A bit of reorganization to help with more flexible output streams. Pushed construction of data
sources and post-construction validation back into the GATKEngine, leaving the MicroScheduler to just microschedule. git-svn-id: file:///humgen/gsa-scr1/gsa-engineering/svn_contents/trunk@1336 348d0f76-0448-11de-a6fe-93d51630548a
This commit is contained in:
parent
bca894ebce
commit
5429b4d4a8
|
|
@ -26,11 +26,9 @@
|
|||
package org.broadinstitute.sting.gatk;
|
||||
|
||||
import net.sf.picard.reference.ReferenceSequenceFile;
|
||||
import net.sf.picard.reference.ReferenceSequenceFileFactory;
|
||||
import net.sf.picard.sam.SamFileHeaderMerger;
|
||||
import net.sf.picard.filter.SamRecordFilter;
|
||||
import net.sf.samtools.SAMFileReader;
|
||||
import net.sf.samtools.SAMReadGroupRecord;
|
||||
import net.sf.samtools.*;
|
||||
|
||||
import org.apache.log4j.Logger;
|
||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||
|
|
@ -40,7 +38,6 @@ import org.broadinstitute.sting.gatk.datasources.shards.ShardStrategyFactory;
|
|||
import org.broadinstitute.sting.gatk.executive.MicroScheduler;
|
||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedData;
|
||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedDatum;
|
||||
import org.broadinstitute.sting.gatk.traversals.TraversalEngine;
|
||||
import org.broadinstitute.sting.gatk.walkers.*;
|
||||
import org.broadinstitute.sting.gatk.filters.ZeroMappingQualityReadFilter;
|
||||
import org.broadinstitute.sting.utils.*;
|
||||
|
|
@ -58,9 +55,20 @@ public class GenomeAnalysisEngine {
|
|||
// TODO: public static without final tends to indicate we're thinking about this the wrong way
|
||||
public static GenomeAnalysisEngine instance;
|
||||
|
||||
// our traversal engine
|
||||
private TraversalEngine engine = null;
|
||||
private SAMDataSource dataSource = null;
|
||||
/**
|
||||
* Accessor for sharded read data.
|
||||
*/
|
||||
private SAMDataSource readsDataSource = null;
|
||||
|
||||
/**
|
||||
* Accessor for sharded reference data.
|
||||
*/
|
||||
private IndexedFastaSequenceFile referenceDataSource = null;
|
||||
|
||||
/**
|
||||
* Accessor for sharded reference-ordered data.
|
||||
*/
|
||||
private List<ReferenceOrderedDataSource> rodDataSources;
|
||||
|
||||
// our argument collection
|
||||
private GATKArgumentCollection argCollection;
|
||||
|
|
@ -105,55 +113,24 @@ public class GenomeAnalysisEngine {
|
|||
// save our argument parameter
|
||||
this.argCollection = args;
|
||||
|
||||
// our reference ordered data collection
|
||||
List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods = new ArrayList<ReferenceOrderedData<? extends ReferenceOrderedDatum>>();
|
||||
|
||||
//
|
||||
// please don't use these in the future, use the new syntax <- if we're not using these please remove them
|
||||
//
|
||||
if (argCollection.DBSNPFile != null) bindConvenienceRods("dbSNP", "dbsnp", argCollection.DBSNPFile);
|
||||
if (argCollection.HAPMAPFile != null)
|
||||
bindConvenienceRods("hapmap", "HapMapAlleleFrequencies", argCollection.HAPMAPFile);
|
||||
if (argCollection.HAPMAPChipFile != null)
|
||||
bindConvenienceRods("hapmap-chip", "GFF", argCollection.HAPMAPChipFile);
|
||||
// TODO: The ROD iterator currently does not understand multiple intervals file. Fix this by cleaning the ROD system.
|
||||
if (argCollection.intervals != null && argCollection.intervals.size() == 1) {
|
||||
bindConvenienceRods("interval", "Intervals", argCollection.intervals.get(0).replaceAll(",", ""));
|
||||
}
|
||||
|
||||
// parse out the rod bindings
|
||||
ReferenceOrderedData.parseBindings(logger, argCollection.RODBindings, rods);
|
||||
|
||||
// Validate the walker inputs against the walker.
|
||||
validateInputsAgainstWalker(my_walker, argCollection, rods);
|
||||
// Prepare the data for traversal.
|
||||
initializeDataSources( my_walker, argCollection );
|
||||
|
||||
// our microscheduler, which is in charge of running everything
|
||||
MicroScheduler microScheduler = createMicroscheduler(my_walker, rods);
|
||||
MicroScheduler microScheduler = createMicroscheduler(my_walker);
|
||||
|
||||
// create the output streams
|
||||
initializeOutputStreams(my_walker);
|
||||
|
||||
// Prepare the sort ordering w.r.t. the sequence dictionary
|
||||
if (argCollection.referenceFile != null) {
|
||||
final ReferenceSequenceFile refFile = ReferenceSequenceFileFactory.getReferenceSequenceFile(argCollection.referenceFile);
|
||||
GenomeLocParser.setupRefContigOrdering(refFile);
|
||||
}
|
||||
|
||||
logger.info("Strictness is " + argCollection.strictnessLevel);
|
||||
|
||||
// perform validation steps that are common to all the engines
|
||||
engine.setMaximumIterations(argCollection.maximumEngineIterations);
|
||||
engine.initialize();
|
||||
|
||||
GenomeLocSortedSet locs = null;
|
||||
if (argCollection.intervals != null) {
|
||||
locs = GenomeLocSortedSet.createSetFromList(parseIntervalRegion(argCollection.intervals));
|
||||
}
|
||||
|
||||
ShardStrategy shardStrategy = this.getShardStrategy(my_walker, microScheduler.getReference(), locs, argCollection.maximumEngineIterations);
|
||||
ShardStrategy shardStrategy = getShardStrategy(my_walker, microScheduler.getReference(), locs, argCollection.maximumEngineIterations);
|
||||
|
||||
// execute the microscheduler, storing the results
|
||||
return microScheduler.execute(my_walker, shardStrategy);
|
||||
return microScheduler.execute(my_walker, shardStrategy, argCollection.maximumEngineIterations);
|
||||
}
|
||||
|
||||
/**
|
||||
|
|
@ -182,28 +159,49 @@ public class GenomeAnalysisEngine {
|
|||
return walkerManager.createWalkerByName(walkerName);
|
||||
}
|
||||
|
||||
private void initializeDataSources( Walker my_walker, GATKArgumentCollection argCollection ) {
|
||||
validateSuppliedReadsAgainstWalker( my_walker, argCollection );
|
||||
logger.info("Strictness is " + argCollection.strictnessLevel);
|
||||
readsDataSource = createReadsDataSource(extractSourceInfo(my_walker,argCollection));
|
||||
|
||||
validateSuppliedReferenceAgainstWalker( my_walker, argCollection );
|
||||
referenceDataSource = openReferenceSequenceFile(argCollection.referenceFile);
|
||||
|
||||
validateReadsAndReferenceAreCompatible(readsDataSource, referenceDataSource);
|
||||
|
||||
// our reference ordered data collection
|
||||
List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods = new ArrayList<ReferenceOrderedData<? extends ReferenceOrderedDatum>>();
|
||||
|
||||
//
|
||||
// please don't use these in the future, use the new syntax <- if we're not using these please remove them
|
||||
//
|
||||
if (argCollection.DBSNPFile != null) bindConvenienceRods("dbSNP", "dbsnp", argCollection.DBSNPFile);
|
||||
if (argCollection.HAPMAPFile != null)
|
||||
bindConvenienceRods("hapmap", "HapMapAlleleFrequencies", argCollection.HAPMAPFile);
|
||||
if (argCollection.HAPMAPChipFile != null)
|
||||
bindConvenienceRods("hapmap-chip", "GFF", argCollection.HAPMAPChipFile);
|
||||
// TODO: The ROD iterator currently does not understand multiple intervals file. Fix this by cleaning the ROD system.
|
||||
if (argCollection.intervals != null && argCollection.intervals.size() == 1) {
|
||||
bindConvenienceRods("interval", "Intervals", argCollection.intervals.get(0).replaceAll(",", ""));
|
||||
}
|
||||
|
||||
// parse out the rod bindings
|
||||
ReferenceOrderedData.parseBindings(logger, argCollection.RODBindings, rods);
|
||||
|
||||
validateSuppliedReferenceOrderedDataAgainstWalker( my_walker, rods );
|
||||
|
||||
rodDataSources = getReferenceOrderedDataSources(rods);
|
||||
}
|
||||
|
||||
/**
|
||||
* setup a microscheduler
|
||||
*
|
||||
* @param my_walker our walker of type LocusWalker
|
||||
* @param rods the reference order data
|
||||
*
|
||||
* @return a new microscheduler
|
||||
*/
|
||||
private MicroScheduler createMicroscheduler(Walker my_walker, List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods) {
|
||||
private MicroScheduler createMicroscheduler(Walker my_walker) {
|
||||
// the mircoscheduler to return
|
||||
MicroScheduler microScheduler = null;
|
||||
|
||||
SAMDataSource readsDataSource = createReadsDataSource(extractSourceInfo(my_walker,argCollection));
|
||||
IndexedFastaSequenceFile referenceDataSource = openReferenceSequenceFile(argCollection.referenceFile);
|
||||
List<ReferenceOrderedDataSource> rodDataSources = getReferenceOrderedDataSources(rods);
|
||||
|
||||
GenomeLocSortedSet locs = null;
|
||||
if (argCollection.intervals != null) {
|
||||
locs = GenomeLocSortedSet.createSetFromList(parseIntervalRegion(argCollection.intervals));
|
||||
}
|
||||
|
||||
// we need to verify different parameter based on the walker type
|
||||
if (my_walker instanceof LocusWalker || my_walker instanceof LocusWindowWalker) {
|
||||
// create the MicroScheduler
|
||||
|
|
@ -216,9 +214,6 @@ public class GenomeAnalysisEngine {
|
|||
Utils.scareUser(String.format("Unable to create the appropriate TraversalEngine for analysis type " + argCollection.analysisName));
|
||||
}
|
||||
|
||||
dataSource = microScheduler.getSAMDataSource();
|
||||
engine = microScheduler.getTraversalEngine();
|
||||
|
||||
return microScheduler;
|
||||
}
|
||||
|
||||
|
|
@ -351,23 +346,43 @@ public class GenomeAnalysisEngine {
|
|||
filters );
|
||||
}
|
||||
|
||||
private void validateInputsAgainstWalker(Walker walker,
|
||||
GATKArgumentCollection arguments,
|
||||
List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods) {
|
||||
String walkerName = WalkerManager.getWalkerName(walker.getClass());
|
||||
|
||||
/**
|
||||
* Verifies that the supplied set of reads files mesh with what the walker says it requires.
|
||||
* @param walker Walker to test.
|
||||
* @param arguments Supplied reads files.
|
||||
*/
|
||||
private void validateSuppliedReadsAgainstWalker( Walker walker, GATKArgumentCollection arguments ) {
|
||||
// Check what the walker says is required against what was provided on the command line.
|
||||
if (WalkerManager.isRequired(walker, DataSource.READS) && (arguments.samFiles == null || arguments.samFiles.size() == 0))
|
||||
throw new ArgumentException(String.format("Walker %s requires reads but none were provided. If this is incorrect, alter the walker's @Requires annotation.", walkerName));
|
||||
if (WalkerManager.isRequired(walker, DataSource.REFERENCE) && arguments.referenceFile == null)
|
||||
throw new ArgumentException(String.format("Walker %s requires a reference but none was provided. If this is incorrect, alter the walker's @Requires annotation.", walkerName));
|
||||
throw new ArgumentException("Walker requires reads but none were provided. If this is incorrect, alter the walker's @Requires annotation.");
|
||||
|
||||
// Check what the walker says is allowed against what was provided on the command line.
|
||||
if ((arguments.samFiles != null && arguments.samFiles.size() > 0) && !WalkerManager.isAllowed(walker, DataSource.READS))
|
||||
throw new ArgumentException(String.format("Walker %s does not allow reads but reads were provided. If this is incorrect, alter the walker's @Allows annotation", walkerName));
|
||||
if (arguments.referenceFile != null && !WalkerManager.isAllowed(walker, DataSource.REFERENCE))
|
||||
throw new ArgumentException(String.format("Walker %s does not allow a reference but one was provided. If this is incorrect, alter the walker's @Allows annotation", walkerName));
|
||||
throw new ArgumentException("Walker does not allow reads but reads were provided. If this is incorrect, alter the walker's @Allows annotation");
|
||||
}
|
||||
|
||||
/**
|
||||
* Verifies that the supplied reference file mesh with what the walker says it requires.
|
||||
* @param walker Walker to test.
|
||||
* @param arguments Supplied reads files.
|
||||
*/
|
||||
private void validateSuppliedReferenceAgainstWalker( Walker walker, GATKArgumentCollection arguments ) {
|
||||
// Check what the walker says is required against what was provided on the command line.
|
||||
if (WalkerManager.isRequired(walker, DataSource.REFERENCE) && arguments.referenceFile == null)
|
||||
throw new ArgumentException("Walker requires a reference but none was provided. If this is incorrect, alter the walker's @Requires annotation.");
|
||||
|
||||
// Check what the walker says is allowed against what was provided on the command line.
|
||||
if (arguments.referenceFile != null && !WalkerManager.isAllowed(walker, DataSource.REFERENCE))
|
||||
throw new ArgumentException("Walker does not allow a reference but one was provided. If this is incorrect, alter the walker's @Allows annotation");
|
||||
}
|
||||
|
||||
/**
|
||||
* Verifies that all required reference-ordered data has been supplied, and any reference-ordered data that was not
|
||||
* 'allowed' is still present.
|
||||
* @param walker Walker to test.
|
||||
* @param rods Reference-ordered data to load.
|
||||
*/
|
||||
private void validateSuppliedReferenceOrderedDataAgainstWalker( Walker walker, List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods ) {
|
||||
// Check to make sure that all required metadata is present.
|
||||
List<RMD> allRequired = WalkerManager.getRequiredMetaData(walker);
|
||||
for (RMD required : allRequired) {
|
||||
|
|
@ -383,10 +398,73 @@ public class GenomeAnalysisEngine {
|
|||
// Check to see that no forbidden rods are present.
|
||||
for (ReferenceOrderedData<? extends ReferenceOrderedDatum> rod : rods) {
|
||||
if (!WalkerManager.isAllowed(walker, rod))
|
||||
throw new ArgumentException(String.format("Walker does not allow access to metadata: %s. If this is correct, change the @Allows metadata", rod.getName()));
|
||||
throw new ArgumentException(String.format("Walker does not allow access to metadata: %s. If this is incorrect, change the @Allows metadata", rod.getName()));
|
||||
}
|
||||
}
|
||||
|
||||
/**
|
||||
* Now that all files are open, validate the sequence dictionaries of the reads vs. the reference.
|
||||
* @param reads Reads data source.
|
||||
* @param reference Reference data source.
|
||||
*/
|
||||
private void validateReadsAndReferenceAreCompatible( SAMDataSource reads, ReferenceSequenceFile reference ) {
|
||||
if( reads == null || reference == null )
|
||||
return;
|
||||
|
||||
// Compile a set of sequence names that exist in the BAM files.
|
||||
SAMSequenceDictionary readsDictionary = reads.getHeader().getSequenceDictionary();
|
||||
|
||||
Set<String> readsSequenceNames = new TreeSet<String>();
|
||||
for( SAMSequenceRecord dictionaryEntry: readsDictionary.getSequences() )
|
||||
readsSequenceNames.add(dictionaryEntry.getSequenceName());
|
||||
|
||||
// Compile a set of sequence names that exist in the reference file.
|
||||
SAMSequenceDictionary referenceDictionary = reference.getSequenceDictionary();
|
||||
|
||||
Set<String> referenceSequenceNames = new TreeSet<String>();
|
||||
for( SAMSequenceRecord dictionaryEntry: referenceDictionary.getSequences() )
|
||||
referenceSequenceNames.add(dictionaryEntry.getSequenceName());
|
||||
|
||||
if( readsSequenceNames.size() == 0 ) {
|
||||
logger.info("Reads file is unmapped. Skipping validation against reference.");
|
||||
return;
|
||||
}
|
||||
|
||||
// If there's no overlap between reads and reference, data will be bogus. Throw an exception.
|
||||
Set<String> intersectingSequenceNames = new HashSet<String>(readsSequenceNames);
|
||||
intersectingSequenceNames.retainAll(referenceSequenceNames);
|
||||
if( intersectingSequenceNames.size() == 0 ) {
|
||||
StringBuilder error = new StringBuilder();
|
||||
error.append("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
||||
error.append(System.getProperty("line.separator"));
|
||||
error.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
||||
error.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
||||
logger.error(error.toString());
|
||||
Utils.scareUser("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference.");
|
||||
}
|
||||
|
||||
// If the two datasets are not equal and neither is a strict subset of the other, warn the user.
|
||||
if( !readsSequenceNames.equals(referenceSequenceNames) &&
|
||||
!readsSequenceNames.containsAll(referenceSequenceNames) &&
|
||||
!referenceSequenceNames.containsAll(readsSequenceNames)) {
|
||||
StringBuilder warning = new StringBuilder();
|
||||
warning.append("Limited overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
||||
warning.append(System.getProperty("line.separator"));
|
||||
warning.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
||||
warning.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
||||
logger.warn(warning.toString());
|
||||
}
|
||||
}
|
||||
|
||||
private String prettyPrintSequenceRecords( SAMSequenceDictionary sequenceDictionary ) {
|
||||
String[] sequenceRecordNames = new String[ sequenceDictionary.size() ];
|
||||
int sequenceRecordIndex = 0;
|
||||
for( SAMSequenceRecord sequenceRecord: sequenceDictionary.getSequences() )
|
||||
sequenceRecordNames[sequenceRecordIndex++] = sequenceRecord.getSequenceName();
|
||||
return Arrays.deepToString(sequenceRecordNames);
|
||||
}
|
||||
|
||||
|
||||
/**
|
||||
* Convenience function that binds RODs using the old-style command line parser to the new style list for
|
||||
* a uniform processing.
|
||||
|
|
@ -532,8 +610,8 @@ public class GenomeAnalysisEngine {
|
|||
return outputTracker;
|
||||
}
|
||||
|
||||
public TraversalEngine getEngine() {
|
||||
return this.engine;
|
||||
public SAMFileHeader getSAMFileHeader() {
|
||||
return readsDataSource.getHeader();
|
||||
}
|
||||
|
||||
/**
|
||||
|
|
@ -542,7 +620,7 @@ public class GenomeAnalysisEngine {
|
|||
* @return
|
||||
*/
|
||||
public SAMDataSource getDataSource() {
|
||||
return this.dataSource;
|
||||
return this.readsDataSource;
|
||||
}
|
||||
|
||||
/**
|
||||
|
|
|
|||
|
|
@ -95,11 +95,15 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
|
|||
}
|
||||
}
|
||||
|
||||
public Object execute( Walker walker, ShardStrategy shardStrategy ) {
|
||||
public Object execute( Walker walker, ShardStrategy shardStrategy, int maxIterations ) {
|
||||
// Fast fail for walkers not supporting TreeReducible interface.
|
||||
if (!( walker instanceof TreeReducible ))
|
||||
throw new IllegalArgumentException("Hierarchical microscheduler only works with TreeReducible walkers");
|
||||
|
||||
// Having maxiterations in the execute method is a holdover from the old TraversalEngine days.
|
||||
// Lets do something else with this.
|
||||
traversalEngine.setMaximumIterations(maxIterations);
|
||||
|
||||
ReduceTree reduceTree = new ReduceTree(this);
|
||||
|
||||
walker.initialize();
|
||||
|
|
|
|||
|
|
@ -6,10 +6,6 @@ import org.broadinstitute.sting.gatk.datasources.shards.ShardStrategy;
|
|||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.ReferenceOrderedDataSource;
|
||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||
import org.broadinstitute.sting.gatk.walkers.Walker;
|
||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedDatum;
|
||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedData;
|
||||
import org.broadinstitute.sting.gatk.Reads;
|
||||
import org.broadinstitute.sting.utils.GenomeLocSortedSet;
|
||||
import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
|
||||
|
||||
import java.util.Collection;
|
||||
|
|
@ -35,7 +31,11 @@ public class LinearMicroScheduler extends MicroScheduler {
|
|||
* @param walker Computation to perform over dataset.
|
||||
* @param shardStrategy A strategy for sharding the data.
|
||||
*/
|
||||
public Object execute(Walker walker, ShardStrategy shardStrategy) {
|
||||
public Object execute(Walker walker, ShardStrategy shardStrategy, int maxIterations) {
|
||||
// Having maxiterations in the execute method is a holdover from the old TraversalEngine days.
|
||||
// Lets do something else with this.
|
||||
traversalEngine.setMaximumIterations(maxIterations);
|
||||
|
||||
walker.initialize();
|
||||
Accumulator accumulator = Accumulator.create(walker);
|
||||
|
||||
|
|
|
|||
|
|
@ -25,9 +25,6 @@
|
|||
|
||||
package org.broadinstitute.sting.gatk.executive;
|
||||
|
||||
import net.sf.picard.reference.ReferenceSequenceFile;
|
||||
import net.sf.samtools.SAMSequenceDictionary;
|
||||
import net.sf.samtools.SAMSequenceRecord;
|
||||
import org.apache.log4j.Logger;
|
||||
import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
|
||||
import org.broadinstitute.sting.gatk.datasources.shards.Shard;
|
||||
|
|
@ -36,7 +33,6 @@ import org.broadinstitute.sting.gatk.datasources.simpleDataSources.ReferenceOrde
|
|||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||
import org.broadinstitute.sting.gatk.traversals.*;
|
||||
import org.broadinstitute.sting.gatk.walkers.*;
|
||||
import org.broadinstitute.sting.utils.Utils;
|
||||
import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
|
||||
|
||||
import java.util.*;
|
||||
|
|
@ -91,6 +87,10 @@ public abstract class MicroScheduler {
|
|||
* @param rods the rods to include in the traversal
|
||||
*/
|
||||
protected MicroScheduler(Walker walker, SAMDataSource reads, IndexedFastaSequenceFile reference, Collection<ReferenceOrderedDataSource> rods) {
|
||||
this.reads = reads;
|
||||
this.reference = reference;
|
||||
this.rods = rods;
|
||||
|
||||
if (walker instanceof ReadWalker) {
|
||||
traversalEngine = new TraverseReads();
|
||||
} else if (walker instanceof LocusWalker) {
|
||||
|
|
@ -102,29 +102,10 @@ public abstract class MicroScheduler {
|
|||
} else {
|
||||
throw new UnsupportedOperationException("Unable to determine traversal type, the walker is an unknown type.");
|
||||
}
|
||||
this.reads = reads;
|
||||
this.reference = reference;
|
||||
this.rods = rods;
|
||||
|
||||
validate(this.reads,this.reference);
|
||||
|
||||
// Side effect: initialize the traversal engine with reads data.
|
||||
// TODO: Give users a dedicated way of getting the header so that the MicroScheduler
|
||||
// doesn't have to bend over backward providing legacy getters and setters.
|
||||
traversalEngine.setSAMHeader(reads.getHeader());
|
||||
traversalEngine.initialize();
|
||||
}
|
||||
|
||||
/**
|
||||
* A temporary getter for the traversal engine. In the future, clients
|
||||
* of the microscheduler shouldn't need to know anything about the traversal engine.
|
||||
*
|
||||
* @return The traversal engine.
|
||||
*/
|
||||
public TraversalEngine getTraversalEngine() {
|
||||
return traversalEngine;
|
||||
}
|
||||
|
||||
/**
|
||||
* Walks a walker over the given list of intervals.
|
||||
*
|
||||
|
|
@ -133,7 +114,7 @@ public abstract class MicroScheduler {
|
|||
*
|
||||
* @return the return type of the walker
|
||||
*/
|
||||
public abstract Object execute(Walker walker, ShardStrategy shardStrategy);
|
||||
public abstract Object execute(Walker walker, ShardStrategy shardStrategy, int iterations );
|
||||
|
||||
|
||||
/**
|
||||
|
|
@ -174,68 +155,4 @@ public abstract class MicroScheduler {
|
|||
* @return The reference maintained by this scheduler.
|
||||
*/
|
||||
public IndexedFastaSequenceFile getReference() { return reference; }
|
||||
|
||||
/**
|
||||
* Now that all files are open, validate the sequence dictionaries of the reads vs. the reference.
|
||||
* TODO: Doing this in the MicroScheduler is a bit late, but this is where data sources are initialized.
|
||||
* TODO: Move the initialization of data sources back to the GenomeAnalysisEngine.
|
||||
* @param reads Reads data source.
|
||||
* @param reference Reference data source.
|
||||
*/
|
||||
private void validate( SAMDataSource reads, ReferenceSequenceFile reference ) {
|
||||
if( reads == null || reference == null )
|
||||
return;
|
||||
|
||||
// Compile a set of sequence names that exist in the BAM files.
|
||||
SAMSequenceDictionary readsDictionary = reads.getHeader().getSequenceDictionary();
|
||||
|
||||
Set<String> readsSequenceNames = new TreeSet<String>();
|
||||
for( SAMSequenceRecord dictionaryEntry: readsDictionary.getSequences() )
|
||||
readsSequenceNames.add(dictionaryEntry.getSequenceName());
|
||||
|
||||
// Compile a set of sequence names that exist in the reference file.
|
||||
SAMSequenceDictionary referenceDictionary = reference.getSequenceDictionary();
|
||||
|
||||
Set<String> referenceSequenceNames = new TreeSet<String>();
|
||||
for( SAMSequenceRecord dictionaryEntry: referenceDictionary.getSequences() )
|
||||
referenceSequenceNames.add(dictionaryEntry.getSequenceName());
|
||||
|
||||
if( readsSequenceNames.size() == 0 ) {
|
||||
logger.info("Reads file is unmapped. Skipping validation against reference.");
|
||||
return;
|
||||
}
|
||||
|
||||
// If there's no overlap between reads and reference, data will be bogus. Throw an exception.
|
||||
Set<String> intersectingSequenceNames = new HashSet<String>(readsSequenceNames);
|
||||
intersectingSequenceNames.retainAll(referenceSequenceNames);
|
||||
if( intersectingSequenceNames.size() == 0 ) {
|
||||
StringBuilder error = new StringBuilder();
|
||||
error.append("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
||||
error.append(System.getProperty("line.separator"));
|
||||
error.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
||||
error.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
||||
logger.error(error.toString());
|
||||
Utils.scareUser("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference.");
|
||||
}
|
||||
|
||||
// If the two datasets are not equal and neither is a strict subset of the other, warn the user.
|
||||
if( !readsSequenceNames.equals(referenceSequenceNames) &&
|
||||
!readsSequenceNames.containsAll(referenceSequenceNames) &&
|
||||
!referenceSequenceNames.containsAll(readsSequenceNames)) {
|
||||
StringBuilder warning = new StringBuilder();
|
||||
warning.append("Limited overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
||||
warning.append(System.getProperty("line.separator"));
|
||||
warning.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
||||
warning.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
||||
logger.warn(warning.toString());
|
||||
}
|
||||
}
|
||||
|
||||
private String prettyPrintSequenceRecords( SAMSequenceDictionary sequenceDictionary ) {
|
||||
String[] sequenceRecordNames = new String[ sequenceDictionary.size() ];
|
||||
int sequenceRecordIndex = 0;
|
||||
for( SAMSequenceRecord sequenceRecord: sequenceDictionary.getSequences() )
|
||||
sequenceRecordNames[sequenceRecordIndex++] = sequenceRecord.getSequenceName();
|
||||
return Arrays.deepToString(sequenceRecordNames);
|
||||
}
|
||||
}
|
||||
|
|
|
|||
|
|
@ -1,10 +1,8 @@
|
|||
package org.broadinstitute.sting.gatk.traversals;
|
||||
|
||||
import net.sf.samtools.SAMFileHeader;
|
||||
import org.apache.log4j.Logger;
|
||||
import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
|
||||
import org.broadinstitute.sting.gatk.datasources.shards.Shard;
|
||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||
import org.broadinstitute.sting.gatk.walkers.Walker;
|
||||
import org.broadinstitute.sting.utils.GenomeLoc;
|
||||
|
||||
|
|
@ -20,9 +18,6 @@ public abstract class TraversalEngine {
|
|||
// Maximum number of reads to process before finishing
|
||||
protected long maximumIterations = -1;
|
||||
|
||||
// the stored header
|
||||
private SAMFileHeader myHeader = null;
|
||||
|
||||
/** our log, which we want to capture anything from this class */
|
||||
protected static Logger logger = Logger.getLogger(TraversalEngine.class);
|
||||
|
||||
|
|
@ -34,27 +29,6 @@ public abstract class TraversalEngine {
|
|||
this.maximumIterations = maximumIterations;
|
||||
}
|
||||
|
||||
/**
|
||||
* get the associated SAM header for our run
|
||||
*
|
||||
* @return the header if it's stored, null if not
|
||||
*/
|
||||
public SAMFileHeader getSAMHeader() {
|
||||
return myHeader;
|
||||
}
|
||||
|
||||
/**
|
||||
* set's the SAM header for this traversal, which should
|
||||
* be the merged header in the multiple BAM file case.
|
||||
*
|
||||
* @param myHeader the passed in header
|
||||
*/
|
||||
|
||||
public void setSAMHeader(SAMFileHeader myHeader) {
|
||||
this.myHeader = myHeader;
|
||||
}
|
||||
|
||||
|
||||
/**
|
||||
* @param curTime (current runtime, in millisecs)
|
||||
*
|
||||
|
|
|
|||
|
|
@ -75,7 +75,7 @@ public class PrintReadsWalker extends ReadWalker<SAMRecord, SAMFileWriter> {
|
|||
if ( platform != null ) {
|
||||
Object readGroupAttr = read.getAttribute("RG");
|
||||
if ( readGroupAttr != null ) {
|
||||
SAMReadGroupRecord readGroup = getToolkit().getEngine().getSAMHeader().getReadGroup(readGroupAttr.toString());
|
||||
SAMReadGroupRecord readGroup = getToolkit().getSAMFileHeader().getReadGroup(readGroupAttr.toString());
|
||||
if ( readGroup != null ) {
|
||||
Object readPlatformAttr = readGroup.getAttribute("PL");
|
||||
if ( readPlatformAttr != null )
|
||||
|
|
|
|||
|
|
@ -26,20 +26,11 @@
|
|||
package org.broadinstitute.sting.gatk.walkers;
|
||||
|
||||
import net.sf.samtools.*;
|
||||
import org.broadinstitute.sting.gatk.walkers.WalkerName;
|
||||
import org.broadinstitute.sting.gatk.walkers.ReadWalker;
|
||||
import org.broadinstitute.sting.gatk.walkers.Requires;
|
||||
import org.broadinstitute.sting.gatk.walkers.DataSource;
|
||||
import org.broadinstitute.sting.gatk.walkers.recalibration.*;
|
||||
import org.broadinstitute.sting.utils.cmdLine.Argument;
|
||||
import org.broadinstitute.sting.utils.*;
|
||||
import org.apache.log4j.Logger;
|
||||
|
||||
import java.util.*;
|
||||
import java.util.regex.Pattern;
|
||||
import java.util.regex.Matcher;
|
||||
import java.io.File;
|
||||
import java.io.FileNotFoundException;
|
||||
|
||||
@WalkerName("SplitSamFile")
|
||||
@Requires({DataSource.READS})
|
||||
|
|
@ -74,10 +65,10 @@ public class SplitSamFileWalker extends ReadWalker<SAMRecord, Map<String, SAMFil
|
|||
|
||||
public Map<String, SAMFileWriter> reduceInit() {
|
||||
HashMap<String, SAMFileHeader> headers = new HashMap<String, SAMFileHeader>();
|
||||
for ( SAMReadGroupRecord readGroup : this.getToolkit().getEngine().getSAMHeader().getReadGroups()) {
|
||||
for ( SAMReadGroupRecord readGroup : this.getToolkit().getSAMFileHeader().getReadGroups()) {
|
||||
final String sample = readGroup.getSample();
|
||||
if ( ! headers.containsKey(sample) ) {
|
||||
SAMFileHeader header = Utils.copySAMFileHeader(this.getToolkit().getEngine().getSAMHeader());
|
||||
SAMFileHeader header = Utils.copySAMFileHeader(this.getToolkit().getSAMFileHeader());
|
||||
logger.debug(String.format("Creating BAM header for sample %s", sample));
|
||||
ArrayList<SAMReadGroupRecord> readGroups = new ArrayList<SAMReadGroupRecord>();
|
||||
header.setReadGroups(readGroups);
|
||||
|
|
|
|||
|
|
@ -61,7 +61,6 @@ public class IntervalCleanerWalker extends LocusWindowWalker<Integer, Integer>
|
|||
if ( MISMATCH_THRESHOLD <= 0.0 || MISMATCH_THRESHOLD > 1.0 )
|
||||
throw new RuntimeException("Entropy threshold must be a fraction between 0 and 1");
|
||||
|
||||
SAMFileHeader header = getToolkit().getEngine().getSAMHeader();
|
||||
if ( writer != null ) {
|
||||
readsToWrite = new TreeSet<ComparableSAMRecord>();
|
||||
}
|
||||
|
|
@ -888,7 +887,7 @@ public class IntervalCleanerWalker extends LocusWindowWalker<Integer, Integer>
|
|||
String reference = "AAAAAACCCCCCAAAAAA";
|
||||
// the alternate reference is: "AAAAAACCCTTCCCAAAAAA";
|
||||
ArrayList<SAMRecord> reads = new ArrayList<SAMRecord>();
|
||||
SAMFileHeader header = getToolkit().getEngine().getSAMHeader();
|
||||
SAMFileHeader header = getToolkit().getSAMFileHeader();
|
||||
SAMRecord r1 = new SAMRecord(header);
|
||||
r1.setReadName("1");
|
||||
r1.setReadString("AACCCCCC");
|
||||
|
|
@ -938,7 +937,7 @@ public class IntervalCleanerWalker extends LocusWindowWalker<Integer, Integer>
|
|||
String reference = "AAAAAACCCTTCCCAAAAAA";
|
||||
// the alternate reference is: "AAAAAACCCCCCAAAAAA";
|
||||
ArrayList<SAMRecord> reads = new ArrayList<SAMRecord>();
|
||||
SAMFileHeader header = getToolkit().getEngine().getSAMHeader();
|
||||
SAMFileHeader header = getToolkit().getSAMFileHeader();
|
||||
SAMRecord r1 = new SAMRecord(header);
|
||||
r1.setReadName("1");
|
||||
r1.setReadString("ACCCTTCC");
|
||||
|
|
|
|||
|
|
@ -50,7 +50,7 @@ public class CovariateCounterWalker extends LocusWalker<Integer, PrintStream> {
|
|||
*/
|
||||
public void initialize() {
|
||||
Set<String> readGroups = new HashSet<String>();
|
||||
for (SAMReadGroupRecord readGroup : this.getToolkit().getEngine().getSAMHeader().getReadGroups()) {
|
||||
for (SAMReadGroupRecord readGroup : this.getToolkit().getSAMFileHeader().getReadGroups()) {
|
||||
if( readGroup.getAttribute("PL") == null )
|
||||
Utils.warnUser(String.format("PL attribute for read group %s is unset; assuming all reads are supported",readGroup.getReadGroupId()));
|
||||
if( !isSupportedReadGroup(readGroup) )
|
||||
|
|
|
|||
|
|
@ -25,7 +25,7 @@ public class CoverageBySample extends LocusWalker<String, String>
|
|||
public void initialize()
|
||||
{
|
||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||
this.header = toolkit.getEngine().getSAMHeader();
|
||||
this.header = toolkit.getSAMFileHeader();
|
||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||
|
||||
sample_names = new ArrayList<String>();
|
||||
|
|
|
|||
|
|
@ -53,7 +53,7 @@ public class IOCrusherWalker extends ReadWalker<SAMRecord, ArrayList<SAMFileWrit
|
|||
public ArrayList<SAMFileWriter> reduceInit() {
|
||||
ArrayList<SAMFileWriter> outputs = new ArrayList<SAMFileWriter>(nWaysOut);
|
||||
for ( int i = 0; i < nWaysOut; i++ ) {
|
||||
SAMFileHeader header = this.getToolkit().getEngine().getSAMHeader();
|
||||
SAMFileHeader header = this.getToolkit().getSAMFileHeader();
|
||||
outputs.add(Utils.createSAMFileWriterWithCompression(header, true, outputBase + "." + i + ".bam", BAMcompression));
|
||||
}
|
||||
return outputs;
|
||||
|
|
|
|||
|
|
@ -16,7 +16,7 @@ public class ListSampleIds extends LocusWalker<Boolean, Boolean>
|
|||
public void initialize()
|
||||
{
|
||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||
SAMFileHeader header = toolkit.getEngine().getSAMHeader();
|
||||
SAMFileHeader header = toolkit.getSAMFileHeader();
|
||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||
|
||||
for (int i = 0; i < read_groups.size(); i++)
|
||||
|
|
|
|||
|
|
@ -90,7 +90,7 @@ public class MultiSampleCaller extends LocusWalker<MultiSampleCaller.MultiSample
|
|||
|
||||
|
||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||
this.header = toolkit.getEngine().getSAMHeader();
|
||||
this.header = toolkit.getSAMFileHeader();
|
||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||
|
||||
sample_names = new ArrayList<String>();
|
||||
|
|
|
|||
|
|
@ -34,7 +34,7 @@ public class PoolCallingExperiment extends LocusWalker<AlleleFrequencyEstimate,
|
|||
public void initialize()
|
||||
{
|
||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||
SAMFileHeader header = toolkit.getEngine().getSAMHeader();
|
||||
SAMFileHeader header = toolkit.getSAMFileHeader();
|
||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||
|
||||
sample_names = new ArrayList<String>();
|
||||
|
|
|
|||
|
|
@ -259,7 +259,7 @@ public class SingleSampleGenotyper extends LocusWalker<GenotypeCall, GenotypeWri
|
|||
* @return an empty string
|
||||
*/
|
||||
public GenotypeWriter reduceInit() {
|
||||
return GenotypeWriterFactory.create(VAR_FORMAT, GenomeAnalysisEngine.instance.getEngine().getSAMHeader(), VARIANTS_FILE);
|
||||
return GenotypeWriterFactory.create(VAR_FORMAT, GenomeAnalysisEngine.instance.getSAMFileHeader(), VARIANTS_FILE);
|
||||
|
||||
}
|
||||
|
||||
|
|
|
|||
Loading…
Reference in New Issue