUtils.qualToProbLog10((byte)qualIndexGOP);
final double e0 = ( im1 == 0 ? QualityUtils.qualToProbLog10(DEFAULT_GCP) : QualityUtils.qualToProbLog10(overallGCP[im1-1]) );
matchMetricArray[indI][indJ] = pBaseReadLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI-1][indJ-1] + d0, XMetricArray[indI-1][indJ-1] + e0, YMetricArray[indI-1][indJ-1] + e0);
// update the X (insertion) array
final double d1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GOP) : QualityUtils.qualToErrorProbLog10(insertionGOP[im1-1]) );
final double e1 = ( im1 == 0 ? QualityUtils.qualToErrorProbLog10(DEFAULT_GCP) : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) );
final double qBaseReadLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0
XMetricArray[indI][indJ] = qBaseReadLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI-1][indJ] + d1, XMetricArray[indI-1][indJ] + e1);
// update the Y (deletion) array, with penalty of zero on the left and right flanks to allow for a local alignment within the haplotype
final double d2 = ( im1 == 0 || im1 == readBases.length ? 0.0 : QualityUtils.qualToErrorProbLog10(deletionGOP[im1-1]) );
final double e2 = ( im1 == 0 || im1 == readBases.length ? 0.0 : QualityUtils.qualToErrorProbLog10(overallGCP[im1-1]) );
final double qBaseRefLog10 = 0.0; // Math.log10(1.0) -- we don't have an estimate for this emission probability so assume q=1.0
YMetricArray[indI][indJ] = qBaseRefLog10 + MathUtils.approximateLog10SumLog10(matchMetricArray[indI][indJ-1] + d2, YMetricArray[indI][indJ-1] + e2);
}
}

View File

@ -0,0 +1,45 @@
package org.broadinstitute.sting.utils.pairhmm;
import com.google.java.contract.Ensures;
import com.google.java.contract.Requires;
/**
* Created with IntelliJ IDEA.
* User: rpoplin
* Date: 10/16/12
*/
public abstract class PairHMM {
protected static final Byte MAX_CACHED_QUAL = Byte.MAX_VALUE;
protected static final byte DEFAULT_GOP = (byte) 45;
protected static final byte DEFAULT_GCP = (byte) 10;
public enum HMM_IMPLEMENTATION {
/* Very slow implementation which uses very accurate log10 sum functions. Only meant to be used as a reference test implementation */
EXACT,
/* PairHMM as implemented for the UnifiedGenotyper. Uses log10 sum functions accurate to only 1E-4 */
ORIGINAL,
/* Optimized version of the PairHMM which caches per-read computations */
CACHING,
/* Optimized version of the PairHMM which caches per-read computations and operations in real space to avoid costly sums of log10'ed likelihoods */
LOGLESS_CACHING
}
protected double[][] matchMetricArray = null;
protected double[][] XMetricArray = null;
protected double[][] YMetricArray = null;
public abstract void initialize( final int READ_MAX_LENGTH, final int HAPLOTYPE_MAX_LENGTH );
@Requires({"readBases.length == readQuals.length", "readBases.length == insertionGOP.length", "readBases.length == deletionGOP.length",
"readBases.length == overallGCP.length", "matchMetricArray!=null", "XMetricArray!=null", "YMetricArray!=null"})
@Ensures({"!Double.isInfinite(result)", "!Double.isNaN(result)"}) // Result should be a proper log10 likelihood
public abstract double computeReadLikelihoodGivenHaplotypeLog10( final byte[] haplotypeBases,
final byte[] readBases,
final byte[] readQuals,
final byte[] insertionGOP,
final byte[] deletionGOP,
final byte[] overallGCP,
final int hapStartIndex,
final boolean recacheReadValues );
}

View File

@ -388,9 +388,14 @@ public class GATKSAMRecord extends BAMRecord {
public int getSoftStart() { public int getSoftStart() {
if (softStart < 0) { if (softStart < 0) {
softStart = getAlignmentStart(); softStart = getAlignmentStart();
final CigarElement firstCig = getCigar().getCigarElement(0); for (final CigarElement cig : getCigar().getCigarElements()) {
if (firstCig.getOperator() == CigarOperator.HARD_CLIP) final CigarOperator op = cig.getOperator();
softStart -= firstCig.getLength();
if (op == CigarOperator.SOFT_CLIP)
softStart -= cig.getLength();
else if (op != CigarOperator.HARD_CLIP)
break;
}
} }
return softStart; return softStart;
} }

View File

@ -28,7 +28,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testMultiSamplePilot1() { public void testMultiSamplePilot1() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
baseCommand + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10,022,000-10,025,000", 1, baseCommand + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10,022,000-10,025,000", 1,
Arrays.asList("b3abf320f7d02d0e3b2883833419130e")); Arrays.asList("847605f4efafef89529fe0e496315edd"));
executeTest("test MultiSample Pilot1", spec); executeTest("test MultiSample Pilot1", spec);
} }
@ -52,7 +52,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testSingleSamplePilot2() { public void testSingleSamplePilot2() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,100,000", 1, baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,100,000", 1,
Arrays.asList("57e409dbb12e0d85cd8af73db221b1fc")); Arrays.asList("afb8768f31ab57eb43f75c1115eadc99"));
executeTest("test SingleSample Pilot2", spec); executeTest("test SingleSample Pilot2", spec);
} }
@ -60,7 +60,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testMultipleSNPAlleles() { public void testMultipleSNPAlleles() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -glm BOTH --dbsnp " + b37dbSNP129 + " -I " + privateTestDir + "multiallelic.snps.bam -o %s -L " + privateTestDir + "multiallelic.snps.intervals", 1, "-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -glm BOTH --dbsnp " + b37dbSNP129 + " -I " + privateTestDir + "multiallelic.snps.bam -o %s -L " + privateTestDir + "multiallelic.snps.intervals", 1,
Arrays.asList("48b4f4b05461be276bffc91350f08cbc")); Arrays.asList("73c9b926c5e971a113de347a64fdcf20"));
executeTest("test Multiple SNP alleles", spec); executeTest("test Multiple SNP alleles", spec);
} }
@ -76,7 +76,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testReverseTrim() { public void testReverseTrim() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -glm INDEL -I " + validationDataLocation + "CEUTrio.HiSeq.b37.chr20.10_11mb.bam -o %s -L 20:10289124 -L 20:10090289", 1, "-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -glm INDEL -I " + validationDataLocation + "CEUTrio.HiSeq.b37.chr20.10_11mb.bam -o %s -L 20:10289124 -L 20:10090289", 1,
Arrays.asList("04affcc9d720ee17bc221759707e0cd2")); Arrays.asList("7f8d13690cb7d4173787afa00c496f12"));
executeTest("test reverse trim", spec); executeTest("test reverse trim", spec);
} }
@ -84,7 +84,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testMismatchedPLs() { public void testMismatchedPLs() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -glm INDEL -I " + privateTestDir + "mismatchedPLs.bam -o %s -L 1:24020341", 1, "-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -glm INDEL -I " + privateTestDir + "mismatchedPLs.bam -o %s -L 1:24020341", 1,
Arrays.asList("112e7bedfd284d4d9390aa006118c733")); Arrays.asList("3c006b06b17bbe8e787d64eff6a63a19"));
executeTest("test mismatched PLs", spec); executeTest("test mismatched PLs", spec);
} }
@ -94,7 +94,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
// //
// -------------------------------------------------------------------------------------------------------------- // --------------------------------------------------------------------------------------------------------------
private final static String COMPRESSED_OUTPUT_MD5 = "367c0355b4e7b10c2988e5c41f44b3d2"; private final static String COMPRESSED_OUTPUT_MD5 = "fd236bd635d514e4214d364f45ec4d10";
@Test @Test
public void testCompressedOutput() { public void testCompressedOutput() {
@ -115,7 +115,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
// Note that we need to turn off any randomization for this to work, so no downsampling and no annotations // Note that we need to turn off any randomization for this to work, so no downsampling and no annotations
String md5 = "360d1274c1072a1ae9868e4e106c2650"; String md5 = "d408b4661b820ed86272415b8ea08780";
WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec(
baseCommand + " -dt NONE -G none -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,075,000", 1, baseCommand + " -dt NONE -G none -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,075,000", 1,
@ -147,7 +147,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testMinBaseQualityScore() { public void testMinBaseQualityScore() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,010,000 --min_base_quality_score 26", 1, baseCommand + " -I " + validationDataLocation + "NA12878.1kg.p2.chr1_10mb_11_mb.SLX.bam -o %s -L 1:10,000,000-10,010,000 --min_base_quality_score 26", 1,
Arrays.asList("6ae4a219c7b9c837fcbf12edeeac3c0c")); Arrays.asList("839ecd30d354a36b5dfa2b5e99859765"));
executeTest("test min_base_quality_score 26", spec); executeTest("test min_base_quality_score 26", spec);
} }
@ -182,12 +182,12 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
@Test @Test
public void testOutputParameterAllConfident() { public void testOutputParameterAllConfident() {
testOutputParameters("--output_mode EMIT_ALL_CONFIDENT_SITES", "f9ea04d96eeef29e71d37e60518c2579"); testOutputParameters("--output_mode EMIT_ALL_CONFIDENT_SITES", "8800c58715c2bb434b69e1873cb77de6");
} }
@Test @Test
public void testOutputParameterAllSites() { public void testOutputParameterAllSites() {
testOutputParameters("--output_mode EMIT_ALL_SITES", "67739a3ccf30975bcaef8a563e4b80cf"); testOutputParameters("--output_mode EMIT_ALL_SITES", "639df9f4c029792ac2e46069efc82b20");
} }
private void testOutputParameters(final String args, final String md5) { private void testOutputParameters(final String args, final String md5) {
@ -220,12 +220,12 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
// -------------------------------------------------------------------------------------------------------------- // --------------------------------------------------------------------------------------------------------------
@Test @Test
public void testHeterozyosity1() { public void testHeterozyosity1() {
testHeterozosity( 0.01, "f1c4c8e701b2334bf3c4f12fc395fec8" ); testHeterozosity( 0.01, "986923de51c71635d47e3d06fe3794a1" );
} }
@Test @Test
public void testHeterozyosity2() { public void testHeterozyosity2() {
testHeterozosity( 1.0 / 1850, "7fbbf4a21d6bf0026bfdadbb3c086fbe" ); testHeterozosity( 1.0 / 1850, "fb12b1553f813004a394a391a8540873" );
} }
private void testHeterozosity(final double arg, final String md5) { private void testHeterozosity(final double arg, final String md5) {
@ -268,7 +268,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
" -L 1:10,000,000-10,100,000" + " -L 1:10,000,000-10,100,000" +
" -baq CALCULATE_AS_NECESSARY", " -baq CALCULATE_AS_NECESSARY",
1, 1,
Arrays.asList("950fb032cc9902ae48bd21f272d2fd52")); Arrays.asList("98058fc913b61c22d44875da1f5ea89c"));
executeTest(String.format("test calling with BAQ"), spec); executeTest(String.format("test calling with BAQ"), spec);
} }
@ -287,7 +287,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
" -o %s" + " -o %s" +
" -L 1:10,000,000-10,500,000", " -L 1:10,000,000-10,500,000",
1, 1,
Arrays.asList("b3df138254ed141b61a758df87757e0d")); Arrays.asList("650c53774afacfc07a595675e8cdde17"));
executeTest(String.format("test indel caller in SLX"), spec); executeTest(String.format("test indel caller in SLX"), spec);
} }
@ -302,7 +302,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
" -minIndelCnt 1" + " -minIndelCnt 1" +
" -L 1:10,000,000-10,100,000", " -L 1:10,000,000-10,100,000",
1, 1,
Arrays.asList("63fd9488daadd4baaef0a98f02916996")); Arrays.asList("6a0c2a3a7bcc56ad01428c71408055aa"));
executeTest(String.format("test indel caller in SLX with low min allele count"), spec); executeTest(String.format("test indel caller in SLX with low min allele count"), spec);
} }
@ -315,7 +315,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
" -o %s" + " -o %s" +
" -L 1:10,000,000-10,500,000", " -L 1:10,000,000-10,500,000",
1, 1,
Arrays.asList("52b5a432092995c92fe71e1942689ba8")); Arrays.asList("5f2721c3323de5390d2d47446139f32b"));
executeTest(String.format("test indel calling, multiple technologies"), spec); executeTest(String.format("test indel calling, multiple technologies"), spec);
} }
@ -343,13 +343,13 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testMultiSampleIndels1() { public void testMultiSampleIndels1() {
WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec1 = new WalkerTest.WalkerTestSpec(
baseCommandIndels + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10450700-10551000", 1, baseCommandIndels + " -I " + validationDataLocation + "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10450700-10551000", 1,
Arrays.asList("863ee56b3594f09795644127f2f9539f")); Arrays.asList("a4761d7f25e7a62f34494801c98a0da7"));
List<File> result = executeTest("test MultiSample Pilot1 CEU indels", spec1).getFirst(); List<File> result = executeTest("test MultiSample Pilot1 CEU indels", spec1).getFirst();
WalkerTest.WalkerTestSpec spec2 = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec2 = new WalkerTest.WalkerTestSpec(
baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + result.get(0).getAbsolutePath() + " -I " + validationDataLocation + baseCommandIndels + " --genotyping_mode GENOTYPE_GIVEN_ALLELES -alleles " + result.get(0).getAbsolutePath() + " -I " + validationDataLocation +
"low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10450700-10551000", 1, "low_coverage_CEU.chr1.10k-11k.bam -o %s -L 1:10450700-10551000", 1,
Arrays.asList("503ca1b75cc7b2679eaa80f7b5e7ef1c")); Arrays.asList("c526c234947482d1cd2ffc5102083a08"));
executeTest("test MultiSample Pilot1 CEU indels using GENOTYPE_GIVEN_ALLELES", spec2); executeTest("test MultiSample Pilot1 CEU indels using GENOTYPE_GIVEN_ALLELES", spec2);
} }
@ -371,7 +371,7 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
" -o %s" + " -o %s" +
" -L 20:10,000,000-10,100,000", " -L 20:10,000,000-10,100,000",
1, 1,
Arrays.asList("945a2f994eaced8efdf8de24b58f2680")); Arrays.asList("1e0d2c15546c3b0959b00ffb75488b56"));
executeTest(String.format("test UG with base indel quality scores"), spec); executeTest(String.format("test UG with base indel quality scores"), spec);
} }
@ -449,7 +449,25 @@ public class UnifiedGenotyperIntegrationTest extends WalkerTest {
public void testReducedBam() { public void testReducedBam() {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec( WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -I " + privateTestDir + "bamExample.ReducedRead.ADAnnotation.bam -o %s -L 1:67,225,396-67,288,518", 1, "-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -I " + privateTestDir + "bamExample.ReducedRead.ADAnnotation.bam -o %s -L 1:67,225,396-67,288,518", 1,
Arrays.asList("bbf16e1873e525ee5975021cfb8988cf")); Arrays.asList("da9c05f87bd6415e97f90c49cf68ed19"));
executeTest("test calling on a ReducedRead BAM", spec); executeTest("test calling on a ReducedRead BAM", spec);
} }
@Test
public void testReducedBamSNPs() {
testReducedCalling("SNP", "1d4a826b144723ff0766c36aa0239287");
}
@Test
public void testReducedBamINDELs() {
testReducedCalling("INDEL", "68ef51d5c98480e0c0192e0eecb95bca");
}
private void testReducedCalling(final String model, final String md5) {
WalkerTest.WalkerTestSpec spec = new WalkerTest.WalkerTestSpec(
"-T UnifiedGenotyper -R " + b37KGReference + " -nosl --no_cmdline_in_header -I " + privateTestDir + "NA12878.HiSeq.b37.chr20.10_11mb.reduced.bam -o %s -L 20:10,000,000-11,000,000 -glm " + model, 1,
Arrays.asList(md5));
executeTest("test calling on a ReducedRead BAM with " + model, spec);
}
} }

View File

@ -190,7 +190,7 @@ public class SelectVariantsIntegrationTest extends WalkerTest {
WalkerTestSpec spec = new WalkerTestSpec( WalkerTestSpec spec = new WalkerTestSpec(
"-T SelectVariants -R " + b36KGReference + " -regenotype -sn NA12892 --variant " + testFile + " -o %s --no_cmdline_in_header", "-T SelectVariants -R " + b36KGReference + " -regenotype -sn NA12892 --variant " + testFile + " -o %s --no_cmdline_in_header",
1, 1,
Arrays.asList("549321a2543608f214ab4893ab478be6") Arrays.asList("46ff472fc7ef6734ad01170028d5924a")
); );
executeTest("testRegenotype--" + testFile, spec); executeTest("testRegenotype--" + testFile, spec);
@ -216,7 +216,7 @@ public class SelectVariantsIntegrationTest extends WalkerTest {
WalkerTestSpec spec = new WalkerTestSpec( WalkerTestSpec spec = new WalkerTestSpec(
"-T SelectVariants -R " + b36KGReference + " -regenotype -sn NA12892 --variant " + testFile + " -o %s --no_cmdline_in_header", "-T SelectVariants -R " + b36KGReference + " -regenotype -sn NA12892 --variant " + testFile + " -o %s --no_cmdline_in_header",
1, 1,
Arrays.asList("549321a2543608f214ab4893ab478be6") Arrays.asList("46ff472fc7ef6734ad01170028d5924a")
); );
executeTest("testRemoveMLEAndRegenotype--" + testFile, spec); executeTest("testRemoveMLEAndRegenotype--" + testFile, spec);

View File

@ -21,7 +21,7 @@ public class NanoSchedulerIntegrationTest extends WalkerTest {
for ( final int nct : Arrays.asList(1, 2) ) { for ( final int nct : Arrays.asList(1, 2) ) {
// tests.add(new Object[]{ "SNP", "a1c7546f32a8919a3f3a70a04b2e8322", nt, nct }); // tests.add(new Object[]{ "SNP", "a1c7546f32a8919a3f3a70a04b2e8322", nt, nct });
//// tests.add(new Object[]{ "INDEL", "0a6d2be79f4f8a4b0eb788cc4751b31b", nt, nct }); //// tests.add(new Object[]{ "INDEL", "0a6d2be79f4f8a4b0eb788cc4751b31b", nt, nct });
tests.add(new Object[]{ "BOTH", "8cad82c3a5f5b932042933f136663c8a", nt, nct }); tests.add(new Object[]{ "BOTH", "85fc5d6dfeb60ed89763470f4b4c981e", nt, nct });
} }
return tests.toArray(new Object[][]{}); return tests.toArray(new Object[][]{});

View File

@ -130,7 +130,10 @@ public class EfficiencyMonitoringThreadFactoryUnitTest extends BaseTest {
return StateTest.getTests(StateTest.class); return StateTest.getTests(StateTest.class);
} }
@Test(enabled = true, dataProvider = "StateTest", timeOut = MAX_THREADS * THREAD_TARGET_DURATION_IN_MILLISECOND) // NOTE this test takes an unreasonably long time to run, and so it's been disabled as these monitoring threads
// aren't a core GATK feature any longer. Should be reabled if we come to care about this capability again
// in the future, or we can run these in parallel
@Test(enabled = false, dataProvider = "StateTest", timeOut = MAX_THREADS * THREAD_TARGET_DURATION_IN_MILLISECOND)
public void testStateTest(final StateTest test) throws InterruptedException { public void testStateTest(final StateTest test) throws InterruptedException {
// allows us to test blocking // allows us to test blocking
final EfficiencyMonitoringThreadFactory factory = new EfficiencyMonitoringThreadFactory(test.getNStates()); final EfficiencyMonitoringThreadFactory factory = new EfficiencyMonitoringThreadFactory(test.getNStates());

View File

@ -27,28 +27,28 @@ class PacbioProcessingPipeline extends QScript {
@Input(doc="dbsnp VCF file to use ", shortName="D", required=true) @Input(doc="dbsnp VCF file to use ", shortName="D", required=true)
var dbSNP: File = _ var dbSNP: File = _
@Input(doc="Number of jobs to scatter/gather. Default: 0." , shortName = "sg", required=false) @Argument(doc="Number of jobs to scatter/gather. Default: 0." , shortName = "sg", required=false)
var threads: Int = 0 var threads: Int = 0
@Input(doc="Sample Name to fill in the Read Group information (only necessary if using fasta/fastq)" , shortName = "sn", required=false) @Argument(doc="Sample Name to fill in the Read Group information (only necessary if using fasta/fastq)" , shortName = "sn", required=false)
var sample: String = "NA" var sample: String = "NA"
@Input(doc="The path to the binary of bwa to align fasta/fastq files", fullName="path_to_bwa", shortName="bwa", required=false) @Input(doc="The path to the binary of bwa to align fasta/fastq files", fullName="path_to_bwa", shortName="bwa", required=false)
var bwaPath: File = _ var bwaPath: File = _
@Input(doc="Input is a BLASR generated BAM file", shortName = "blasr", fullName="blasr_bam", required=false) @Argument(doc="Input is a BLASR generated BAM file", shortName = "blasr", fullName="blasr_bam", required=false)
var BLASR_BAM: Boolean = false var BLASR_BAM: Boolean = false
@Hidden @Hidden
@Input(doc="The default base qualities to use before recalibration. Default is Q20 (should be good for every dataset)." , shortName = "dbq", required=false) @Argument(doc="The default base qualities to use before recalibration. Default is Q20 (should be good for every dataset)." , shortName = "dbq", required=false)
var dbq: Int = 20 var dbq: Int = 20
@Hidden @Hidden
@Input(shortName="bwastring", required=false) @Argument(shortName="bwastring", required=false)
var bwastring: String = "" var bwastring: String = ""
@Hidden @Hidden
@Input(shortName = "test", fullName = "test_mode", required = false) @Argument(shortName = "test", fullName = "test_mode", required = false)
var testMode: Boolean = false var testMode: Boolean = false
val queueLogDir: String = ".qlog/" val queueLogDir: String = ".qlog/"

View File

@ -25,7 +25,7 @@
package org.broadinstitute.sting.queue package org.broadinstitute.sting.queue
import java.io.File import java.io.File
import org.broadinstitute.sting.commandline.Argument import org.broadinstitute.sting.commandline.{ClassType, Argument}
/** /**
* Default settings settable on the command line and passed to CommandLineFunctions. * Default settings settable on the command line and passed to CommandLineFunctions.
@ -41,6 +41,7 @@ class QSettings {
var jobQueue: String = _ var jobQueue: String = _
@Argument(fullName="job_priority", shortName="jobPriority", doc="Default priority for jobs. Min = 0, Max = 100", required=false) @Argument(fullName="job_priority", shortName="jobPriority", doc="Default priority for jobs. Min = 0, Max = 100", required=false)
@ClassType(classOf[Int])
var jobPriority: Option[Int] = None var jobPriority: Option[Int] = None
@Argument(fullName="job_native_arg", shortName="jobNative", doc="Native arguments to pass to the job runner.", required=false) @Argument(fullName="job_native_arg", shortName="jobNative", doc="Native arguments to pass to the job runner.", required=false)
@ -53,15 +54,19 @@ class QSettings {
var jobEnvironmentNames: Seq[String] = Nil var jobEnvironmentNames: Seq[String] = Nil
@Argument(fullName="memory_limit", shortName="memLimit", doc="Default memory limit for jobs, in gigabytes. If not set defaults to 2GB.", required=false) @Argument(fullName="memory_limit", shortName="memLimit", doc="Default memory limit for jobs, in gigabytes. If not set defaults to 2GB.", required=false)
@ClassType(classOf[Double])
var memoryLimit: Option[Double] = Some(2) var memoryLimit: Option[Double] = Some(2)
@Argument(fullName="memory_limit_threshold", shortName="memLimitThresh", doc="After passing this threshold stop increasing memory limit for jobs, in gigabytes.", required=false) @Argument(fullName="memory_limit_threshold", shortName="memLimitThresh", doc="After passing this threshold stop increasing memory limit for jobs, in gigabytes.", required=false)
@ClassType(classOf[Double])
var memoryLimitThreshold: Option[Double] = None var memoryLimitThreshold: Option[Double] = None
@Argument(fullName="resident_memory_limit", shortName="resMemLimit", doc="Default resident memory limit for jobs, in gigabytes.", required=false) @Argument(fullName="resident_memory_limit", shortName="resMemLimit", doc="Default resident memory limit for jobs, in gigabytes.", required=false)
@ClassType(classOf[Double])
var residentLimit: Option[Double] = None var residentLimit: Option[Double] = None
@Argument(fullName="resident_memory_request", shortName="resMemReq", doc="Default resident memory request for jobs, in gigabytes.", required=false) @Argument(fullName="resident_memory_request", shortName="resMemReq", doc="Default resident memory request for jobs, in gigabytes.", required=false)
@ClassType(classOf[Double])
var residentRequest: Option[Double] = None var residentRequest: Option[Double] = None
@Argument(fullName="resident_memory_request_parameter", shortName="resMemReqParam", doc="Parameter for resident memory requests. By default not requested.", required=false) @Argument(fullName="resident_memory_request_parameter", shortName="resMemReqParam", doc="Parameter for resident memory requests. By default not requested.", required=false)

View File

@ -159,12 +159,11 @@ object ReflectionUtils {
private def getGenericTypes(field: Field): Option[Array[Class[_]]] = { private def getGenericTypes(field: Field): Option[Array[Class[_]]] = {
// TODO: Refactor: based on java code in org.broadinstitute.sting.commandline.ArgumentTypeDescriptor // TODO: Refactor: based on java code in org.broadinstitute.sting.commandline.ArgumentTypeDescriptor
// If this is a parameterized collection, find the contained type. If blow up if only one type exists. // If this is a parameterized collection, find the contained type. If blow up if only one type exists.
if (field.getGenericType.isInstanceOf[ParameterizedType]) { if (hasAnnotation(field, classOf[ClassType])) {
Some(Array(getAnnotation(field, classOf[ClassType]).value))
} else if (field.getGenericType.isInstanceOf[ParameterizedType]) {
val parameterizedType = field.getGenericType.asInstanceOf[ParameterizedType] val parameterizedType = field.getGenericType.asInstanceOf[ParameterizedType]
Some(parameterizedType.getActualTypeArguments.map(_.asInstanceOf[Class[_]])) Some(parameterizedType.getActualTypeArguments.map(_.asInstanceOf[Class[_]]))
} else if (hasAnnotation(field, classOf[ClassType])) { } else None
Some(Array(getAnnotation(field, classOf[ClassType]).value))
}
else None
} }
} }