Merge branch 'master' of ssh://gsa1/humgen/gsa-scr1/gsa-engineering/git/unstable

This commit is contained in:
Matt Hanna 2012-02-08 08:43:55 -05:00
commit 51ac87b28c
50 changed files with 2620 additions and 1278 deletions

View File

@ -139,11 +139,11 @@ public class AnalyzeCovariates extends CommandLineProgram {
*/
@Argument(fullName="max_histogram_value", shortName="maxHist", required = false, doc="If supplied, this value will be the max value of the histogram plots")
private int MAX_HISTOGRAM_VALUE = 0;
@Hidden
@Argument(fullName="do_indel_quality", shortName="indels", required = false, doc="If supplied, do indel quality plotting")
private boolean DO_INDEL_QUALITY = false;
/////////////////////////////
// Private Member Variables
/////////////////////////////
@ -274,7 +274,6 @@ public class AnalyzeCovariates extends CommandLineProgram {
RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 );
// Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, IGNORE_QSCORES_LESS_THAN );
}
private void writeDataTables() {
@ -341,7 +340,7 @@ public class AnalyzeCovariates extends CommandLineProgram {
// for each covariate
for( int iii = 1; iii < requestedCovariates.size(); iii++ ) {
Covariate cov = requestedCovariates.get(iii);
final Covariate cov = requestedCovariates.get(iii);
final File outputFile = new File(OUTPUT_DIR, readGroup + "." + cov.getClass().getSimpleName()+ ".dat");
if (DO_INDEL_QUALITY) {
RScriptExecutor executor = new RScriptExecutor();

View File

@ -53,6 +53,7 @@ import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.interval.IntervalSetRule;
import org.broadinstitute.sting.utils.interval.IntervalUtils;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import java.io.File;
import java.util.*;
@ -179,10 +180,18 @@ public class GenomeAnalysisEngine {
*/
private static final long GATK_RANDOM_SEED = 47382911L;
private static Random randomGenerator = new Random(GATK_RANDOM_SEED);
public static Random getRandomGenerator() { return randomGenerator; }
public static void resetRandomGenerator() { randomGenerator.setSeed(GATK_RANDOM_SEED); }
public static void resetRandomGenerator(long seed) { randomGenerator.setSeed(seed); }
/**
* Static base quality score recalibration helper object
*/
private static BaseRecalibration baseRecalibration = null;
public static BaseRecalibration getBaseRecalibration() { return baseRecalibration; }
public static boolean hasBaseRecalibration() { return baseRecalibration != null; }
public static void setBaseRecalibration(File recalFile) { baseRecalibration = new BaseRecalibration(recalFile); }
/**
* Actually run the GATK with the specified walker.
*
@ -205,6 +214,10 @@ public class GenomeAnalysisEngine {
if (this.getArguments().nonDeterministicRandomSeed)
resetRandomGenerator(System.currentTimeMillis());
// if the use specified an input BQSR recalibration table then enable on the fly recalibration
if (this.getArguments().BQSR_RECAL_FILE != null)
setBaseRecalibration(this.getArguments().BQSR_RECAL_FILE);
// Determine how the threads should be divided between CPU vs. IO.
determineThreadAllocation();
@ -224,7 +237,7 @@ public class GenomeAnalysisEngine {
// create temp directories as necessary
initializeTempDirectory();
// create the output streams "
// create the output streams
initializeOutputStreams(microScheduler.getOutputTracker());
Iterable<Shard> shardStrategy = getShardStrategy(readsDataSource,microScheduler.getReference(),intervals);

View File

@ -75,6 +75,7 @@ public class GATKArgumentCollection {
* Using this option one can instruct the GATK engine to traverse over only part of the genome. This argument can be specified multiple times.
* One may use samtools-style intervals either explicitly (e.g. -L chr1 or -L chr1:100-200) or listed in a file (e.g. -L myFile.intervals).
* Additionally, one may specify a rod file to traverse over the positions for which there is a record in the file (e.g. -L file.vcf).
* To specify the completely unmapped reads in the BAM file (i.e. those without a reference contig) use -L unmapped.
*/
@Input(fullName = "intervals", shortName = "L", doc = "One or more genomic intervals over which to operate. Can be explicitly specified on the command line or in a file (including a rod file)", required = false)
public List<IntervalBinding<Feature>> intervals = null;
@ -185,6 +186,15 @@ public class GATKArgumentCollection {
@Argument(fullName="useOriginalQualities", shortName = "OQ", doc = "If set, use the original base quality scores from the OQ tag when present instead of the standard scores", required=false)
public Boolean useOriginalBaseQualities = false;
/**
* After the header, data records occur one per line until the end of the file. The first several items on a line are the
* values of the individual covariates and will change depending on which covariates were specified at runtime. The last
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/
@Input(fullName="BQSR", shortName="BQSR", required=false, doc="Filename for the input covariates table recalibration .csv file which enables on the fly base quality score recalibration")
public File BQSR_RECAL_FILE = null; // BUGBUG: need a better argument name once we decide how BQSRs v1 and v2 will live in the code base simultaneously
@Argument(fullName="defaultBaseQualities", shortName = "DBQ", doc = "If reads are missing some or all base quality scores, this value will be used for all base quality scores", required=false)
public byte defaultBaseQualities = -1;

View File

@ -24,6 +24,7 @@ public class GATKReport {
/**
* Create a new GATKReport with the contents of a GATKReport on disk.
*
* @param filename the path to the file to load
*/
public GATKReport(String filename) {
@ -32,6 +33,7 @@ public class GATKReport {
/**
* Create a new GATKReport with the contents of a GATKReport on disk.
*
* @param file the file to load
*/
public GATKReport(File file) {
@ -40,6 +42,7 @@ public class GATKReport {
/**
* Load a GATKReport file from disk
*
* @param file the file to load
*/
private void loadReport(File file) {
@ -48,12 +51,11 @@ public class GATKReport {
GATKReportTable table = null;
String[] header = null;
int id = 0;
GATKReportVersion version = null;
List<Integer> columnStarts = null;
String line;
while ( (line = reader.readLine()) != null ) {
while ((line = reader.readLine()) != null) {
if (line.startsWith(GATKREPORT_HEADER_PREFIX)) {
@ -71,7 +73,7 @@ public class GATKReport {
header = null;
columnStarts = null;
} else if ( line.trim().isEmpty() ) {
} else if (line.trim().isEmpty()) {
// do nothing
} else {
if (table != null) {
@ -97,19 +99,22 @@ public class GATKReport {
if (header == null) {
header = splitLine;
table.addPrimaryKey("id", false);
for ( String columnName : header ) {
table.addColumn(columnName, "");
// Set the first column as the primary key
table.addPrimaryKey(header[0]);
// Set every other column as column
for (int i = 1; i < header.length; i++) {
table.addColumn(header[i], "");
}
id = 0;
} else {
for (int columnIndex = 0; columnIndex < header.length; columnIndex++) {
table.set(id, header[columnIndex], splitLine[columnIndex]);
//Get primary key Value from the current line array
String primaryKey = splitLine[0];
//Input all the remaining values
for (int columnIndex = 1; columnIndex < header.length; columnIndex++) {
table.set(primaryKey, header[columnIndex], splitLine[columnIndex]);
}
id++;
}
}
}
@ -175,4 +180,24 @@ public class GATKReport {
public Collection<GATKReportTable> getTables() {
return tables.values();
}
public void combineWith(GATKReport input) {
// For every input table, add values
System.out.println("This.tables: keySet");
for (String s : tables.keySet())
System.out.println(s);
// todo test tables exist
for (String tableName : input.tables.keySet()) {
System.out.println("Input table key: " + tableName);
if (tables.containsKey(tableName))
tables.get(tableName).mergeRows(input.getTable(tableName));
else
throw new ReviewedStingException("Failed to combine GATKReport, tables don't match!");
}
}
}

View File

@ -0,0 +1,46 @@
package org.broadinstitute.sting.gatk.report;
import org.broadinstitute.sting.commandline.Gatherer;
import org.broadinstitute.sting.utils.exceptions.UserException;
import java.io.File;
import java.io.FileNotFoundException;
import java.io.PrintStream;
import java.util.List;
/**
* Created by IntelliJ IDEA.
* User: roger
* Date: 1/9/12
* Time: 11:17 PM
* To change this template use File | Settings | File Templates.
*/
public class GATKReportGatherer extends Gatherer {
@Override
public void gather(List<File> inputs, File output) {
//Combines inputs GATKReport to one output
PrintStream o;
try {
o = new PrintStream(output);
} catch (FileNotFoundException e) {
throw new UserException("File to be output by CoverageByRG Gather function was not found");
}
GATKReport current = new GATKReport();
boolean isFirst = true;
for (File input : inputs) {
// If the table is empty
if (isFirst) {
current = new GATKReport(input);
isFirst = false;
} else {
GATKReport toAdd = new GATKReport(input);
current.combineWith(toAdd);
}
}
current.print(o);
}
}

View File

@ -4,7 +4,10 @@ import org.apache.commons.lang.ObjectUtils;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.io.PrintStream;
import java.util.*;
import java.util.Collection;
import java.util.HashMap;
import java.util.LinkedList;
import java.util.TreeSet;
import java.util.regex.Matcher;
import java.util.regex.Pattern;
@ -12,12 +15,12 @@ import java.util.regex.Pattern;
* A data structure that allows data to be collected over the course of a walker's computation, then have that data
* written to a PrintStream such that it's human-readable, AWK-able, and R-friendly (given that you load it using the
* GATKReport loader module).
*
* <p/>
* The goal of this object is to use the same data structure for both accumulating data during a walker's computation
* and emitting that data to a file for easy analysis in R (or any other program/language that can take in a table of
* results). Thus, all of the infrastructure below is designed simply to make printing the following as easy as
* possible:
*
* <p/>
* ##:GATKReport.v0.1 ErrorRatePerCycle : The error rate per sequenced position in the reads
* cycle errorrate.61PA8.7 qualavg.61PA8.7
* 0 0.007451835696110506 25.474613284804366
@ -29,60 +32,60 @@ import java.util.regex.Pattern;
* 6 5.452562704471102E-4 36.1217248908297
* 7 5.452562704471102E-4 36.1910480349345
* 8 5.452562704471102E-4 36.00345705967977
*
* <p/>
* Here, we have a GATKReport table - a well-formatted, easy to read representation of some tabular data. Every single
* table has this same GATKReport.v0.1 header, which permits multiple files from different sources to be cat-ed
* together, which makes it very easy to pull tables from different programs into R via a single file.
*
* <p/>
* ------------
* Definitions:
*
* <p/>
* Table info:
* The first line, structured as
* ##:<report version> <table name> : <table description>
*
* <p/>
* Table header:
* The second line, specifying a unique name for each column in the table.
*
* <p/>
* The first column mentioned in the table header is the "primary key" column - a column that provides the unique
* identifier for each row in the table. Once this column is created, any element in the table can be referenced by
* the row-column coordinate, i.e. "primary key"-"column name" coordinate.
*
* <p/>
* When a column is added to a table, a default value must be specified (usually 0). This is the initial value for
* an element in a column. This permits operations like increment() and decrement() to work properly on columns that
* are effectively counters for a particular event.
*
* <p/>
* Finally, the display property for each column can be set during column creation. This is useful when a given
* column stores an intermediate result that will be used later on, perhaps to calculate the value of another column.
* In these cases, it's obviously necessary to store the value required for further computation, but it's not
* necessary to actually print the intermediate column.
*
* <p/>
* Table body:
* The values of the table itself.
*
* <p/>
* ---------------
* Implementation:
*
* <p/>
* The implementation of this table has two components:
* 1. A TreeSet<Object> that stores all the values ever specified for the primary key. Any get() operation that
* refers to an element where the primary key object does not exist will result in its implicit creation. I
* haven't yet decided if this is a good idea...
*
* <p/>
* 2. A HashMap<String, GATKReportColumn> that stores a mapping from column name to column contents. Each
* GATKReportColumn is effectively a map (in fact, GATKReportColumn extends TreeMap<Object, Object>) between
* primary key and the column value. This means that, given N columns, the primary key information is stored
* N+1 times. This is obviously wasteful and can likely be handled much more elegantly in future implementations.
*
* <p/>
* ------------------------------
* Element and column operations:
*
* <p/>
* In addition to simply getting and setting values, this object also permits some simple operations to be applied to
* individual elements or to whole columns. For instance, an element can be easily incremented without the hassle of
* calling get(), incrementing the obtained value by 1, and then calling set() with the new value. Also, some vector
* operations are supported. For instance, two whole columns can be divided and have the result be set to a third
* column. This is especially useful when aggregating counts in two intermediate columns that will eventually need to
* be manipulated row-by-row to compute the final column.
*
* <p/>
* Note: I've made no attempt whatsoever to make these operations efficient. Right now, some of the methods check the
* type of the stored object using an instanceof call and attempt to do the right thing. Others cast the contents of
* the cell to a Number, call the Number.toDouble() method and compute a result. This is clearly not the ideal design,
@ -92,7 +95,9 @@ import java.util.regex.Pattern;
* @author Khalid Shakir
*/
public class GATKReportTable {
/** REGEX that matches any table with an invalid name */
/**
* REGEX that matches any table with an invalid name
*/
public final static String INVALID_TABLE_NAME_REGEX = "[^a-zA-Z0-9_\\-\\.]";
private static final GATKReportVersion LATEST_REPORT_VERSION = GATKReportVersion.V0_2;
private String tableName;
@ -195,6 +200,7 @@ public class GATKReportTable {
/**
* Returns the first primary key matching the dotted column values.
* Ex: dbsnp.eval.called.all.novel.all
*
* @param dottedColumnValues Period concatenated values.
* @return The first primary key matching the column values or throws an exception.
*/
@ -208,6 +214,7 @@ public class GATKReportTable {
/**
* Returns true if there is at least on row with the dotted column values.
* Ex: dbsnp.eval.called.all.novel.all
*
* @param dottedColumnValues Period concatenated values.
* @return true if there is at least one row matching the columns.
*/
@ -218,6 +225,7 @@ public class GATKReportTable {
/**
* Returns the first primary key matching the dotted column values.
* Ex: dbsnp.eval.called.all.novel.all
*
* @param dottedColumnValues Period concatenated values.
* @return The first primary key matching the column values or null.
*/
@ -228,6 +236,7 @@ public class GATKReportTable {
/**
* Returns the first primary key matching the column values.
* Ex: new String[] { "dbsnp", "eval", "called", "all", "novel", "all" }
*
* @param columnValues column values.
* @return The first primary key matching the column values.
*/
@ -235,7 +244,7 @@ public class GATKReportTable {
for (Object primaryKey : primaryKeyColumn) {
boolean matching = true;
for (int i = 0; matching && i < columnValues.length; i++) {
matching = ObjectUtils.equals(columnValues[i], get(primaryKey, i+1));
matching = ObjectUtils.equals(columnValues[i], get(primaryKey, i + 1));
}
if (matching)
return primaryKey;
@ -256,6 +265,7 @@ public class GATKReportTable {
public void addColumn(String columnName, Object defaultValue, String format) {
addColumn(columnName, defaultValue, true, format);
}
/**
* Add a column to the report, specify the default column value, and specify whether the column should be displayed in the final output (useful when intermediate columns are necessary for later calculations, but are not required to be in the output file.
*
@ -585,10 +595,11 @@ public class GATKReportTable {
/**
* Return the print width of the primary key column
*
* @return the width of the primary key column
*/
public int getPrimaryKeyColumnWidth() {
int maxWidth = primaryKeyName.length();
int maxWidth = getPrimaryKeyName().length();
for (Object primaryKey : primaryKeyColumn) {
int width = primaryKey.toString().length();
@ -620,13 +631,15 @@ public class GATKReportTable {
// Emit the table header, taking into account the padding requirement if the primary key is a hidden column
boolean needsPadding = false;
if (primaryKeyDisplay) {
out.printf(primaryKeyFormat, primaryKeyName);
out.printf(primaryKeyFormat, getPrimaryKeyName());
needsPadding = true;
}
for (String columnName : columns.keySet()) {
if (columns.get(columnName).isDisplayable()) {
if (needsPadding) { out.printf(" "); }
if (needsPadding) {
out.printf(" ");
}
out.printf(columnFormats.get(columnName).getNameFormat(), columnName);
needsPadding = true;
@ -645,7 +658,9 @@ public class GATKReportTable {
for (String columnName : columns.keySet()) {
if (columns.get(columnName).isDisplayable()) {
if (needsPadding) { out.printf(" "); }
if (needsPadding) {
out.printf(" ");
}
String value = columns.get(columnName).getStringValue(primaryKey);
out.printf(columnFormats.get(columnName).getValueFormat(), value);
@ -675,4 +690,49 @@ public class GATKReportTable {
public GATKReportColumns getColumns() {
return columns;
}
public void mergeRows(GATKReportTable input) {
/*
* This function is different from addRowsFrom because we will add the ability to sum,average, etc rows
* TODO: Add other combining algorithms
*/
// Make sure the columns match AND the Primary Key
if (input.getColumns().keySet().equals(this.getColumns().keySet()) &&
input.getPrimaryKeyName().equals(this.getPrimaryKeyName())) {
this.addRowsFrom(input);
} else
throw new ReviewedStingException("Failed to combine GATKReportTable, columns don't match!");
}
public void addRowsFrom(GATKReportTable input) {
// add column by column
// For every column
for (String columnKey : input.getColumns().keySet()) {
GATKReportColumn current = this.getColumns().get(columnKey);
GATKReportColumn toAdd = input.getColumns().get(columnKey);
// We want to take the current column and add all the values from input
// The column is a map of values <Key, Value>
for (Object rowKey : toAdd.keySet()) {
// We add every value from toAdd to the current
if (!current.containsKey(rowKey)) {
this.set(rowKey, columnKey, toAdd.get(rowKey));
System.out.printf("Putting row with PK: %s \n", rowKey);
} else {
// TODO we should be able to handle combining data by adding, averaging, etc.
this.set(rowKey, columnKey, toAdd.get(rowKey));
System.out.printf("OVERWRITING Row with PK: %s \n", rowKey);
}
}
}
}
public String getPrimaryKeyName() {
return primaryKeyName;
}
}

View File

@ -1,6 +1,5 @@
package org.broadinstitute.sting.gatk.traversals;
import net.sf.samtools.SAMRecord;
import org.apache.log4j.Logger;
import org.broadinstitute.sting.gatk.WalkerManager;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
@ -29,7 +28,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
protected static Logger logger = Logger.getLogger(TraversalEngine.class);
private final Queue<ActiveRegion> workQueue = new LinkedList<ActiveRegion>();
private final LinkedHashSet<SAMRecord> myReads = new LinkedHashSet<SAMRecord>();
private final LinkedHashSet<GATKSAMRecord> myReads = new LinkedHashSet<GATKSAMRecord>();
@Override
protected String getTraversalType() {
@ -101,7 +100,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// Grab all the previously unseen reads from this pileup and add them to the massive read list
for( final PileupElement p : locus.getBasePileup() ) {
final SAMRecord read = p.getRead();
final GATKSAMRecord read = p.getRead();
if( !myReads.contains(read) ) {
myReads.add(read);
}
@ -111,7 +110,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// which active regions in the work queue are now safe to process
if( !locusView.hasNext() ) {
for( final PileupElement p : locus.getBasePileup() ) {
final SAMRecord read = p.getRead();
final GATKSAMRecord read = p.getRead();
if( !myReads.contains(read) ) {
myReads.add(read);
}
@ -124,7 +123,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
// Take the individual isActive calls and integrate them into contiguous active regions and
// add these blocks of work to the work queue
final ArrayList<ActiveRegion> activeRegions = integrateActiveList( isActiveList, firstIsActiveStart, activeRegionExtension );
final ArrayList<ActiveRegion> activeRegions = integrateActiveList( isActiveList, firstIsActiveStart, activeRegionExtension, walker.presetActiveRegions != null );
logger.debug("Integrated " + isActiveList.size() + " isActive calls into " + activeRegions.size() + " regions." );
if( walker.activeRegionOutStream == null ) {
workQueue.addAll( activeRegions );
@ -156,9 +155,9 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
return sum;
}
private T processActiveRegion( final ActiveRegion activeRegion, final LinkedHashSet<SAMRecord> reads, final Queue<ActiveRegion> workQueue, final T sum, final ActiveRegionWalker<M,T> walker ) {
final ArrayList<SAMRecord> placedReads = new ArrayList<SAMRecord>();
for( final SAMRecord read : reads ) {
private T processActiveRegion( final ActiveRegion activeRegion, final LinkedHashSet<GATKSAMRecord> reads, final Queue<ActiveRegion> workQueue, final T sum, final ActiveRegionWalker<M,T> walker ) {
final ArrayList<GATKSAMRecord> placedReads = new ArrayList<GATKSAMRecord>();
for( final GATKSAMRecord read : reads ) {
final GenomeLoc readLoc = this.engine.getGenomeLocParser().createGenomeLoc( read );
if( activeRegion.getLocation().overlapsP( readLoc ) ) {
// The region which the highest amount of overlap is chosen as the primary region for the read (tie breaking is done as right most region)
@ -170,22 +169,22 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
bestRegion = otherRegionToTest;
}
}
bestRegion.add( (GATKSAMRecord) read );
bestRegion.add( read );
// The read is also added to all other regions in which it overlaps but marked as non-primary
if( walker.wantsNonPrimaryReads() ) {
if( !bestRegion.equals(activeRegion) ) {
activeRegion.add( (GATKSAMRecord) read );
activeRegion.add( read );
}
for( final ActiveRegion otherRegionToTest : workQueue ) {
if( !bestRegion.equals(otherRegionToTest) && otherRegionToTest.getExtendedLoc().overlapsP( readLoc ) ) {
otherRegionToTest.add( (GATKSAMRecord) read );
otherRegionToTest.add( read );
}
}
}
placedReads.add( read );
} else if( activeRegion.getExtendedLoc().overlapsP( readLoc ) && walker.wantsNonPrimaryReads() ) {
activeRegion.add( (GATKSAMRecord) read );
activeRegion.add( read );
}
}
reads.removeAll( placedReads ); // remove all the reads which have been placed into their active region
@ -214,7 +213,7 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
}
// band-pass filter the list of isActive probabilities and turn into active regions
private ArrayList<ActiveRegion> integrateActiveList( final ArrayList<Double> activeList, final GenomeLoc firstIsActiveStart, final int activeRegionExtension ) {
private ArrayList<ActiveRegion> integrateActiveList( final ArrayList<Double> activeList, final GenomeLoc firstIsActiveStart, final int activeRegionExtension, final boolean presetRegions ) {
final double ACTIVE_PROB_THRESHOLD = 0.2; // BUGBUG: needs to be set-able by the walker author
final ArrayList<ActiveRegion> returnList = new ArrayList<ActiveRegion>();
@ -227,11 +226,11 @@ public class TraverseActiveRegions <M,T> extends TraversalEngine<M,T,ActiveRegio
} else {
final Double[] activeProbArray = activeList.toArray(new Double[activeList.size()]);
final double[] filteredProbArray = new double[activeProbArray.length];
final int FILTER_SIZE = 50; // BUGBUG: needs to be set-able by the walker author
final int MAX_ACTIVE_REGION = 425; // BUGBUG: needs to be set-able by the walker author
final int FILTER_SIZE = ( presetRegions ? 0 : 50 ); // BUGBUG: needs to be set-able by the walker author
final int MAX_ACTIVE_REGION = ( presetRegions ? 16001 : 425 ); // BUGBUG: needs to be set-able by the walker author
for( int iii = 0; iii < activeProbArray.length; iii++ ) {
double maxVal = 0;
for( int jjj = Math.max(0, iii-FILTER_SIZE); jjj < Math.min(activeList.size(), iii+FILTER_SIZE); jjj++ ) {
for( int jjj = Math.max(0, iii-FILTER_SIZE); jjj < Math.min(activeList.size(), iii+FILTER_SIZE+1); jjj++ ) {
if( activeProbArray[jjj] > maxVal ) { maxVal = activeProbArray[jjj]; }
}
filteredProbArray[iii] = maxVal;

View File

@ -7,6 +7,7 @@ import org.broadinstitute.sting.gatk.samples.Sample;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatibleWalker;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.ExperimentalAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation;
import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.RodRequiringAnnotation;
import org.broadinstitute.sting.utils.MathUtils;
import org.broadinstitute.sting.utils.codecs.vcf.VCFHeaderLineType;
import org.broadinstitute.sting.utils.codecs.vcf.VCFInfoHeaderLine;
@ -17,16 +18,13 @@ import java.util.*;
/**
* Created by IntelliJ IDEA.
* User: rpoplin, lfran
* User: rpoplin, lfran, ebanks
* Date: 11/14/11
*/
public class TransmissionDisequilibriumTest extends InfoFieldAnnotation implements ExperimentalAnnotation {
public class TransmissionDisequilibriumTest extends InfoFieldAnnotation implements ExperimentalAnnotation, RodRequiringAnnotation {
private Set<Sample> trios = null;
private final static int REF = 0;
private final static int HET = 1;
private final static int HOM = 2;
private final static int MIN_NUM_VALID_TRIOS = 5; // don't calculate this population-level statistic if there are less than X trios with full genotype likelihood information
public Map<String, Object> annotate(RefMetaDataTracker tracker, AnnotatorCompatibleWalker walker, ReferenceContext ref, Map<String, AlignmentContext> stratifiedContexts, VariantContext vc) {
@ -38,10 +36,10 @@ public class TransmissionDisequilibriumTest extends InfoFieldAnnotation implemen
}
}
final Map<String,Object> toRet = new HashMap<String,Object>(1);
final Map<String, Object> toRet = new HashMap<String, Object>(1);
final HashSet<Sample> triosToTest = new HashSet<Sample>();
for( final Sample child : trios) {
for( final Sample child : trios ) {
final boolean hasAppropriateGenotypes = vc.hasGenotype(child.getID()) && vc.getGenotype(child.getID()).hasLikelihoods() &&
vc.hasGenotype(child.getPaternalID()) && vc.getGenotype(child.getPaternalID()).hasLikelihoods() &&
vc.hasGenotype(child.getMaternalID()) && vc.getGenotype(child.getMaternalID()).hasLikelihoods();
@ -65,28 +63,55 @@ public class TransmissionDisequilibriumTest extends InfoFieldAnnotation implemen
// Following derivation in http://en.wikipedia.org/wiki/Transmission_disequilibrium_test#A_modified_version_of_the_TDT
private double calculateTDT( final VariantContext vc, final Set<Sample> triosToTest ) {
final double nABGivenABandBB = calculateNChildren(vc, triosToTest, HET, HET, HOM) + calculateNChildren(vc, triosToTest, HET, HOM, HET);
final double nBBGivenABandBB = calculateNChildren(vc, triosToTest, HOM, HET, HOM) + calculateNChildren(vc, triosToTest, HOM, HOM, HET);
final double nAAGivenABandAB = calculateNChildren(vc, triosToTest, REF, HET, HET);
final double nBBGivenABandAB = calculateNChildren(vc, triosToTest, HOM, HET, HET);
final double nAAGivenAAandAB = calculateNChildren(vc, triosToTest, REF, REF, HET) + calculateNChildren(vc, triosToTest, REF, HET, REF);
final double nABGivenAAandAB = calculateNChildren(vc, triosToTest, HET, REF, HET) + calculateNChildren(vc, triosToTest, HET, HET, REF);
double nABGivenABandBB = 0.0;
double nBBGivenABandBB = 0.0;
double nAAGivenABandAB = 0.0;
double nBBGivenABandAB = 0.0;
double nAAGivenAAandAB = 0.0;
double nABGivenAAandAB = 0.0;
// for each pair of alleles, add the likelihoods
int numAlleles = vc.getNAlleles();
for ( int allele1 = 0; allele1 < numAlleles; allele1++ ) {
final int HOM1index = determineHomIndex(allele1, numAlleles);
for ( int allele2 = allele1 + 1; allele2 < numAlleles; allele2++ ) {
// TODO -- cache these for better performance
final int HETindex = HOM1index + (allele2 - allele1);
final int HOM2index = determineHomIndex(allele2, numAlleles);
nABGivenABandBB += calculateNChildren(vc, triosToTest, HETindex, HETindex, HOM2index) + calculateNChildren(vc, triosToTest, HETindex, HOM2index, HETindex);
nBBGivenABandBB += calculateNChildren(vc, triosToTest, HOM2index, HETindex, HOM2index) + calculateNChildren(vc, triosToTest, HOM2index, HOM2index, HETindex);
nAAGivenABandAB += calculateNChildren(vc, triosToTest, HOM1index, HETindex, HETindex);
nBBGivenABandAB += calculateNChildren(vc, triosToTest, HOM2index, HETindex, HETindex);
nAAGivenAAandAB += calculateNChildren(vc, triosToTest, HOM1index, HOM1index, HETindex) + calculateNChildren(vc, triosToTest, HOM1index, HETindex, HOM1index);
nABGivenAAandAB += calculateNChildren(vc, triosToTest, HETindex, HOM1index, HETindex) + calculateNChildren(vc, triosToTest, HETindex, HETindex, HOM1index);
}
}
final double numer = (nABGivenABandBB - nBBGivenABandBB) + 2.0 * (nAAGivenABandAB - nBBGivenABandAB) + (nAAGivenAAandAB - nABGivenAAandAB);
final double denom = (nABGivenABandBB + nBBGivenABandBB) + 4.0 * (nAAGivenABandAB + nBBGivenABandAB) + (nAAGivenAAandAB + nABGivenAAandAB);
return (numer * numer) / denom;
}
private double calculateNChildren( final VariantContext vc, final Set<Sample> triosToTest, final int childIdx, final int parent1Idx, final int parent2Idx ) {
private double calculateNChildren( final VariantContext vc, final Set<Sample> triosToTest, final int childIdx, final int momIdx, final int dadIdx ) {
final double likelihoodVector[] = new double[triosToTest.size()];
int iii = 0;
for( final Sample child : triosToTest ) {
final double[] momGL = vc.getGenotype(child.getMaternalID()).getLikelihoods().getAsVector();
final double[] dadGL = vc.getGenotype(child.getPaternalID()).getLikelihoods().getAsVector();
final double[] childGL = vc.getGenotype(child.getID()).getLikelihoods().getAsVector();
likelihoodVector[iii++] = momGL[parent1Idx] + dadGL[parent2Idx] + childGL[childIdx];
likelihoodVector[iii++] = momGL[momIdx] + dadGL[dadIdx] + childGL[childIdx];
}
return MathUtils.sumLog10(likelihoodVector);
}
private static int determineHomIndex(final int alleleIndex, int numAlleles) {
int result = 0;
for ( int i = 0; i < alleleIndex; i++ )
result += numAlleles--;
return result;
}
}

View File

@ -0,0 +1,22 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
/**
* Short one line description of the walker.
*
* @author Mauricio Carneiro
* @since 2/1/12
*/
public enum CallableStatus {
/** the reference base was an N, which is not considered callable the GATK */
REF_N,
/** the base satisfied the min. depth for calling but had less than maxDepth to avoid having EXCESSIVE_COVERAGE */
CALLABLE,
/** absolutely no reads were seen at this locus, regardless of the filtering parameters */
NO_COVERAGE,
/** there were less than min. depth bases at the locus, after applying filters */
LOW_COVERAGE,
/** more than -maxDepth read at the locus, indicating some sort of mapping problem */
EXCESSIVE_COVERAGE,
/** more than --maxFractionOfReadsWithLowMAPQ at the locus, indicating a poor mapping quality of the reads */
POOR_QUALITY
}

View File

@ -0,0 +1,172 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
import org.broad.tribble.Feature;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Input;
import org.broadinstitute.sting.commandline.IntervalBinding;
import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.By;
import org.broadinstitute.sting.gatk.walkers.DataSource;
import org.broadinstitute.sting.gatk.walkers.LocusWalker;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocComparator;
import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.exceptions.UserException;
import java.io.PrintStream;
import java.util.HashMap;
import java.util.Iterator;
import java.util.List;
import java.util.TreeSet;
/**
* Short one line description of the walker.
*
* <p>
* [Long description of the walker]
* </p>
*
*
* <h2>Input</h2>
* <p>
* [Description of the Input]
* </p>
*
* <h2>Output</h2>
* <p>
* [Description of the Output]
* </p>
*
* <h2>Examples</h2>
* <pre>
* java
* -jar GenomeAnalysisTK.jar
* -T [walker name]
* </pre>
*
* @author Mauricio Carneiro
* @since 2/1/12
*/
@By(value = DataSource.READS)
public class DiagnoseTargets extends LocusWalker<Long, Long> {
@Input(fullName = "interval_track", shortName = "int", doc = "", required = true)
private IntervalBinding<Feature> intervalTrack = null;
@Output
private PrintStream out = System.out;
@Argument(fullName = "expand_interval", shortName = "exp", doc = "", required = false)
private int expandInterval = 50;
@Argument(fullName = "minimum_base_quality", shortName = "mbq", doc = "", required = false)
private int minimumBaseQuality = 20;
@Argument(fullName = "minimum_mapping_quality", shortName = "mmq", doc = "", required = false)
private int minimumMappingQuality = 20;
@Argument(fullName = "minimum_coverage", shortName = "mincov", doc = "", required = false)
private int minimumCoverage = 5;
@Argument(fullName = "maximum_coverage", shortName = "maxcov", doc = "", required = false)
private int maximumCoverage = 700;
private TreeSet<GenomeLoc> intervalList = null; // The list of intervals of interest (plus expanded intervals if user wants them)
private HashMap<GenomeLoc, IntervalStatistics> intervalMap = null; // interval => statistics
private Iterator<GenomeLoc> intervalListIterator; // An iterator to go over all the intervals provided as we traverse the genome
private GenomeLoc currentInterval = null; // The "current" interval loaded and being filled with statistics
private IntervalStatistics currentIntervalStatistics = null; // The "current" interval loaded and being filled with statistics
private GenomeLocParser parser; // just an object to allow us to create genome locs (for the expanded intervals)
@Override
public void initialize() {
super.initialize();
if (intervalTrack == null)
throw new UserException("This tool currently only works if you provide an interval track");
parser = new GenomeLocParser(getToolkit().getMasterSequenceDictionary()); // Important to initialize the parser before creating the intervals below
List<GenomeLoc> originalList = intervalTrack.getIntervals(getToolkit()); // The original list of targets provided by the user that will be expanded or not depending on the options provided
intervalList = new TreeSet<GenomeLoc>(new GenomeLocComparator());
intervalMap = new HashMap<GenomeLoc, IntervalStatistics>(originalList.size() * 2);
for (GenomeLoc interval : originalList)
addAndExpandIntervalToLists(interval);
intervalListIterator = intervalList.iterator();
}
@Override
public Long map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {
GenomeLoc refLocus = ref.getLocus();
while (currentInterval == null || currentInterval.isBefore(refLocus)) {
if (!intervalListIterator.hasNext())
return 0L;
currentInterval = intervalListIterator.next();
currentIntervalStatistics = intervalMap.get(currentInterval);
}
if (currentInterval.isPast(refLocus))
return 0L;
byte[] mappingQualities = context.getBasePileup().getMappingQuals();
byte[] baseQualities = context.getBasePileup().getQuals();
int coverage = context.getBasePileup().getBaseAndMappingFilteredPileup(minimumBaseQuality, minimumMappingQuality).depthOfCoverage();
int rawCoverage = context.size();
IntervalStatisticLocus locusData = new IntervalStatisticLocus(mappingQualities, baseQualities, coverage, rawCoverage);
currentIntervalStatistics.addLocus(refLocus, locusData);
return 1L;
}
@Override
public Long reduceInit() {
return 0L;
}
@Override
public Long reduce(Long value, Long sum) {
return sum + value;
}
@Override
public void onTraversalDone(Long result) {
super.onTraversalDone(result);
out.println("Interval\tCallStatus\tCOV\tAVG");
for (GenomeLoc interval : intervalList) {
IntervalStatistics stats = intervalMap.get(interval);
out.println(String.format("%s\t%s\t%d\t%f", interval, stats.callableStatus(), stats.totalCoverage(), stats.averageCoverage()));
}
}
private GenomeLoc createIntervalBefore(GenomeLoc interval) {
int start = Math.max(interval.getStart() - expandInterval, 0);
int stop = Math.max(interval.getStart() - 1, 0);
return parser.createGenomeLoc(interval.getContig(), interval.getContigIndex(), start, stop);
}
private GenomeLoc createIntervalAfter(GenomeLoc interval) {
int contigLimit = getToolkit().getSAMFileHeader().getSequenceDictionary().getSequence(interval.getContigIndex()).getSequenceLength();
int start = Math.min(interval.getStop() + 1, contigLimit);
int stop = Math.min(interval.getStop() + expandInterval, contigLimit);
return parser.createGenomeLoc(interval.getContig(), interval.getContigIndex(), start, stop);
}
private void addAndExpandIntervalToLists(GenomeLoc interval) {
if (expandInterval > 0) {
GenomeLoc before = createIntervalBefore(interval);
GenomeLoc after = createIntervalAfter(interval);
intervalList.add(before);
intervalList.add(after);
intervalMap.put(before, new IntervalStatistics(before, minimumCoverage, maximumCoverage, minimumMappingQuality, minimumBaseQuality));
intervalMap.put(after, new IntervalStatistics(after, minimumCoverage, maximumCoverage, minimumMappingQuality, minimumBaseQuality));
}
intervalList.add(interval);
intervalMap.put(interval, new IntervalStatistics(interval, minimumCoverage, maximumCoverage, minimumMappingQuality, minimumBaseQuality));
}
}

View File

@ -0,0 +1,34 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
/**
* The definition of a locus for the DiagnoseTargets walker statistics calculation
*
* @author Mauricio Carneiro
* @since 2/3/12
*/
class IntervalStatisticLocus {
private final byte[] mappingQuality;
private final byte[] baseQuality;
private final int coverage;
private final int rawCoverage;
public IntervalStatisticLocus(byte[] mappingQuality, byte[] baseQuality, int coverage, int rawCoverage) {
this.mappingQuality = mappingQuality;
this.baseQuality = baseQuality;
this.coverage = coverage;
this.rawCoverage = rawCoverage;
}
public IntervalStatisticLocus() {
this(new byte[1], new byte[1], 0, 0);
}
public int getCoverage() {
return coverage;
}
public int getRawCoverage() {
return rawCoverage;
}
}

View File

@ -0,0 +1,122 @@
package org.broadinstitute.sting.gatk.walkers.diagnostics.targets;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import java.util.ArrayList;
import java.util.HashMap;
/**
* Short one line description of the walker.
*
* @author Mauricio Carneiro
* @since 2/1/12
*/
class IntervalStatistics {
private final GenomeLoc interval;
private final ArrayList<IntervalStatisticLocus> loci;
private final int minimumCoverageThreshold;
private final int maximumCoverageThreshold;
private final int minimumMappingQuality;
private final int minimumBaseQuality;
private int preComputedTotalCoverage = -1; // avoids re-calculating the total sum (-1 means we haven't pre-computed it yet)
private IntervalStatistics(GenomeLoc interval, ArrayList<IntervalStatisticLocus> loci, int minimumCoverageThreshold, int maximumCoverageThreshold, int minimumMappingQuality, int minimumBaseQuality) {
this.interval = interval;
this.loci = loci;
this.minimumCoverageThreshold = minimumCoverageThreshold;
this.maximumCoverageThreshold = maximumCoverageThreshold;
this.minimumMappingQuality = minimumMappingQuality;
this.minimumBaseQuality = minimumBaseQuality;
}
public IntervalStatistics(GenomeLoc interval, int minimumCoverageThreshold, int maximumCoverageThreshold, int minimumMappingQuality, int minimumBaseQuality) {
this(interval, new ArrayList<IntervalStatisticLocus>(interval.size()), minimumCoverageThreshold, maximumCoverageThreshold, minimumMappingQuality, minimumBaseQuality);
// Initialize every loci (this way we don't have to worry about non-existent loci in the object
for (int i = 0; i < interval.size(); i++)
this.loci.add(i, new IntervalStatisticLocus());
}
public long totalCoverage() {
if (preComputedTotalCoverage < 0)
calculateTotalCoverage();
return preComputedTotalCoverage;
}
public double averageCoverage() {
if (preComputedTotalCoverage < 0)
calculateTotalCoverage();
return (double) preComputedTotalCoverage / loci.size();
}
/**
* Calculates the callable status of the entire interval
*
* @return the callable status of the entire interval
*/
public CallableStatus callableStatus() {
long max = -1;
CallableStatus maxCallableStatus = null;
HashMap<CallableStatus, Integer> statusCounts = new HashMap<CallableStatus, Integer>(CallableStatus.values().length);
// initialize the statusCounts with all callable states
for (CallableStatus key : CallableStatus.values())
statusCounts.put(key, 0);
// calculate the callable status for each locus
for (int i = 0; i < loci.size(); i++) {
CallableStatus status = callableStatus(i);
int count = statusCounts.get(status) + 1;
statusCounts.put(status, count);
if (count > max) {
max = count;
maxCallableStatus = status;
}
}
return maxCallableStatus;
}
public void addLocus(GenomeLoc locus, IntervalStatisticLocus locusData) {
if (!interval.containsP(locus))
throw new ReviewedStingException(String.format("Locus %s is not part of the Interval", locus));
int locusIndex = locus.getStart() - interval.getStart();
loci.add(locusIndex, locusData);
}
/**
* returns the callable status of this locus without taking the reference base into account.
*
* @param locusIndex location in the genome to inquire (only one locus)
* @return the callable status of a locus
*/
private CallableStatus callableStatus(int locusIndex) {
if (loci.get(locusIndex).getCoverage() > maximumCoverageThreshold)
return CallableStatus.EXCESSIVE_COVERAGE;
if (loci.get(locusIndex).getCoverage() >= minimumCoverageThreshold)
return CallableStatus.CALLABLE;
if (loci.get(locusIndex).getRawCoverage() >= minimumCoverageThreshold)
return CallableStatus.POOR_QUALITY;
if (loci.get(locusIndex).getRawCoverage() > 0)
return CallableStatus.LOW_COVERAGE;
return CallableStatus.NO_COVERAGE;
}
private void calculateTotalCoverage() {
preComputedTotalCoverage = 0;
for (IntervalStatisticLocus locus : loci)
preComputedTotalCoverage += locus.getCoverage();
}
}

View File

@ -253,7 +253,7 @@ public class UnifiedGenotyperEngine {
VariantContext vcInput = UnifiedGenotyperEngine.getVCFromAllelesRod(tracker, ref, rawContext.getLocation(), false, logger, UAC.alleles);
if ( vcInput == null )
return null;
vc = new VariantContextBuilder(vcInput).source("UG_call").noID().referenceBaseForIndel(ref.getBase()).make();
vc = new VariantContextBuilder(vcInput).source("UG_call").noID().referenceBaseForIndel(ref.getBase()).attributes(new HashMap<String, Object>()).filters(new HashSet<String>()).make();
} else {
// deal with bad/non-standard reference bases
if ( !Allele.acceptableAlleleBases(new byte[]{ref.getBase()}) )

View File

@ -0,0 +1,70 @@
/*
* Copyright (c) 2011 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.gatk.walkers.recalibration;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/**
* Created by IntelliJ IDEA.
* User: rpoplin
* Date: 9/26/11
*/
public class ContextCovariate implements ExperimentalCovariate {
private int CONTEXT_SIZE;
private String allN = "";
// Initialize any member variables using the command-line arguments passed to the walkers
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
CONTEXT_SIZE = RAC.CONTEXT_SIZE;
if (CONTEXT_SIZE <= 0)
throw new UserException("Context Size must be positive, if you don't want to use the context covariate, just turn it off instead");
// initialize allN given the size of the context
for (int i = 0; i < CONTEXT_SIZE; i++)
allN += "N";
}
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
byte[] bases = read.getReadBases();
for (int i = 0; i < read.getReadLength(); i++)
comparable[i] = (i < CONTEXT_SIZE) ? allN : new String(Arrays.copyOfRange(bases, i - CONTEXT_SIZE, i));
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return str;
}
}

View File

@ -41,6 +41,7 @@ import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.pileup.PileupElement;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.io.PrintStream;
@ -128,13 +129,14 @@ import java.util.Map;
* -cov DinucCovariate \
* -recalFile my_reads.recal_data.csv
* </pre>
*
*/
@BAQMode(ApplicationTime = BAQ.ApplicationTime.FORBIDDEN)
@By( DataSource.READS ) // Only look at covered loci, not every loci of the reference file
@ReadFilters( {MappingQualityZeroFilter.class, MappingQualityUnavailableFilter.class} ) // Filter out all reads with zero or unavailable mapping quality
@Requires( {DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES} ) // This walker requires both -I input.bam and -R reference.fasta
@By(DataSource.READS) // Only look at covered loci, not every loci of the reference file
@ReadFilters({MappingQualityZeroFilter.class, MappingQualityUnavailableFilter.class})
// Filter out all reads with zero or unavailable mapping quality
@Requires({DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES})
// This walker requires both -I input.bam and -R reference.fasta
@PartitionBy(PartitionType.LOCUS)
public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.CountedData, CountCovariatesWalker.CountedData> implements TreeReducible<CountCovariatesWalker.CountedData> {
@ -148,7 +150,8 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/////////////////////////////
// Shared Arguments
/////////////////////////////
@ArgumentCollection private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
@ArgumentCollection
private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
/////////////////////////////
// Command Line Arguments
@ -159,7 +162,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* for use as this database. For users wishing to exclude an interval list of known variation simply use -XL my.interval.list to skip over processing those sites.
* Please note however that the statistics reported by the tool will not accurately reflected those sites skipped by the -XL argument.
*/
@Input(fullName="knownSites", shortName = "knownSites", doc="A database of known polymorphic sites to skip over in the recalibration algorithm", required=false)
@Input(fullName = "knownSites", shortName = "knownSites", doc = "A database of known polymorphic sites to skip over in the recalibration algorithm", required = false)
public List<RodBinding<Feature>> knownSites = Collections.emptyList();
/**
@ -168,31 +171,31 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/
@Output(fullName="recal_file", shortName="recalFile", required=true, doc="Filename for the output covariates table recalibration file")
@Output(fullName = "recal_file", shortName = "recalFile", required = true, doc = "Filename for the output covariates table recalibration file")
@Gather(CountCovariatesGatherer.class)
public PrintStream RECAL_FILE;
@Argument(fullName="list", shortName="ls", doc="List the available covariates and exit", required=false)
@Argument(fullName = "list", shortName = "ls", doc = "List the available covariates and exit", required = false)
private boolean LIST_ONLY = false;
/**
* See the -list argument to view available covariates.
*/
@Argument(fullName="covariate", shortName="cov", doc="Covariates to be used in the recalibration. Each covariate is given as a separate cov parameter. ReadGroup and ReportedQuality are required covariates and are already added for you.", required=false)
@Argument(fullName = "covariate", shortName = "cov", doc = "Covariates to be used in the recalibration. Each covariate is given as a separate cov parameter. ReadGroup and ReportedQuality are required covariates and are already added for you.", required = false)
private String[] COVARIATES = null;
@Argument(fullName="standard_covs", shortName="standard", doc="Use the standard set of covariates in addition to the ones listed using the -cov argument", required=false)
@Argument(fullName = "standard_covs", shortName = "standard", doc = "Use the standard set of covariates in addition to the ones listed using the -cov argument", required = false)
private boolean USE_STANDARD_COVARIATES = false;
/////////////////////////////
// Debugging-only Arguments
/////////////////////////////
@Argument(fullName="dont_sort_output", shortName="unsorted", required=false, doc="If specified, the output table recalibration csv file will be in an unsorted, arbitrary order to save some run time.")
@Argument(fullName = "dont_sort_output", shortName = "unsorted", required = false, doc = "If specified, the output table recalibration csv file will be in an unsorted, arbitrary order to save some run time.")
private boolean DONT_SORT_OUTPUT = false;
/**
* This calculation is critically dependent on being able to skip over known polymorphic sites. Please be sure that you know what you are doing if you use this option.
*/
@Argument(fullName="run_without_dbsnp_potentially_ruining_quality", shortName="run_without_dbsnp_potentially_ruining_quality", required=false, doc="If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only.")
@Argument(fullName = "run_without_dbsnp_potentially_ruining_quality", shortName = "run_without_dbsnp_potentially_ruining_quality", required = false, doc = "If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only.")
private boolean RUN_WITHOUT_DBSNP = false;
/////////////////////////////
@ -216,6 +219,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/**
* Adds the values of other to this, returning this
*
* @param other
* @return this object
*/
@ -246,53 +250,55 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
*/
public void initialize() {
if( RAC.FORCE_READ_GROUP != null ) { RAC.DEFAULT_READ_GROUP = RAC.FORCE_READ_GROUP; }
if( RAC.FORCE_PLATFORM != null ) { RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM; }
if (RAC.FORCE_PLATFORM != null) {
RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM;
}
// Get a list of all available covariates
final List<Class<? extends Covariate>> covariateClasses = new PluginManager<Covariate>( Covariate.class ).getPlugins();
final List<Class<? extends RequiredCovariate>> requiredClasses = new PluginManager<RequiredCovariate>( RequiredCovariate.class ).getPlugins();
final List<Class<? extends StandardCovariate>> standardClasses = new PluginManager<StandardCovariate>( StandardCovariate.class ).getPlugins();
final List<Class<? extends Covariate>> covariateClasses = new PluginManager<Covariate>(Covariate.class).getPlugins();
final List<Class<? extends RequiredCovariate>> requiredClasses = new PluginManager<RequiredCovariate>(RequiredCovariate.class).getPlugins();
final List<Class<? extends StandardCovariate>> standardClasses = new PluginManager<StandardCovariate>(StandardCovariate.class).getPlugins();
// Print and exit if that's what was requested
if ( LIST_ONLY ) {
logger.info( "Available covariates:" );
for( Class<?> covClass : covariateClasses ) {
logger.info( covClass.getSimpleName() );
if (LIST_ONLY) {
logger.info("Available covariates:");
for (Class<?> covClass : covariateClasses) {
logger.info(covClass.getSimpleName());
}
logger.info("");
System.exit( 0 ); // Early exit here because user requested it
System.exit(0); // Early exit here because user requested it
}
// Warn the user if no dbSNP file or other variant mask was specified
if( knownSites.isEmpty() && !RUN_WITHOUT_DBSNP ) {
if (knownSites.isEmpty() && !RUN_WITHOUT_DBSNP) {
throw new UserException.CommandLineException("This calculation is critically dependent on being able to skip over known variant sites. Please provide a VCF file containing known sites of genetic variation.");
}
// Initialize the requested covariates by parsing the -cov argument
// First add the required covariates
if( requiredClasses.size() == 2) { // readGroup and reported quality score
requestedCovariates.add( new ReadGroupCovariate() ); // Order is important here
requestedCovariates.add( new QualityScoreCovariate() );
} else {
if (requiredClasses.size() == 2) { // readGroup and reported quality score
requestedCovariates.add(new ReadGroupCovariate()); // Order is important here
requestedCovariates.add(new QualityScoreCovariate());
}
else {
throw new UserException.CommandLineException("There are more required covariates than expected. The instantiation list needs to be updated with the new required covariate and in the correct order.");
}
// Next add the standard covariates if -standard was specified by the user
if( USE_STANDARD_COVARIATES ) {
if (USE_STANDARD_COVARIATES) {
// We want the standard covariates to appear in a consistent order but the packageUtils method gives a random order
// A list of Classes can't be sorted, but a list of Class names can be
final List<String> standardClassNames = new ArrayList<String>();
for( Class<?> covClass : standardClasses ) {
standardClassNames.add( covClass.getName() );
for (Class<?> covClass : standardClasses) {
standardClassNames.add(covClass.getName());
}
Collections.sort(standardClassNames); // Sort the list of class names
for( String className : standardClassNames ) {
for( Class<?> covClass : standardClasses ) { // Find the class that matches this class name
if( covClass.getName().equals( className ) ) {
for (String className : standardClassNames) {
for (Class<?> covClass : standardClasses) { // Find the class that matches this class name
if (covClass.getName().equals(className)) {
try {
final Covariate covariate = (Covariate)covClass.newInstance();
requestedCovariates.add( covariate );
final Covariate covariate = (Covariate) covClass.newInstance();
requestedCovariates.add(covariate);
} catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e);
}
@ -301,17 +307,17 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
}
}
// Finally parse the -cov arguments that were provided, skipping over the ones already specified
if( COVARIATES != null ) {
for( String requestedCovariateString : COVARIATES ) {
if (COVARIATES != null) {
for (String requestedCovariateString : COVARIATES) {
boolean foundClass = false;
for( Class<?> covClass : covariateClasses ) {
if( requestedCovariateString.equalsIgnoreCase( covClass.getSimpleName() ) ) { // -cov argument matches the class name for an implementing class
for (Class<?> covClass : covariateClasses) {
if (requestedCovariateString.equalsIgnoreCase(covClass.getSimpleName())) { // -cov argument matches the class name for an implementing class
foundClass = true;
if( !requiredClasses.contains( covClass ) && (!USE_STANDARD_COVARIATES || !standardClasses.contains( covClass )) ) {
if (!requiredClasses.contains(covClass) && (!USE_STANDARD_COVARIATES || !standardClasses.contains(covClass))) {
try {
// Now that we've found a matching class, try to instantiate it
final Covariate covariate = (Covariate)covClass.newInstance();
requestedCovariates.add( covariate );
final Covariate covariate = (Covariate) covClass.newInstance();
requestedCovariates.add(covariate);
} catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e);
}
@ -319,20 +325,19 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
}
}
if( !foundClass ) {
throw new UserException.CommandLineException( "The requested covariate type (" + requestedCovariateString + ") isn't a valid covariate option. Use --list to see possible covariates." );
if (!foundClass) {
throw new UserException.CommandLineException("The requested covariate type (" + requestedCovariateString + ") isn't a valid covariate option. Use --list to see possible covariates.");
}
}
}
logger.info( "The covariates being used here: " );
for( Covariate cov : requestedCovariates ) {
logger.info( "\t" + cov.getClass().getSimpleName() );
cov.initialize( RAC ); // Initialize any covariate member variables using the shared argument collection
logger.info("The covariates being used here: ");
for (Covariate cov : requestedCovariates) {
logger.info("\t" + cov.getClass().getSimpleName());
cov.initialize(RAC); // Initialize any covariate member variables using the shared argument collection
}
}
//---------------------------------------------------------------------------------------------------------------
//
// map
@ -342,61 +347,62 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/**
* For each read at this locus get the various covariate values and increment that location in the map based on
* whether or not the base matches the reference at this particular location
*
* @param tracker The reference metadata tracker
* @param ref The reference context
* @param context The alignment context
* @return Returns 1, but this value isn't used in the reduce step
*/
public CountedData map( RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context ) {
public CountedData map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {
// Only use data from non-dbsnp sites
// Assume every mismatch at a non-dbsnp site is indicative of poor quality
CountedData counter = new CountedData();
if( tracker.getValues(knownSites).size() == 0 ) { // If something here is in one of the knownSites tracks then skip over it, otherwise proceed
if (tracker.getValues(knownSites).size() == 0) { // If something here is in one of the knownSites tracks then skip over it, otherwise proceed
// For each read at this locus
for( final PileupElement p : context.getBasePileup() ) {
final GATKSAMRecord gatkRead = (GATKSAMRecord) p.getRead();
for (final PileupElement p : context.getBasePileup()) {
final GATKSAMRecord gatkRead = p.getRead();
int offset = p.getOffset();
if( gatkRead.containsTemporaryAttribute( SKIP_RECORD_ATTRIBUTE ) ) {
if (gatkRead.containsTemporaryAttribute(SKIP_RECORD_ATTRIBUTE)) {
continue;
}
if( !gatkRead.containsTemporaryAttribute( SEEN_ATTRIBUTE ) )
{
gatkRead.setTemporaryAttribute( SEEN_ATTRIBUTE, true );
RecalDataManager.parseSAMRecord( gatkRead, RAC );
if (!gatkRead.containsTemporaryAttribute(SEEN_ATTRIBUTE)) {
gatkRead.setTemporaryAttribute(SEEN_ATTRIBUTE, true);
RecalDataManager.parseSAMRecord(gatkRead, RAC);
// Skip over reads with no calls in the color space if the user requested it
if( !(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) && RecalDataManager.checkNoCallColorSpace( gatkRead ) ) {
gatkRead.setTemporaryAttribute( SKIP_RECORD_ATTRIBUTE, true);
if (!(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) && RecalDataManager.checkNoCallColorSpace(gatkRead)) {
gatkRead.setTemporaryAttribute(SKIP_RECORD_ATTRIBUTE, true);
continue;
}
RecalDataManager.parseColorSpace( gatkRead );
gatkRead.setTemporaryAttribute( COVARS_ATTRIBUTE,
RecalDataManager.computeCovariates( gatkRead, requestedCovariates ));
RecalDataManager.parseColorSpace(gatkRead);
gatkRead.setTemporaryAttribute(COVARS_ATTRIBUTE, RecalDataManager.computeCovariates(gatkRead, requestedCovariates, BaseRecalibration.BaseRecalibrationType.BASE_SUBSTITUTION));
}
// Skip this position if base quality is zero
if( gatkRead.getBaseQualities()[offset] > 0 ) {
if (gatkRead.getBaseQualities()[offset] > 0) {
byte[] bases = gatkRead.getReadBases();
byte refBase = ref.getBase();
// Skip if this base is an 'N' or etc.
if( BaseUtils.isRegularBase( bases[offset] ) ) {
if (BaseUtils.isRegularBase(bases[offset])) {
// SOLID bams have inserted the reference base into the read if the color space in inconsistent with the read base so skip it
if( !gatkRead.getReadGroup().getPlatform().toUpperCase().contains("SOLID") || RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING ||
!RecalDataManager.isInconsistentColorSpace( gatkRead, offset ) ) {
if (!gatkRead.getReadGroup().getPlatform().toUpperCase().contains("SOLID") || RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING ||
!RecalDataManager.isInconsistentColorSpace(gatkRead, offset)) {
// This base finally passed all the checks for a good base, so add it to the big data hashmap
updateDataFromRead( counter, gatkRead, offset, refBase );
updateDataFromRead(counter, gatkRead, offset, refBase);
} else { // calculate SOLID reference insertion rate
if( refBase == bases[offset] ) {
}
else { // calculate SOLID reference insertion rate
if (refBase == bases[offset]) {
counter.solidInsertedReferenceBases++;
} else {
}
else {
counter.otherColorSpaceInconsistency++;
}
}
@ -404,7 +410,8 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
}
}
counter.countedSites++;
} else { // We skipped over the dbSNP site, and we are only processing every Nth locus
}
else { // We skipped over the dbSNP site, and we are only processing every Nth locus
counter.skippedSites++;
updateMismatchCounts(counter, context, ref.getBase()); // For sanity check to ensure novel mismatch rate vs dnsnp mismatch rate is reasonable
}
@ -420,13 +427,13 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* @param refBase The reference base
*/
private static void updateMismatchCounts(CountedData counter, final AlignmentContext context, final byte refBase) {
for( PileupElement p : context.getBasePileup() ) {
for (PileupElement p : context.getBasePileup()) {
final byte readBase = p.getBase();
final int readBaseIndex = BaseUtils.simpleBaseToBaseIndex(readBase);
final int refBaseIndex = BaseUtils.simpleBaseToBaseIndex(refBase);
if( readBaseIndex != -1 && refBaseIndex != -1 ) {
if( readBaseIndex != refBaseIndex ) {
if (readBaseIndex != -1 && refBaseIndex != -1) {
if (readBaseIndex != refBaseIndex) {
counter.novelCountsMM++;
}
counter.novelCountsBases++;
@ -441,6 +448,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* adding one to the number of observations and potentially one to the number of mismatches
* Lots of things are passed as parameters to this method as a strategy for optimizing the covariate.getValue calls
* because pulling things out of the SAMRecord is an expensive operation.
*
* @param counter Data structure which holds the counted bases
* @param gatkRead The SAMRecord holding all the data for this read
* @param offset The offset in the read for this locus
@ -452,10 +460,10 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
// Using the list of covariate values as a key, pick out the RecalDatum from the data HashMap
final NestedHashMap data = dataManager.data; //optimization - create local reference
RecalDatumOptimized datum = (RecalDatumOptimized) data.get( key );
if( datum == null ) { // key doesn't exist yet in the map so make a new bucket and add it
RecalDatumOptimized datum = (RecalDatumOptimized) data.get(key);
if (datum == null) { // key doesn't exist yet in the map so make a new bucket and add it
// initialized with zeros, will be incremented at end of method
datum = (RecalDatumOptimized)data.put( new RecalDatumOptimized(), true, (Object[])key );
datum = (RecalDatumOptimized) data.put(new RecalDatumOptimized(), true, (Object[]) key);
}
// Need the bases to determine whether or not we have a mismatch
@ -463,13 +471,12 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
final long curMismatches = datum.getNumMismatches();
// Add one to the number of observations and potentially one to the number of mismatches
datum.incrementBaseCounts( base, refBase );
datum.incrementBaseCounts(base, refBase);
counter.countedBases++;
counter.novelCountsBases++;
counter.novelCountsMM += datum.getNumMismatches() - curMismatches; // For sanity check to ensure novel mismatch rate vs dnsnp mismatch rate is reasonable
}
//---------------------------------------------------------------------------------------------------------------
//
// reduce
@ -478,6 +485,7 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/**
* Initialize the reduce step by creating a PrintStream from the filename specified as an argument to the walker.
*
* @return returns A PrintStream created from the -recalFile filename argument specified to the walker
*/
public CountedData reduceInit() {
@ -486,11 +494,12 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
/**
* The Reduce method doesn't do anything for this walker.
*
* @param mapped Result of the map. This value is immediately ignored.
* @param sum The summing CountedData used to output the CSV data
* @return returns The sum used to output the CSV data
*/
public CountedData reduce( CountedData mapped, CountedData sum ) {
public CountedData reduce(CountedData mapped, CountedData sum) {
// Do a dbSNP sanity check every so often
return validatingDbsnpMismatchRate(sum.add(mapped));
}
@ -499,16 +508,15 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
* Validate the dbSNP reference mismatch rates.
*/
private CountedData validatingDbsnpMismatchRate(CountedData counter) {
if( ++counter.lociSinceLastDbsnpCheck >= DBSNP_VALIDATION_CHECK_FREQUENCY ) {
if (++counter.lociSinceLastDbsnpCheck >= DBSNP_VALIDATION_CHECK_FREQUENCY) {
counter.lociSinceLastDbsnpCheck = 0;
if( counter.novelCountsBases != 0L && counter.dbSNPCountsBases != 0L ) {
final double fractionMM_novel = (double)counter.novelCountsMM / (double)counter.novelCountsBases;
final double fractionMM_dbsnp = (double)counter.dbSNPCountsMM / (double)counter.dbSNPCountsBases;
if (counter.novelCountsBases != 0L && counter.dbSNPCountsBases != 0L) {
final double fractionMM_novel = (double) counter.novelCountsMM / (double) counter.novelCountsBases;
final double fractionMM_dbsnp = (double) counter.dbSNPCountsMM / (double) counter.dbSNPCountsBases;
if( fractionMM_dbsnp < DBSNP_VS_NOVEL_MISMATCH_RATE * fractionMM_novel ) {
Utils.warnUser("The variation rate at the supplied list of known variant sites seems suspiciously low. Please double-check that the correct ROD is being used. " +
String.format("[dbSNP variation rate = %.4f, novel variation rate = %.4f]", fractionMM_dbsnp, fractionMM_novel) );
if (fractionMM_dbsnp < DBSNP_VS_NOVEL_MISMATCH_RATE * fractionMM_novel) {
Utils.warnUser("The variation rate at the supplied list of known variant sites seems suspiciously low. Please double-check that the correct ROD is being used. " + String.format("[dbSNP variation rate = %.4f, novel variation rate = %.4f]", fractionMM_dbsnp, fractionMM_novel));
DBSNP_VALIDATION_CHECK_FREQUENCY *= 2; // Don't annoyingly output the warning message every megabase of a large file
}
}
@ -517,47 +525,50 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
return counter;
}
public CountedData treeReduce( CountedData sum1, CountedData sum2 ) {
public CountedData treeReduce(CountedData sum1, CountedData sum2) {
return validatingDbsnpMismatchRate(sum1.add(sum2));
}
/**
* Write out the full data hashmap to disk in CSV format
*
* @param sum The CountedData to write out to RECAL_FILE
*/
public void onTraversalDone( CountedData sum ) {
logger.info( "Writing raw recalibration data..." );
if( sum.countedBases == 0L ) {
public void onTraversalDone(CountedData sum) {
logger.info("Writing raw recalibration data...");
if (sum.countedBases == 0L) {
throw new UserException.BadInput("Could not find any usable data in the input BAM file(s).");
}
outputToCSV( sum, RECAL_FILE );
logger.info( "...done!" );
outputToCSV(sum, RECAL_FILE);
logger.info("...done!");
}
/**
* For each entry (key-value pair) in the data hashmap output the Covariate's values as well as the RecalDatum's data in CSV format
*
* @param recalTableStream The PrintStream to write out to
*/
private void outputToCSV( CountedData sum, final PrintStream recalTableStream ) {
private void outputToCSV(CountedData sum, final PrintStream recalTableStream) {
recalTableStream.printf("# Counted Sites %d%n", sum.countedSites);
recalTableStream.printf("# Counted Bases %d%n", sum.countedBases);
recalTableStream.printf("# Skipped Sites %d%n", sum.skippedSites);
recalTableStream.printf("# Fraction Skipped 1 / %.0f bp%n", (double)sum.countedSites / sum.skippedSites);
recalTableStream.printf("# Fraction Skipped 1 / %.0f bp%n", (double) sum.countedSites / sum.skippedSites);
if( sum.solidInsertedReferenceBases != 0 ) {
if (sum.solidInsertedReferenceBases != 0) {
recalTableStream.printf("# Fraction SOLiD inserted reference 1 / %.0f bases%n", (double) sum.countedBases / sum.solidInsertedReferenceBases);
recalTableStream.printf("# Fraction other color space inconsistencies 1 / %.0f bases%n", (double) sum.countedBases / sum.otherColorSpaceInconsistency);
}
// Output header saying which covariates were used and in what order
for( Covariate cov : requestedCovariates ) {
recalTableStream.print( cov.getClass().getSimpleName().split("Covariate")[0] + "," );
for (Covariate cov : requestedCovariates) {
recalTableStream.print(cov.getClass().getSimpleName().split("Covariate")[0] + ",");
}
recalTableStream.println("nObservations,nMismatches,Qempirical");
if( DONT_SORT_OUTPUT ) {
if (DONT_SORT_OUTPUT) {
printMappings(recalTableStream, 0, new Object[requestedCovariates.size()], dataManager.data.data);
} else {
}
else {
printMappingsSorted(recalTableStream, 0, new Object[requestedCovariates.size()], dataManager.data.data);
}
@ -565,45 +576,47 @@ public class CountCovariatesWalker extends LocusWalker<CountCovariatesWalker.Cou
recalTableStream.println(TableRecalibrationWalker.EOF_MARKER);
}
private void printMappingsSorted( final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) {
private void printMappingsSorted(final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) {
final ArrayList<Comparable> keyList = new ArrayList<Comparable>();
for( Object comp : data.keySet() ) {
for (Object comp : data.keySet()) {
keyList.add((Comparable) comp);
}
Collections.sort(keyList);
for( Comparable comp : keyList ) {
for (Comparable comp : keyList) {
key[curPos] = comp;
final Object val = data.get(comp);
if( val instanceof RecalDatumOptimized ) { // We are at the end of the nested hash maps
if (val instanceof RecalDatumOptimized) { // We are at the end of the nested hash maps
// For each Covariate in the key
for( Object compToPrint : key ) {
for (Object compToPrint : key) {
// Output the Covariate's value
recalTableStream.print( compToPrint + "," );
recalTableStream.print(compToPrint + ",");
}
// Output the RecalDatum entry
recalTableStream.println( ((RecalDatumOptimized)val).outputToCSV() );
} else { // Another layer in the nested hash map
printMappingsSorted( recalTableStream, curPos + 1, key, (Map) val );
recalTableStream.println(((RecalDatumOptimized) val).outputToCSV());
}
else { // Another layer in the nested hash map
printMappingsSorted(recalTableStream, curPos + 1, key, (Map) val);
}
}
}
private void printMappings( final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) {
for( Object comp : data.keySet() ) {
private void printMappings(final PrintStream recalTableStream, final int curPos, final Object[] key, final Map data) {
for (Object comp : data.keySet()) {
key[curPos] = comp;
final Object val = data.get(comp);
if( val instanceof RecalDatumOptimized ) { // We are at the end of the nested hash maps
if (val instanceof RecalDatumOptimized) { // We are at the end of the nested hash maps
// For each Covariate in the key
for( Object compToPrint : key ) {
for (Object compToPrint : key) {
// Output the Covariate's value
recalTableStream.print( compToPrint + "," );
recalTableStream.print(compToPrint + ",");
}
// Output the RecalDatum entry
recalTableStream.println( ((RecalDatumOptimized)val).outputToCSV() );
} else { // Another layer in the nested hash map
printMappings( recalTableStream, curPos + 1, key, (Map) val );
recalTableStream.println(((RecalDatumOptimized) val).outputToCSV());
}
else { // Another layer in the nested hash map
printMappings(recalTableStream, curPos + 1, key, (Map) val);
}
}
}

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -32,24 +33,24 @@ import net.sf.samtools.SAMRecord;
* User: rpoplin
* Date: Oct 30, 2009
*
* The Covariate interface. A Covariate is a feature used in the recalibration that can be picked out of the read, offset, and corresponding reference bases
* The Covariate interface. A Covariate is a feature used in the recalibration that can be picked out of the read.
* In general most error checking and adjustments to the data are done before the call to the covariates getValue methods in order to speed up the code.
* This unfortunately muddies the code, but most of these corrections can be done per read while the covariates get called per base, resulting in a big speed up.
*/
public interface Covariate {
public void initialize( RecalibrationArgumentCollection RAC ); // Initialize any member variables using the command-line arguments passed to the walkers
public Comparable getValue( String str ); // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public void getValues( SAMRecord read, Comparable[] comparable ); //Takes an array of size (at least) read.getReadLength() and fills it with covariate
public void initialize(RecalibrationArgumentCollection RAC); // Initialize any member variables using the command-line arguments passed to the walkers
public Comparable getValue(String str); // Used to get the covariate's value from input csv file in TableRecalibrationWalker
public void getValues(GATKSAMRecord read, Comparable[] comparable, BaseRecalibration.BaseRecalibrationType modelType);
//Takes an array of size (at least) read.getReadLength() and fills it with covariate
//values for each position in the read. This method was created as an optimization over calling getValue( read, offset ) for each offset and allows
//read-specific calculations to be done just once rather than for each offset.
}
interface RequiredCovariate extends Covariate {
}
interface RequiredCovariate extends Covariate {}
interface StandardCovariate extends Covariate {
}
interface StandardCovariate extends Covariate {}
interface ExperimentalCovariate extends Covariate {
}
interface ExperimentalCovariate extends Covariate {}

View File

@ -1,9 +1,9 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.NGSPlatform;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.EnumSet;
@ -51,55 +51,57 @@ public class CycleCovariate implements StandardCovariate {
private final static EnumSet<NGSPlatform> FLOW_CYCLE_PLATFORMS = EnumSet.of(NGSPlatform.LS454, NGSPlatform.ION_TORRENT);
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
if( RAC.DEFAULT_PLATFORM != null ) {
if( RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "SLX" ) || RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "ILLUMINA" ) ||
RAC.DEFAULT_PLATFORM.contains( "454" ) || RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "SOLID" ) || RAC.DEFAULT_PLATFORM.equalsIgnoreCase( "ABI_SOLID" ) ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
if (RAC.DEFAULT_PLATFORM != null) {
if (RAC.DEFAULT_PLATFORM.equalsIgnoreCase("SLX") || RAC.DEFAULT_PLATFORM.equalsIgnoreCase("ILLUMINA") ||
RAC.DEFAULT_PLATFORM.contains("454") || RAC.DEFAULT_PLATFORM.equalsIgnoreCase("SOLID") || RAC.DEFAULT_PLATFORM.equalsIgnoreCase("ABI_SOLID")) {
// nothing to do
} else {
throw new UserException.CommandLineException("The requested default platform (" + RAC.DEFAULT_PLATFORM +") is not a recognized platform. Implemented options are illumina, 454, and solid");
}
else {
throw new UserException.CommandLineException("The requested default platform (" + RAC.DEFAULT_PLATFORM + ") is not a recognized platform. Implemented options are illumina, 454, and solid");
}
}
}
// Used to pick out the covariate's value from attributes of the read
public void getValues(SAMRecord read, Comparable[] comparable) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
//-----------------------------
// Illumina, Solid, PacBio, and Complete Genomics
//-----------------------------
final NGSPlatform ngsPlatform = ((GATKSAMRecord)read).getNGSPlatform();
if( DISCRETE_CYCLE_PLATFORMS.contains(ngsPlatform) ) {
final NGSPlatform ngsPlatform = read.getNGSPlatform();
if (DISCRETE_CYCLE_PLATFORMS.contains(ngsPlatform)) {
final int init;
final int increment;
if( !read.getReadNegativeStrandFlag() ) {
if (!read.getReadNegativeStrandFlag()) {
// Differentiate between first and second of pair.
// The sequencing machine cycle keeps incrementing for the second read in a pair. So it is possible for a read group
// to have an error affecting quality at a particular cycle on the first of pair which carries over to the second of pair.
// Therefore the cycle covariate must differentiate between first and second of pair reads.
// This effect can not be corrected by pulling out the first of pair and second of pair flags into a separate covariate because
// the current sequential model would consider the effects independently instead of jointly.
if( read.getReadPairedFlag() && read.getSecondOfPairFlag() ) {
if (read.getReadPairedFlag() && read.getSecondOfPairFlag()) {
//second of pair, positive strand
init = -1;
increment = -1;
}
else
{
else {
//first of pair, positive strand
init = 1;
increment = 1;
}
} else {
if( read.getReadPairedFlag() && read.getSecondOfPairFlag() ) {
}
else {
if (read.getReadPairedFlag() && read.getSecondOfPairFlag()) {
//second of pair, negative strand
init = -read.getReadLength();
increment = 1;
}
else
{
else {
//first of pair, negative strand
init = read.getReadLength();
increment = -1;
@ -107,7 +109,7 @@ public class CycleCovariate implements StandardCovariate {
}
int cycle = init;
for(int i = 0; i < read.getReadLength(); i++) {
for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = cycle;
cycle += increment;
}
@ -116,7 +118,7 @@ public class CycleCovariate implements StandardCovariate {
//-----------------------------
// 454 and Ion Torrent
//-----------------------------
else if( FLOW_CYCLE_PLATFORMS.contains(ngsPlatform) ) {
else if (FLOW_CYCLE_PLATFORMS.contains(ngsPlatform)) {
final int readLength = read.getReadLength();
final byte[] bases = read.getReadBases();
@ -133,28 +135,67 @@ public class CycleCovariate implements StandardCovariate {
// BUGBUG: Consider looking at degradation of base quality scores in homopolymer runs to detect when the cycle incremented even though the nucleotide didn't change
// For example, AAAAAAA was probably read in two flow cycles but here we count it as one
if( !read.getReadNegativeStrandFlag() ) { // Forward direction
if (!read.getReadNegativeStrandFlag()) { // Forward direction
int iii = 0;
while( iii < readLength )
{
while( iii < readLength && bases[iii] == (byte)'T' ) { comparable[iii] = cycle; iii++; }
while( iii < readLength && bases[iii] == (byte)'A' ) { comparable[iii] = cycle; iii++; }
while( iii < readLength && bases[iii] == (byte)'C' ) { comparable[iii] = cycle; iii++; }
while( iii < readLength && bases[iii] == (byte)'G' ) { comparable[iii] = cycle; iii++; }
if( iii < readLength ) { if (multiplyByNegative1) cycle--; else cycle++; }
if( iii < readLength && !BaseUtils.isRegularBase(bases[iii]) ) { comparable[iii] = cycle; iii++; }
while (iii < readLength) {
while (iii < readLength && bases[iii] == (byte) 'T') {
comparable[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'A') {
comparable[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'C') {
comparable[iii] = cycle;
iii++;
}
while (iii < readLength && bases[iii] == (byte) 'G') {
comparable[iii] = cycle;
iii++;
}
if (iii < readLength) {
if (multiplyByNegative1)
cycle--;
else
cycle++;
}
if (iii < readLength && !BaseUtils.isRegularBase(bases[iii])) {
comparable[iii] = cycle;
iii++;
}
}
} else { // Negative direction
int iii = readLength-1;
while( iii >= 0 )
{
while( iii >= 0 && bases[iii] == (byte)'T' ) { comparable[iii] = cycle; iii--; }
while( iii >= 0 && bases[iii] == (byte)'A' ) { comparable[iii] = cycle; iii--; }
while( iii >= 0 && bases[iii] == (byte)'C' ) { comparable[iii] = cycle; iii--; }
while( iii >= 0 && bases[iii] == (byte)'G' ) { comparable[iii] = cycle; iii--; }
if( iii >= 0 ) { if (multiplyByNegative1) cycle--; else cycle++; }
if( iii >= 0 && !BaseUtils.isRegularBase(bases[iii]) ) { comparable[iii] = cycle; iii--; }
}
else { // Negative direction
int iii = readLength - 1;
while (iii >= 0) {
while (iii >= 0 && bases[iii] == (byte) 'T') {
comparable[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'A') {
comparable[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'C') {
comparable[iii] = cycle;
iii--;
}
while (iii >= 0 && bases[iii] == (byte) 'G') {
comparable[iii] = cycle;
iii--;
}
if (iii >= 0) {
if (multiplyByNegative1)
cycle--;
else
cycle++;
}
if (iii >= 0 && !BaseUtils.isRegularBase(bases[iii])) {
comparable[iii] = cycle;
iii--;
}
}
}
}
@ -164,7 +205,8 @@ public class CycleCovariate implements StandardCovariate {
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,7 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.BaseUtils;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.HashMap;
@ -42,63 +43,30 @@ import java.util.HashMap;
public class DinucCovariate implements StandardCovariate {
private static final byte NO_CALL = (byte)'N';
private static final byte NO_CALL = (byte) 'N';
private static final Dinuc NO_DINUC = new Dinuc(NO_CALL, NO_CALL);
private HashMap<Integer, Dinuc> dinucHashMap;
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
final byte[] BASES = { (byte)'A', (byte)'C', (byte)'G', (byte)'T' };
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
final byte[] BASES = {(byte) 'A', (byte) 'C', (byte) 'G', (byte) 'T'};
dinucHashMap = new HashMap<Integer, Dinuc>();
for( byte byte1 : BASES ) {
for( byte byte2: BASES ) {
dinucHashMap.put( Dinuc.hashBytes(byte1, byte2), new Dinuc(byte1, byte2) ); // This might seem silly, but Strings are too slow
for (byte byte1 : BASES) {
for (byte byte2 : BASES) {
dinucHashMap.put(Dinuc.hashBytes(byte1, byte2), new Dinuc(byte1, byte2)); // This might seem silly, but Strings are too slow
}
}
// Add the "no dinuc" entry too
dinucHashMap.put( Dinuc.hashBytes(NO_CALL, NO_CALL), NO_DINUC );
dinucHashMap.put(Dinuc.hashBytes(NO_CALL, NO_CALL), NO_DINUC);
}
/*
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
byte base;
byte prevBase;
final byte[] bases = read.getReadBases();
// If this is a negative strand read then we need to reverse the direction for our previous base
if( read.getReadNegativeStrandFlag() ) {
// No dinuc at the beginning of the read
if( offset == bases.length-1 ) {
return NO_DINUC;
}
base = (byte)BaseUtils.simpleComplement( (char)(bases[offset]) );
// Note: We are using the previous base in the read, not the previous base in the reference. This is done in part to be consistent with unmapped reads.
prevBase = (byte)BaseUtils.simpleComplement( (char)(bases[offset + 1]) );
} else {
// No dinuc at the beginning of the read
if( offset == 0 ) {
return NO_DINUC;
}
base = bases[offset];
// Note: We are using the previous base in the read, not the previous base in the reference. This is done in part to be consistent with unmapped reads.
prevBase = bases[offset - 1];
}
// Make sure the previous base is good
if( !BaseUtils.isRegularBase( prevBase ) ) {
return NO_DINUC;
}
return dinucHashMap.get( Dinuc.hashBytes( prevBase, base ) );
}
*/
/**
* Takes an array of size (at least) read.getReadLength() and fills it with the covariate values for each position in the read.
*/
public void getValues( SAMRecord read, Comparable[] result ) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
final HashMap<Integer, Dinuc> dinucHashMapRef = this.dinucHashMap; //optimize access to dinucHashMap
final int readLength = read.getReadLength();
final boolean negativeStrand = read.getReadNegativeStrandFlag();
@ -108,50 +76,51 @@ public class DinucCovariate implements StandardCovariate {
int offset = 0;
// If this is a negative strand read then we need to reverse the direction for our previous base
if(negativeStrand) {
if (negativeStrand) {
bases = BaseUtils.simpleReverseComplement(bases); //this is NOT in-place
}
result[0] = NO_DINUC; // No dinuc at the beginning of the read
comparable[0] = NO_DINUC; // No dinuc at the beginning of the read
prevBase = bases[0];
offset++;
while(offset < readLength) {
while (offset < readLength) {
// Note: We are using the previous base in the read, not the
// previous base in the reference. This is done in part to be consistent with unmapped reads.
base = bases[offset];
if( BaseUtils.isRegularBase( prevBase ) ) {
result[offset] = dinucHashMapRef.get( Dinuc.hashBytes( prevBase, base ) );
} else {
result[offset] = NO_DINUC;
if (BaseUtils.isRegularBase(prevBase)) {
comparable[offset] = dinucHashMapRef.get(Dinuc.hashBytes(prevBase, base));
}
else {
comparable[offset] = NO_DINUC;
}
offset++;
prevBase = base;
}
if(negativeStrand) {
reverse( result );
if (negativeStrand) {
reverse(comparable);
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
@Override
public final Comparable getValue(final String str) {
byte[] bytes = str.getBytes();
final Dinuc returnDinuc = dinucHashMap.get( Dinuc.hashBytes( bytes[0], bytes[1] ) );
if( returnDinuc.compareTo(NO_DINUC) == 0 ) {
final Dinuc returnDinuc = dinucHashMap.get(Dinuc.hashBytes(bytes[0], bytes[1]));
if (returnDinuc.compareTo(NO_DINUC) == 0) {
return null;
}
return returnDinuc;
}
/**
* Reverses the given array in place.
*
* @param array
* @param array any array
*/
private static void reverse(final Comparable[] array) {
final int arrayLength = array.length;
for(int l = 0, r = arrayLength - 1; l < r; l++, r--) {
for (int l = 0, r = arrayLength - 1; l < r; l++, r--) {
final Comparable temp = array[l];
array[l] = array[r];
array[r] = temp;

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2010 The Broad Institute
@ -38,55 +40,57 @@ import net.sf.samtools.SAMRecord;
public class GCContentCovariate implements ExperimentalCovariate {
int numBack = 7;
private int numBack = 7;
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
numBack = RAC.HOMOPOLYMER_NBACK;
}
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
private Comparable getValue(final SAMRecord read, final int offset) {
// ATTGCCCCGTAAAAAAAGAGAA
// 0000123456654321001122
if( read.getReadGroup().getPlatform().equalsIgnoreCase( "ILLUMINA" ) || read.getReadGroup().getPlatform().equalsIgnoreCase( "SLX" ) ) {
if (read.getReadGroup().getPlatform().equalsIgnoreCase("ILLUMINA") || read.getReadGroup().getPlatform().equalsIgnoreCase("SLX")) {
int numGC = 0;
int startPos = 0;
int stopPos = 0;
int startPos;
int stopPos;
final byte[] bases = read.getReadBases();
if( !read.getReadNegativeStrandFlag() ) { // Forward direction
if (!read.getReadNegativeStrandFlag()) { // Forward direction
startPos = Math.max(offset - numBack, 0);
stopPos = Math.max(offset - 1, 0);
} else { // Negative direction
}
else { // Negative direction
startPos = Math.min(offset + 2, bases.length);
stopPos = Math.min(offset + numBack + 1, bases.length);
}
for( int iii = startPos; iii < stopPos; iii++ ) {
if( bases[iii] == (byte)'G' || bases[iii] == (byte)'C' ) {
for (int iii = startPos; iii < stopPos; iii++) {
if (bases[iii] == (byte) 'G' || bases[iii] == (byte) 'C') {
numGC++;
}
}
return numGC;
} else { // This effect is specific to the Illumina platform
}
else { // This effect is specific to the Illumina platform
return -1;
}
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -40,15 +42,16 @@ import net.sf.samtools.SAMRecord;
public class HomopolymerCovariate implements ExperimentalCovariate {
int numBack = 7;
private int numBack;
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
numBack = RAC.HOMOPOLYMER_NBACK;
}
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
private Comparable getValue(final SAMRecord read, final int offset) {
// This block of code is for if you don't want to only count consecutive bases
// ATTGCCCCGTAAAAAAAAATA
@ -75,13 +78,14 @@ public class HomopolymerCovariate implements ExperimentalCovariate {
int numAgree = 0; // The number of consecutive bases that agree with you in the previous numBack bases of the read
final byte[] bases = read.getReadBases();
int iii = offset;
if( !read.getReadNegativeStrandFlag() ) { // Forward direction
while( iii <= bases.length-2 && bases[iii] == bases[iii+1] && numAgree < numBack ) {
if (!read.getReadNegativeStrandFlag()) { // Forward direction
while (iii <= bases.length - 2 && bases[iii] == bases[iii + 1] && numAgree < numBack) {
numAgree++;
iii++;
}
} else { // Negative direction
while( iii >= 1 && bases[iii] == bases[iii-1] && numAgree < numBack ) {
}
else { // Negative direction
while (iii >= 1 && bases[iii] == bases[iii - 1] && numAgree < numBack) {
numAgree++;
iii--;
}
@ -90,15 +94,16 @@ public class HomopolymerCovariate implements ExperimentalCovariate {
return numAgree;
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -38,23 +39,25 @@ import net.sf.samtools.SAMRecord;
public class MappingQualityCovariate implements ExperimentalCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
private Comparable getValue(final GATKSAMRecord read) {
return read.getMappingQuality();
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read); // BUGBUG: this can be optimized
}
}
}

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -41,34 +43,37 @@ public class MinimumNQSCovariate implements ExperimentalCovariate {
private int windowReach; // How far in each direction from the current base to look
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
windowReach = RAC.WINDOW_SIZE / 2; // integer division
}
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
private Comparable getValue(final SAMRecord read, final int offset) {
// Loop over the list of base quality scores in the window and find the minimum
final byte[] quals = read.getBaseQualities();
int minQual = quals[offset];
final int minIndex = Math.max(offset - windowReach, 0);
final int maxIndex = Math.min(offset + windowReach, quals.length - 1);
for ( int iii = minIndex; iii < maxIndex; iii++ ) {
if( quals[iii] < minQual ) {
for (int iii = minIndex; iii < maxIndex; iii++) {
if (quals[iii] < minQual) {
minQual = quals[iii];
}
}
return minQual;
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -39,27 +41,29 @@ import net.sf.samtools.SAMRecord;
public class PositionCovariate implements ExperimentalCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
private Comparable getValue(final SAMRecord read, final int offset) {
int cycle = offset;
if( read.getReadNegativeStrandFlag() ) {
if (read.getReadNegativeStrandFlag()) {
cycle = read.getReadLength() - (offset + 1);
}
return cycle;
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -40,31 +42,35 @@ import net.sf.samtools.SAMRecord;
public class PrimerRoundCovariate implements ExperimentalCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
if( read.getReadGroup().getPlatform().equalsIgnoreCase( "SOLID" ) || read.getReadGroup().getPlatform().equalsIgnoreCase( "ABI_SOLID" ) ) {
private Comparable getValue(final SAMRecord read, final int offset) {
if (read.getReadGroup().getPlatform().equalsIgnoreCase("SOLID") || read.getReadGroup().getPlatform().equalsIgnoreCase("ABI_SOLID")) {
int pos = offset;
if( read.getReadNegativeStrandFlag() ) {
if (read.getReadNegativeStrandFlag()) {
pos = read.getReadLength() - (offset + 1);
}
return pos % 5; // the primer round according to http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/generaldocuments/cms_057511.pdf
} else {
}
else {
return 1; // nothing to do here because it is always the same
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
}
public void getValues(SAMRecord read, Comparable[] comparable) {
for(int iii = 0; iii < read.getReadLength(); iii++) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
for (int iii = 0; iii < read.getReadLength(); iii++) {
comparable[iii] = getValue(read, iii); // BUGBUG: this can be optimized
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,6 +1,9 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import java.util.Arrays;
/*
* Copyright (c) 2009 The Broad Institute
@ -38,26 +41,27 @@ import net.sf.samtools.SAMRecord;
public class QualityScoreCovariate implements RequiredCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
/*
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
return (int)(read.getBaseQualities()[offset]);
}
*/
public void getValues(SAMRecord read, Comparable[] comparable) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
if (modelType == BaseRecalibration.BaseRecalibrationType.BASE_SUBSTITUTION) {
byte[] baseQualities = read.getBaseQualities();
for(int i = 0; i < read.getReadLength(); i++) {
for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = (int) baseQualities[i];
}
}
else { // model == BASE_INSERTION || model == BASE_DELETION
Arrays.fill(comparable, 45); // Some day in the future when base insertion and base deletion quals exist the samtools API will
// be updated and the original quals will be pulled here, but for now we assume the original quality is a flat Q45
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
return Integer.parseInt( str );
@Override
public final Comparable getValue(final String str) {
return Integer.parseInt(str);
}
}

View File

@ -1,6 +1,7 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
/*
* Copyright (c) 2009 The Broad Institute
@ -35,33 +36,26 @@ import net.sf.samtools.SAMRecord;
* The Read Group covariate.
*/
public class ReadGroupCovariate implements RequiredCovariate{
public static final String defaultReadGroup = "DefaultReadGroup";
public class ReadGroupCovariate implements RequiredCovariate {
// Initialize any member variables using the command-line arguments passed to the walkers
public void initialize( final RecalibrationArgumentCollection RAC ) {
@Override
public void initialize(final RecalibrationArgumentCollection RAC) {
}
/*
// Used to pick out the covariate's value from attributes of the read
public final Comparable getValue( final SAMRecord read, final int offset ) {
return read.getReadGroup().getReadGroupId();
}
*/
public void getValues(SAMRecord read, Comparable[] comparable) {
@Override
public void getValues(final GATKSAMRecord read, final Comparable[] comparable, final BaseRecalibration.BaseRecalibrationType modelType) {
final String readGroupId = read.getReadGroup().getReadGroupId();
for(int i = 0; i < read.getReadLength(); i++) {
for (int i = 0; i < read.getReadLength(); i++) {
comparable[i] = readGroupId;
}
}
// Used to get the covariate's value from input csv file in TableRecalibrationWalker
public final Comparable getValue( final String str ) {
@Override
public final Comparable getValue(final String str) {
return str;
}
}

View File

@ -25,8 +25,6 @@
package org.broadinstitute.sting.gatk.walkers.recalibration;
import net.sf.samtools.SAMReadGroupRecord;
import net.sf.samtools.SAMRecord;
import net.sf.samtools.SAMUtils;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.utils.BaseUtils;
@ -34,9 +32,11 @@ import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.AlignmentUtils;
import org.broadinstitute.sting.utils.sam.GATKSAMReadGroupRecord;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.sam.ReadUtils;
import java.util.ArrayList;
import java.util.List;
@ -67,42 +67,57 @@ public class RecalDataManager {
private static boolean warnUserNullPlatform = false;
public enum SOLID_RECAL_MODE {
/** Treat reference inserted bases as reference matching bases. Very unsafe! */
/**
* Treat reference inserted bases as reference matching bases. Very unsafe!
*/
DO_NOTHING,
/** Set reference inserted bases and the previous base (because of color space alignment details) to Q0. This is the default option. */
/**
* Set reference inserted bases and the previous base (because of color space alignment details) to Q0. This is the default option.
*/
SET_Q_ZERO,
/** In addition to setting the quality scores to zero, also set the base itself to 'N'. This is useful to visualize in IGV. */
/**
* In addition to setting the quality scores to zero, also set the base itself to 'N'. This is useful to visualize in IGV.
*/
SET_Q_ZERO_BASE_N,
/** Look at the color quality scores and probabilistically decide to change the reference inserted base to be the base which is implied by the original color space instead of the reference. */
/**
* Look at the color quality scores and probabilistically decide to change the reference inserted base to be the base which is implied by the original color space instead of the reference.
*/
REMOVE_REF_BIAS
}
public enum SOLID_NOCALL_STRATEGY {
/** When a no call is detected throw an exception to alert the user that recalibrating this SOLiD data is unsafe. This is the default option. */
/**
* When a no call is detected throw an exception to alert the user that recalibrating this SOLiD data is unsafe. This is the default option.
*/
THROW_EXCEPTION,
/** Leave the read in the output bam completely untouched. This mode is only okay if the no calls are very rare. */
/**
* Leave the read in the output bam completely untouched. This mode is only okay if the no calls are very rare.
*/
LEAVE_READ_UNRECALIBRATED,
/** Mark these reads as failing vendor quality checks so they can be filtered out by downstream analyses. */
/**
* Mark these reads as failing vendor quality checks so they can be filtered out by downstream analyses.
*/
PURGE_READ
}
RecalDataManager() {
public RecalDataManager() {
data = new NestedHashMap();
dataCollapsedReadGroup = null;
dataCollapsedQualityScore = null;
dataCollapsedByCovariate = null;
}
RecalDataManager( final boolean createCollapsedTables, final int numCovariates ) {
if( createCollapsedTables ) { // Initialize all the collapsed tables, only used by TableRecalibrationWalker
public RecalDataManager(final boolean createCollapsedTables, final int numCovariates) {
if (createCollapsedTables) { // Initialize all the collapsed tables, only used by TableRecalibrationWalker
data = null;
dataCollapsedReadGroup = new NestedHashMap();
dataCollapsedQualityScore = new NestedHashMap();
dataCollapsedByCovariate = new ArrayList<NestedHashMap>();
for( int iii = 0; iii < numCovariates - 2; iii++ ) { // readGroup and QualityScore aren't counted here, their tables are separate
dataCollapsedByCovariate.add( new NestedHashMap() );
for (int iii = 0; iii < numCovariates - 2; iii++) { // readGroup and QualityScore aren't counted here, their tables are separate
dataCollapsedByCovariate.add(new NestedHashMap());
}
} else {
}
else {
data = new NestedHashMap();
dataCollapsedReadGroup = null;
dataCollapsedQualityScore = null;
@ -112,54 +127,58 @@ public class RecalDataManager {
/**
* Add the given mapping to all of the collapsed hash tables
*
* @param key The list of comparables that is the key for this mapping
* @param fullDatum The RecalDatum which is the data for this mapping
* @param PRESERVE_QSCORES_LESS_THAN The threshold in report quality for adding to the aggregate collapsed table
*/
public final void addToAllTables( final Object[] key, final RecalDatum fullDatum, final int PRESERVE_QSCORES_LESS_THAN ) {
public final void addToAllTables(final Object[] key, final RecalDatum fullDatum, final int PRESERVE_QSCORES_LESS_THAN) {
// The full dataset isn't actually ever used for anything because of the sequential calculation so no need to keep the full data HashMap around
//data.put(key, thisDatum); // add the mapping to the main table
final int qualityScore = Integer.parseInt( key[1].toString() );
final int qualityScore = Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3];
RecalDatum collapsedDatum;
// Create dataCollapsedReadGroup, the table where everything except read group has been collapsed
if( qualityScore >= PRESERVE_QSCORES_LESS_THAN ) {
if (qualityScore >= PRESERVE_QSCORES_LESS_THAN) {
readGroupCollapsedKey[0] = key[0]; // Make a new key with just the read group
collapsedDatum = (RecalDatum) dataCollapsedReadGroup.get( readGroupCollapsedKey );
if( collapsedDatum == null ) {
dataCollapsedReadGroup.put( new RecalDatum(fullDatum), readGroupCollapsedKey );
} else {
collapsedDatum.combine( fullDatum ); // using combine instead of increment in order to calculate overall aggregateQReported
collapsedDatum = (RecalDatum) dataCollapsedReadGroup.get(readGroupCollapsedKey);
if (collapsedDatum == null) {
dataCollapsedReadGroup.put(new RecalDatum(fullDatum), readGroupCollapsedKey);
}
else {
collapsedDatum.combine(fullDatum); // using combine instead of increment in order to calculate overall aggregateQReported
}
}
// Create dataCollapsedQuality, the table where everything except read group and quality score has been collapsed
qualityScoreCollapsedKey[0] = key[0]; // Make a new key with the read group ...
qualityScoreCollapsedKey[1] = key[1]; // and quality score
collapsedDatum = (RecalDatum) dataCollapsedQualityScore.get( qualityScoreCollapsedKey );
if( collapsedDatum == null ) {
dataCollapsedQualityScore.put( new RecalDatum(fullDatum), qualityScoreCollapsedKey );
} else {
collapsedDatum.increment( fullDatum );
collapsedDatum = (RecalDatum) dataCollapsedQualityScore.get(qualityScoreCollapsedKey);
if (collapsedDatum == null) {
dataCollapsedQualityScore.put(new RecalDatum(fullDatum), qualityScoreCollapsedKey);
}
else {
collapsedDatum.increment(fullDatum);
}
// Create dataCollapsedByCovariate's, the tables where everything except read group, quality score, and given covariate has been collapsed
for( int iii = 0; iii < dataCollapsedByCovariate.size(); iii++ ) {
for (int iii = 0; iii < dataCollapsedByCovariate.size(); iii++) {
covariateCollapsedKey[0] = key[0]; // Make a new key with the read group ...
covariateCollapsedKey[1] = key[1]; // and quality score ...
final Object theCovariateElement = key[iii + 2]; // and the given covariate
if( theCovariateElement != null ) {
if (theCovariateElement != null) {
covariateCollapsedKey[2] = theCovariateElement;
collapsedDatum = (RecalDatum) dataCollapsedByCovariate.get(iii).get( covariateCollapsedKey );
if( collapsedDatum == null ) {
dataCollapsedByCovariate.get(iii).put( new RecalDatum(fullDatum), covariateCollapsedKey );
} else {
collapsedDatum.increment( fullDatum );
collapsedDatum = (RecalDatum) dataCollapsedByCovariate.get(iii).get(covariateCollapsedKey);
if (collapsedDatum == null) {
dataCollapsedByCovariate.get(iii).put(new RecalDatum(fullDatum), covariateCollapsedKey);
}
else {
collapsedDatum.increment(fullDatum);
}
}
}
@ -168,147 +187,133 @@ public class RecalDataManager {
/**
* Loop over all the collapsed tables and turn the recalDatums found there into an empirical quality score
* that will be used in the sequential calculation in TableRecalibrationWalker
*
* @param smoothing The smoothing parameter that goes into empirical quality score calculation
* @param maxQual At which value to cap the quality scores
*/
public final void generateEmpiricalQualities( final int smoothing, final int maxQual ) {
public final void generateEmpiricalQualities(final int smoothing, final int maxQual) {
recursivelyGenerateEmpiricalQualities(dataCollapsedReadGroup.data, smoothing, maxQual);
recursivelyGenerateEmpiricalQualities(dataCollapsedQualityScore.data, smoothing, maxQual);
for( NestedHashMap map : dataCollapsedByCovariate ) {
for (NestedHashMap map : dataCollapsedByCovariate) {
recursivelyGenerateEmpiricalQualities(map.data, smoothing, maxQual);
checkForSingletons(map.data);
}
}
private void recursivelyGenerateEmpiricalQualities( final Map data, final int smoothing, final int maxQual ) {
private void recursivelyGenerateEmpiricalQualities(final Map data, final int smoothing, final int maxQual) {
for( Object comp : data.keySet() ) {
for (Object comp : data.keySet()) {
final Object val = data.get(comp);
if( val instanceof RecalDatum ) { // We are at the end of the nested hash maps
((RecalDatum)val).calcCombinedEmpiricalQuality(smoothing, maxQual);
} else { // Another layer in the nested hash map
recursivelyGenerateEmpiricalQualities( (Map) val, smoothing, maxQual);
if (val instanceof RecalDatum) { // We are at the end of the nested hash maps
((RecalDatum) val).calcCombinedEmpiricalQuality(smoothing, maxQual);
}
else { // Another layer in the nested hash map
recursivelyGenerateEmpiricalQualities((Map) val, smoothing, maxQual);
}
}
}
private void checkForSingletons( final Map data ) {
private void checkForSingletons(final Map data) {
// todo -- this looks like it's better just as a data.valueSet() call?
for( Object comp : data.keySet() ) {
for (Object comp : data.keySet()) {
final Object val = data.get(comp);
if( val instanceof RecalDatum ) { // We are at the end of the nested hash maps
if( data.keySet().size() == 1) {
if (val instanceof RecalDatum) { // We are at the end of the nested hash maps
if (data.keySet().size() == 1) {
data.clear(); // don't TableRecalibrate a non-required covariate if it only has one element because that correction has already been done ...
// in a previous step of the sequential calculation model
}
} else { // Another layer in the nested hash map
checkForSingletons( (Map) val );
}
else { // Another layer in the nested hash map
checkForSingletons((Map) val);
}
}
}
/**
* Get the appropriate collapsed table out of the set of all the tables held by this Object
*
* @param covariate Which covariate indexes the desired collapsed HashMap
* @return The desired collapsed HashMap
*/
public final NestedHashMap getCollapsedTable( final int covariate ) {
if( covariate == 0) {
public final NestedHashMap getCollapsedTable(final int covariate) {
if (covariate == 0) {
return dataCollapsedReadGroup; // Table where everything except read group has been collapsed
} else if( covariate == 1 ) {
}
else if (covariate == 1) {
return dataCollapsedQualityScore; // Table where everything except read group and quality score has been collapsed
} else {
return dataCollapsedByCovariate.get( covariate - 2 ); // Table where everything except read group, quality score, and given covariate has been collapsed
}
else {
return dataCollapsedByCovariate.get(covariate - 2); // Table where everything except read group, quality score, and given covariate has been collapsed
}
}
/**
* Section of code shared between the two recalibration walkers which uses the command line arguments to adjust attributes of the read such as quals or platform string
*
* @param read The read to adjust
* @param RAC The list of shared command line arguments
*/
public static void parseSAMRecord( final SAMRecord read, final RecalibrationArgumentCollection RAC ) {
GATKSAMReadGroupRecord readGroup = ((GATKSAMRecord)read).getReadGroup();
public static void parseSAMRecord(final GATKSAMRecord read, final RecalibrationArgumentCollection RAC) {
GATKSAMReadGroupRecord readGroup = ((GATKSAMRecord) read).getReadGroup();
// If there are no read groups we have to default to something, and that something could be specified by the user using command line arguments
if( readGroup == null ) {
if( RAC.DEFAULT_READ_GROUP != null && RAC.DEFAULT_PLATFORM != null) {
if( !warnUserNullReadGroup && RAC.FORCE_READ_GROUP == null ) {
Utils.warnUser("The input .bam file contains reads with no read group. " +
"Defaulting to read group ID = " + RAC.DEFAULT_READ_GROUP + " and platform = " + RAC.DEFAULT_PLATFORM + ". " +
"First observed at read with name = " + read.getReadName() );
warnUserNullReadGroup = true;
}
// There is no readGroup so defaulting to these values
readGroup = new GATKSAMReadGroupRecord( RAC.DEFAULT_READ_GROUP );
readGroup.setPlatform( RAC.DEFAULT_PLATFORM );
((GATKSAMRecord)read).setReadGroup( readGroup );
} else {
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no read group. First observed at read with name = " + read.getReadName() );
}
if (RAC.FORCE_PLATFORM != null && (readGroup.getPlatform() == null || !readGroup.getPlatform().equals(RAC.FORCE_PLATFORM))) {
readGroup.setPlatform(RAC.FORCE_PLATFORM);
}
if( RAC.FORCE_READ_GROUP != null && !readGroup.getReadGroupId().equals(RAC.FORCE_READ_GROUP) ) { // Collapse all the read groups into a single common String provided by the user
final String oldPlatform = readGroup.getPlatform();
readGroup = new GATKSAMReadGroupRecord( RAC.FORCE_READ_GROUP );
readGroup.setPlatform( oldPlatform );
((GATKSAMRecord)read).setReadGroup( readGroup );
}
if( RAC.FORCE_PLATFORM != null && (readGroup.getPlatform() == null || !readGroup.getPlatform().equals(RAC.FORCE_PLATFORM))) {
readGroup.setPlatform( RAC.FORCE_PLATFORM );
}
if ( readGroup.getPlatform() == null ) {
if( RAC.DEFAULT_PLATFORM != null ) {
if( !warnUserNullPlatform ) {
if (readGroup.getPlatform() == null) {
if (RAC.DEFAULT_PLATFORM != null) {
if (!warnUserNullPlatform) {
Utils.warnUser("The input .bam file contains reads with no platform information. " +
"Defaulting to platform = " + RAC.DEFAULT_PLATFORM + ". " +
"First observed at read with name = " + read.getReadName() );
"First observed at read with name = " + read.getReadName());
warnUserNullPlatform = true;
}
readGroup.setPlatform( RAC.DEFAULT_PLATFORM );
} else {
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no platform information. First observed at read with name = " + read.getReadName() );
readGroup.setPlatform(RAC.DEFAULT_PLATFORM);
}
else {
throw new UserException.MalformedBAM(read, "The input .bam file contains reads with no platform information. First observed at read with name = " + read.getReadName());
}
}
}
/**
* Parse through the color space of the read and add a new tag to the SAMRecord that says which bases are inconsistent with the color space
*
* @param read The SAMRecord to parse
*/
public static void parseColorSpace( final SAMRecord read ) {
public static void parseColorSpace(final GATKSAMRecord read) {
// If this is a SOLID read then we have to check if the color space is inconsistent. This is our only sign that SOLID has inserted the reference base
if( read.getReadGroup().getPlatform().toUpperCase().contains("SOLID") ) {
if( read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG) == null ) { // Haven't calculated the inconsistency array yet for this read
if (ReadUtils.isSOLiDRead(read)) {
if (read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG) == null) { // Haven't calculated the inconsistency array yet for this read
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if( attr != null ) {
if (attr != null) {
byte[] colorSpace;
if( attr instanceof String ) {
colorSpace = ((String)attr).getBytes();
} else {
if (attr instanceof String) {
colorSpace = ((String) attr).getBytes();
}
else {
throw new UserException.MalformedBAM(read, String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
}
// Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read
byte[] readBases = read.getReadBases();
if( read.getReadNegativeStrandFlag() ) {
readBases = BaseUtils.simpleReverseComplement( read.getReadBases() );
if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement(read.getReadBases());
}
final byte[] inconsistency = new byte[readBases.length];
int iii;
byte prevBase = colorSpace[0]; // The sentinel
for( iii = 0; iii < readBases.length; iii++ ) {
final byte thisBase = getNextBaseFromColor( read, prevBase, colorSpace[iii + 1] );
inconsistency[iii] = (byte)( thisBase == readBases[iii] ? 0 : 1 );
for (iii = 0; iii < readBases.length; iii++) {
final byte thisBase = getNextBaseFromColor(read, prevBase, colorSpace[iii + 1]);
inconsistency[iii] = (byte) (thisBase == readBases[iii] ? 0 : 1);
prevBase = readBases[iii];
}
read.setAttribute( RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency );
read.setAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG, inconsistency);
} else {
}
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
}
@ -319,52 +324,57 @@ public class RecalDataManager {
/**
* Parse through the color space of the read and apply the desired --solid_recal_mode correction to the bases
* This method doesn't add the inconsistent tag to the read like parseColorSpace does
*
* @param read The SAMRecord to parse
* @param originalQualScores The array of original quality scores to modify during the correction
* @param solidRecalMode Which mode of solid recalibration to apply
* @param refBases The reference for this read
* @return A new array of quality scores that have been ref bias corrected
*/
public static byte[] calcColorSpace( final SAMRecord read, byte[] originalQualScores, final SOLID_RECAL_MODE solidRecalMode, final byte[] refBases ) {
public static byte[] calcColorSpace(final GATKSAMRecord read, byte[] originalQualScores, final SOLID_RECAL_MODE solidRecalMode, final byte[] refBases) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if( attr != null ) {
if (attr != null) {
byte[] colorSpace;
if( attr instanceof String ) {
colorSpace = ((String)attr).getBytes();
} else {
if (attr instanceof String) {
colorSpace = ((String) attr).getBytes();
}
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
}
// Loop over the read and calculate first the inferred bases from the color and then check if it is consistent with the read
byte[] readBases = read.getReadBases();
final byte[] colorImpliedBases = readBases.clone();
byte[] refBasesDirRead = AlignmentUtils.alignmentToByteArray( read.getCigar(), read.getReadBases(), refBases ); //BUGBUG: This needs to change when read walkers are changed to give the aligned refBases
if( read.getReadNegativeStrandFlag() ) {
readBases = BaseUtils.simpleReverseComplement( read.getReadBases() );
refBasesDirRead = BaseUtils.simpleReverseComplement( refBasesDirRead.clone() );
byte[] refBasesDirRead = AlignmentUtils.alignmentToByteArray(read.getCigar(), read.getReadBases(), refBases); //BUGBUG: This needs to change when read walkers are changed to give the aligned refBases
if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement(read.getReadBases());
refBasesDirRead = BaseUtils.simpleReverseComplement(refBasesDirRead.clone());
}
final int[] inconsistency = new int[readBases.length];
byte prevBase = colorSpace[0]; // The sentinel
for( int iii = 0; iii < readBases.length; iii++ ) {
final byte thisBase = getNextBaseFromColor( read, prevBase, colorSpace[iii + 1] );
for (int iii = 0; iii < readBases.length; iii++) {
final byte thisBase = getNextBaseFromColor(read, prevBase, colorSpace[iii + 1]);
colorImpliedBases[iii] = thisBase;
inconsistency[iii] = ( thisBase == readBases[iii] ? 0 : 1 );
inconsistency[iii] = (thisBase == readBases[iii] ? 0 : 1);
prevBase = readBases[iii];
}
// Now that we have the inconsistency array apply the desired correction to the inconsistent bases
if( solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO ) { // Set inconsistent bases and the one before it to Q0
if (solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO) { // Set inconsistent bases and the one before it to Q0
final boolean setBaseN = false;
originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN);
} else if( solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO_BASE_N ) {
}
else if (solidRecalMode == SOLID_RECAL_MODE.SET_Q_ZERO_BASE_N) {
final boolean setBaseN = true;
originalQualScores = solidRecalSetToQZero(read, readBases, inconsistency, originalQualScores, refBasesDirRead, setBaseN);
} else if( solidRecalMode == SOLID_RECAL_MODE.REMOVE_REF_BIAS ) { // Use the color space quality to probabilistically remove ref bases at inconsistent color space bases
}
else if (solidRecalMode == SOLID_RECAL_MODE.REMOVE_REF_BIAS) { // Use the color space quality to probabilistically remove ref bases at inconsistent color space bases
solidRecalRemoveRefBias(read, readBases, inconsistency, colorImpliedBases, refBasesDirRead);
}
} else {
}
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
}
@ -372,24 +382,26 @@ public class RecalDataManager {
return originalQualScores;
}
public static boolean checkNoCallColorSpace( final SAMRecord read ) {
if( read.getReadGroup().getPlatform().toUpperCase().contains("SOLID") ) {
public static boolean checkNoCallColorSpace(final GATKSAMRecord read) {
if (ReadUtils.isSOLiDRead(read)) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG);
if( attr != null ) {
if (attr != null) {
byte[] colorSpace;
if( attr instanceof String ) {
colorSpace = ((String)attr).substring(1).getBytes(); // trim off the Sentinel
} else {
if (attr instanceof String) {
colorSpace = ((String) attr).substring(1).getBytes(); // trim off the Sentinel
}
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_ATTRIBUTE_TAG, read.getReadName()));
}
for( byte color : colorSpace ) {
if( color != (byte)'0' && color != (byte)'1' && color != (byte)'2' && color != (byte)'3' ) {
for (byte color : colorSpace) {
if (color != (byte) '0' && color != (byte) '1' && color != (byte) '2' && color != (byte) '3') {
return true; // There is a bad color in this SOLiD read and the user wants to skip over it
}
}
} else {
}
else {
throw new UserException.MalformedBAM(read, "Unable to find color space information in SOLiD read. First observed at read with name = " + read.getReadName() +
" Unfortunately this .bam file can not be recalibrated without color space information because of potential reference bias.");
}
@ -400,6 +412,7 @@ public class RecalDataManager {
/**
* Perform the SET_Q_ZERO solid recalibration. Inconsistent color space bases and their previous base are set to quality zero
*
* @param read The SAMRecord to recalibrate
* @param readBases The bases in the read which have been RC'd if necessary
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color
@ -408,82 +421,96 @@ public class RecalDataManager {
* @param setBaseN Should we also set the base to N as well as quality zero in order to visualize in IGV or something similar
* @return The byte array of original quality scores some of which might have been set to zero
*/
private static byte[] solidRecalSetToQZero( final SAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] originalQualScores,
final byte[] refBases, final boolean setBaseN ) {
private static byte[] solidRecalSetToQZero(final GATKSAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] originalQualScores, final byte[] refBases, final boolean setBaseN) {
final boolean negStrand = read.getReadNegativeStrandFlag();
for( int iii = 1; iii < originalQualScores.length; iii++ ) {
if( inconsistency[iii] == 1 ) {
if( readBases[iii] == refBases[iii] ) {
if( negStrand ) { originalQualScores[originalQualScores.length-(iii+1)] = (byte)0; }
else { originalQualScores[iii] = (byte)0; }
if( setBaseN ) { readBases[iii] = (byte)'N'; }
for (int iii = 1; iii < originalQualScores.length; iii++) {
if (inconsistency[iii] == 1) {
if (readBases[iii] == refBases[iii]) {
if (negStrand) {
originalQualScores[originalQualScores.length - (iii + 1)] = (byte) 0;
}
else {
originalQualScores[iii] = (byte) 0;
}
if (setBaseN) {
readBases[iii] = (byte) 'N';
}
}
// Set the prev base to Q0 as well
if( readBases[iii-1] == refBases[iii-1] ) {
if( negStrand ) { originalQualScores[originalQualScores.length-iii] = (byte)0; }
else { originalQualScores[iii-1] = (byte)0; }
if( setBaseN ) { readBases[iii-1] = (byte)'N'; }
if (readBases[iii - 1] == refBases[iii - 1]) {
if (negStrand) {
originalQualScores[originalQualScores.length - iii] = (byte) 0;
}
else {
originalQualScores[iii - 1] = (byte) 0;
}
if (setBaseN) {
readBases[iii - 1] = (byte) 'N';
}
}
}
if( negStrand ) {
readBases = BaseUtils.simpleReverseComplement( readBases.clone() ); // Put the bases back in reverse order to stuff them back in the read
}
read.setReadBases( readBases );
if (negStrand) {
readBases = BaseUtils.simpleReverseComplement(readBases.clone()); // Put the bases back in reverse order to stuff them back in the read
}
read.setReadBases(readBases);
return originalQualScores;
}
/**
* Peform the REMOVE_REF_BIAS solid recalibration. Look at the color space qualities and probabilistically decide if the base should be change to match the color or left as reference
*
* @param read The SAMRecord to recalibrate
* @param readBases The bases in the read which have been RC'd if necessary
* @param inconsistency The array of 1/0 that says if this base is inconsistent with its color
* @param colorImpliedBases The bases implied by the color space, RC'd if necessary
* @param refBases The reference which has been RC'd if necessary
*/
private static void solidRecalRemoveRefBias( final SAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] colorImpliedBases,
final byte[] refBases) {
private static void solidRecalRemoveRefBias(final GATKSAMRecord read, byte[] readBases, final int[] inconsistency, final byte[] colorImpliedBases, final byte[] refBases) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG);
if( attr != null ) {
if (attr != null) {
byte[] colorSpaceQuals;
if( attr instanceof String ) {
String x = (String)attr;
if (attr instanceof String) {
String x = (String) attr;
colorSpaceQuals = x.getBytes();
SAMUtils.fastqToPhred(colorSpaceQuals);
} else {
}
else {
throw new ReviewedStingException(String.format("Value encoded by %s in %s isn't a string!", RecalDataManager.COLOR_SPACE_QUAL_ATTRIBUTE_TAG, read.getReadName()));
}
for( int iii = 1; iii < inconsistency.length - 1; iii++ ) {
if( inconsistency[iii] == 1 ) {
for( int jjj = iii - 1; jjj <= iii; jjj++ ) { // Correct this base and the one before it along the direction of the read
if( jjj == iii || inconsistency[jjj] == 0 ) { // Don't want to correct the previous base a second time if it was already corrected in the previous step
if( readBases[jjj] == refBases[jjj] ) {
if( colorSpaceQuals[jjj] == colorSpaceQuals[jjj+1] ) { // Equal evidence for the color implied base and the reference base, so flip a coin
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt( 2 );
if( rand == 0 ) { // The color implied base won the coin flip
for (int iii = 1; iii < inconsistency.length - 1; iii++) {
if (inconsistency[iii] == 1) {
for (int jjj = iii - 1; jjj <= iii; jjj++) { // Correct this base and the one before it along the direction of the read
if (jjj == iii || inconsistency[jjj] == 0) { // Don't want to correct the previous base a second time if it was already corrected in the previous step
if (readBases[jjj] == refBases[jjj]) {
if (colorSpaceQuals[jjj] == colorSpaceQuals[jjj + 1]) { // Equal evidence for the color implied base and the reference base, so flip a coin
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt(2);
if (rand == 0) { // The color implied base won the coin flip
readBases[jjj] = colorImpliedBases[jjj];
}
} else {
final int maxQuality = Math.max((int)colorSpaceQuals[jjj], (int)colorSpaceQuals[jjj+1]);
final int minQuality = Math.min((int)colorSpaceQuals[jjj], (int)colorSpaceQuals[jjj+1]);
}
else {
final int maxQuality = Math.max((int) colorSpaceQuals[jjj], (int) colorSpaceQuals[jjj + 1]);
final int minQuality = Math.min((int) colorSpaceQuals[jjj], (int) colorSpaceQuals[jjj + 1]);
int diffInQuality = maxQuality - minQuality;
int numLow = minQuality;
if( numLow == 0 ) {
if (numLow == 0) {
numLow++;
diffInQuality++;
}
final int numHigh = Math.round( numLow * (float)Math.pow(10.0f, (float) diffInQuality / 10.0f) ); // The color with higher quality is exponentially more likely
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt( numLow + numHigh );
if( rand >= numLow ) { // higher q score won
if( maxQuality == (int)colorSpaceQuals[jjj] ) {
final int numHigh = Math.round(numLow * (float) Math.pow(10.0f, (float) diffInQuality / 10.0f)); // The color with higher quality is exponentially more likely
final int rand = GenomeAnalysisEngine.getRandomGenerator().nextInt(numLow + numHigh);
if (rand >= numLow) { // higher q score won
if (maxQuality == (int) colorSpaceQuals[jjj]) {
readBases[jjj] = colorImpliedBases[jjj];
} // else ref color had higher q score, and won out, so nothing to do here
} else { // lower q score won
if( minQuality == (int)colorSpaceQuals[jjj] ) {
}
else { // lower q score won
if (minQuality == (int) colorSpaceQuals[jjj]) {
readBases[jjj] = colorImpliedBases[jjj];
} // else ref color had lower q score, and won out, so nothing to do here
}
@ -494,52 +521,56 @@ public class RecalDataManager {
}
}
if( read.getReadNegativeStrandFlag() ) {
readBases = BaseUtils.simpleReverseComplement( readBases.clone() ); // Put the bases back in reverse order to stuff them back in the read
if (read.getReadNegativeStrandFlag()) {
readBases = BaseUtils.simpleReverseComplement(readBases.clone()); // Put the bases back in reverse order to stuff them back in the read
}
read.setReadBases( readBases );
} else { // No color space quality tag in file
read.setReadBases(readBases);
}
else { // No color space quality tag in file
throw new UserException.MalformedBAM(read, "REMOVE_REF_BIAS recal mode requires color space qualities but they can't be found for read: " + read.getReadName());
}
}
/**
* Given the base and the color calculate the next base in the sequence
*
* @param prevBase The base
* @param color The color
* @return The next base in the sequence
*/
private static byte getNextBaseFromColor( SAMRecord read, final byte prevBase, final byte color ) {
switch(color) {
private static byte getNextBaseFromColor(GATKSAMRecord read, final byte prevBase, final byte color) {
switch (color) {
case '0':
return prevBase;
case '1':
return performColorOne( prevBase );
return performColorOne(prevBase);
case '2':
return performColorTwo( prevBase );
return performColorTwo(prevBase);
case '3':
return performColorThree( prevBase );
return performColorThree(prevBase);
default:
throw new UserException.MalformedBAM(read, "Unrecognized color space in SOLID read, color = " + (char)color +
throw new UserException.MalformedBAM(read, "Unrecognized color space in SOLID read, color = " + (char) color +
" Unfortunately this bam file can not be recalibrated without full color space information because of potential reference bias.");
}
}
/**
* Check if this base is inconsistent with its color space. If it is then SOLID inserted the reference here and we should reduce the quality
*
* @param read The read which contains the color space to check against
* @param offset The offset in the read at which to check
* @return Returns true if the base was inconsistent with the color space
*/
public static boolean isInconsistentColorSpace( final SAMRecord read, final int offset ) {
public static boolean isInconsistentColorSpace(final GATKSAMRecord read, final int offset) {
final Object attr = read.getAttribute(RecalDataManager.COLOR_SPACE_INCONSISTENCY_TAG);
if( attr != null ) {
final byte[] inconsistency = (byte[])attr;
if (attr != null) {
final byte[] inconsistency = (byte[]) attr;
// NOTE: The inconsistency array is in the direction of the read, not aligned to the reference!
if( read.getReadNegativeStrandFlag() ) { // Negative direction
return inconsistency[inconsistency.length - offset - 1] != (byte)0;
} else { // Forward direction
return inconsistency[offset] != (byte)0;
if (read.getReadNegativeStrandFlag()) { // Negative direction
return inconsistency[inconsistency.length - offset - 1] != (byte) 0;
}
else { // Forward direction
return inconsistency[offset] != (byte) 0;
}
// This block of code is for if you want to check both the offset and the next base for color space inconsistency
@ -557,7 +588,8 @@ public class RecalDataManager {
// }
//}
} else { // No inconsistency array, so nothing is inconsistent
}
else { // No inconsistency array, so nothing is inconsistent
return false;
}
}
@ -572,30 +604,25 @@ public class RecalDataManager {
* value for the ith position in the read and the jth covariate in
* reqeustedCovariates list.
*/
public static Comparable[][] computeCovariates(final GATKSAMRecord gatkRead, final List<Covariate> requestedCovariates) {
public static Comparable[][] computeCovariates(final GATKSAMRecord gatkRead, final List<Covariate> requestedCovariates, final BaseRecalibration.BaseRecalibrationType modelType) {
//compute all covariates for this read
final List<Covariate> requestedCovariatesRef = requestedCovariates;
final int numRequestedCovariates = requestedCovariatesRef.size();
final int numRequestedCovariates = requestedCovariates.size();
final int readLength = gatkRead.getReadLength();
final Comparable[][] covariateValues_offset_x_covar = new Comparable[readLength][numRequestedCovariates];
final Comparable[] tempCovariateValuesHolder = new Comparable[readLength];
// Loop through the list of requested covariates and compute the values of each covariate for all positions in this read
for( int i = 0; i < numRequestedCovariates; i++ ) {
requestedCovariatesRef.get(i).getValues( gatkRead, tempCovariateValuesHolder );
for(int j = 0; j < readLength; j++) {
//copy values into a 2D array that allows all covar types to be extracted at once for
//an offset j by doing covariateValues_offset_x_covar[j]. This avoids the need to later iterate over covar types.
covariateValues_offset_x_covar[j][i] = tempCovariateValuesHolder[j];
}
for (int i = 0; i < numRequestedCovariates; i++) { // Loop through the list of requested covariates and compute the values of each covariate for all positions in this read
requestedCovariates.get(i).getValues(gatkRead, tempCovariateValuesHolder, modelType);
for (int j = 0; j < readLength; j++)
covariateValues_offset_x_covar[j][i] = tempCovariateValuesHolder[j]; // copy values into a 2D array that allows all covar types to be extracted at once for an offset j by doing covariateValues_offset_x_covar[j]. This avoids the need to later iterate over covar types.
}
return covariateValues_offset_x_covar;
}
/**
* Perform a ceratin transversion (A <-> C or G <-> T) on the base.
* Perform a certain transversion (A <-> C or G <-> T) on the base.
*
* @param base the base [AaCcGgTt]
* @return the transversion of the base, or the input base if it's not one of the understood ones
@ -603,14 +630,19 @@ public class RecalDataManager {
private static byte performColorOne(byte base) {
switch (base) {
case 'A':
case 'a': return 'C';
case 'a':
return 'C';
case 'C':
case 'c': return 'A';
case 'c':
return 'A';
case 'G':
case 'g': return 'T';
case 'g':
return 'T';
case 'T':
case 't': return 'G';
default: return base;
case 't':
return 'G';
default:
return base;
}
}
@ -623,14 +655,19 @@ public class RecalDataManager {
private static byte performColorTwo(byte base) {
switch (base) {
case 'A':
case 'a': return 'G';
case 'a':
return 'G';
case 'C':
case 'c': return 'T';
case 'c':
return 'T';
case 'G':
case 'g': return 'A';
case 'g':
return 'A';
case 'T':
case 't': return 'C';
default: return base;
case 't':
return 'C';
default:
return base;
}
}
@ -643,14 +680,19 @@ public class RecalDataManager {
private static byte performColorThree(byte base) {
switch (base) {
case 'A':
case 'a': return 'T';
case 'a':
return 'T';
case 'C':
case 'c': return 'G';
case 'c':
return 'G';
case 'G':
case 'g': return 'C';
case 'g':
return 'C';
case 'T':
case 't': return 'A';
default: return base;
case 't':
return 'A';
default:
return base;
}
}
}

View File

@ -43,36 +43,20 @@ public class RecalibrationArgumentCollection {
// Shared Command Line Arguments
//////////////////////////////////
@Hidden
@Argument(fullName="default_read_group", shortName="dRG", required=false, doc="If a read has no read group then default to the provided String.")
public String DEFAULT_READ_GROUP = null;
@Hidden
@Argument(fullName="default_platform", shortName="dP", required=false, doc="If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.")
@Argument(fullName = "default_platform", shortName = "dP", required = false, doc = "If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.")
public String DEFAULT_PLATFORM = null;
@Hidden
@Argument(fullName="force_read_group", shortName="fRG", required=false, doc="If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group.")
public String FORCE_READ_GROUP = null;
@Hidden
@Argument(fullName="force_platform", shortName="fP", required=false, doc="If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.")
@Argument(fullName = "force_platform", shortName = "fP", required = false, doc = "If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.")
public String FORCE_PLATFORM = null;
@Hidden
@Argument(fullName = "window_size_nqs", shortName="nqs", doc="The window size used by MinimumNQSCovariate for its calculation", required=false)
@Argument(fullName = "window_size_nqs", shortName = "nqs", doc = "The window size used by MinimumNQSCovariate for its calculation", required = false)
public int WINDOW_SIZE = 5;
/**
* This window size tells the module in how big of a neighborhood around the current base it should look for the minimum base quality score.
*/
@Hidden
@Argument(fullName = "homopolymer_nback", shortName="nback", doc="The number of previous bases to look at in HomopolymerCovariate", required=false)
public int HOMOPOLYMER_NBACK = 7;
@Hidden
@Argument(fullName = "exception_if_no_tile", shortName="throwTileException", doc="If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1", required=false)
public boolean EXCEPTION_IF_NO_TILE = false;
/**
* CountCovariates and TableRecalibration accept a --solid_recal_mode <MODE> flag which governs how the recalibrator handles the
* reads which have had the reference inserted because of color space inconsistencies.
*/
@Argument(fullName="solid_recal_mode", shortName="sMode", required = false, doc="How should we recalibrate solid bases in which the reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS")
@Argument(fullName = "solid_recal_mode", shortName = "sMode", required = false, doc = "How should we recalibrate solid bases in which the reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS")
public RecalDataManager.SOLID_RECAL_MODE SOLID_RECAL_MODE = RecalDataManager.SOLID_RECAL_MODE.SET_Q_ZERO;
/**
@ -80,6 +64,19 @@ public class RecalibrationArgumentCollection {
* no calls in the color space tag. Unfortunately because of the reference inserted bases mentioned above, reads with no calls in
* their color space tag can not be recalibrated.
*/
@Argument(fullName = "solid_nocall_strategy", shortName="solid_nocall_strategy", doc="Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ", required=false)
@Argument(fullName = "solid_nocall_strategy", shortName = "solid_nocall_strategy", doc = "Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ", required = false)
public RecalDataManager.SOLID_NOCALL_STRATEGY SOLID_NOCALL_STRATEGY = RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION;
/**
* The context covariate will use a context of this size to calculate it's covariate value
*/
@Argument(fullName = "context_size", shortName = "cs", doc = "size of the k-mer context to be used", required = false)
public int CONTEXT_SIZE = 8;
/**
* This window size tells the module in how big of a neighborhood around the current base it should look for the minimum base quality score.
*/
@Argument(fullName = "homopolymer_nback", shortName = "nback", doc = "The number of previous bases to look at in HomopolymerCovariate", required = false)
public int HOMOPOLYMER_NBACK = 7;
}

View File

@ -39,6 +39,7 @@ import org.broadinstitute.sting.utils.classloader.PluginManager;
import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.text.TextFormattingUtils;
import org.broadinstitute.sting.utils.text.XReadLines;
@ -85,12 +86,12 @@ import java.util.regex.Pattern;
* -o my_reads.recal.bam \
* -recalFile my_reads.recal_data.csv
* </pre>
*
*/
@BAQMode(QualityMode = BAQ.QualityMode.ADD_TAG, ApplicationTime = BAQ.ApplicationTime.ON_OUTPUT)
@WalkerName("TableRecalibration")
@Requires({ DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES }) // This walker requires -I input.bam, it also requires -R reference.fasta
@Requires({DataSource.READS, DataSource.REFERENCE, DataSource.REFERENCE_BASES})
// This walker requires -I input.bam, it also requires -R reference.fasta
public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWriter> {
public static final String PROGRAM_RECORD_NAME = "GATK TableRecalibration";
@ -98,7 +99,8 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/////////////////////////////
// Shared Arguments
/////////////////////////////
@ArgumentCollection private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
@ArgumentCollection
private RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
/////////////////////////////
// Command Line Arguments
@ -109,12 +111,12 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* three items are the data- that is, number of observations for this combination of covariates, number of reference mismatches,
* and the raw empirical quality score calculated by phred-scaling the mismatch rate.
*/
@Input(fullName="recal_file", shortName="recalFile", required=true, doc="Filename for the input covariates table recalibration .csv file")
@Input(fullName = "recal_file", shortName = "recalFile", required = true, doc = "Filename for the input covariates table recalibration .csv file")
public File RECAL_FILE = null;
/**
* A new bam file in which the quality scores in each read have been recalibrated. The alignment of the reads is left untouched.
*/
@Output(doc="The output recalibrated BAM file", required=true)
@Output(doc = "The output recalibrated BAM file", required = true)
private StingSAMFileWriter OUTPUT_BAM = null;
/**
@ -125,7 +127,7 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* your Q2 and Q3 bins can be elevated to Q8 or Q10, leading to issues downstream. With the default value of 5, all Q0-Q4 bases
* are unmodified during recalibration, so they don't get inappropriately evaluated.
*/
@Argument(fullName="preserve_qscores_less_than", shortName="pQ", doc="Bases with quality scores less than this threshold won't be recalibrated. In general it's unsafe to change qualities scores below < 5, since base callers use these values to indicate random or bad bases", required=false)
@Argument(fullName = "preserve_qscores_less_than", shortName = "pQ", doc = "Bases with quality scores less than this threshold won't be recalibrated. In general it's unsafe to change qualities scores below < 5, since base callers use these values to indicate random or bad bases", required = false)
private int PRESERVE_QSCORES_LESS_THAN = 5;
/**
@ -134,37 +136,36 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* argument which sets how many unobserved counts to add to every bin. Use --smoothing 0 to turn off all smoothing or, for example,
* --smoothing 15 for a large amount of smoothing.
*/
@Argument(fullName="smoothing", shortName="sm", required = false, doc="Number of imaginary counts to add to each bin in order to smooth out bins with few data points")
@Argument(fullName = "smoothing", shortName = "sm", required = false, doc = "Number of imaginary counts to add to each bin in order to smooth out bins with few data points")
private int SMOOTHING = 1;
/**
* Combinations of covariates in which there are zero mismatches technically have infinite quality. We get around this situation
* by capping at the specified value. We've found that Q40 is too low when using a more completely database of known variation like dbSNP build 132 or later.
*/
@Argument(fullName="max_quality_score", shortName="maxQ", required = false, doc="The integer value at which to cap the quality scores")
@Argument(fullName = "max_quality_score", shortName = "maxQ", required = false, doc = "The integer value at which to cap the quality scores")
private int MAX_QUALITY_SCORE = 50;
/**
* By default TableRecalibration emits the OQ field -- so you can go back and look at the original quality scores, rerun
* the system using the OQ flags, etc, on the output BAM files; to turn off emission of the OQ field use this flag.
*/
@Argument(fullName="doNotWriteOriginalQuals", shortName="noOQs", required=false, doc="If true, we will not write the original quality (OQ) tag for each read")
@Argument(fullName = "doNotWriteOriginalQuals", shortName = "noOQs", required = false, doc = "If true, we will not write the original quality (OQ) tag for each read")
private boolean DO_NOT_WRITE_OQ = false;
/////////////////////////////
// Debugging-only Arguments
/////////////////////////////
@Hidden
@Argument(fullName="no_pg_tag", shortName="noPG", required=false, doc="Don't output the usual PG tag in the recalibrated bam file header. FOR DEBUGGING PURPOSES ONLY. This option is required in order to pass integration tests.")
@Argument(fullName = "no_pg_tag", shortName = "noPG", required = false, doc = "Don't output the usual PG tag in the recalibrated bam file header. FOR DEBUGGING PURPOSES ONLY. This option is required in order to pass integration tests.")
private boolean NO_PG_TAG = false;
@Hidden
@Argument(fullName="fail_with_no_eof_marker", shortName="requireEOF", required=false, doc="If no EOF marker is present in the covariates file, exit the program with an exception.")
@Argument(fullName = "fail_with_no_eof_marker", shortName = "requireEOF", required = false, doc = "If no EOF marker is present in the covariates file, exit the program with an exception.")
private boolean REQUIRE_EOF = false;
@Hidden
@Argument(fullName="skipUQUpdate", shortName="skipUQUpdate", required=false, doc="If true, we will skip the UQ updating step for each read, speeding up the calculations")
@Argument(fullName = "skipUQUpdate", shortName = "skipUQUpdate", required = false, doc = "If true, we will skip the UQ updating step for each read, speeding up the calculations")
private boolean skipUQUpdate = false;
/////////////////////////////
// Private Member Variables
/////////////////////////////
@ -181,7 +182,6 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/////////////////////////////
private NestedHashMap qualityScoreByFullCovariateKey = new NestedHashMap(); // Caches the result of performSequentialQualityCalculation(..) for all sets of covariate values.
//---------------------------------------------------------------------------------------------------------------
//
// initialize
@ -195,8 +195,9 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
*/
public void initialize() {
if( RAC.FORCE_READ_GROUP != null ) { RAC.DEFAULT_READ_GROUP = RAC.FORCE_READ_GROUP; }
if( RAC.FORCE_PLATFORM != null ) { RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM; }
if (RAC.FORCE_PLATFORM != null) {
RAC.DEFAULT_PLATFORM = RAC.FORCE_PLATFORM;
}
// Get a list of all available covariates
final List<Class<? extends Covariate>> classes = new PluginManager<Covariate>(Covariate.class).getPlugins();
@ -205,31 +206,33 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
boolean foundAllCovariates = false;
// Read in the data from the csv file and populate the data map and covariates list
logger.info( "Reading in the data from input csv file..." );
logger.info("Reading in the data from input csv file...");
boolean sawEOF = false;
try {
for ( String line : new XReadLines(RECAL_FILE) ) {
for (String line : new XReadLines(RECAL_FILE)) {
lineNumber++;
if ( EOF_MARKER.equals(line) ) {
if (EOF_MARKER.equals(line)) {
sawEOF = true;
} else if( COMMENT_PATTERN.matcher(line).matches() || OLD_RECALIBRATOR_HEADER.matcher(line).matches() ) {
}
else if (COMMENT_PATTERN.matcher(line).matches() || OLD_RECALIBRATOR_HEADER.matcher(line).matches()) {
; // Skip over the comment lines, (which start with '#')
}
// Read in the covariates that were used from the input file
else if( COVARIATE_PATTERN.matcher(line).matches() ) { // The line string is either specifying a covariate or is giving csv data
if( foundAllCovariates ) {
throw new UserException.MalformedFile( RECAL_FILE, "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE );
} else { // Found the covariate list in input file, loop through all of them and instantiate them
else if (COVARIATE_PATTERN.matcher(line).matches()) { // The line string is either specifying a covariate or is giving csv data
if (foundAllCovariates) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE);
}
else { // Found the covariate list in input file, loop through all of them and instantiate them
String[] vals = line.split(",");
for( int iii = 0; iii < vals.length - 3; iii++ ) { // There are n-3 covariates. The last three items are nObservations, nMismatch, and Qempirical
for (int iii = 0; iii < vals.length - 3; iii++) { // There are n-3 covariates. The last three items are nObservations, nMismatch, and Qempirical
boolean foundClass = false;
for( Class<?> covClass : classes ) {
if( (vals[iii] + "Covariate").equalsIgnoreCase( covClass.getSimpleName() ) ) {
for (Class<?> covClass : classes) {
if ((vals[iii] + "Covariate").equalsIgnoreCase(covClass.getSimpleName())) {
foundClass = true;
try {
Covariate covariate = (Covariate)covClass.newInstance();
requestedCovariates.add( covariate );
Covariate covariate = (Covariate) covClass.newInstance();
requestedCovariates.add(covariate);
} catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e);
}
@ -237,107 +240,110 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
}
}
if( !foundClass ) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option." );
if (!foundClass) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option.");
}
}
}
} else { // Found a line of data
if( !foundAllCovariates ) {
}
else { // Found a line of data
if (!foundAllCovariates) {
foundAllCovariates = true;
// At this point all the covariates should have been found and initialized
if( requestedCovariates.size() < 2 ) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration csv file. Covariate names can't be found in file: " + RECAL_FILE );
if (requestedCovariates.size() < 2) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration csv file. Covariate names can't be found in file: " + RECAL_FILE);
}
final boolean createCollapsedTables = true;
// Initialize any covariate member variables using the shared argument collection
for( Covariate cov : requestedCovariates ) {
cov.initialize( RAC );
for (Covariate cov : requestedCovariates) {
cov.initialize(RAC);
}
// Initialize the data hashMaps
dataManager = new RecalDataManager( createCollapsedTables, requestedCovariates.size() );
dataManager = new RecalDataManager(createCollapsedTables, requestedCovariates.size());
}
addCSVData(RECAL_FILE, line); // Parse the line and add the data to the HashMap
}
}
} catch ( FileNotFoundException e ) {
} catch (FileNotFoundException e) {
throw new UserException.CouldNotReadInputFile(RECAL_FILE, "Can not find input file", e);
} catch ( NumberFormatException e ) {
} catch (NumberFormatException e) {
throw new UserException.MalformedFile(RECAL_FILE, "Error parsing recalibration data at line " + lineNumber + ". Perhaps your table was generated by an older version of CovariateCounterWalker.");
}
logger.info( "...done!" );
logger.info("...done!");
if ( !sawEOF ) {
if (!sawEOF) {
final String errorMessage = "No EOF marker was present in the recal covariates table; this could mean that the file is corrupted or was generated with an old version of the CountCovariates tool.";
if ( REQUIRE_EOF )
if (REQUIRE_EOF)
throw new UserException.MalformedFile(RECAL_FILE, errorMessage);
logger.warn(errorMessage);
}
logger.info( "The covariates being used here: " );
for( Covariate cov : requestedCovariates ) {
logger.info( "\t" + cov.getClass().getSimpleName() );
logger.info("The covariates being used here: ");
for (Covariate cov : requestedCovariates) {
logger.info("\t" + cov.getClass().getSimpleName());
}
if( dataManager == null ) {
if (dataManager == null) {
throw new UserException.MalformedFile(RECAL_FILE, "Can't initialize the data manager. Perhaps the recal csv file contains no data?");
}
// Create the tables of empirical quality scores that will be used in the sequential calculation
logger.info( "Generating tables of empirical qualities for use in sequential calculation..." );
dataManager.generateEmpiricalQualities( SMOOTHING, MAX_QUALITY_SCORE );
logger.info( "...done!" );
logger.info("Generating tables of empirical qualities for use in sequential calculation...");
dataManager.generateEmpiricalQualities(SMOOTHING, MAX_QUALITY_SCORE);
logger.info("...done!");
// Take the header of the input SAM file and tweak it by adding in a new programRecord with the version number and list of covariates that were used
final SAMFileHeader header = getToolkit().getSAMFileHeader().clone();
if( !NO_PG_TAG ) {
if (!NO_PG_TAG) {
final SAMProgramRecord programRecord = new SAMProgramRecord(PROGRAM_RECORD_NAME);
final ResourceBundle headerInfo = TextFormattingUtils.loadResourceBundle("StingText");
try {
final String version = headerInfo.getString("org.broadinstitute.sting.gatk.version");
programRecord.setProgramVersion(version);
} catch (MissingResourceException e) {}
} catch (MissingResourceException e) {
}
StringBuffer sb = new StringBuffer();
sb.append(getToolkit().createApproximateCommandLineArgumentString(getToolkit(), this));
sb.append(" Covariates=[");
for( Covariate cov : requestedCovariates ) {
for (Covariate cov : requestedCovariates) {
sb.append(cov.getClass().getSimpleName());
sb.append(", ");
}
sb.setCharAt(sb.length()-2, ']');
sb.setCharAt(sb.length()-1, ' ');
sb.setCharAt(sb.length() - 2, ']');
sb.setCharAt(sb.length() - 1, ' ');
programRecord.setCommandLine(sb.toString());
List<SAMProgramRecord> oldRecords = header.getProgramRecords();
List<SAMProgramRecord> newRecords = new ArrayList<SAMProgramRecord>(oldRecords.size()+1);
for ( SAMProgramRecord record : oldRecords ) {
if ( !record.getId().startsWith(PROGRAM_RECORD_NAME) )
List<SAMProgramRecord> newRecords = new ArrayList<SAMProgramRecord>(oldRecords.size() + 1);
for (SAMProgramRecord record : oldRecords) {
if (!record.getId().startsWith(PROGRAM_RECORD_NAME))
newRecords.add(record);
}
newRecords.add(programRecord);
header.setProgramRecords(newRecords);
// Write out the new header
OUTPUT_BAM.writeHeader( header );
OUTPUT_BAM.writeHeader(header);
}
}
/**
* For each covariate read in a value and parse it. Associate those values with the data itself (num observation and num mismatches)
*
* @param line A line of CSV data read from the recalibration table data file
*/
private void addCSVData(final File file, final String line) {
final String[] vals = line.split(",");
// Check if the data line is malformed, for example if the read group string contains a comma then it won't be parsed correctly
if( vals.length != requestedCovariates.size() + 3 ) { // +3 because of nObservations, nMismatch, and Qempirical
if (vals.length != requestedCovariates.size() + 3) { // +3 because of nObservations, nMismatch, and Qempirical
throw new UserException.MalformedFile(file, "Malformed input recalibration file. Found data line with too many fields: " + line +
" --Perhaps the read group string contains a comma and isn't being parsed correctly.");
}
@ -345,15 +351,15 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
final Object[] key = new Object[requestedCovariates.size()];
Covariate cov;
int iii;
for( iii = 0; iii < requestedCovariates.size(); iii++ ) {
cov = requestedCovariates.get( iii );
key[iii] = cov.getValue( vals[iii] );
for (iii = 0; iii < requestedCovariates.size(); iii++) {
cov = requestedCovariates.get(iii);
key[iii] = cov.getValue(vals[iii]);
}
// Create a new datum using the number of observations, number of mismatches, and reported quality score
final RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 );
final RecalDatum datum = new RecalDatum(Long.parseLong(vals[iii]), Long.parseLong(vals[iii + 1]), Double.parseDouble(vals[1]), 0.0);
// Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, PRESERVE_QSCORES_LESS_THAN );
dataManager.addToAllTables(key, datum, PRESERVE_QSCORES_LESS_THAN);
}
//---------------------------------------------------------------------------------------------------------------
@ -369,61 +375,60 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* @param read The read to be recalibrated
* @return The read with quality scores replaced
*/
public SAMRecord map( ReferenceContext refBases, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker ) {
public SAMRecord map(ReferenceContext refBases, GATKSAMRecord read, ReadMetaDataTracker metaDataTracker) {
if( read.getReadLength() == 0 ) { // Some reads have '*' as the SEQ field and samtools returns length zero. We don't touch these reads.
if (read.getReadLength() == 0) { // Some reads have '*' as the SEQ field and samtools returns length zero. We don't touch these reads.
return read;
}
RecalDataManager.parseSAMRecord( read, RAC );
RecalDataManager.parseSAMRecord(read, RAC);
byte[] originalQuals = read.getBaseQualities();
final byte[] recalQuals = originalQuals.clone();
final String platform = read.getReadGroup().getPlatform();
if( platform.toUpperCase().contains("SOLID") && !(RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING) ) {
if( !(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION) ) {
final boolean badColor = RecalDataManager.checkNoCallColorSpace( read );
if( badColor ) {
if (platform.toUpperCase().contains("SOLID") && !(RAC.SOLID_RECAL_MODE == RecalDataManager.SOLID_RECAL_MODE.DO_NOTHING)) {
if (!(RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.THROW_EXCEPTION)) {
final boolean badColor = RecalDataManager.checkNoCallColorSpace(read);
if (badColor) {
numReadsWithMalformedColorSpace++;
if( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED ) {
if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED) {
return read; // can't recalibrate a SOLiD read with no calls in the color space, and the user wants to skip over them
} else if ( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ ) {
}
else if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ) {
read.setReadFailsVendorQualityCheckFlag(true);
return read;
}
}
}
originalQuals = RecalDataManager.calcColorSpace( read, originalQuals, RAC.SOLID_RECAL_MODE, refBases == null ? null : refBases.getBases() );
originalQuals = RecalDataManager.calcColorSpace(read, originalQuals, RAC.SOLID_RECAL_MODE, refBases == null ? null : refBases.getBases());
}
//compute all covariate values for this read
final Comparable[][] covariateValues_offset_x_covar =
RecalDataManager.computeCovariates((GATKSAMRecord) read, requestedCovariates);
final Comparable[][] covariateValues_offset_x_covar = RecalDataManager.computeCovariates(read, requestedCovariates, BaseRecalibration.BaseRecalibrationType.BASE_SUBSTITUTION);
// For each base in the read
for( int offset = 0; offset < read.getReadLength(); offset++ ) {
for (int offset = 0; offset < read.getReadLength(); offset++) {
final Object[] fullCovariateKey = covariateValues_offset_x_covar[offset];
Byte qualityScore = (Byte) qualityScoreByFullCovariateKey.get(fullCovariateKey);
if(qualityScore == null)
{
qualityScore = performSequentialQualityCalculation( fullCovariateKey );
if (qualityScore == null) {
qualityScore = performSequentialQualityCalculation(fullCovariateKey);
qualityScoreByFullCovariateKey.put(qualityScore, fullCovariateKey);
}
recalQuals[offset] = qualityScore;
}
preserveQScores( originalQuals, recalQuals ); // Overwrite the work done if original quality score is too low
preserveQScores(originalQuals, recalQuals); // Overwrite the work done if original quality score is too low
read.setBaseQualities( recalQuals ); // Overwrite old qualities with new recalibrated qualities
if ( !DO_NOT_WRITE_OQ && read.getAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG) == null ) { // Save the old qualities if the tag isn't already taken in the read
read.setBaseQualities(recalQuals); // Overwrite old qualities with new recalibrated qualities
if (!DO_NOT_WRITE_OQ && read.getAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG) == null) { // Save the old qualities if the tag isn't already taken in the read
read.setAttribute(RecalDataManager.ORIGINAL_QUAL_ATTRIBUTE_TAG, SAMUtils.phredToFastq(originalQuals));
}
if (! skipUQUpdate && refBases != null && read.getAttribute(SAMTag.UQ.name()) != null) {
if (!skipUQUpdate && refBases != null && read.getAttribute(SAMTag.UQ.name()) != null) {
read.setAttribute(SAMTag.UQ.name(), SequenceUtil.sumQualitiesOfMismatches(read, refBases.getBases(), read.getAlignmentStart() - 1, false));
}
@ -446,21 +451,22 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
* - The final shift equation is:
*
* Qrecal = Qreported + DeltaQ + DeltaQ(pos) + DeltaQ(dinuc) + DeltaQ( ... any other covariate ... )
*
* @param key The list of Comparables that were calculated from the covariates
* @return A recalibrated quality score as a byte
*/
private byte performSequentialQualityCalculation( final Object... key ) {
private byte performSequentialQualityCalculation(final Object... key) {
final byte qualFromRead = (byte)Integer.parseInt(key[1].toString());
final byte qualFromRead = (byte) Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3];
// The global quality shift (over the read group only)
readGroupCollapsedKey[0] = key[0];
final RecalDatum globalRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(0).get( readGroupCollapsedKey ));
final RecalDatum globalRecalDatum = ((RecalDatum) dataManager.getCollapsedTable(0).get(readGroupCollapsedKey));
double globalDeltaQ = 0.0;
if( globalRecalDatum != null ) {
if (globalRecalDatum != null) {
final double globalDeltaQEmpirical = globalRecalDatum.getEmpiricalQuality();
final double aggregrateQReported = globalRecalDatum.getEstimatedQReported();
globalDeltaQ = globalDeltaQEmpirical - aggregrateQReported;
@ -469,9 +475,9 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
// The shift in quality between reported and empirical
qualityScoreCollapsedKey[0] = key[0];
qualityScoreCollapsedKey[1] = key[1];
final RecalDatum qReportedRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(1).get( qualityScoreCollapsedKey ));
final RecalDatum qReportedRecalDatum = ((RecalDatum) dataManager.getCollapsedTable(1).get(qualityScoreCollapsedKey));
double deltaQReported = 0.0;
if( qReportedRecalDatum != null ) {
if (qReportedRecalDatum != null) {
final double deltaQReportedEmpirical = qReportedRecalDatum.getEmpiricalQuality();
deltaQReported = deltaQReportedEmpirical - qualFromRead - globalDeltaQ;
}
@ -481,17 +487,17 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
double deltaQCovariateEmpirical;
covariateCollapsedKey[0] = key[0];
covariateCollapsedKey[1] = key[1];
for( int iii = 2; iii < key.length; iii++ ) {
for (int iii = 2; iii < key.length; iii++) {
covariateCollapsedKey[2] = key[iii]; // The given covariate
final RecalDatum covariateRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(iii).get( covariateCollapsedKey ));
if( covariateRecalDatum != null ) {
final RecalDatum covariateRecalDatum = ((RecalDatum) dataManager.getCollapsedTable(iii).get(covariateCollapsedKey));
if (covariateRecalDatum != null) {
deltaQCovariateEmpirical = covariateRecalDatum.getEmpiricalQuality();
deltaQCovariates += ( deltaQCovariateEmpirical - qualFromRead - (globalDeltaQ + deltaQReported) );
deltaQCovariates += (deltaQCovariateEmpirical - qualFromRead - (globalDeltaQ + deltaQReported));
}
}
final double newQuality = qualFromRead + globalDeltaQ + deltaQReported + deltaQCovariates;
return QualityUtils.boundQual( (int)Math.round(newQuality), (byte)MAX_QUALITY_SCORE );
return QualityUtils.boundQual((int) Math.round(newQuality), (byte) MAX_QUALITY_SCORE);
// Verbose printouts used to validate with old recalibrator
//if(key.contains(null)) {
@ -508,12 +514,13 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/**
* Loop over the list of qualities and overwrite the newly recalibrated score to be the original score if it was less than some threshold
*
* @param originalQuals The list of original base quality scores
* @param recalQuals A list of the new recalibrated quality scores
*/
private void preserveQScores( final byte[] originalQuals, final byte[] recalQuals ) {
for( int iii = 0; iii < recalQuals.length; iii++ ) {
if( originalQuals[iii] < PRESERVE_QSCORES_LESS_THAN ) {
private void preserveQScores(final byte[] originalQuals, final byte[] recalQuals) {
for (int iii = 0; iii < recalQuals.length; iii++) {
if (originalQuals[iii] < PRESERVE_QSCORES_LESS_THAN) {
recalQuals[iii] = originalQuals[iii];
}
}
@ -527,6 +534,7 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/**
* Start the reduce with a handle to the output bam file
*
* @return A FileWriter pointing to a new bam file
*/
public SAMFileWriter reduceInit() {
@ -535,12 +543,13 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/**
* Output each read to disk
*
* @param read The read to output
* @param output The FileWriter to write the read to
* @return The FileWriter
*/
public SAMFileWriter reduce( SAMRecord read, SAMFileWriter output ) {
if( output != null ) {
public SAMFileWriter reduce(SAMRecord read, SAMFileWriter output) {
if (output != null) {
output.addAlignment(read);
}
return output;
@ -548,16 +557,18 @@ public class TableRecalibrationWalker extends ReadWalker<SAMRecord, SAMFileWrite
/**
* Do nothing
*
* @param output The SAMFileWriter that outputs the bam file
*/
public void onTraversalDone(SAMFileWriter output) {
if( numReadsWithMalformedColorSpace != 0 ) {
if( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED ) {
if (numReadsWithMalformedColorSpace != 0) {
if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.LEAVE_READ_UNRECALIBRATED) {
Utils.warnUser("Discovered " + numReadsWithMalformedColorSpace + " SOLiD reads with no calls in the color space. Unfortunately these reads cannot be recalibrated with this recalibration algorithm " +
"because we use reference mismatch rate as the only indication of a base's true quality. These reads have had reference bases inserted as a way of correcting " +
"for color space misalignments and there is now no way of knowing how often it mismatches the reference and therefore no way to recalibrate the quality score. " +
"These reads remain in the output bam file but haven't been corrected for reference bias. !!! USE AT YOUR OWN RISK !!!");
} else if ( RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ ) {
}
else if (RAC.SOLID_NOCALL_STRATEGY == RecalDataManager.SOLID_NOCALL_STRATEGY.PURGE_READ) {
Utils.warnUser("Discovered " + numReadsWithMalformedColorSpace + " SOLiD reads with no calls in the color space. Unfortunately these reads cannot be recalibrated with this recalibration algorithm " +
"because we use reference mismatch rate as the only indication of a base's true quality. These reads have had reference bases inserted as a way of correcting " +
"for color space misalignments and there is now no way of knowing how often it mismatches the reference and therefore no way to recalibrate the quality score. " +

View File

@ -71,8 +71,8 @@ public class KeepAFSpectrumFrequencySelector extends FrequencyModeSelector {
// recompute AF,AC,AN based on genotypes:
// todo - - maybe too inefficient??
VariantContextUtils.calculateChromosomeCounts(vc, attributes, false);
afArray = new double[] {Double.valueOf((String)attributes.get(VCFConstants.ALLELE_FREQUENCY_KEY))};
} else {
}
// sites-only vc or we explicitly tell to ignore genotypes; we trust the AF field if present
if ( vc.hasAttribute(VCFConstants.ALLELE_FREQUENCY_KEY) ) {
String afo = vc.getAttributeAsString(VCFConstants.ALLELE_FREQUENCY_KEY, null);
@ -90,7 +90,6 @@ public class KeepAFSpectrumFrequencySelector extends FrequencyModeSelector {
else
afArray = new double[] {Double.valueOf(afo)};
}
}
if (afArray == null )

View File

@ -83,29 +83,39 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
@DataPoint(description = "Multi-allelic SNP Novelty Rate")
public String SNPNoveltyRate = "NA";
@DataPoint(description = "Multi-allelic Indels partially known")
//TODO -- implement me
//@DataPoint(description = "Multi-allelic Indels partially known")
public int knownIndelsPartial = 0;
@DataPoint(description = "Multi-allelic Indels completely known")
//@DataPoint(description = "Multi-allelic Indels completely known")
public int knownIndelsComplete = 0;
@DataPoint(description = "Multi-allelic Indel Novelty Rate")
//@DataPoint(description = "Multi-allelic Indel Novelty Rate")
public String indelNoveltyRate = "NA";
@DataPoint(description="Histogram of allele frequencies")
AFHistogram AFhistogram = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for most common SNP alternate allele")
AFHistogram AFhistogramMaxSnp = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for less common SNP alternate alleles")
AFHistogram AFhistogramMinSnp = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for most common Indel alternate allele")
AFHistogram AFhistogramMaxIndel = new AFHistogram();
@DataPoint(description="Histogram of allele frequencies for less common Indel alternate alleles")
AFHistogram AFhistogramMinIndel = new AFHistogram();
/*
* AF histogram table object
*/
static class AFHistogram implements TableType {
private Object[] colKeys, rowKeys = {"pairwise_AF"};
private Object[] rowKeys, colKeys = {"count"};
private int[] AFhistogram;
private static final double AFincrement = 0.01;
private static final int numBins = (int)(1.00 / AFincrement);
public AFHistogram() {
colKeys = initColKeys();
AFhistogram = new int[colKeys.length];
rowKeys = initRowKeys();
AFhistogram = new int[rowKeys.length];
}
public Object[] getColumnKeys() {
@ -117,10 +127,10 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
}
public Object getCell(int row, int col) {
return AFhistogram[col];
return AFhistogram[row];
}
private static Object[] initColKeys() {
private static Object[] initRowKeys() {
ArrayList<String> keyList = new ArrayList<String>(numBins + 1);
for ( double a = 0.00; a <= 1.01; a += AFincrement ) {
keyList.add(String.format("%.2f", a));
@ -130,19 +140,11 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
public String getName() { return "AFHistTable"; }
public void update(VariantContext vc) {
final Object obj = vc.getAttribute(VCFConstants.ALLELE_FREQUENCY_KEY, null);
if ( obj == null || !(obj instanceof List) )
return;
List<String> list = (List<String>)obj;
for ( String str : list ) {
final double AF = Double.valueOf(str);
public void update(final double AF) {
final int bin = (int)(numBins * MathUtils.round(AF, 2));
AFhistogram[bin]++;
}
}
}
public void initialize(VariantEvalWalker walker) {}
@ -168,6 +170,7 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
nMultiSNPs++;
calculatePairwiseTiTv(eval);
calculateSNPPairwiseNovelty(eval, comp);
updateAFhistogram(eval, AFhistogramMaxSnp, AFhistogramMinSnp);
}
break;
case INDEL:
@ -175,12 +178,12 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
if ( !eval.isBiallelic() ) {
nMultiIndels++;
calculateIndelPairwiseNovelty(eval, comp);
updateAFhistogram(eval, AFhistogramMaxIndel, AFhistogramMinIndel);
}
break;
default:
throw new UserException.BadInput("Unexpected variant context type: " + eval);
}
AFhistogram.update(eval);
return null; // we don't capture any interesting sites
}
@ -213,6 +216,24 @@ public class MultiallelicSummary extends VariantEvaluator { // implements Standa
private void calculateIndelPairwiseNovelty(VariantContext eval, VariantContext comp) {
}
private void updateAFhistogram(VariantContext vc, AFHistogram max, AFHistogram min) {
final Object obj = vc.getAttribute(VCFConstants.ALLELE_FREQUENCY_KEY, null);
if ( obj == null || !(obj instanceof List) )
return;
List<String> list = (List<String>)obj;
ArrayList<Double> AFs = new ArrayList<Double>(list.size());
for ( String str : list ) {
AFs.add(Double.valueOf(str));
}
Collections.sort(AFs);
max.update(AFs.get(AFs.size()-1));
for ( int i = 0; i < AFs.size() - 1; i++ )
min.update(AFs.get(i));
}
private final String noveltyRate(final int all, final int known) {
final int novel = all - known;
final double rate = (novel / (1.0 * all));

View File

@ -128,13 +128,13 @@ public class ValidateVariants extends RodWalker<Integer, Integer> {
// get the true reference allele
Allele reportedRefAllele = vc.getReference();
Allele observedRefAllele;
Allele observedRefAllele = null;
// insertions
if ( vc.isSimpleInsertion() ) {
observedRefAllele = Allele.create(Allele.NULL_ALLELE_STRING);
}
// deletions
else if ( vc.isSimpleDeletion() || vc.isMixed() || vc.isMNP() ) {
else if ( vc.isSimpleDeletion() || vc.isMNP() ) {
// we can't validate arbitrarily long deletions
if ( reportedRefAllele.length() > 100 ) {
logger.info(String.format("Reference allele is too long (%d) at position %s:%d; skipping that record.", reportedRefAllele.length(), vc.getChr(), vc.getStart()));
@ -143,16 +143,15 @@ public class ValidateVariants extends RodWalker<Integer, Integer> {
// deletions are associated with the (position of) the last (preceding) non-deleted base;
// hence to get actually deleted bases we need offset = 1
int offset = 1 ;
if ( vc.isMNP() ) offset = 0; // if it's an MNP, the reported position IS the first modified base
int offset = vc.isMNP() ? 0 : 1;
byte[] refBytes = ref.getBases();
byte[] trueRef = new byte[reportedRefAllele.length()];
for (int i = 0; i < reportedRefAllele.length(); i++)
trueRef[i] = refBytes[i+offset];
observedRefAllele = Allele.create(trueRef, true);
}
// SNPs, etc.
else {
// SNPs, etc. but not mixed types because they are too difficult
else if ( !vc.isMixed() ) {
byte[] refByte = new byte[1];
refByte[0] = ref.getBase();
observedRefAllele = Allele.create(refByte, true);

View File

@ -114,7 +114,7 @@ public class VariantsToPed extends RodWalker<Integer,Integer> {
String mid = mVals.containsKey("mom") ? mVals.get("mom") : String.format("dummy_%d",++dummyID);
String sex = mVals.containsKey("sex") ? mVals.get("sex") : "3";
String pheno = mVals.get("phenotype");
outFam.printf("%s\t%s\t%s\t%s\t%s\t%s%n",fid,pid,sample,mid,sex,pheno);
outFam.printf("%s\t%s\t%s\t%s\t%s\t%s%n",fid,sample,pid,mid,sex,pheno);
}
}
}

View File

@ -272,12 +272,11 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
getters.put("POS", new Getter() { public String get(VariantContext vc) { return Integer.toString(vc.getStart()); } });
getters.put("REF", new Getter() {
public String get(VariantContext vc) {
String x = "";
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() ) {
Byte refByte = vc.getReferenceBaseForIndel();
x=x+new String(new byte[]{refByte});
}
return x+vc.getReference().getDisplayString();
StringBuilder x = new StringBuilder();
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() )
x.append((char)vc.getReferenceBaseForIndel().byteValue());
x.append(vc.getReference().getDisplayString());
return x.toString();
}
});
getters.put("ALT", new Getter() {
@ -285,13 +284,11 @@ public class VariantsToTable extends RodWalker<Integer, Integer> {
StringBuilder x = new StringBuilder();
int n = vc.getAlternateAlleles().size();
if ( n == 0 ) return ".";
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() ) {
Byte refByte = vc.getReferenceBaseForIndel();
x.append(new String(new byte[]{refByte}));
}
for ( int i = 0; i < n; i++ ) {
if ( i != 0 ) x.append(",");
if ( vc.hasReferenceBaseForIndel() && !vc.isSNP() )
x.append((char)vc.getReferenceBaseForIndel().byteValue());
x.append(vc.getAlternateAllele(i).getDisplayString());
}
return x.toString();

View File

@ -2,57 +2,59 @@ package org.broadinstitute.sting.utils;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
/**
* BaseUtils contains some basic utilities for manipulating nucleotides.
*/
public class BaseUtils {
public final static byte A = (byte)'A';
public final static byte C = (byte)'C';
public final static byte G = (byte)'G';
public final static byte T = (byte)'T';
public final static byte A = (byte) 'A';
public final static byte C = (byte) 'C';
public final static byte G = (byte) 'G';
public final static byte T = (byte) 'T';
public final static byte N = (byte)'N';
public final static byte D = (byte)'D';
public final static byte N = (byte) 'N';
public final static byte D = (byte) 'D';
//
// todo -- we need a generalized base abstraction using the Base enum.
//
public final static byte[] BASES = { 'A', 'C', 'G', 'T' };
public final static byte[] EXTENDED_BASES = { 'A', 'C', 'G', 'T', 'N', 'D' };
public final static byte[] BASES = {'A', 'C', 'G', 'T'};
public final static byte[] EXTENDED_BASES = {'A', 'C', 'G', 'T', 'N', 'D'};
public enum Base {
A ( 'A', 0 ),
C ( 'C', 1 ),
G ( 'G', 2 ),
T ( 'T', 3 );
A('A', 0),
C('C', 1),
G('G', 2),
T('T', 3);
byte b;
int index;
private Base(char base, int index) {
this.b = (byte)base;
this.b = (byte) base;
this.index = index;
}
public byte getBase() { return b; }
public char getBaseAsChar() { return (char)b; }
public char getBaseAsChar() { return (char) b; }
public int getIndex() { return index; }
public boolean sameBase(byte o) { return b == o; }
public boolean sameBase(char o) { return b == (byte)o; }
public boolean sameBase(char o) { return b == (byte) o; }
public boolean sameBase(int i) { return index == i; }
}
// todo -- fix me (enums?)
public static final byte DELETION_INDEX = 4;
public static final byte NO_CALL_INDEX = 5; // (this is 'N')
public static int gIndex = BaseUtils.simpleBaseToBaseIndex((byte)'G');
public static int cIndex = BaseUtils.simpleBaseToBaseIndex((byte)'C');
public static int aIndex = BaseUtils.simpleBaseToBaseIndex((byte)'A');
public static int tIndex = BaseUtils.simpleBaseToBaseIndex((byte)'T');
public static int gIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'G');
public static int cIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'C');
public static int aIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'A');
public static int tIndex = BaseUtils.simpleBaseToBaseIndex((byte) 'T');
/// In genetics, a transition is a mutation changing a purine to another purine nucleotide (A <-> G) or
// a pyrimidine to another pyrimidine nucleotide (C <-> T).
@ -64,28 +66,31 @@ public class BaseUtils {
/**
* Returns the base substitution type of the 2 state SNP
*
* @param base1
* @param base2
* @return
*/
public static BaseSubstitutionType SNPSubstitutionType( byte base1, byte base2 ) {
public static BaseSubstitutionType SNPSubstitutionType(byte base1, byte base2) {
BaseSubstitutionType t = isTransition(base1, base2) ? BaseSubstitutionType.TRANSITION : BaseSubstitutionType.TRANSVERSION;
//System.out.printf("SNPSubstitutionType( char %c, char %c ) => %s%n", base1, base2, t);
return t;
}
public static boolean isTransition( byte base1, byte base2 ) {
public static boolean isTransition(byte base1, byte base2) {
int b1 = simpleBaseToBaseIndex(base1);
int b2 = simpleBaseToBaseIndex(base2);
return b1 == 0 && b2 == 2 || b1 == 2 && b2 == 0 ||
b1 == 1 && b2 == 3 || b1 == 3 && b2 == 1;
}
public static boolean isTransversion( byte base1, byte base2 ) {
return ! isTransition(base1, base2);
public static boolean isTransversion(byte base1, byte base2) {
return !isTransition(base1, base2);
}
/** Private constructor. No instantiating this class! */
/**
* Private constructor. No instantiating this class!
*/
private BaseUtils() {}
static public boolean basesAreEqual(byte base1, byte base2) {
@ -96,7 +101,6 @@ public class BaseUtils {
return extendedBaseToBaseIndex(base1) == extendedBaseToBaseIndex(base2);
}
/**
* Converts a IUPAC nucleotide code to a pair of bases
*
@ -170,22 +174,26 @@ public class BaseUtils {
switch (base) {
case '*': // the wildcard character counts as an A
case 'A':
case 'a': return 0;
case 'a':
return 0;
case 'C':
case 'c': return 1;
case 'c':
return 1;
case 'G':
case 'g': return 2;
case 'g':
return 2;
case 'T':
case 't': return 3;
case 't':
return 3;
default: return -1;
default:
return -1;
}
}
/**
* Converts a simple base to a base index
*
@ -197,29 +205,37 @@ public class BaseUtils {
switch (base) {
case '*': // the wildcard character counts as an A
case 'A':
case 'a': return 0;
case 'a':
return 0;
case 'C':
case 'c': return 1;
case 'c':
return 1;
case 'G':
case 'g': return 2;
case 'g':
return 2;
case 'T':
case 't': return 3;
case 't':
return 3;
default: return -1;
default:
return -1;
}
}
static public int extendedBaseToBaseIndex(byte base) {
switch (base) {
case 'd':
case 'D': return DELETION_INDEX;
case 'D':
return DELETION_INDEX;
case 'n':
case 'N': return NO_CALL_INDEX;
case 'N':
return NO_CALL_INDEX;
default: return simpleBaseToBaseIndex(base);
default:
return simpleBaseToBaseIndex(base);
}
}
@ -232,11 +248,6 @@ public class BaseUtils {
return simpleBaseToBaseIndex(base) != -1;
}
@Deprecated
static public boolean isNBase(char base) {
return isNBase((byte)base);
}
static public boolean isNBase(byte base) {
return base == 'N' || base == 'n';
}
@ -249,17 +260,22 @@ public class BaseUtils {
*/
static public byte baseIndexToSimpleBase(int baseIndex) {
switch (baseIndex) {
case 0: return 'A';
case 1: return 'C';
case 2: return 'G';
case 3: return 'T';
default: return '.';
case 0:
return 'A';
case 1:
return 'C';
case 2:
return 'G';
case 3:
return 'T';
default:
return '.';
}
}
@Deprecated
static public char baseIndexToSimpleBaseAsChar(int baseIndex) {
return (char)baseIndexToSimpleBase(baseIndex);
return (char) baseIndexToSimpleBase(baseIndex);
}
/**
@ -270,11 +286,16 @@ public class BaseUtils {
*/
static public int crossTalkPartnerIndex(int baseIndex) {
switch (baseIndex) {
case 0: return 1; // A -> C
case 1: return 0; // C -> A
case 2: return 3; // G -> T
case 3: return 2; // T -> G
default: return -1;
case 0:
return 1; // A -> C
case 1:
return 0; // C -> A
case 2:
return 3; // G -> T
case 3:
return 2; // T -> G
default:
return -1;
}
}
@ -286,7 +307,7 @@ public class BaseUtils {
*/
@Deprecated
static public char crossTalkPartnerBase(char base) {
return (char)baseIndexToSimpleBase(crossTalkPartnerIndex(simpleBaseToBaseIndex(base)));
return (char) baseIndexToSimpleBase(crossTalkPartnerIndex(simpleBaseToBaseIndex(base)));
}
/**
@ -297,11 +318,16 @@ public class BaseUtils {
*/
static public byte complementIndex(int baseIndex) {
switch (baseIndex) {
case 0: return 3; // a -> t
case 1: return 2; // c -> g
case 2: return 1; // g -> c
case 3: return 0; // t -> a
default: return -1; // wtf?
case 0:
return 3; // a -> t
case 1:
return 2; // c -> g
case 2:
return 1; // g -> c
case 3:
return 0; // t -> a
default:
return -1; // wtf?
}
}
@ -314,20 +340,25 @@ public class BaseUtils {
static public byte simpleComplement(byte base) {
switch (base) {
case 'A':
case 'a': return 'T';
case 'a':
return 'T';
case 'C':
case 'c': return 'G';
case 'c':
return 'G';
case 'G':
case 'g': return 'C';
case 'g':
return 'C';
case 'T':
case 't': return 'A';
default: return base;
case 't':
return 'A';
default:
return base;
}
}
@Deprecated
static public char simpleComplement(char base) {
return (char)simpleComplement((byte)base);
return (char) simpleComplement((byte) base);
}
/**
@ -407,7 +438,6 @@ public class BaseUtils {
return new String(simpleReverseComplement(bases.getBytes()));
}
/**
* Complement a String of bases. Preserves ambiguous bases.
*
@ -467,7 +497,7 @@ public class BaseUtils {
static public double mostFrequentBaseFraction(byte[] sequence) {
int[] baseCounts = new int[4];
for ( byte base : sequence ) {
for (byte base : sequence) {
int baseIndex = simpleBaseToBaseIndex(base);
if (baseIndex >= 0) {
@ -477,7 +507,7 @@ public class BaseUtils {
int mostFrequentBaseIndex = mostFrequentBaseIndex(baseCounts);
return ((double) baseCounts[mostFrequentBaseIndex])/((double) sequence.length);
return ((double) baseCounts[mostFrequentBaseIndex]) / ((double) sequence.length);
}
// --------------------------------------------------------------------------------
@ -532,8 +562,8 @@ public class BaseUtils {
return BaseUtils.baseIndexToSimpleBase(getRandomBaseIndex(BaseUtils.simpleBaseToBaseIndex(excludeBase)));
}
/** Computes the smallest period >= minPeriod for the specified string. The period is defined as such p,
/**
* Computes the smallest period >= minPeriod for the specified string. The period is defined as such p,
* that for all i = 0... seq.length-1, seq[ i % p ] = seq[i] (or equivalently seq[i] = seq[i+p] for i=0...seq.length-1-p).
* The sequence does <i>not</i> have to contain whole number of periods. For instance, "ACACACAC" has a period
* of 2 (it has a period of 4 as well), and so does
@ -545,18 +575,16 @@ public class BaseUtils {
* @return
*/
public static int sequencePeriod(byte[] seq, int minPeriod) {
int period = ( minPeriod > seq.length ? seq.length : minPeriod );
int period = (minPeriod > seq.length ? seq.length : minPeriod);
// we assume that bases [0,period-1] repeat themselves and check this assumption
// until we find correct period
for ( int pos = period ; pos < seq.length ; pos++ ) {
for (int pos = period; pos < seq.length; pos++) {
int offset = pos % period; // we are currenlty 'offset' bases into the putative repeat of period 'period'
// if our current hypothesis holds, base[pos] must be the same as base[offset]
if ( Character.toUpperCase( seq[pos] ) !=
Character.toUpperCase( seq[offset] )
) {
if (Character.toUpperCase(seq[pos]) != Character.toUpperCase(seq[offset])) {
// period we have been trying so far does not work.
// two possibilities:
@ -569,8 +597,10 @@ public class BaseUtils {
// we set period to pos (thus trying the hypothesis that bases from start up to the current one,
// non-inclusive are repeated hereafter), and decrement pos (this will re-test current base against the first base
// on the next loop re-entrance after pos is autoincremented)
if ( offset == 0 ) period = pos+1;
else period = pos-- ;
if (offset == 0)
period = pos + 1;
else
period = pos--;
}
}

View File

@ -436,7 +436,7 @@ public class GenomeLoc implements Comparable<GenomeLoc>, Serializable, HasGenome
* never be < 1.
*/
@Ensures("result > 0")
public long size() {
public int size() {
return stop - start + 1;
}

View File

@ -49,7 +49,6 @@ public class MathUtils {
* high precision
*/
/**
* Private constructor. No instantiating this class!
*/
@ -60,7 +59,7 @@ public class MathUtils {
// under/overflow checking, so this shouldn't be used in the general case (but is fine
// if one is already make those checks before calling in to the rounding).
public static int fastRound(double d) {
return (d > 0) ? (int)(d + 0.5d) : (int)(d - 0.5d);
return (d > 0) ? (int) (d + 0.5d) : (int) (d - 0.5d);
}
public static double approximateLog10SumLog10(final double[] vals) {
@ -71,15 +70,15 @@ public class MathUtils {
final int maxElementIndex = MathUtils.maxElementIndex(vals, endIndex);
double approxSum = vals[maxElementIndex];
if ( approxSum == Double.NEGATIVE_INFINITY )
if (approxSum == Double.NEGATIVE_INFINITY)
return approxSum;
for ( int i = 0; i < endIndex; i++ ) {
if ( i == maxElementIndex || vals[i] == Double.NEGATIVE_INFINITY )
for (int i = 0; i < endIndex; i++) {
if (i == maxElementIndex || vals[i] == Double.NEGATIVE_INFINITY)
continue;
final double diff = approxSum - vals[i];
if ( diff < MathUtils.MAX_JACOBIAN_TOLERANCE ) {
if (diff < MathUtils.MAX_JACOBIAN_TOLERANCE) {
// See notes from the 2-inout implementation below
final int ind = fastRound(diff / MathUtils.JACOBIAN_LOG_TABLE_STEP); // hard rounding
approxSum += MathUtils.jacobianLogTable[ind];
@ -91,17 +90,17 @@ public class MathUtils {
public static double approximateLog10SumLog10(double small, double big) {
// make sure small is really the smaller value
if ( small > big ) {
if (small > big) {
final double t = big;
big = small;
small = t;
}
if ( small == Double.NEGATIVE_INFINITY || big == Double.NEGATIVE_INFINITY )
if (small == Double.NEGATIVE_INFINITY || big == Double.NEGATIVE_INFINITY)
return big;
final double diff = big - small;
if ( diff >= MathUtils.MAX_JACOBIAN_TOLERANCE )
if (diff >= MathUtils.MAX_JACOBIAN_TOLERANCE)
return big;
// OK, so |y-x| < tol: we use the following identity then:
@ -138,10 +137,15 @@ public class MathUtils {
return size;
}
public static double average(Collection<Integer> x) {
return (double) sum(x) / x.size();
}
public static double average(Collection<Number> numbers, boolean ignoreNan) {
if (ignoreNan) {
return sum(numbers, true) / nonNanSize(numbers);
} else {
}
else {
return sum(numbers, false) / nonNanSize(numbers);
}
}
@ -172,10 +176,17 @@ public class MathUtils {
public static double sum(double[] values) {
double s = 0.0;
for (double v : values) s += v;
for (double v : values)
s += v;
return s;
}
public static long sum(int[] x) {
long total = 0;
for (int v : x)
total += v;
return total;
}
/**
* Calculates the log10 cumulative sum of an array with log10 probabilities
@ -218,21 +229,23 @@ public class MathUtils {
public static double sumDoubles(List<Double> values) {
double s = 0.0;
for (double v : values) s += v;
for (double v : values)
s += v;
return s;
}
public static int sumIntegers(List<Integer> values) {
int s = 0;
for (int v : values) s += v;
for (int v : values)
s += v;
return s;
}
public static double sumLog10(double[] log10values) {
return Math.pow(10.0, log10sumLog10(log10values));
// double s = 0.0;
// for ( double v : log10values) s += Math.pow(10.0, v);
// return s;
// double s = 0.0;
// for ( double v : log10values) s += Math.pow(10.0, v);
// return s;
}
public static double log10sumLog10(double[] log10values) {
@ -445,7 +458,6 @@ public class MathUtils {
return Math.sqrt(rms);
}
/**
* calculate the Root Mean Square of an array of integers
*
@ -506,7 +518,6 @@ public class MathUtils {
return result;
}
/**
* normalizes the log10-based array. ASSUMES THAT ALL ARRAY ENTRIES ARE <= 0 (<= 1 IN REAL-SPACE).
*
@ -543,7 +554,8 @@ public class MathUtils {
sum += normalized[i];
for (int i = 0; i < array.length; i++) {
double x = normalized[i] / sum;
if (takeLog10OfOutput) x = Math.log10(x);
if (takeLog10OfOutput)
x = Math.log10(x);
normalized[i] = x;
}
@ -565,7 +577,8 @@ public class MathUtils {
sum += normalized[i];
for (int i = 0; i < array.size(); i++) {
double x = normalized[i] / sum;
if (takeLog10OfOutput) x = Math.log10(x);
if (takeLog10OfOutput)
x = Math.log10(x);
normalized[i] = x;
}
@ -591,7 +604,8 @@ public class MathUtils {
}
public static int maxElementIndex(final double[] array, final int endIndex) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int maxI = -1;
for (int i = 0; i < endIndex; i++) {
@ -607,7 +621,8 @@ public class MathUtils {
}
public static int maxElementIndex(final int[] array, int endIndex) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int maxI = -1;
for (int i = 0; i < endIndex; i++) {
@ -635,7 +650,8 @@ public class MathUtils {
}
public static int minElementIndex(double[] array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int minI = -1;
for (int i = 0; i < array.length; i++) {
@ -647,7 +663,8 @@ public class MathUtils {
}
public static int minElementIndex(byte[] array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int minI = -1;
for (int i = 0; i < array.length; i++) {
@ -659,7 +676,8 @@ public class MathUtils {
}
public static int minElementIndex(int[] array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
int minI = -1;
for (int i = 0; i < array.length; i++) {
@ -671,20 +689,26 @@ public class MathUtils {
}
public static int arrayMaxInt(List<Integer> array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array.size() == 0) throw new IllegalArgumentException("Array size cannot be 0!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
if (array.size() == 0)
throw new IllegalArgumentException("Array size cannot be 0!");
int m = array.get(0);
for (int e : array) m = Math.max(m, e);
for (int e : array)
m = Math.max(m, e);
return m;
}
public static double arrayMaxDouble(List<Double> array) {
if (array == null) throw new IllegalArgumentException("Array cannot be null!");
if (array.size() == 0) throw new IllegalArgumentException("Array size cannot be 0!");
if (array == null)
throw new IllegalArgumentException("Array cannot be null!");
if (array.size() == 0)
throw new IllegalArgumentException("Array size cannot be 0!");
double m = array.get(0);
for (double e : array) m = Math.max(m, e);
for (double e : array)
m = Math.max(m, e);
return m;
}
@ -722,6 +746,13 @@ public class MathUtils {
return average(vals, vals.size());
}
public static double average(int[] x) {
int sum = 0;
for (int v : x)
sum += v;
return (double) sum / x.length;
}
public static byte average(byte[] vals) {
int sum = 0;
for (byte v : vals) {
@ -798,7 +829,6 @@ public class MathUtils {
return permutation;
}
public static int[] permuteArray(int[] array, Integer[] permutation) {
int[] output = new int[array.length];
for (int i = 0; i < output.length; i++) {
@ -839,7 +869,6 @@ public class MathUtils {
return output;
}
/**
* Draw N random elements from list.
*/
@ -905,7 +934,8 @@ public class MathUtils {
public static <T> int countOccurrences(T x, List<T> l) {
int count = 0;
for (T y : l) {
if (x.equals(y)) count++;
if (x.equals(y))
count++;
}
return count;
@ -1013,9 +1043,11 @@ public class MathUtils {
for (Comparable y : list) {
if (x.compareTo(y) > 0) {
lessThanX.add(y);
} else if (x.compareTo(y) < 0) {
}
else if (x.compareTo(y) < 0) {
greaterThanX.add(y);
} else
}
else
equalToX.add(y);
}
@ -1028,7 +1060,6 @@ public class MathUtils {
}
public static Object getMedian(List<Comparable> list) {
return orderStatisticSearch((int) Math.ceil(list.size() / 2), list);
}
@ -1058,10 +1089,12 @@ public class MathUtils {
if (quality < qk) {
lessThanQReads.add(read);
lessThanQOffsets.add(offset);
} else if (quality > qk) {
}
else if (quality > qk) {
greaterThanQReads.add(read);
greaterThanQOffsets.add(offset);
} else {
}
else {
equalToQReads.add(reads.get(iter));
}
}
@ -1079,6 +1112,13 @@ public class MathUtils {
return getQScoreOrderStatistic(reads, offsets, (int) Math.floor(reads.size() / 2.));
}
public static long sum(Collection<Integer> x) {
long sum = 0;
for (int v : x)
sum += v;
return sum;
}
/**
* A utility class that computes on the fly average and standard deviation for a stream of numbers.
* The number of observations does not have to be known in advance, and can be also very big (so that
@ -1184,8 +1224,7 @@ public class MathUtils {
log10Cache[k] = Math.log10(k);
for (int k = 0; k < JACOBIAN_LOG_TABLE_SIZE; k++) {
jacobianLogTable[k] = Math.log10(1.0 + Math.pow(10.0, -((double) k)
* JACOBIAN_LOG_TABLE_STEP));
jacobianLogTable[k] = Math.log10(1.0 + Math.pow(10.0, -((double) k) * JACOBIAN_LOG_TABLE_STEP));
}
}
@ -1232,7 +1271,8 @@ public class MathUtils {
else if (diff >= 0) {
int ind = (int) (diff * INV_JACOBIAN_LOG_TABLE_STEP + 0.5);
return x + jacobianLogTable[ind];
} else {
}
else {
int ind = (int) (-diff * INV_JACOBIAN_LOG_TABLE_STEP + 0.5);
return y + jacobianLogTable[ind];
}
@ -1273,71 +1313,7 @@ public class MathUtils {
/**
* Constants to simplify the log gamma function calculation.
*/
private static final double
zero = 0.0,
one = 1.0,
half = .5,
a0 = 7.72156649015328655494e-02,
a1 = 3.22467033424113591611e-01,
a2 = 6.73523010531292681824e-02,
a3 = 2.05808084325167332806e-02,
a4 = 7.38555086081402883957e-03,
a5 = 2.89051383673415629091e-03,
a6 = 1.19270763183362067845e-03,
a7 = 5.10069792153511336608e-04,
a8 = 2.20862790713908385557e-04,
a9 = 1.08011567247583939954e-04,
a10 = 2.52144565451257326939e-05,
a11 = 4.48640949618915160150e-05,
tc = 1.46163214496836224576e+00,
tf = -1.21486290535849611461e-01,
tt = -3.63867699703950536541e-18,
t0 = 4.83836122723810047042e-01,
t1 = -1.47587722994593911752e-01,
t2 = 6.46249402391333854778e-02,
t3 = -3.27885410759859649565e-02,
t4 = 1.79706750811820387126e-02,
t5 = -1.03142241298341437450e-02,
t6 = 6.10053870246291332635e-03,
t7 = -3.68452016781138256760e-03,
t8 = 2.25964780900612472250e-03,
t9 = -1.40346469989232843813e-03,
t10 = 8.81081882437654011382e-04,
t11 = -5.38595305356740546715e-04,
t12 = 3.15632070903625950361e-04,
t13 = -3.12754168375120860518e-04,
t14 = 3.35529192635519073543e-04,
u0 = -7.72156649015328655494e-02,
u1 = 6.32827064025093366517e-01,
u2 = 1.45492250137234768737e+00,
u3 = 9.77717527963372745603e-01,
u4 = 2.28963728064692451092e-01,
u5 = 1.33810918536787660377e-02,
v1 = 2.45597793713041134822e+00,
v2 = 2.12848976379893395361e+00,
v3 = 7.69285150456672783825e-01,
v4 = 1.04222645593369134254e-01,
v5 = 3.21709242282423911810e-03,
s0 = -7.72156649015328655494e-02,
s1 = 2.14982415960608852501e-01,
s2 = 3.25778796408930981787e-01,
s3 = 1.46350472652464452805e-01,
s4 = 2.66422703033638609560e-02,
s5 = 1.84028451407337715652e-03,
s6 = 3.19475326584100867617e-05,
r1 = 1.39200533467621045958e+00,
r2 = 7.21935547567138069525e-01,
r3 = 1.71933865632803078993e-01,
r4 = 1.86459191715652901344e-02,
r5 = 7.77942496381893596434e-04,
r6 = 7.32668430744625636189e-06,
w0 = 4.18938533204672725052e-01,
w1 = 8.33333333333329678849e-02,
w2 = -2.77777777728775536470e-03,
w3 = 7.93650558643019558500e-04,
w4 = -5.95187557450339963135e-04,
w5 = 8.36339918996282139126e-04,
w6 = -1.63092934096575273989e-03;
private static final double zero = 0.0, one = 1.0, half = .5, a0 = 7.72156649015328655494e-02, a1 = 3.22467033424113591611e-01, a2 = 6.73523010531292681824e-02, a3 = 2.05808084325167332806e-02, a4 = 7.38555086081402883957e-03, a5 = 2.89051383673415629091e-03, a6 = 1.19270763183362067845e-03, a7 = 5.10069792153511336608e-04, a8 = 2.20862790713908385557e-04, a9 = 1.08011567247583939954e-04, a10 = 2.52144565451257326939e-05, a11 = 4.48640949618915160150e-05, tc = 1.46163214496836224576e+00, tf = -1.21486290535849611461e-01, tt = -3.63867699703950536541e-18, t0 = 4.83836122723810047042e-01, t1 = -1.47587722994593911752e-01, t2 = 6.46249402391333854778e-02, t3 = -3.27885410759859649565e-02, t4 = 1.79706750811820387126e-02, t5 = -1.03142241298341437450e-02, t6 = 6.10053870246291332635e-03, t7 = -3.68452016781138256760e-03, t8 = 2.25964780900612472250e-03, t9 = -1.40346469989232843813e-03, t10 = 8.81081882437654011382e-04, t11 = -5.38595305356740546715e-04, t12 = 3.15632070903625950361e-04, t13 = -3.12754168375120860518e-04, t14 = 3.35529192635519073543e-04, u0 = -7.72156649015328655494e-02, u1 = 6.32827064025093366517e-01, u2 = 1.45492250137234768737e+00, u3 = 9.77717527963372745603e-01, u4 = 2.28963728064692451092e-01, u5 = 1.33810918536787660377e-02, v1 = 2.45597793713041134822e+00, v2 = 2.12848976379893395361e+00, v3 = 7.69285150456672783825e-01, v4 = 1.04222645593369134254e-01, v5 = 3.21709242282423911810e-03, s0 = -7.72156649015328655494e-02, s1 = 2.14982415960608852501e-01, s2 = 3.25778796408930981787e-01, s3 = 1.46350472652464452805e-01, s4 = 2.66422703033638609560e-02, s5 = 1.84028451407337715652e-03, s6 = 3.19475326584100867617e-05, r1 = 1.39200533467621045958e+00, r2 = 7.21935547567138069525e-01, r3 = 1.71933865632803078993e-01, r4 = 1.86459191715652901344e-02, r5 = 7.77942496381893596434e-04, r6 = 7.32668430744625636189e-06, w0 = 4.18938533204672725052e-01, w1 = 8.33333333333329678849e-02, w2 = -2.77777777728775536470e-03, w3 = 7.93650558643019558500e-04, w4 = -5.95187557450339963135e-04, w5 = 8.36339918996282139126e-04, w6 = -1.63092934096575273989e-03;
/**
* Efficient rounding functions to simplify the log gamma function calculation
@ -1368,14 +1344,17 @@ public class MathUtils {
/* purge off +-inf, NaN, +-0, and negative arguments */
int ix = hx & 0x7fffffff;
if (ix >= 0x7ff00000) return Double.POSITIVE_INFINITY;
if ((ix | lx) == 0 || hx < 0) return Double.NaN;
if (ix >= 0x7ff00000)
return Double.POSITIVE_INFINITY;
if ((ix | lx) == 0 || hx < 0)
return Double.NaN;
if (ix < 0x3b900000) { /* |x|<2**-70, return -log(|x|) */
return -Math.log(x);
}
/* purge off 1 and 2 */
if ((((ix - 0x3ff00000) | lx) == 0) || (((ix - 0x40000000) | lx) == 0)) r = 0;
if ((((ix - 0x3ff00000) | lx) == 0) || (((ix - 0x40000000) | lx) == 0))
r = 0;
/* for x < 2.0 */
else if (ix < 0x40000000) {
if (ix <= 0x3feccccc) { /* lgamma(x) = lgamma(x+1)-log(x) */
@ -1383,22 +1362,27 @@ public class MathUtils {
if (ix >= 0x3FE76944) {
y = one - x;
i = 0;
} else if (ix >= 0x3FCDA661) {
}
else if (ix >= 0x3FCDA661) {
y = x - (tc - one);
i = 1;
} else {
}
else {
y = x;
i = 2;
}
} else {
}
else {
r = zero;
if (ix >= 0x3FFBB4C3) {
y = 2.0 - x;
i = 0;
} /* [1.7316,2] */ else if (ix >= 0x3FF3B4C4) {
} /* [1.7316,2] */
else if (ix >= 0x3FF3B4C4) {
y = x - tc;
i = 1;
} /* [1.23,1.73] */ else {
} /* [1.23,1.73] */
else {
y = x - one;
i = 2;
}
@ -1426,7 +1410,8 @@ public class MathUtils {
p2 = one + y * (v1 + y * (v2 + y * (v3 + y * (v4 + y * v5))));
r += (-0.5 * y + p1 / p2);
}
} else if (ix < 0x40200000) { /* x < 8.0 */
}
else if (ix < 0x40200000) { /* x < 8.0 */
i = (int) x;
t = zero;
y = x - (double) i;
@ -1449,13 +1434,15 @@ public class MathUtils {
break;
}
/* 8.0 <= x < 2**58 */
} else if (ix < 0x43900000) {
}
else if (ix < 0x43900000) {
t = Math.log(x);
z = one / x;
y = z * z;
w = w0 + z * (w1 + y * (w2 + y * (w3 + y * (w4 + y * (w5 + y * w6)))));
r = (x - half) * (t - one) + w;
} else
}
else
/* 2**58 <= x <= inf */
r = x * (Math.log(x) - one);
return r;
@ -1490,7 +1477,6 @@ public class MathUtils {
return log10BinomialCoefficient(n, k) + log10p * k + log10OneMinusP * (n - k);
}
/**
* Calculates the log10 of the multinomial coefficient. Designed to prevent
* overflows even with very large numbers.
@ -1534,7 +1520,6 @@ public class MathUtils {
return log10Gamma(x + 1);
}
/**
* Adds two arrays together and returns a new array with the sum.
*
@ -1572,6 +1557,7 @@ public class MathUtils {
/**
* Vector operations
*
* @param v1 first numerical array
* @param v2 second numerical array
* @return a new array with the elements added
@ -1581,8 +1567,8 @@ public class MathUtils {
throw new UserException("BUG: vectors v1, v2 of different size in vectorSum()");
Double[] result = new Double[v1.length];
for (int k=0; k < v1.length; k++)
result[k] = v1[k].doubleValue()+v2[k].doubleValue();
for (int k = 0; k < v1.length; k++)
result[k] = v1[k].doubleValue() + v2[k].doubleValue();
return result;
}
@ -1590,8 +1576,8 @@ public class MathUtils {
public static <E extends Number> Double[] scalarTimesVector(E a, E[] v1) {
Double result[] = new Double[v1.length];
for (int k=0; k < v1.length; k++)
result[k] = a.doubleValue()*v1[k].doubleValue();
for (int k = 0; k < v1.length; k++)
result[k] = a.doubleValue() * v1[k].doubleValue();
return result;
}
@ -1601,8 +1587,8 @@ public class MathUtils {
throw new UserException("BUG: vectors v1, v2 of different size in vectorSum()");
Double result = 0.0;
for (int k=0; k < v1.length; k++)
result += v1[k].doubleValue() *v2[k].doubleValue();
for (int k = 0; k < v1.length; k++)
result += v1[k].doubleValue() * v2[k].doubleValue();
return result;
@ -1610,7 +1596,7 @@ public class MathUtils {
public static double[] vectorLog10(double v1[]) {
double result[] = new double[v1.length];
for (int k=0; k < v1.length; k++)
for (int k = 0; k < v1.length; k++)
result[k] = Math.log10(v1[k]);
return result;
@ -1620,7 +1606,7 @@ public class MathUtils {
// todo - silly overloading, just because Java can't unbox/box arrays of primitive types, and we can't do generics with primitive types!
public static Double[] vectorLog10(Double v1[]) {
Double result[] = new Double[v1.length];
for (int k=0; k < v1.length; k++)
for (int k = 0; k < v1.length; k++)
result[k] = Math.log10(v1[k]);
return result;

View File

@ -55,6 +55,14 @@ public class QualityUtils {
return qualToErrorProbCache[(int)qual & 0xff]; // Map: 127 -> 127; -128 -> 128; -1 -> 255; etc.
}
static public double[] qualArrayToLog10ErrorProb(byte[] quals) {
double[] returnArray = new double[quals.length];
for( int iii = 0; iii < quals.length; iii++ ) {
returnArray[iii] = ((double) quals[iii])/-10.0;
}
return returnArray;
}
/**
* Convert a probability to a quality score. Note, this is capped at Q40.
*

View File

@ -673,7 +673,7 @@ public class BAQ {
}
/**
* Returns true if we don't think this read is eligable for the BAQ calculation. Examples include non-PF reads,
* Returns true if we don't think this read is eligible for the BAQ calculation. Examples include non-PF reads,
* duplicates, or unmapped reads. Used by baqRead to determine if a read should fall through the calculation.
*
* @param read

View File

@ -314,10 +314,10 @@ public class IntervalUtils {
* @param reference The reference for the intervals.
* @return A map of contig names with their sizes.
*/
public static Map<String, Long> getContigSizes(File reference) {
public static Map<String, Integer> getContigSizes(File reference) {
ReferenceDataSource referenceSource = new ReferenceDataSource(reference);
List<GenomeLoc> locs = GenomeLocSortedSet.createSetFromSequenceDictionary(referenceSource.getReference().getSequenceDictionary()).toList();
Map<String, Long> lengths = new LinkedHashMap<String, Long>();
Map<String, Integer> lengths = new LinkedHashMap<String, Integer>();
for (GenomeLoc loc: locs)
lengths.put(loc.getContig(), loc.size());
return lengths;

View File

@ -27,7 +27,6 @@ public class PileupElement implements Comparable<PileupElement> {
protected final boolean isBeforeInsertion;
protected final boolean isNextToSoftClip;
/**
* Creates a new pileup element.
*
@ -90,6 +89,14 @@ public class PileupElement implements Comparable<PileupElement> {
return getQual(offset);
}
public byte getBaseInsertionQual() {
return getBaseInsertionQual(offset);
}
public byte getBaseDeletionQual() {
return getBaseDeletionQual(offset);
}
public int getMappingQual() {
return read.getMappingQuality();
}
@ -111,6 +118,14 @@ public class PileupElement implements Comparable<PileupElement> {
return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseQualities()[offset];
}
protected byte getBaseInsertionQual(final int offset) {
return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseInsertionQualities()[offset];
}
protected byte getBaseDeletionQual(final int offset) {
return (isDeletion() || isInsertionAtBeginningOfRead()) ? DELETION_QUAL : read.getBaseDeletionQualities()[offset];
}
@Override
public int compareTo(final PileupElement pileupElement) {
if (offset < pileupElement.offset)

View File

@ -0,0 +1,295 @@
/*
* Copyright (c) 2012 The Broad Institute
*
* Permission is hereby granted, free of charge, to any person
* obtaining a copy of this software and associated documentation
* files (the "Software"), to deal in the Software without
* restriction, including without limitation the rights to use,
* copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the
* Software is furnished to do so, subject to the following
* conditions:
*
* The above copyright notice and this permission notice shall be
* included in all copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR
* THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
package org.broadinstitute.sting.utils.recalibration;
import org.broadinstitute.sting.gatk.walkers.recalibration.Covariate;
import org.broadinstitute.sting.gatk.walkers.recalibration.RecalDataManager;
import org.broadinstitute.sting.gatk.walkers.recalibration.RecalDatum;
import org.broadinstitute.sting.gatk.walkers.recalibration.RecalibrationArgumentCollection;
import org.broadinstitute.sting.utils.QualityUtils;
import org.broadinstitute.sting.utils.classloader.PluginManager;
import org.broadinstitute.sting.utils.collections.NestedHashMap;
import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.sam.GATKSAMRecord;
import org.broadinstitute.sting.utils.text.XReadLines;
import java.io.File;
import java.io.FileNotFoundException;
import java.util.ArrayList;
import java.util.List;
import java.util.regex.Pattern;
/**
* Utility methods to facilitate on-the-fly base quality score recalibration.
*
* User: rpoplin
* Date: 2/4/12
*/
public class BaseRecalibration {
public enum BaseRecalibrationType {
BASE_SUBSTITUTION,
BASE_INSERTION,
BASE_DELETION
}
private RecalDataManager dataManager; // Holds the data HashMap, mostly used by TableRecalibrationWalker to create collapsed data hashmaps
private final ArrayList<Covariate> requestedCovariates = new ArrayList<Covariate>(); // List of covariates to be used in this calculation
public static final Pattern COMMENT_PATTERN = Pattern.compile("^#.*");
public static final Pattern COVARIATE_PATTERN = Pattern.compile("^ReadGroup,QualityScore,.*");
public static final String EOF_MARKER = "EOF";
private static final int MAX_QUALITY_SCORE = 65; //BUGBUG: what value to use here?
private NestedHashMap qualityScoreByFullCovariateKey = new NestedHashMap(); // Caches the result of performSequentialQualityCalculation(..) for all sets of covariate values.
public BaseRecalibration( final File RECAL_FILE ) {
// Get a list of all available covariates
final List<Class<? extends Covariate>> classes = new PluginManager<Covariate>(Covariate.class).getPlugins();
int lineNumber = 0;
boolean foundAllCovariates = false;
// Read in the data from the csv file and populate the data map and covariates list
boolean sawEOF = false;
try {
for ( String line : new XReadLines(RECAL_FILE) ) {
lineNumber++;
if ( EOF_MARKER.equals(line) ) {
sawEOF = true;
} else if( COMMENT_PATTERN.matcher(line).matches() ) {
; // Skip over the comment lines, (which start with '#')
}
// Read in the covariates that were used from the input file
else if( COVARIATE_PATTERN.matcher(line).matches() ) { // The line string is either specifying a covariate or is giving csv data
if( foundAllCovariates ) {
throw new UserException.MalformedFile( RECAL_FILE, "Malformed input recalibration file. Found covariate names intermingled with data in file: " + RECAL_FILE );
} else { // Found the covariate list in input file, loop through all of them and instantiate them
String[] vals = line.split(",");
for( int iii = 0; iii < vals.length - 3; iii++ ) { // There are n-3 covariates. The last three items are nObservations, nMismatch, and Qempirical
boolean foundClass = false;
for( Class<?> covClass : classes ) {
if( (vals[iii] + "Covariate").equalsIgnoreCase( covClass.getSimpleName() ) ) {
foundClass = true;
try {
Covariate covariate = (Covariate)covClass.newInstance();
requestedCovariates.add( covariate );
} catch (Exception e) {
throw new DynamicClassResolutionException(covClass, e);
}
}
}
if( !foundClass ) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration file. The requested covariate type (" + (vals[iii] + "Covariate") + ") isn't a valid covariate option." );
}
}
}
} else { // Found a line of data
if( !foundAllCovariates ) {
foundAllCovariates = true;
// At this point all the covariates should have been found and initialized
if( requestedCovariates.size() < 2 ) {
throw new UserException.MalformedFile(RECAL_FILE, "Malformed input recalibration csv file. Covariate names can't be found in file: " + RECAL_FILE );
}
final boolean createCollapsedTables = true;
// Initialize any covariate member variables using the shared argument collection
RecalibrationArgumentCollection RAC = new RecalibrationArgumentCollection();
for( Covariate cov : requestedCovariates ) {
cov.initialize( RAC );
}
// Initialize the data hashMaps
dataManager = new RecalDataManager( createCollapsedTables, requestedCovariates.size() );
}
addCSVData(RECAL_FILE, line); // Parse the line and add the data to the HashMap
}
}
} catch ( FileNotFoundException e ) {
throw new UserException.CouldNotReadInputFile(RECAL_FILE, "Can not find input file", e);
} catch ( NumberFormatException e ) {
throw new UserException.MalformedFile(RECAL_FILE, "Error parsing recalibration data at line " + lineNumber + ". Perhaps your table was generated by an older version of CovariateCounterWalker.");
}
if ( !sawEOF ) {
final String errorMessage = "No EOF marker was present in the recal covariates table; this could mean that the file is corrupted or was generated with an old version of the CountCovariates tool.";
throw new UserException.MalformedFile(RECAL_FILE, errorMessage);
}
if( dataManager == null ) {
throw new UserException.MalformedFile(RECAL_FILE, "Can't initialize the data manager. Perhaps the recal csv file contains no data?");
}
dataManager.generateEmpiricalQualities( 1, MAX_QUALITY_SCORE );
}
/**
* For each covariate read in a value and parse it. Associate those values with the data itself (num observation and num mismatches)
* @param line A line of CSV data read from the recalibration table data file
*/
private void addCSVData(final File file, final String line) {
final String[] vals = line.split(",");
// Check if the data line is malformed, for example if the read group string contains a comma then it won't be parsed correctly
if( vals.length != requestedCovariates.size() + 3 ) { // +3 because of nObservations, nMismatch, and Qempirical
throw new UserException.MalformedFile(file, "Malformed input recalibration file. Found data line with too many fields: " + line +
" --Perhaps the read group string contains a comma and isn't being parsed correctly.");
}
final Object[] key = new Object[requestedCovariates.size()];
Covariate cov;
int iii;
for( iii = 0; iii < requestedCovariates.size(); iii++ ) {
cov = requestedCovariates.get( iii );
key[iii] = cov.getValue( vals[iii] );
}
// Create a new datum using the number of observations, number of mismatches, and reported quality score
final RecalDatum datum = new RecalDatum( Long.parseLong( vals[iii] ), Long.parseLong( vals[iii + 1] ), Double.parseDouble( vals[1] ), 0.0 );
// Add that datum to all the collapsed tables which will be used in the sequential calculation
dataManager.addToAllTables( key, datum, QualityUtils.MIN_USABLE_Q_SCORE ); //BUGBUG: used to be Q5 now is Q6, probably doesn't matter
}
public byte[] recalibrateRead( final GATKSAMRecord read, final byte[] originalQuals, final BaseRecalibrationType modelType ) {
final byte[] recalQuals = originalQuals.clone();
//compute all covariate values for this read
final Comparable[][] covariateValues_offset_x_covar =
RecalDataManager.computeCovariates(read, requestedCovariates, modelType);
// For each base in the read
for( int offset = 0; offset < read.getReadLength(); offset++ ) {
final Object[] fullCovariateKey = covariateValues_offset_x_covar[offset];
Byte qualityScore = (Byte) qualityScoreByFullCovariateKey.get(fullCovariateKey);
if(qualityScore == null)
{
qualityScore = performSequentialQualityCalculation( fullCovariateKey );
qualityScoreByFullCovariateKey.put(qualityScore, fullCovariateKey);
}
recalQuals[offset] = qualityScore;
}
preserveQScores( originalQuals, recalQuals ); // Overwrite the work done if original quality score is too low
return recalQuals;
}
/**
* Implements a serial recalibration of the reads using the combinational table.
* First, we perform a positional recalibration, and then a subsequent dinuc correction.
*
* Given the full recalibration table, we perform the following preprocessing steps:
*
* - calculate the global quality score shift across all data [DeltaQ]
* - calculate for each of cycle and dinuc the shift of the quality scores relative to the global shift
* -- i.e., DeltaQ(dinuc) = Sum(pos) Sum(Qual) Qempirical(pos, qual, dinuc) - Qreported(pos, qual, dinuc) / Npos * Nqual
* - The final shift equation is:
*
* Qrecal = Qreported + DeltaQ + DeltaQ(pos) + DeltaQ(dinuc) + DeltaQ( ... any other covariate ... )
* @param key The list of Comparables that were calculated from the covariates
* @return A recalibrated quality score as a byte
*/
private byte performSequentialQualityCalculation( final Object... key ) {
final byte qualFromRead = (byte)Integer.parseInt(key[1].toString());
final Object[] readGroupCollapsedKey = new Object[1];
final Object[] qualityScoreCollapsedKey = new Object[2];
final Object[] covariateCollapsedKey = new Object[3];
// The global quality shift (over the read group only)
readGroupCollapsedKey[0] = key[0];
final RecalDatum globalRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(0).get( readGroupCollapsedKey ));
double globalDeltaQ = 0.0;
if( globalRecalDatum != null ) {
final double globalDeltaQEmpirical = globalRecalDatum.getEmpiricalQuality();
final double aggregrateQReported = globalRecalDatum.getEstimatedQReported();
globalDeltaQ = globalDeltaQEmpirical - aggregrateQReported;
}
// The shift in quality between reported and empirical
qualityScoreCollapsedKey[0] = key[0];
qualityScoreCollapsedKey[1] = key[1];
final RecalDatum qReportedRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(1).get( qualityScoreCollapsedKey ));
double deltaQReported = 0.0;
if( qReportedRecalDatum != null ) {
final double deltaQReportedEmpirical = qReportedRecalDatum.getEmpiricalQuality();
deltaQReported = deltaQReportedEmpirical - qualFromRead - globalDeltaQ;
}
// The shift in quality due to each covariate by itself in turn
double deltaQCovariates = 0.0;
double deltaQCovariateEmpirical;
covariateCollapsedKey[0] = key[0];
covariateCollapsedKey[1] = key[1];
for( int iii = 2; iii < key.length; iii++ ) {
covariateCollapsedKey[2] = key[iii]; // The given covariate
final RecalDatum covariateRecalDatum = ((RecalDatum)dataManager.getCollapsedTable(iii).get( covariateCollapsedKey ));
if( covariateRecalDatum != null ) {
deltaQCovariateEmpirical = covariateRecalDatum.getEmpiricalQuality();
deltaQCovariates += ( deltaQCovariateEmpirical - qualFromRead - (globalDeltaQ + deltaQReported) );
}
}
final double newQuality = qualFromRead + globalDeltaQ + deltaQReported + deltaQCovariates;
return QualityUtils.boundQual( (int)Math.round(newQuality), (byte)MAX_QUALITY_SCORE );
// Verbose printouts used to validate with old recalibrator
//if(key.contains(null)) {
// System.out.println( key + String.format(" => %d + %.2f + %.2f + %.2f + %.2f = %d",
// qualFromRead, globalDeltaQ, deltaQReported, deltaQPos, deltaQDinuc, newQualityByte));
//}
//else {
// System.out.println( String.format("%s %s %s %s => %d + %.2f + %.2f + %.2f + %.2f = %d",
// key.get(0).toString(), key.get(3).toString(), key.get(2).toString(), key.get(1).toString(), qualFromRead, globalDeltaQ, deltaQReported, deltaQPos, deltaQDinuc, newQualityByte) );
//}
//return newQualityByte;
}
/**
* Loop over the list of qualities and overwrite the newly recalibrated score to be the original score if it was less than some threshold
* @param originalQuals The list of original base quality scores
* @param recalQuals A list of the new recalibrated quality scores
*/
private void preserveQScores( final byte[] originalQuals, final byte[] recalQuals ) {
for( int iii = 0; iii < recalQuals.length; iii++ ) {
if( originalQuals[iii] < QualityUtils.MIN_USABLE_Q_SCORE ) { //BUGBUG: used to be Q5 now is Q6, probably doesn't matter
recalQuals[iii] = originalQuals[iii];
}
}
}
}

View File

@ -25,8 +25,11 @@
package org.broadinstitute.sting.utils.sam;
import net.sf.samtools.*;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.utils.NGSPlatform;
import org.broadinstitute.sting.utils.recalibration.BaseRecalibration;
import java.util.Arrays;
import java.util.HashMap;
import java.util.Map;
@ -48,6 +51,11 @@ public class GATKSAMRecord extends BAMRecord {
public static final String REDUCED_READ_ORIGINAL_ALIGNMENT_START_SHIFT = "OP"; // reads that are clipped may use this attribute to keep track of their original alignment start
public static final String REDUCED_READ_ORIGINAL_ALIGNMENT_END_SHIFT = "OE"; // reads that are clipped may use this attribute to keep track of their original alignment end
// Base Quality Score Recalibrator specific attribute tags
public static final String BQSR_BASE_INSERTION_QUALITIES = "BI";
public static final String BQSR_BASE_DELETION_QUALITIES = "BD";
public static final String BQSR_BASES_HAVE_BEEN_RECALIBRATED_TAG = "BR";
// the SAMRecord data we're caching
private String mReadString = null;
private GATKSAMReadGroupRecord mReadGroup = null;
@ -155,6 +163,62 @@ public class GATKSAMRecord extends BAMRecord {
return super.equals(o);
}
@Override
public byte[] getBaseQualities() {
return super.getBaseQualities();
/*
if( getAttribute( BQSR_BASES_HAVE_BEEN_RECALIBRATED_TAG ) != null ) {
return super.getBaseQualities();
} else {
// if the recal data was populated in the engine then recalibrate the quality scores on the fly
if( GenomeAnalysisEngine.hasBaseRecalibration() ) {
final byte[] quals = GenomeAnalysisEngine.getBaseRecalibration().recalibrateRead( this, super.getBaseQualities() );
setBaseQualities(quals);
setAttribute( BQSR_BASES_HAVE_BEEN_RECALIBRATED_TAG, true );
return quals;
} else { // just use the qualities that are in the read since we don't have the sufficient information to recalibrate on the fly
return super.getBaseQualities();
}
}
*/
}
/**
* Accessors for base insertion and base deletion quality scores
*/
public byte[] getBaseInsertionQualities() {
byte[] quals = getByteArrayAttribute( BQSR_BASE_INSERTION_QUALITIES );
if( quals == null ) {
quals = new byte[getBaseQualities().length];
Arrays.fill(quals, (byte) 45); // allow for differing default values between BaseInsertions and BaseDeletions
// if the recal data was populated in the engine then recalibrate the quality scores on the fly
// else give default values which are flat Q45
if( GenomeAnalysisEngine.hasBaseRecalibration() ) {
quals = GenomeAnalysisEngine.getBaseRecalibration().recalibrateRead( this, quals, BaseRecalibration.BaseRecalibrationType.BASE_INSERTION ); // the original quals here are the flat base insertion/deletion quals, NOT the original base qualities
}
// add the qual array to the read so that we don't have to do the recalibration work again
setAttribute( BQSR_BASE_INSERTION_QUALITIES, quals );
}
return quals;
}
public byte[] getBaseDeletionQualities() {
byte[] quals = getByteArrayAttribute( BQSR_BASE_DELETION_QUALITIES );
if( quals == null ) {
quals = new byte[getBaseQualities().length];
Arrays.fill(quals, (byte) 45);
// if the recal data was populated in the engine then recalibrate the quality scores on the fly
// else give default values which are flat Q45
if( GenomeAnalysisEngine.hasBaseRecalibration() ) {
quals = GenomeAnalysisEngine.getBaseRecalibration().recalibrateRead( this, quals, BaseRecalibration.BaseRecalibrationType.BASE_DELETION ); // the original quals here are the flat base insertion/deletion quals, NOT the original base qualities
}
// add the qual array to the read so that we don't have to do the recalibration work again
setAttribute( BQSR_BASE_DELETION_QUALITIES, quals );
}
return quals;
}
/**
* Efficient caching accessor that returns the GATK NGSPlatform of this read
* @return

View File

@ -920,6 +920,9 @@ public class VariantContext implements Feature { // to enable tribble intergrati
}
public void validateReferenceBases(Allele reference, Byte paddedRefBase) {
if ( reference == null )
return;
// don't validate if we're a complex event
if ( !isComplexIndel() && !reference.isNull() && !reference.basesMatch(getReference()) ) {
throw new TribbleException.InternalCodecException(String.format("the REF allele is incorrect for the record at position %s:%d, fasta says %s vs. VCF says %s", getChr(), getStart(), reference.getBaseString(), getReference().getBaseString()));
@ -963,6 +966,9 @@ public class VariantContext implements Feature { // to enable tribble intergrati
}
public void validateChromosomeCounts() {
if ( !hasGenotypes() )
return;
// AN
if ( hasAttribute(VCFConstants.ALLELE_NUMBER_KEY) ) {
int reportedAN = Integer.valueOf(getAttribute(VCFConstants.ALLELE_NUMBER_KEY).toString());
@ -993,7 +999,7 @@ public class VariantContext implements Feature { // to enable tribble intergrati
throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag doesn't have the correct number of values for the record at position %s:%d, %d vs. %d", getChr(), getStart(), reportedACs.size(), observedACs.size()));
for (int i = 0; i < observedACs.size(); i++) {
if ( Integer.valueOf(reportedACs.get(i).toString()) != observedACs.get(i) )
throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag is incorrect for the record at position %s:%d, %d vs. %d", getChr(), getStart(), reportedACs.get(i), observedACs.get(i)));
throw new TribbleException.InternalCodecException(String.format("the Allele Count (AC) tag is incorrect for the record at position %s:%d, %s vs. %d", getChr(), getStart(), reportedACs.get(i), observedACs.get(i)));
}
} else {
if ( observedACs.size() != 1 )

View File

@ -30,7 +30,7 @@ import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
public class GATKReportUnitTest extends BaseTest {
@Test
@Test(enabled = false)
public void testParse() throws Exception {
String reportPath = validationDataLocation + "exampleGATKReport.eval";
GATKReport report = new GATKReport(reportPath);
@ -49,23 +49,23 @@ public class GATKReportUnitTest extends BaseTest {
@DataProvider(name = "rightAlignValues")
public Object[][] getRightAlignValues() {
return new Object[][] {
new Object[] {null, true},
new Object[] {"null", true},
new Object[] {"NA", true},
new Object[] {"0", true},
new Object[] {"0.0", true},
new Object[] {"-0", true},
new Object[] {"-0.0", true},
new Object[] {String.valueOf(Long.MAX_VALUE), true},
new Object[] {String.valueOf(Long.MIN_VALUE), true},
new Object[] {String.valueOf(Float.MIN_NORMAL), true},
new Object[] {String.valueOf(Double.MAX_VALUE), true},
new Object[] {String.valueOf(Double.MIN_VALUE), true},
new Object[] {String.valueOf(Double.POSITIVE_INFINITY), true},
new Object[] {String.valueOf(Double.NEGATIVE_INFINITY), true},
new Object[] {String.valueOf(Double.NaN), true},
new Object[] {"hello", false}
return new Object[][]{
new Object[]{null, true},
new Object[]{"null", true},
new Object[]{"NA", true},
new Object[]{"0", true},
new Object[]{"0.0", true},
new Object[]{"-0", true},
new Object[]{"-0.0", true},
new Object[]{String.valueOf(Long.MAX_VALUE), true},
new Object[]{String.valueOf(Long.MIN_VALUE), true},
new Object[]{String.valueOf(Float.MIN_NORMAL), true},
new Object[]{String.valueOf(Double.MAX_VALUE), true},
new Object[]{String.valueOf(Double.MIN_VALUE), true},
new Object[]{String.valueOf(Double.POSITIVE_INFINITY), true},
new Object[]{String.valueOf(Double.NEGATIVE_INFINITY), true},
new Object[]{String.valueOf(Double.NaN), true},
new Object[]{"hello", false}
};
}
@ -73,4 +73,96 @@ public class GATKReportUnitTest extends BaseTest {
public void testIsRightAlign(String value, boolean expected) {
Assert.assertEquals(GATKReportColumn.isRightAlign(value), expected, "right align of '" + value + "'");
}
@Test
public void testGATKReportGatherer() {
/*
GATKReportTable actual1 = new GATKReportTable("TableName", "Description");
actual1.addPrimaryKey("key");
actual1.addColumn("colA", 0);
actual1.addColumn("colB", 0);
actual1.set("row1", "colA", 1);
actual1.set("row1", "colB", 2);
GATKReportTable actual2 = new GATKReportTable("TableName", "Description");
actual2.addPrimaryKey("key");
actual2.addColumn("colA", 0);
actual2.addColumn("colB", 0);
actual2.set("row2", "colA", 3);
actual2.set("row2", "colB", 4);
GATKReportTable actual3 = new GATKReportTable("TableName", "Description");
actual3.addPrimaryKey("key");
actual3.addColumn("colA", 0);
actual3.addColumn("colB", 0);
actual3.set("row3", "colA", 5);
actual3.set("row3", "colB", 6);
actual1.mergeRows(actual2);
actual1.mergeRows(actual3);
actual1.write(System.out);
*/
GATKReportTable expected = new GATKReportTable("TableName", "Description");
expected.addPrimaryKey("key");
expected.addColumn("colA", 0);
expected.addColumn("colB", 0);
expected.set("row1", "colA", 1);
expected.set("row1", "colB", 2);
expected.set("row2", "colA", 3);
expected.set("row2", "colB", 4);
expected.set("row3", "colA", 5);
expected.set("row3", "colB", 6);
expected.write(System.out);
GATKReport report1, report2, report3;
report1 = new GATKReport();
report1.addTable("TableName", "Description");
report1.getTable("TableName").addPrimaryKey("key");
report1.getTable("TableName").addColumn("colA", 0);
report1.getTable("TableName").addColumn("colB", 0);
report1.getTable("TableName").set("row1", "colA", 1);
report1.getTable("TableName").set("row1", "colB", 2);
report2 = new GATKReport();
report2.addTable("TableName", "Description");
report2.getTable("TableName").addPrimaryKey("key");
report2.getTable("TableName").addColumn("colA", 0);
report2.getTable("TableName").addColumn("colB", 0);
report2.getTable("TableName").set("row2", "colA", 3);
report2.getTable("TableName").set("row2", "colB", 4);
report3 = new GATKReport();
report3.addTable("TableName", "Description");
report3.getTable("TableName").addPrimaryKey("key");
report3.getTable("TableName").addColumn("colA", 0);
report3.getTable("TableName").addColumn("colB", 0);
report3.getTable("TableName").set("row3", "colA", 5);
report3.getTable("TableName").set("row3", "colB", 6);
report1.combineWith(report2);
report1.combineWith(report3);
report1.print(System.out);
/*
File a = new File("/home/roger/tbls/a.tbl");
File b = new File("/home/roger/tbls/b.tbl");
File c = new File("/home/roger/tbls/c.tbl");
File out = new File("/home/roger/tbls/out.tbl");
List<File> FileList = new ArrayList<File>();
FileList.add(a);
FileList.add(b);
FileList.add(c);
GATKReportGatherer gatherer = new GATKReportGatherer();
gatherer.gather(FileList, out);
System.out.print(out);
*/
//Assert.assertEquals(1,1);
}
}

View File

@ -8,13 +8,12 @@ import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.commandline.IntervalBinding;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource;
import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.testng.Assert;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.GenomeLoc;
import org.broadinstitute.sting.utils.GenomeLocParser;
import org.broadinstitute.sting.utils.GenomeLocSortedSet;
import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile;
import org.testng.Assert;
import org.testng.annotations.BeforeClass;
import org.testng.annotations.DataProvider;
import org.testng.annotations.Test;
@ -341,7 +340,7 @@ public class IntervalUtilsUnitTest extends BaseTest {
@Test
public void testGetContigLengths() {
Map<String, Long> lengths = IntervalUtils.getContigSizes(new File(BaseTest.hg18Reference));
Map<String, Integer> lengths = IntervalUtils.getContigSizes(new File(BaseTest.hg18Reference));
Assert.assertEquals((long)lengths.get("chr1"), 247249719);
Assert.assertEquals((long)lengths.get("chr2"), 242951149);
Assert.assertEquals((long)lengths.get("chr3"), 199501827);

View File

@ -0,0 +1,88 @@
package org.broadinstitute.sting.queue.qscripts.lib
import org.broadinstitute.sting.queue.QScript
import org.broadinstitute.sting.queue.library.ipf.vcf.VCFExtractIntervals
import scala.collection.JavaConversions._
import org.broadinstitute.sting.utils.text.XReadLines
import java.io.PrintStream
import org.broadinstitute.sting.queue.extensions.gatk.SelectVariants
/**
* Created by IntelliJ IDEA.
* User: chartl
* Date: 2/2/12
* Time: 12:13 PM
* To change this template use File | Settings | File Templates.
*/
class ChunkVCF extends QScript {
@Input(shortName="V",fullName="VCF",doc="The VCF you want to chunk",required=true)
var inVCF : File = _
@Input(shortName="N",fullName="numEntriesInChunk",doc="The number of variants per chunk",required=true)
var numEntries : Int = _
@Input(shortName="I",fullName="Intervals",doc="The SNP interval list to chunk. If not provided, one will be created for you to provide in a second run.")
var intervals : File = _
@Input(fullName="preserveChromosomes",doc="Restrict chunks to one chromosome (smaller chunk at end of chromosome)",required=false)
var preserve : Boolean = false
@Input(fullName="reference",doc="The reference file",required=false)
var ref : File = new File("/humgen/1kg/reference/human_g1k_v37.fasta")
@Input(fullName="samples",doc="A file of sample IDs to condense VCF file to",required=false)
var extractSamples : File = _
val tmpdir : File = System.getProperty("java.io.tmpdir")
def script = {
if ( intervals == null ) {
// create an interval list from the VCF
val ivals : File = swapExt(variants,".vcf",".intervals.list")
val extract : VCFExtractIntervals = new VCFExtractIntervals(variants,ivals,false)
add(extract)
} else {
var chunkNum = 1
var numLinesInChunk = 0
var chromosome : String = asScalaIterator(new XReadLines(intervals)).next().split(":")(0)
var chunkFile : File = new File(tmpdir,"ChunkVCF.chunk%d.intervals.list".format(chunkNum))
var chunkWriter = new PrintStream(chunkFile)
asScalaIterator(new XReadLines(intervals)).foreach( int => {
// check new chromosome or full chunk
if ( ( preserve && ! int.split(":")(0).equals(chromosome) ) || numLinesInChunk > numEntries ) {
chunkWriter.close()
val chunkSelect : SelectVariants = new SelectVariants
chunkSelect.reference_sequence = ref
chunkSelect.memoryLimit = 2
chunkSelect.intervals :+= chunkFile
if ( extractSamples != null )
chunkSelect.sample_file = extractSamples
chunkSelect.out = swapExt(inVCF,".vcf",".chunk%d.vcf".format(chunkNum))
add(chunkSelect)
chunkNum += 1
numLinesInChunk = 0
chromosome = int.split(":")(0)
chunkFile = new File(tmpdir,"ChunkVCF.chunk%d.intervals.list".format(chunkNum))
chunkWriter = new PrintStream(chunkFile)
}
chunkWriter.printf("%s%n",int)
numLinesInChunk += 1
})
// last chunk
if ( numLinesInChunk > 0 ) {
// some work to do
val chunkSelect : SelectVariants = new SelectVariants
chunkSelect.reference_sequence = ref
chunkSelect.memoryLimit = 2
chunkSelect.intervals :+= chunkFile
chunkWriter.close()
if ( extractSamples != null )
chunkSelect.sample_file = extractSamples
chunkSelect.out = swapExt(inVCF,".vcf",".chunk%d.vcf".format(chunkNum))
add(chunkSelect)
}
}
}
}

View File

@ -6,7 +6,7 @@ import org.broadinstitute.sting.queue.library.ipf.vcf.VCFExtractIntervals
import org.broadinstitute.sting.utils.text.XReadLines
import collection.JavaConversions._
import java.io._
import org.broadinstitute.sting.queue.extensions.gatk.VariantsToPed
import org.broadinstitute.sting.queue.extensions.gatk.{SelectVariants, VariantsToPed}
/**
* Created by IntelliJ IDEA.
@ -31,11 +31,14 @@ class VcfToPed extends QScript {
var intervals : File = _
@Argument(shortName="R",fullName="Ref",required=false,doc="Reference file")
var ref : File = new File("/humgen/1kg/references/human_g1k_v37.fasta")
var ref : File = new File("/humgen/1kg/reference/human_g1k_v37.fasta")
@Argument(shortName="D",fullName="dbsnp",required=false,doc="dbsnp file")
var dbsnp : File = new File("/humgen/gsa-hpprojects/GATK/data/dbsnp_129_b37.vcf")
@Argument(shortName="sf",fullName="sampleFile",required=false,doc="sample file")
var samFile : File = _
val tmpdir : File = System.getProperty("java.io.tmpdir")
def script = {
@ -59,14 +62,27 @@ class VcfToPed extends QScript {
val toPed : VariantsToPed = new VariantsToPed
toPed.memoryLimit = 2
toPed.reference_sequence = ref
toPed.intervals :+= new File(subListFile)
toPed.intervals :+= subListFile
toPed.dbsnp = dbsnp
if ( samFile != null ) {
val base : String = bed.getName.stripSuffix(".bed")+"_%d".format(chunk)
val extract : SelectVariants = new SelectVariants
extract.reference_sequence = ref
extract.memoryLimit = 2
extract.intervals :+= subListFile
extract.variant = variants
extract.out = new File(tmpdir,base+"_extract%d.vcf".format(chunk))
extract.sample_file :+= samFile
add(extract)
toPed.variant = extract.out
} else {
toPed.variant = variants
}
toPed.metaData = meta
lazy val base : String = bed.getName.stripSuffix(".bed")+"_%".format(chunk)
lazy val tBed = new File(tmpdir,base+".bed")
lazy val bim = new File(tmpdir,base+".bim")
lazy val fam = new File(tmpdir,base+".fam")
val base : String = bed.getName.stripSuffix(".bed")+"_%d".format(chunk)
val tBed = new File(tmpdir,base+".bed")
val bim = new File(tmpdir,base+".bim")
val fam = new File(tmpdir,base+".fam")
toPed.bed = tBed
toPed.bim = bim
toPed.fam = fam
@ -87,12 +103,26 @@ class VcfToPed extends QScript {
toPed.reference_sequence = ref
toPed.intervals :+= new File(subListFile)
toPed.dbsnp = dbsnp
if ( samFile != null ) {
val base : String = bed.getName.stripSuffix(".bed")+"_%d".format(chunk)
val extract : SelectVariants = new SelectVariants
extract.reference_sequence = ref
extract.memoryLimit = 2
extract.intervals :+= subListFile
extract.variant = variants
extract.out = new File(tmpdir,base+"_extract%d.vcf".format(chunk))
extract.sample_file :+= samFile
add(extract)
toPed.variant = extract.out
} else {
toPed.variant = variants
}
toPed.metaData = meta
lazy val base : String = bed.getName.stripSuffix(".bed")+"_%".format(chunk)
lazy val tBed = new File(tmpdir,base+".bed")
lazy val bim = new File(tmpdir,base+".bim")
lazy val fam = new File(tmpdir,base+".fam")
toPed.memoryLimit = 2
val base : String = bed.getName.stripSuffix(".bed")+"_%d".format(chunk)
val tBed = new File(tmpdir,base+".bed")
val bim = new File(tmpdir,base+".bim")
val fam = new File(tmpdir,base+".fam")
toPed.bed = tBed
toPed.bim = bim
toPed.fam = fam

View File

@ -26,7 +26,7 @@ package org.broadinstitute.sting.queue.extensions.gatk
import java.io.File
import collection.JavaConversions._
import org.broadinstitute.sting.utils.interval.IntervalUtils
import org.broadinstitute.sting.utils.interval.{IntervalMergingRule, IntervalUtils}
import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource
import net.sf.samtools.SAMFileHeader
import java.util.Collections
@ -50,6 +50,8 @@ case class GATKIntervals(reference: File, intervals: Seq[String]) {
IntervalUtils.parseIntervalArguments(parser, intervals)
Collections.sort(parsedLocs)
Collections.unmodifiableList(parsedLocs)
val mergedLocs = IntervalUtils.mergeIntervalLocations(parsedLocs, IntervalMergingRule.OVERLAPPING_ONLY)
Collections.unmodifiableList(mergedLocs)
}
lazy val contigs = locs.map(_.getContig).distinct.toSeq

View File

@ -32,6 +32,7 @@ import org.broadinstitute.sting.gatk.datasources.reference.ReferenceDataSource
import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile
import org.broadinstitute.sting.utils.{GenomeLocSortedSet, GenomeLocParser}
import collection.JavaConversions._
import org.broadinstitute.sting.utils.interval.IntervalUtils
class GATKIntervalsUnitTest {
private final lazy val hg18Reference = new File(BaseTest.hg18Reference)
@ -60,7 +61,7 @@ class GATKIntervalsUnitTest {
// for(Item item: javaConvertedScalaList)
// This for loop is actually an O(N^2) operation as the iterator calls the
// O(N) javaConvertedScalaList.size() for each iteration of the loop.
//Assert.assertEquals(gi.getSplits(gi.locs.size).size, 189894)
Assert.assertEquals(IntervalUtils.splitFixedIntervals(gi.locs, 189894).size(), 189894)
Assert.assertEquals(gi.contigs.size, 24)
}
@ -77,4 +78,17 @@ class GATKIntervalsUnitTest {
Assert.assertEquals(new GATKIntervals(hg18Reference, Seq("chr1", "chr2", "chr3")).contigs, Seq("chr1", "chr2", "chr3"))
Assert.assertEquals(new GATKIntervals(hg18Reference, Seq("chr1:1-2", "chr1:4-5", "chr2:1-1", "chr3:2-2")).contigs, Seq("chr1", "chr2", "chr3"))
}
@Test
def testSortAndMergeIntervals() {
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:1-10", "chr1:1-10"), Seq("chr1:1-10"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:1-11", "chr1:1-12"), Seq("chr1:1-12"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:11-20", "chr1:21-30"), Seq("chr1:1-10", "chr1:11-20", "chr1:21-30"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:10-20", "chr1:21-30"), Seq("chr1:1-20", "chr1:21-30"))
testSortAndMergeIntervals(Seq("chr1:1-10", "chr1:21-30", "chr1:10-20"), Seq("chr1:1-20", "chr1:21-30"))
}
private def testSortAndMergeIntervals(actual: Seq[String], expected: Seq[String]) {
Assert.assertEquals(new GATKIntervals(hg18Reference, actual).locs.toSeq, expected.map(hg18GenomeLocParser.parseGenomeLoc(_)))
}
}