A bit of reorganization to help with more flexible output streams. Pushed construction of data
sources and post-construction validation back into the GATKEngine, leaving the MicroScheduler to just microschedule. git-svn-id: file:///humgen/gsa-scr1/gsa-engineering/svn_contents/trunk@1336 348d0f76-0448-11de-a6fe-93d51630548a
This commit is contained in:
parent
bca894ebce
commit
5429b4d4a8
|
|
@ -26,11 +26,9 @@
|
||||||
package org.broadinstitute.sting.gatk;
|
package org.broadinstitute.sting.gatk;
|
||||||
|
|
||||||
import net.sf.picard.reference.ReferenceSequenceFile;
|
import net.sf.picard.reference.ReferenceSequenceFile;
|
||||||
import net.sf.picard.reference.ReferenceSequenceFileFactory;
|
|
||||||
import net.sf.picard.sam.SamFileHeaderMerger;
|
import net.sf.picard.sam.SamFileHeaderMerger;
|
||||||
import net.sf.picard.filter.SamRecordFilter;
|
import net.sf.picard.filter.SamRecordFilter;
|
||||||
import net.sf.samtools.SAMFileReader;
|
import net.sf.samtools.*;
|
||||||
import net.sf.samtools.SAMReadGroupRecord;
|
|
||||||
|
|
||||||
import org.apache.log4j.Logger;
|
import org.apache.log4j.Logger;
|
||||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||||
|
|
@ -40,7 +38,6 @@ import org.broadinstitute.sting.gatk.datasources.shards.ShardStrategyFactory;
|
||||||
import org.broadinstitute.sting.gatk.executive.MicroScheduler;
|
import org.broadinstitute.sting.gatk.executive.MicroScheduler;
|
||||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedData;
|
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedData;
|
||||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedDatum;
|
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedDatum;
|
||||||
import org.broadinstitute.sting.gatk.traversals.TraversalEngine;
|
|
||||||
import org.broadinstitute.sting.gatk.walkers.*;
|
import org.broadinstitute.sting.gatk.walkers.*;
|
||||||
import org.broadinstitute.sting.gatk.filters.ZeroMappingQualityReadFilter;
|
import org.broadinstitute.sting.gatk.filters.ZeroMappingQualityReadFilter;
|
||||||
import org.broadinstitute.sting.utils.*;
|
import org.broadinstitute.sting.utils.*;
|
||||||
|
|
@ -58,9 +55,20 @@ public class GenomeAnalysisEngine {
|
||||||
// TODO: public static without final tends to indicate we're thinking about this the wrong way
|
// TODO: public static without final tends to indicate we're thinking about this the wrong way
|
||||||
public static GenomeAnalysisEngine instance;
|
public static GenomeAnalysisEngine instance;
|
||||||
|
|
||||||
// our traversal engine
|
/**
|
||||||
private TraversalEngine engine = null;
|
* Accessor for sharded read data.
|
||||||
private SAMDataSource dataSource = null;
|
*/
|
||||||
|
private SAMDataSource readsDataSource = null;
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Accessor for sharded reference data.
|
||||||
|
*/
|
||||||
|
private IndexedFastaSequenceFile referenceDataSource = null;
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Accessor for sharded reference-ordered data.
|
||||||
|
*/
|
||||||
|
private List<ReferenceOrderedDataSource> rodDataSources;
|
||||||
|
|
||||||
// our argument collection
|
// our argument collection
|
||||||
private GATKArgumentCollection argCollection;
|
private GATKArgumentCollection argCollection;
|
||||||
|
|
@ -105,55 +113,24 @@ public class GenomeAnalysisEngine {
|
||||||
// save our argument parameter
|
// save our argument parameter
|
||||||
this.argCollection = args;
|
this.argCollection = args;
|
||||||
|
|
||||||
// our reference ordered data collection
|
// Prepare the data for traversal.
|
||||||
List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods = new ArrayList<ReferenceOrderedData<? extends ReferenceOrderedDatum>>();
|
initializeDataSources( my_walker, argCollection );
|
||||||
|
|
||||||
//
|
|
||||||
// please don't use these in the future, use the new syntax <- if we're not using these please remove them
|
|
||||||
//
|
|
||||||
if (argCollection.DBSNPFile != null) bindConvenienceRods("dbSNP", "dbsnp", argCollection.DBSNPFile);
|
|
||||||
if (argCollection.HAPMAPFile != null)
|
|
||||||
bindConvenienceRods("hapmap", "HapMapAlleleFrequencies", argCollection.HAPMAPFile);
|
|
||||||
if (argCollection.HAPMAPChipFile != null)
|
|
||||||
bindConvenienceRods("hapmap-chip", "GFF", argCollection.HAPMAPChipFile);
|
|
||||||
// TODO: The ROD iterator currently does not understand multiple intervals file. Fix this by cleaning the ROD system.
|
|
||||||
if (argCollection.intervals != null && argCollection.intervals.size() == 1) {
|
|
||||||
bindConvenienceRods("interval", "Intervals", argCollection.intervals.get(0).replaceAll(",", ""));
|
|
||||||
}
|
|
||||||
|
|
||||||
// parse out the rod bindings
|
|
||||||
ReferenceOrderedData.parseBindings(logger, argCollection.RODBindings, rods);
|
|
||||||
|
|
||||||
// Validate the walker inputs against the walker.
|
|
||||||
validateInputsAgainstWalker(my_walker, argCollection, rods);
|
|
||||||
|
|
||||||
// our microscheduler, which is in charge of running everything
|
// our microscheduler, which is in charge of running everything
|
||||||
MicroScheduler microScheduler = createMicroscheduler(my_walker, rods);
|
MicroScheduler microScheduler = createMicroscheduler(my_walker);
|
||||||
|
|
||||||
// create the output streams
|
// create the output streams
|
||||||
initializeOutputStreams(my_walker);
|
initializeOutputStreams(my_walker);
|
||||||
|
|
||||||
// Prepare the sort ordering w.r.t. the sequence dictionary
|
|
||||||
if (argCollection.referenceFile != null) {
|
|
||||||
final ReferenceSequenceFile refFile = ReferenceSequenceFileFactory.getReferenceSequenceFile(argCollection.referenceFile);
|
|
||||||
GenomeLocParser.setupRefContigOrdering(refFile);
|
|
||||||
}
|
|
||||||
|
|
||||||
logger.info("Strictness is " + argCollection.strictnessLevel);
|
|
||||||
|
|
||||||
// perform validation steps that are common to all the engines
|
|
||||||
engine.setMaximumIterations(argCollection.maximumEngineIterations);
|
|
||||||
engine.initialize();
|
|
||||||
|
|
||||||
GenomeLocSortedSet locs = null;
|
GenomeLocSortedSet locs = null;
|
||||||
if (argCollection.intervals != null) {
|
if (argCollection.intervals != null) {
|
||||||
locs = GenomeLocSortedSet.createSetFromList(parseIntervalRegion(argCollection.intervals));
|
locs = GenomeLocSortedSet.createSetFromList(parseIntervalRegion(argCollection.intervals));
|
||||||
}
|
}
|
||||||
|
|
||||||
ShardStrategy shardStrategy = this.getShardStrategy(my_walker, microScheduler.getReference(), locs, argCollection.maximumEngineIterations);
|
ShardStrategy shardStrategy = getShardStrategy(my_walker, microScheduler.getReference(), locs, argCollection.maximumEngineIterations);
|
||||||
|
|
||||||
// execute the microscheduler, storing the results
|
// execute the microscheduler, storing the results
|
||||||
return microScheduler.execute(my_walker, shardStrategy);
|
return microScheduler.execute(my_walker, shardStrategy, argCollection.maximumEngineIterations);
|
||||||
}
|
}
|
||||||
|
|
||||||
/**
|
/**
|
||||||
|
|
@ -182,28 +159,49 @@ public class GenomeAnalysisEngine {
|
||||||
return walkerManager.createWalkerByName(walkerName);
|
return walkerManager.createWalkerByName(walkerName);
|
||||||
}
|
}
|
||||||
|
|
||||||
|
private void initializeDataSources( Walker my_walker, GATKArgumentCollection argCollection ) {
|
||||||
|
validateSuppliedReadsAgainstWalker( my_walker, argCollection );
|
||||||
|
logger.info("Strictness is " + argCollection.strictnessLevel);
|
||||||
|
readsDataSource = createReadsDataSource(extractSourceInfo(my_walker,argCollection));
|
||||||
|
|
||||||
|
validateSuppliedReferenceAgainstWalker( my_walker, argCollection );
|
||||||
|
referenceDataSource = openReferenceSequenceFile(argCollection.referenceFile);
|
||||||
|
|
||||||
|
validateReadsAndReferenceAreCompatible(readsDataSource, referenceDataSource);
|
||||||
|
|
||||||
|
// our reference ordered data collection
|
||||||
|
List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods = new ArrayList<ReferenceOrderedData<? extends ReferenceOrderedDatum>>();
|
||||||
|
|
||||||
|
//
|
||||||
|
// please don't use these in the future, use the new syntax <- if we're not using these please remove them
|
||||||
|
//
|
||||||
|
if (argCollection.DBSNPFile != null) bindConvenienceRods("dbSNP", "dbsnp", argCollection.DBSNPFile);
|
||||||
|
if (argCollection.HAPMAPFile != null)
|
||||||
|
bindConvenienceRods("hapmap", "HapMapAlleleFrequencies", argCollection.HAPMAPFile);
|
||||||
|
if (argCollection.HAPMAPChipFile != null)
|
||||||
|
bindConvenienceRods("hapmap-chip", "GFF", argCollection.HAPMAPChipFile);
|
||||||
|
// TODO: The ROD iterator currently does not understand multiple intervals file. Fix this by cleaning the ROD system.
|
||||||
|
if (argCollection.intervals != null && argCollection.intervals.size() == 1) {
|
||||||
|
bindConvenienceRods("interval", "Intervals", argCollection.intervals.get(0).replaceAll(",", ""));
|
||||||
|
}
|
||||||
|
|
||||||
|
// parse out the rod bindings
|
||||||
|
ReferenceOrderedData.parseBindings(logger, argCollection.RODBindings, rods);
|
||||||
|
|
||||||
|
validateSuppliedReferenceOrderedDataAgainstWalker( my_walker, rods );
|
||||||
|
|
||||||
|
rodDataSources = getReferenceOrderedDataSources(rods);
|
||||||
|
}
|
||||||
|
|
||||||
/**
|
/**
|
||||||
* setup a microscheduler
|
* setup a microscheduler
|
||||||
*
|
|
||||||
* @param my_walker our walker of type LocusWalker
|
* @param my_walker our walker of type LocusWalker
|
||||||
* @param rods the reference order data
|
|
||||||
*
|
|
||||||
* @return a new microscheduler
|
* @return a new microscheduler
|
||||||
*/
|
*/
|
||||||
private MicroScheduler createMicroscheduler(Walker my_walker, List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods) {
|
private MicroScheduler createMicroscheduler(Walker my_walker) {
|
||||||
// the mircoscheduler to return
|
// the mircoscheduler to return
|
||||||
MicroScheduler microScheduler = null;
|
MicroScheduler microScheduler = null;
|
||||||
|
|
||||||
SAMDataSource readsDataSource = createReadsDataSource(extractSourceInfo(my_walker,argCollection));
|
|
||||||
IndexedFastaSequenceFile referenceDataSource = openReferenceSequenceFile(argCollection.referenceFile);
|
|
||||||
List<ReferenceOrderedDataSource> rodDataSources = getReferenceOrderedDataSources(rods);
|
|
||||||
|
|
||||||
GenomeLocSortedSet locs = null;
|
|
||||||
if (argCollection.intervals != null) {
|
|
||||||
locs = GenomeLocSortedSet.createSetFromList(parseIntervalRegion(argCollection.intervals));
|
|
||||||
}
|
|
||||||
|
|
||||||
// we need to verify different parameter based on the walker type
|
// we need to verify different parameter based on the walker type
|
||||||
if (my_walker instanceof LocusWalker || my_walker instanceof LocusWindowWalker) {
|
if (my_walker instanceof LocusWalker || my_walker instanceof LocusWindowWalker) {
|
||||||
// create the MicroScheduler
|
// create the MicroScheduler
|
||||||
|
|
@ -216,9 +214,6 @@ public class GenomeAnalysisEngine {
|
||||||
Utils.scareUser(String.format("Unable to create the appropriate TraversalEngine for analysis type " + argCollection.analysisName));
|
Utils.scareUser(String.format("Unable to create the appropriate TraversalEngine for analysis type " + argCollection.analysisName));
|
||||||
}
|
}
|
||||||
|
|
||||||
dataSource = microScheduler.getSAMDataSource();
|
|
||||||
engine = microScheduler.getTraversalEngine();
|
|
||||||
|
|
||||||
return microScheduler;
|
return microScheduler;
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
@ -351,23 +346,43 @@ public class GenomeAnalysisEngine {
|
||||||
filters );
|
filters );
|
||||||
}
|
}
|
||||||
|
|
||||||
private void validateInputsAgainstWalker(Walker walker,
|
/**
|
||||||
GATKArgumentCollection arguments,
|
* Verifies that the supplied set of reads files mesh with what the walker says it requires.
|
||||||
List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods) {
|
* @param walker Walker to test.
|
||||||
String walkerName = WalkerManager.getWalkerName(walker.getClass());
|
* @param arguments Supplied reads files.
|
||||||
|
*/
|
||||||
|
private void validateSuppliedReadsAgainstWalker( Walker walker, GATKArgumentCollection arguments ) {
|
||||||
// Check what the walker says is required against what was provided on the command line.
|
// Check what the walker says is required against what was provided on the command line.
|
||||||
if (WalkerManager.isRequired(walker, DataSource.READS) && (arguments.samFiles == null || arguments.samFiles.size() == 0))
|
if (WalkerManager.isRequired(walker, DataSource.READS) && (arguments.samFiles == null || arguments.samFiles.size() == 0))
|
||||||
throw new ArgumentException(String.format("Walker %s requires reads but none were provided. If this is incorrect, alter the walker's @Requires annotation.", walkerName));
|
throw new ArgumentException("Walker requires reads but none were provided. If this is incorrect, alter the walker's @Requires annotation.");
|
||||||
if (WalkerManager.isRequired(walker, DataSource.REFERENCE) && arguments.referenceFile == null)
|
|
||||||
throw new ArgumentException(String.format("Walker %s requires a reference but none was provided. If this is incorrect, alter the walker's @Requires annotation.", walkerName));
|
|
||||||
|
|
||||||
// Check what the walker says is allowed against what was provided on the command line.
|
// Check what the walker says is allowed against what was provided on the command line.
|
||||||
if ((arguments.samFiles != null && arguments.samFiles.size() > 0) && !WalkerManager.isAllowed(walker, DataSource.READS))
|
if ((arguments.samFiles != null && arguments.samFiles.size() > 0) && !WalkerManager.isAllowed(walker, DataSource.READS))
|
||||||
throw new ArgumentException(String.format("Walker %s does not allow reads but reads were provided. If this is incorrect, alter the walker's @Allows annotation", walkerName));
|
throw new ArgumentException("Walker does not allow reads but reads were provided. If this is incorrect, alter the walker's @Allows annotation");
|
||||||
if (arguments.referenceFile != null && !WalkerManager.isAllowed(walker, DataSource.REFERENCE))
|
}
|
||||||
throw new ArgumentException(String.format("Walker %s does not allow a reference but one was provided. If this is incorrect, alter the walker's @Allows annotation", walkerName));
|
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Verifies that the supplied reference file mesh with what the walker says it requires.
|
||||||
|
* @param walker Walker to test.
|
||||||
|
* @param arguments Supplied reads files.
|
||||||
|
*/
|
||||||
|
private void validateSuppliedReferenceAgainstWalker( Walker walker, GATKArgumentCollection arguments ) {
|
||||||
|
// Check what the walker says is required against what was provided on the command line.
|
||||||
|
if (WalkerManager.isRequired(walker, DataSource.REFERENCE) && arguments.referenceFile == null)
|
||||||
|
throw new ArgumentException("Walker requires a reference but none was provided. If this is incorrect, alter the walker's @Requires annotation.");
|
||||||
|
|
||||||
|
// Check what the walker says is allowed against what was provided on the command line.
|
||||||
|
if (arguments.referenceFile != null && !WalkerManager.isAllowed(walker, DataSource.REFERENCE))
|
||||||
|
throw new ArgumentException("Walker does not allow a reference but one was provided. If this is incorrect, alter the walker's @Allows annotation");
|
||||||
|
}
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Verifies that all required reference-ordered data has been supplied, and any reference-ordered data that was not
|
||||||
|
* 'allowed' is still present.
|
||||||
|
* @param walker Walker to test.
|
||||||
|
* @param rods Reference-ordered data to load.
|
||||||
|
*/
|
||||||
|
private void validateSuppliedReferenceOrderedDataAgainstWalker( Walker walker, List<ReferenceOrderedData<? extends ReferenceOrderedDatum>> rods ) {
|
||||||
// Check to make sure that all required metadata is present.
|
// Check to make sure that all required metadata is present.
|
||||||
List<RMD> allRequired = WalkerManager.getRequiredMetaData(walker);
|
List<RMD> allRequired = WalkerManager.getRequiredMetaData(walker);
|
||||||
for (RMD required : allRequired) {
|
for (RMD required : allRequired) {
|
||||||
|
|
@ -383,10 +398,73 @@ public class GenomeAnalysisEngine {
|
||||||
// Check to see that no forbidden rods are present.
|
// Check to see that no forbidden rods are present.
|
||||||
for (ReferenceOrderedData<? extends ReferenceOrderedDatum> rod : rods) {
|
for (ReferenceOrderedData<? extends ReferenceOrderedDatum> rod : rods) {
|
||||||
if (!WalkerManager.isAllowed(walker, rod))
|
if (!WalkerManager.isAllowed(walker, rod))
|
||||||
throw new ArgumentException(String.format("Walker does not allow access to metadata: %s. If this is correct, change the @Allows metadata", rod.getName()));
|
throw new ArgumentException(String.format("Walker does not allow access to metadata: %s. If this is incorrect, change the @Allows metadata", rod.getName()));
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Now that all files are open, validate the sequence dictionaries of the reads vs. the reference.
|
||||||
|
* @param reads Reads data source.
|
||||||
|
* @param reference Reference data source.
|
||||||
|
*/
|
||||||
|
private void validateReadsAndReferenceAreCompatible( SAMDataSource reads, ReferenceSequenceFile reference ) {
|
||||||
|
if( reads == null || reference == null )
|
||||||
|
return;
|
||||||
|
|
||||||
|
// Compile a set of sequence names that exist in the BAM files.
|
||||||
|
SAMSequenceDictionary readsDictionary = reads.getHeader().getSequenceDictionary();
|
||||||
|
|
||||||
|
Set<String> readsSequenceNames = new TreeSet<String>();
|
||||||
|
for( SAMSequenceRecord dictionaryEntry: readsDictionary.getSequences() )
|
||||||
|
readsSequenceNames.add(dictionaryEntry.getSequenceName());
|
||||||
|
|
||||||
|
// Compile a set of sequence names that exist in the reference file.
|
||||||
|
SAMSequenceDictionary referenceDictionary = reference.getSequenceDictionary();
|
||||||
|
|
||||||
|
Set<String> referenceSequenceNames = new TreeSet<String>();
|
||||||
|
for( SAMSequenceRecord dictionaryEntry: referenceDictionary.getSequences() )
|
||||||
|
referenceSequenceNames.add(dictionaryEntry.getSequenceName());
|
||||||
|
|
||||||
|
if( readsSequenceNames.size() == 0 ) {
|
||||||
|
logger.info("Reads file is unmapped. Skipping validation against reference.");
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
|
// If there's no overlap between reads and reference, data will be bogus. Throw an exception.
|
||||||
|
Set<String> intersectingSequenceNames = new HashSet<String>(readsSequenceNames);
|
||||||
|
intersectingSequenceNames.retainAll(referenceSequenceNames);
|
||||||
|
if( intersectingSequenceNames.size() == 0 ) {
|
||||||
|
StringBuilder error = new StringBuilder();
|
||||||
|
error.append("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
||||||
|
error.append(System.getProperty("line.separator"));
|
||||||
|
error.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
||||||
|
error.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
||||||
|
logger.error(error.toString());
|
||||||
|
Utils.scareUser("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference.");
|
||||||
|
}
|
||||||
|
|
||||||
|
// If the two datasets are not equal and neither is a strict subset of the other, warn the user.
|
||||||
|
if( !readsSequenceNames.equals(referenceSequenceNames) &&
|
||||||
|
!readsSequenceNames.containsAll(referenceSequenceNames) &&
|
||||||
|
!referenceSequenceNames.containsAll(readsSequenceNames)) {
|
||||||
|
StringBuilder warning = new StringBuilder();
|
||||||
|
warning.append("Limited overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
||||||
|
warning.append(System.getProperty("line.separator"));
|
||||||
|
warning.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
||||||
|
warning.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
||||||
|
logger.warn(warning.toString());
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
private String prettyPrintSequenceRecords( SAMSequenceDictionary sequenceDictionary ) {
|
||||||
|
String[] sequenceRecordNames = new String[ sequenceDictionary.size() ];
|
||||||
|
int sequenceRecordIndex = 0;
|
||||||
|
for( SAMSequenceRecord sequenceRecord: sequenceDictionary.getSequences() )
|
||||||
|
sequenceRecordNames[sequenceRecordIndex++] = sequenceRecord.getSequenceName();
|
||||||
|
return Arrays.deepToString(sequenceRecordNames);
|
||||||
|
}
|
||||||
|
|
||||||
|
|
||||||
/**
|
/**
|
||||||
* Convenience function that binds RODs using the old-style command line parser to the new style list for
|
* Convenience function that binds RODs using the old-style command line parser to the new style list for
|
||||||
* a uniform processing.
|
* a uniform processing.
|
||||||
|
|
@ -532,8 +610,8 @@ public class GenomeAnalysisEngine {
|
||||||
return outputTracker;
|
return outputTracker;
|
||||||
}
|
}
|
||||||
|
|
||||||
public TraversalEngine getEngine() {
|
public SAMFileHeader getSAMFileHeader() {
|
||||||
return this.engine;
|
return readsDataSource.getHeader();
|
||||||
}
|
}
|
||||||
|
|
||||||
/**
|
/**
|
||||||
|
|
@ -542,7 +620,7 @@ public class GenomeAnalysisEngine {
|
||||||
* @return
|
* @return
|
||||||
*/
|
*/
|
||||||
public SAMDataSource getDataSource() {
|
public SAMDataSource getDataSource() {
|
||||||
return this.dataSource;
|
return this.readsDataSource;
|
||||||
}
|
}
|
||||||
|
|
||||||
/**
|
/**
|
||||||
|
|
|
||||||
|
|
@ -95,11 +95,15 @@ public class HierarchicalMicroScheduler extends MicroScheduler implements Hierar
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
public Object execute( Walker walker, ShardStrategy shardStrategy ) {
|
public Object execute( Walker walker, ShardStrategy shardStrategy, int maxIterations ) {
|
||||||
// Fast fail for walkers not supporting TreeReducible interface.
|
// Fast fail for walkers not supporting TreeReducible interface.
|
||||||
if (!( walker instanceof TreeReducible ))
|
if (!( walker instanceof TreeReducible ))
|
||||||
throw new IllegalArgumentException("Hierarchical microscheduler only works with TreeReducible walkers");
|
throw new IllegalArgumentException("Hierarchical microscheduler only works with TreeReducible walkers");
|
||||||
|
|
||||||
|
// Having maxiterations in the execute method is a holdover from the old TraversalEngine days.
|
||||||
|
// Lets do something else with this.
|
||||||
|
traversalEngine.setMaximumIterations(maxIterations);
|
||||||
|
|
||||||
ReduceTree reduceTree = new ReduceTree(this);
|
ReduceTree reduceTree = new ReduceTree(this);
|
||||||
|
|
||||||
walker.initialize();
|
walker.initialize();
|
||||||
|
|
|
||||||
|
|
@ -6,10 +6,6 @@ import org.broadinstitute.sting.gatk.datasources.shards.ShardStrategy;
|
||||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.ReferenceOrderedDataSource;
|
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.ReferenceOrderedDataSource;
|
||||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||||
import org.broadinstitute.sting.gatk.walkers.Walker;
|
import org.broadinstitute.sting.gatk.walkers.Walker;
|
||||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedDatum;
|
|
||||||
import org.broadinstitute.sting.gatk.refdata.ReferenceOrderedData;
|
|
||||||
import org.broadinstitute.sting.gatk.Reads;
|
|
||||||
import org.broadinstitute.sting.utils.GenomeLocSortedSet;
|
|
||||||
import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
|
import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
|
||||||
|
|
||||||
import java.util.Collection;
|
import java.util.Collection;
|
||||||
|
|
@ -35,7 +31,11 @@ public class LinearMicroScheduler extends MicroScheduler {
|
||||||
* @param walker Computation to perform over dataset.
|
* @param walker Computation to perform over dataset.
|
||||||
* @param shardStrategy A strategy for sharding the data.
|
* @param shardStrategy A strategy for sharding the data.
|
||||||
*/
|
*/
|
||||||
public Object execute(Walker walker, ShardStrategy shardStrategy) {
|
public Object execute(Walker walker, ShardStrategy shardStrategy, int maxIterations) {
|
||||||
|
// Having maxiterations in the execute method is a holdover from the old TraversalEngine days.
|
||||||
|
// Lets do something else with this.
|
||||||
|
traversalEngine.setMaximumIterations(maxIterations);
|
||||||
|
|
||||||
walker.initialize();
|
walker.initialize();
|
||||||
Accumulator accumulator = Accumulator.create(walker);
|
Accumulator accumulator = Accumulator.create(walker);
|
||||||
|
|
||||||
|
|
|
||||||
|
|
@ -25,9 +25,6 @@
|
||||||
|
|
||||||
package org.broadinstitute.sting.gatk.executive;
|
package org.broadinstitute.sting.gatk.executive;
|
||||||
|
|
||||||
import net.sf.picard.reference.ReferenceSequenceFile;
|
|
||||||
import net.sf.samtools.SAMSequenceDictionary;
|
|
||||||
import net.sf.samtools.SAMSequenceRecord;
|
|
||||||
import org.apache.log4j.Logger;
|
import org.apache.log4j.Logger;
|
||||||
import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
|
import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
|
||||||
import org.broadinstitute.sting.gatk.datasources.shards.Shard;
|
import org.broadinstitute.sting.gatk.datasources.shards.Shard;
|
||||||
|
|
@ -36,7 +33,6 @@ import org.broadinstitute.sting.gatk.datasources.simpleDataSources.ReferenceOrde
|
||||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
||||||
import org.broadinstitute.sting.gatk.traversals.*;
|
import org.broadinstitute.sting.gatk.traversals.*;
|
||||||
import org.broadinstitute.sting.gatk.walkers.*;
|
import org.broadinstitute.sting.gatk.walkers.*;
|
||||||
import org.broadinstitute.sting.utils.Utils;
|
|
||||||
import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
|
import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
|
||||||
|
|
||||||
import java.util.*;
|
import java.util.*;
|
||||||
|
|
@ -91,6 +87,10 @@ public abstract class MicroScheduler {
|
||||||
* @param rods the rods to include in the traversal
|
* @param rods the rods to include in the traversal
|
||||||
*/
|
*/
|
||||||
protected MicroScheduler(Walker walker, SAMDataSource reads, IndexedFastaSequenceFile reference, Collection<ReferenceOrderedDataSource> rods) {
|
protected MicroScheduler(Walker walker, SAMDataSource reads, IndexedFastaSequenceFile reference, Collection<ReferenceOrderedDataSource> rods) {
|
||||||
|
this.reads = reads;
|
||||||
|
this.reference = reference;
|
||||||
|
this.rods = rods;
|
||||||
|
|
||||||
if (walker instanceof ReadWalker) {
|
if (walker instanceof ReadWalker) {
|
||||||
traversalEngine = new TraverseReads();
|
traversalEngine = new TraverseReads();
|
||||||
} else if (walker instanceof LocusWalker) {
|
} else if (walker instanceof LocusWalker) {
|
||||||
|
|
@ -101,30 +101,11 @@ public abstract class MicroScheduler {
|
||||||
traversalEngine = new TraverseDuplicates();
|
traversalEngine = new TraverseDuplicates();
|
||||||
} else {
|
} else {
|
||||||
throw new UnsupportedOperationException("Unable to determine traversal type, the walker is an unknown type.");
|
throw new UnsupportedOperationException("Unable to determine traversal type, the walker is an unknown type.");
|
||||||
}
|
}
|
||||||
this.reads = reads;
|
|
||||||
this.reference = reference;
|
|
||||||
this.rods = rods;
|
|
||||||
|
|
||||||
validate(this.reads,this.reference);
|
|
||||||
|
|
||||||
// Side effect: initialize the traversal engine with reads data.
|
|
||||||
// TODO: Give users a dedicated way of getting the header so that the MicroScheduler
|
|
||||||
// doesn't have to bend over backward providing legacy getters and setters.
|
|
||||||
traversalEngine.setSAMHeader(reads.getHeader());
|
|
||||||
traversalEngine.initialize();
|
traversalEngine.initialize();
|
||||||
}
|
}
|
||||||
|
|
||||||
/**
|
|
||||||
* A temporary getter for the traversal engine. In the future, clients
|
|
||||||
* of the microscheduler shouldn't need to know anything about the traversal engine.
|
|
||||||
*
|
|
||||||
* @return The traversal engine.
|
|
||||||
*/
|
|
||||||
public TraversalEngine getTraversalEngine() {
|
|
||||||
return traversalEngine;
|
|
||||||
}
|
|
||||||
|
|
||||||
/**
|
/**
|
||||||
* Walks a walker over the given list of intervals.
|
* Walks a walker over the given list of intervals.
|
||||||
*
|
*
|
||||||
|
|
@ -133,7 +114,7 @@ public abstract class MicroScheduler {
|
||||||
*
|
*
|
||||||
* @return the return type of the walker
|
* @return the return type of the walker
|
||||||
*/
|
*/
|
||||||
public abstract Object execute(Walker walker, ShardStrategy shardStrategy);
|
public abstract Object execute(Walker walker, ShardStrategy shardStrategy, int iterations );
|
||||||
|
|
||||||
|
|
||||||
/**
|
/**
|
||||||
|
|
@ -174,68 +155,4 @@ public abstract class MicroScheduler {
|
||||||
* @return The reference maintained by this scheduler.
|
* @return The reference maintained by this scheduler.
|
||||||
*/
|
*/
|
||||||
public IndexedFastaSequenceFile getReference() { return reference; }
|
public IndexedFastaSequenceFile getReference() { return reference; }
|
||||||
|
|
||||||
/**
|
|
||||||
* Now that all files are open, validate the sequence dictionaries of the reads vs. the reference.
|
|
||||||
* TODO: Doing this in the MicroScheduler is a bit late, but this is where data sources are initialized.
|
|
||||||
* TODO: Move the initialization of data sources back to the GenomeAnalysisEngine.
|
|
||||||
* @param reads Reads data source.
|
|
||||||
* @param reference Reference data source.
|
|
||||||
*/
|
|
||||||
private void validate( SAMDataSource reads, ReferenceSequenceFile reference ) {
|
|
||||||
if( reads == null || reference == null )
|
|
||||||
return;
|
|
||||||
|
|
||||||
// Compile a set of sequence names that exist in the BAM files.
|
|
||||||
SAMSequenceDictionary readsDictionary = reads.getHeader().getSequenceDictionary();
|
|
||||||
|
|
||||||
Set<String> readsSequenceNames = new TreeSet<String>();
|
|
||||||
for( SAMSequenceRecord dictionaryEntry: readsDictionary.getSequences() )
|
|
||||||
readsSequenceNames.add(dictionaryEntry.getSequenceName());
|
|
||||||
|
|
||||||
// Compile a set of sequence names that exist in the reference file.
|
|
||||||
SAMSequenceDictionary referenceDictionary = reference.getSequenceDictionary();
|
|
||||||
|
|
||||||
Set<String> referenceSequenceNames = new TreeSet<String>();
|
|
||||||
for( SAMSequenceRecord dictionaryEntry: referenceDictionary.getSequences() )
|
|
||||||
referenceSequenceNames.add(dictionaryEntry.getSequenceName());
|
|
||||||
|
|
||||||
if( readsSequenceNames.size() == 0 ) {
|
|
||||||
logger.info("Reads file is unmapped. Skipping validation against reference.");
|
|
||||||
return;
|
|
||||||
}
|
|
||||||
|
|
||||||
// If there's no overlap between reads and reference, data will be bogus. Throw an exception.
|
|
||||||
Set<String> intersectingSequenceNames = new HashSet<String>(readsSequenceNames);
|
|
||||||
intersectingSequenceNames.retainAll(referenceSequenceNames);
|
|
||||||
if( intersectingSequenceNames.size() == 0 ) {
|
|
||||||
StringBuilder error = new StringBuilder();
|
|
||||||
error.append("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
|
||||||
error.append(System.getProperty("line.separator"));
|
|
||||||
error.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
|
||||||
error.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
|
||||||
logger.error(error.toString());
|
|
||||||
Utils.scareUser("No overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference.");
|
|
||||||
}
|
|
||||||
|
|
||||||
// If the two datasets are not equal and neither is a strict subset of the other, warn the user.
|
|
||||||
if( !readsSequenceNames.equals(referenceSequenceNames) &&
|
|
||||||
!readsSequenceNames.containsAll(referenceSequenceNames) &&
|
|
||||||
!referenceSequenceNames.containsAll(readsSequenceNames)) {
|
|
||||||
StringBuilder warning = new StringBuilder();
|
|
||||||
warning.append("Limited overlap exists between sequence dictionary of the reads and the sequence dictionary of the reference. Perhaps you're using the wrong reference?\n");
|
|
||||||
warning.append(System.getProperty("line.separator"));
|
|
||||||
warning.append(String.format("Reads contigs: %s%n", prettyPrintSequenceRecords(readsDictionary)));
|
|
||||||
warning.append(String.format("Reference contigs: %s%n", prettyPrintSequenceRecords(referenceDictionary)));
|
|
||||||
logger.warn(warning.toString());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
private String prettyPrintSequenceRecords( SAMSequenceDictionary sequenceDictionary ) {
|
|
||||||
String[] sequenceRecordNames = new String[ sequenceDictionary.size() ];
|
|
||||||
int sequenceRecordIndex = 0;
|
|
||||||
for( SAMSequenceRecord sequenceRecord: sequenceDictionary.getSequences() )
|
|
||||||
sequenceRecordNames[sequenceRecordIndex++] = sequenceRecord.getSequenceName();
|
|
||||||
return Arrays.deepToString(sequenceRecordNames);
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
|
||||||
|
|
@ -1,10 +1,8 @@
|
||||||
package org.broadinstitute.sting.gatk.traversals;
|
package org.broadinstitute.sting.gatk.traversals;
|
||||||
|
|
||||||
import net.sf.samtools.SAMFileHeader;
|
|
||||||
import org.apache.log4j.Logger;
|
import org.apache.log4j.Logger;
|
||||||
import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
|
import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider;
|
||||||
import org.broadinstitute.sting.gatk.datasources.shards.Shard;
|
import org.broadinstitute.sting.gatk.datasources.shards.Shard;
|
||||||
import org.broadinstitute.sting.gatk.datasources.simpleDataSources.SAMDataSource;
|
|
||||||
import org.broadinstitute.sting.gatk.walkers.Walker;
|
import org.broadinstitute.sting.gatk.walkers.Walker;
|
||||||
import org.broadinstitute.sting.utils.GenomeLoc;
|
import org.broadinstitute.sting.utils.GenomeLoc;
|
||||||
|
|
||||||
|
|
@ -20,9 +18,6 @@ public abstract class TraversalEngine {
|
||||||
// Maximum number of reads to process before finishing
|
// Maximum number of reads to process before finishing
|
||||||
protected long maximumIterations = -1;
|
protected long maximumIterations = -1;
|
||||||
|
|
||||||
// the stored header
|
|
||||||
private SAMFileHeader myHeader = null;
|
|
||||||
|
|
||||||
/** our log, which we want to capture anything from this class */
|
/** our log, which we want to capture anything from this class */
|
||||||
protected static Logger logger = Logger.getLogger(TraversalEngine.class);
|
protected static Logger logger = Logger.getLogger(TraversalEngine.class);
|
||||||
|
|
||||||
|
|
@ -34,27 +29,6 @@ public abstract class TraversalEngine {
|
||||||
this.maximumIterations = maximumIterations;
|
this.maximumIterations = maximumIterations;
|
||||||
}
|
}
|
||||||
|
|
||||||
/**
|
|
||||||
* get the associated SAM header for our run
|
|
||||||
*
|
|
||||||
* @return the header if it's stored, null if not
|
|
||||||
*/
|
|
||||||
public SAMFileHeader getSAMHeader() {
|
|
||||||
return myHeader;
|
|
||||||
}
|
|
||||||
|
|
||||||
/**
|
|
||||||
* set's the SAM header for this traversal, which should
|
|
||||||
* be the merged header in the multiple BAM file case.
|
|
||||||
*
|
|
||||||
* @param myHeader the passed in header
|
|
||||||
*/
|
|
||||||
|
|
||||||
public void setSAMHeader(SAMFileHeader myHeader) {
|
|
||||||
this.myHeader = myHeader;
|
|
||||||
}
|
|
||||||
|
|
||||||
|
|
||||||
/**
|
/**
|
||||||
* @param curTime (current runtime, in millisecs)
|
* @param curTime (current runtime, in millisecs)
|
||||||
*
|
*
|
||||||
|
|
|
||||||
|
|
@ -75,7 +75,7 @@ public class PrintReadsWalker extends ReadWalker<SAMRecord, SAMFileWriter> {
|
||||||
if ( platform != null ) {
|
if ( platform != null ) {
|
||||||
Object readGroupAttr = read.getAttribute("RG");
|
Object readGroupAttr = read.getAttribute("RG");
|
||||||
if ( readGroupAttr != null ) {
|
if ( readGroupAttr != null ) {
|
||||||
SAMReadGroupRecord readGroup = getToolkit().getEngine().getSAMHeader().getReadGroup(readGroupAttr.toString());
|
SAMReadGroupRecord readGroup = getToolkit().getSAMFileHeader().getReadGroup(readGroupAttr.toString());
|
||||||
if ( readGroup != null ) {
|
if ( readGroup != null ) {
|
||||||
Object readPlatformAttr = readGroup.getAttribute("PL");
|
Object readPlatformAttr = readGroup.getAttribute("PL");
|
||||||
if ( readPlatformAttr != null )
|
if ( readPlatformAttr != null )
|
||||||
|
|
|
||||||
|
|
@ -26,20 +26,11 @@
|
||||||
package org.broadinstitute.sting.gatk.walkers;
|
package org.broadinstitute.sting.gatk.walkers;
|
||||||
|
|
||||||
import net.sf.samtools.*;
|
import net.sf.samtools.*;
|
||||||
import org.broadinstitute.sting.gatk.walkers.WalkerName;
|
|
||||||
import org.broadinstitute.sting.gatk.walkers.ReadWalker;
|
|
||||||
import org.broadinstitute.sting.gatk.walkers.Requires;
|
|
||||||
import org.broadinstitute.sting.gatk.walkers.DataSource;
|
|
||||||
import org.broadinstitute.sting.gatk.walkers.recalibration.*;
|
|
||||||
import org.broadinstitute.sting.utils.cmdLine.Argument;
|
import org.broadinstitute.sting.utils.cmdLine.Argument;
|
||||||
import org.broadinstitute.sting.utils.*;
|
import org.broadinstitute.sting.utils.*;
|
||||||
import org.apache.log4j.Logger;
|
import org.apache.log4j.Logger;
|
||||||
|
|
||||||
import java.util.*;
|
import java.util.*;
|
||||||
import java.util.regex.Pattern;
|
|
||||||
import java.util.regex.Matcher;
|
|
||||||
import java.io.File;
|
|
||||||
import java.io.FileNotFoundException;
|
|
||||||
|
|
||||||
@WalkerName("SplitSamFile")
|
@WalkerName("SplitSamFile")
|
||||||
@Requires({DataSource.READS})
|
@Requires({DataSource.READS})
|
||||||
|
|
@ -74,10 +65,10 @@ public class SplitSamFileWalker extends ReadWalker<SAMRecord, Map<String, SAMFil
|
||||||
|
|
||||||
public Map<String, SAMFileWriter> reduceInit() {
|
public Map<String, SAMFileWriter> reduceInit() {
|
||||||
HashMap<String, SAMFileHeader> headers = new HashMap<String, SAMFileHeader>();
|
HashMap<String, SAMFileHeader> headers = new HashMap<String, SAMFileHeader>();
|
||||||
for ( SAMReadGroupRecord readGroup : this.getToolkit().getEngine().getSAMHeader().getReadGroups()) {
|
for ( SAMReadGroupRecord readGroup : this.getToolkit().getSAMFileHeader().getReadGroups()) {
|
||||||
final String sample = readGroup.getSample();
|
final String sample = readGroup.getSample();
|
||||||
if ( ! headers.containsKey(sample) ) {
|
if ( ! headers.containsKey(sample) ) {
|
||||||
SAMFileHeader header = Utils.copySAMFileHeader(this.getToolkit().getEngine().getSAMHeader());
|
SAMFileHeader header = Utils.copySAMFileHeader(this.getToolkit().getSAMFileHeader());
|
||||||
logger.debug(String.format("Creating BAM header for sample %s", sample));
|
logger.debug(String.format("Creating BAM header for sample %s", sample));
|
||||||
ArrayList<SAMReadGroupRecord> readGroups = new ArrayList<SAMReadGroupRecord>();
|
ArrayList<SAMReadGroupRecord> readGroups = new ArrayList<SAMReadGroupRecord>();
|
||||||
header.setReadGroups(readGroups);
|
header.setReadGroups(readGroups);
|
||||||
|
|
|
||||||
|
|
@ -61,7 +61,6 @@ public class IntervalCleanerWalker extends LocusWindowWalker<Integer, Integer>
|
||||||
if ( MISMATCH_THRESHOLD <= 0.0 || MISMATCH_THRESHOLD > 1.0 )
|
if ( MISMATCH_THRESHOLD <= 0.0 || MISMATCH_THRESHOLD > 1.0 )
|
||||||
throw new RuntimeException("Entropy threshold must be a fraction between 0 and 1");
|
throw new RuntimeException("Entropy threshold must be a fraction between 0 and 1");
|
||||||
|
|
||||||
SAMFileHeader header = getToolkit().getEngine().getSAMHeader();
|
|
||||||
if ( writer != null ) {
|
if ( writer != null ) {
|
||||||
readsToWrite = new TreeSet<ComparableSAMRecord>();
|
readsToWrite = new TreeSet<ComparableSAMRecord>();
|
||||||
}
|
}
|
||||||
|
|
@ -888,7 +887,7 @@ public class IntervalCleanerWalker extends LocusWindowWalker<Integer, Integer>
|
||||||
String reference = "AAAAAACCCCCCAAAAAA";
|
String reference = "AAAAAACCCCCCAAAAAA";
|
||||||
// the alternate reference is: "AAAAAACCCTTCCCAAAAAA";
|
// the alternate reference is: "AAAAAACCCTTCCCAAAAAA";
|
||||||
ArrayList<SAMRecord> reads = new ArrayList<SAMRecord>();
|
ArrayList<SAMRecord> reads = new ArrayList<SAMRecord>();
|
||||||
SAMFileHeader header = getToolkit().getEngine().getSAMHeader();
|
SAMFileHeader header = getToolkit().getSAMFileHeader();
|
||||||
SAMRecord r1 = new SAMRecord(header);
|
SAMRecord r1 = new SAMRecord(header);
|
||||||
r1.setReadName("1");
|
r1.setReadName("1");
|
||||||
r1.setReadString("AACCCCCC");
|
r1.setReadString("AACCCCCC");
|
||||||
|
|
@ -938,7 +937,7 @@ public class IntervalCleanerWalker extends LocusWindowWalker<Integer, Integer>
|
||||||
String reference = "AAAAAACCCTTCCCAAAAAA";
|
String reference = "AAAAAACCCTTCCCAAAAAA";
|
||||||
// the alternate reference is: "AAAAAACCCCCCAAAAAA";
|
// the alternate reference is: "AAAAAACCCCCCAAAAAA";
|
||||||
ArrayList<SAMRecord> reads = new ArrayList<SAMRecord>();
|
ArrayList<SAMRecord> reads = new ArrayList<SAMRecord>();
|
||||||
SAMFileHeader header = getToolkit().getEngine().getSAMHeader();
|
SAMFileHeader header = getToolkit().getSAMFileHeader();
|
||||||
SAMRecord r1 = new SAMRecord(header);
|
SAMRecord r1 = new SAMRecord(header);
|
||||||
r1.setReadName("1");
|
r1.setReadName("1");
|
||||||
r1.setReadString("ACCCTTCC");
|
r1.setReadString("ACCCTTCC");
|
||||||
|
|
|
||||||
|
|
@ -50,7 +50,7 @@ public class CovariateCounterWalker extends LocusWalker<Integer, PrintStream> {
|
||||||
*/
|
*/
|
||||||
public void initialize() {
|
public void initialize() {
|
||||||
Set<String> readGroups = new HashSet<String>();
|
Set<String> readGroups = new HashSet<String>();
|
||||||
for (SAMReadGroupRecord readGroup : this.getToolkit().getEngine().getSAMHeader().getReadGroups()) {
|
for (SAMReadGroupRecord readGroup : this.getToolkit().getSAMFileHeader().getReadGroups()) {
|
||||||
if( readGroup.getAttribute("PL") == null )
|
if( readGroup.getAttribute("PL") == null )
|
||||||
Utils.warnUser(String.format("PL attribute for read group %s is unset; assuming all reads are supported",readGroup.getReadGroupId()));
|
Utils.warnUser(String.format("PL attribute for read group %s is unset; assuming all reads are supported",readGroup.getReadGroupId()));
|
||||||
if( !isSupportedReadGroup(readGroup) )
|
if( !isSupportedReadGroup(readGroup) )
|
||||||
|
|
|
||||||
|
|
@ -25,7 +25,7 @@ public class CoverageBySample extends LocusWalker<String, String>
|
||||||
public void initialize()
|
public void initialize()
|
||||||
{
|
{
|
||||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||||
this.header = toolkit.getEngine().getSAMHeader();
|
this.header = toolkit.getSAMFileHeader();
|
||||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||||
|
|
||||||
sample_names = new ArrayList<String>();
|
sample_names = new ArrayList<String>();
|
||||||
|
|
|
||||||
|
|
@ -53,7 +53,7 @@ public class IOCrusherWalker extends ReadWalker<SAMRecord, ArrayList<SAMFileWrit
|
||||||
public ArrayList<SAMFileWriter> reduceInit() {
|
public ArrayList<SAMFileWriter> reduceInit() {
|
||||||
ArrayList<SAMFileWriter> outputs = new ArrayList<SAMFileWriter>(nWaysOut);
|
ArrayList<SAMFileWriter> outputs = new ArrayList<SAMFileWriter>(nWaysOut);
|
||||||
for ( int i = 0; i < nWaysOut; i++ ) {
|
for ( int i = 0; i < nWaysOut; i++ ) {
|
||||||
SAMFileHeader header = this.getToolkit().getEngine().getSAMHeader();
|
SAMFileHeader header = this.getToolkit().getSAMFileHeader();
|
||||||
outputs.add(Utils.createSAMFileWriterWithCompression(header, true, outputBase + "." + i + ".bam", BAMcompression));
|
outputs.add(Utils.createSAMFileWriterWithCompression(header, true, outputBase + "." + i + ".bam", BAMcompression));
|
||||||
}
|
}
|
||||||
return outputs;
|
return outputs;
|
||||||
|
|
|
||||||
|
|
@ -16,7 +16,7 @@ public class ListSampleIds extends LocusWalker<Boolean, Boolean>
|
||||||
public void initialize()
|
public void initialize()
|
||||||
{
|
{
|
||||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||||
SAMFileHeader header = toolkit.getEngine().getSAMHeader();
|
SAMFileHeader header = toolkit.getSAMFileHeader();
|
||||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||||
|
|
||||||
for (int i = 0; i < read_groups.size(); i++)
|
for (int i = 0; i < read_groups.size(); i++)
|
||||||
|
|
|
||||||
|
|
@ -90,7 +90,7 @@ public class MultiSampleCaller extends LocusWalker<MultiSampleCaller.MultiSample
|
||||||
|
|
||||||
|
|
||||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||||
this.header = toolkit.getEngine().getSAMHeader();
|
this.header = toolkit.getSAMFileHeader();
|
||||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||||
|
|
||||||
sample_names = new ArrayList<String>();
|
sample_names = new ArrayList<String>();
|
||||||
|
|
|
||||||
|
|
@ -34,7 +34,7 @@ public class PoolCallingExperiment extends LocusWalker<AlleleFrequencyEstimate,
|
||||||
public void initialize()
|
public void initialize()
|
||||||
{
|
{
|
||||||
GenomeAnalysisEngine toolkit = this.getToolkit();
|
GenomeAnalysisEngine toolkit = this.getToolkit();
|
||||||
SAMFileHeader header = toolkit.getEngine().getSAMHeader();
|
SAMFileHeader header = toolkit.getSAMFileHeader();
|
||||||
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
List<SAMReadGroupRecord> read_groups = header.getReadGroups();
|
||||||
|
|
||||||
sample_names = new ArrayList<String>();
|
sample_names = new ArrayList<String>();
|
||||||
|
|
|
||||||
|
|
@ -259,7 +259,7 @@ public class SingleSampleGenotyper extends LocusWalker<GenotypeCall, GenotypeWri
|
||||||
* @return an empty string
|
* @return an empty string
|
||||||
*/
|
*/
|
||||||
public GenotypeWriter reduceInit() {
|
public GenotypeWriter reduceInit() {
|
||||||
return GenotypeWriterFactory.create(VAR_FORMAT, GenomeAnalysisEngine.instance.getEngine().getSAMHeader(), VARIANTS_FILE);
|
return GenotypeWriterFactory.create(VAR_FORMAT, GenomeAnalysisEngine.instance.getSAMFileHeader(), VARIANTS_FILE);
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
|
||||||
Loading…
Reference in New Issue