zzh
/
gatk-3.8
1
0
Fork 0
Code Issues Pull Requests Packages Projects Releases Wiki Activity

Added the base test case, fixed the rest of the test cases to follow suit. Added more verbose output to ant for junit tests. 

git-svn-id: file:///humgen/gsa-scr1/gsa-engineering/svn_contents/trunk@403 348d0f76-0448-11de-a6fe-93d51630548a
This commit is contained in:
aaron 2009-04-14 17:11:38 +00:00
parent 961dbbd4ef
commit 4b3578e1de
5 changed files with 37 additions and 33 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

9
build.xml
View File

@ -199,7 +199,7 @@
<target name="test.compile" depends="compile"> <target name="test.compile" depends="compile">
<echo message="Sting: Compiling test cases!"/> <echo message="Sting: Compiling test cases!"/>
<mkdir dir="${test.classes}"/> <mkdir dir="${test.classes}"/>
<javac destdir="${test.classes}" debug="on" optimize="on"> <javac destdir="${test.classes}" debug="true" optimize="on">
<src path="${test.sources}"/> <src path="${test.sources}"/>
<classpath> <classpath>
<path refid="external.dependencies"/> <path refid="external.dependencies"/>
@ -214,9 +214,8 @@
<target name="test" depends="test.compile" description="Run unit tests"> <target name="test" depends="test.compile" description="Run unit tests">
<mkdir dir="${report}"/> <mkdir dir="${report}"/>
<echo message="Sting: Running test cases!"/> <echo message="Sting: Running test cases!"/>
<junit printsummary="yes" showoutput="yes" clonevm="yes" haltonfailure="yes"> <junit printsummary="yes" showoutput="yes" clonevm="yes" haltonfailure="yes" failureProperty="test.failure">
<formatter type="plain"/> <formatter type="brief" usefile="false" />
<classpath> <classpath>
<path refid="external.dependencies"/> <path refid="external.dependencies"/>
<pathelement location="build"/> <pathelement location="build"/>
@ -227,9 +226,11 @@
<batchtest fork="yes" todir="${report}"> <batchtest fork="yes" todir="${report}">
<fileset dir="${test.classes}"> <fileset dir="${test.classes}">
<include name="**/*.class"/> <include name="**/*.class"/>
<exclude name="**/BaseTest.class"/>
</fileset> </fileset>
</batchtest> </batchtest>
</junit> </junit>
<fail message="test failed" if="test.failure" />
</target> </target>

19
java/test/org/broadinstitute/sting/gatk/dataSources/shards/ShardStrategyFactoryTest.java
View File

@ -4,6 +4,7 @@ import static junit.framework.Assert.assertEquals;
import static junit.framework.Assert.fail; import static junit.framework.Assert.fail;
import net.sf.samtools.SAMSequenceDictionary; import net.sf.samtools.SAMSequenceDictionary;
import net.sf.samtools.SAMSequenceRecord; import net.sf.samtools.SAMSequenceRecord;
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.utils.FastaSequenceFile2; import org.broadinstitute.sting.utils.FastaSequenceFile2;
import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLoc;
import org.junit.*; import org.junit.*;
@ -37,7 +38,7 @@ import java.util.ArrayList;
* <p/> * <p/>
* A descriptions should go here. Blame aaron if it's missing. * A descriptions should go here. Blame aaron if it's missing.
*/ */
public class ShardStrategyFactoryTest { public class ShardStrategyFactoryTest extends BaseTest {
private static FastaSequenceFile2 seq; private static FastaSequenceFile2 seq;
@ -47,7 +48,7 @@ public class ShardStrategyFactoryTest {
*/ */
@BeforeClass @BeforeClass
public static void doBeforeAnyTests() { public static void doBeforeAnyTests() {
seq = new FastaSequenceFile2(new File("/seq/references/Homo_sapiens_assembly18/v0/Homo_sapiens_assembly18.fasta")); seq = new FastaSequenceFile2(new File(seqLocation + "/references/Homo_sapiens_assembly18/v0/Homo_sapiens_assembly18.fasta"));
} }
/** /**
@ -117,17 +118,17 @@ public class ShardStrategyFactoryTest {
int size = 10000; int size = 10000;
int location = 1; int location = 1;
GenomeLoc.setupRefContigOrdering(dic); GenomeLoc.setupRefContigOrdering(dic);
System.err.println("done to sleep"); logger.debug("done to sleep");
// keep track of the number of genome locs we build // keep track of the number of genome locs we build
int genomeLocs = 0; int genomeLocs = 0;
ArrayList<GenomeLoc> locations = new ArrayList<GenomeLoc>(); ArrayList<GenomeLoc> locations = new ArrayList<GenomeLoc>();
System.err.println("done to sleep2"); logger.debug("done to sleep2");
try { try {
while (location + size < stop) { while (location + size < stop) {
System.err.println("s = " + s.getSequenceName() + " " + location + " " + size); logger.debug("s = " + s.getSequenceName() + " " + location + " " + size);
// lets make up some fake locations // lets make up some fake locations
GenomeLoc gl = new GenomeLoc(s.getSequenceName(), location, location + size - 1); GenomeLoc gl = new GenomeLoc(s.getSequenceName(), location, location + size - 1);
System.err.println("loc = " + location); logger.debug("loc = " + location);
// let's move the location up, with a size space // let's move the location up, with a size space
location += (size * 2); location += (size * 2);
@ -141,18 +142,18 @@ public class ShardStrategyFactoryTest {
} catch (Exception e) { } catch (Exception e) {
e.printStackTrace(); e.printStackTrace();
} }
System.err.println("Location count = " + genomeLocs); logger.debug("Location count = " + genomeLocs);
ShardStrategy strategy = ShardStrategyFactory.shatter(ShardStrategyFactory.SHATTER_STRATEGY.LINEAR, seq.getSequenceDictionary(), 5000, locations); ShardStrategy strategy = ShardStrategyFactory.shatter(ShardStrategyFactory.SHATTER_STRATEGY.LINEAR, seq.getSequenceDictionary(), 5000, locations);
int shardCount = 0; int shardCount = 0;
try { try {
for (Shard sh : strategy) { for (Shard sh : strategy) {
GenomeLoc l = sh.getGenomeLoc(); GenomeLoc l = sh.getGenomeLoc();
System.err.println("Shard start: " + l.getStart() + " stop " + l.getStop() + " contig " + l.getContig()); logger.debug("Shard start: " + l.getStart() + " stop " + l.getStop() + " contig " + l.getContig());
shardCount++; shardCount++;
} }
System.err.println("Shard count = " + shardCount); logger.debug("Shard count = " + shardCount);
assertEquals(shardCount, genomeLocs * 2); assertEquals(shardCount, genomeLocs * 2);
} catch (Exception e) { } catch (Exception e) {

23
java/test/org/broadinstitute/sting/gatk/dataSources/simpleDataSources/SAMBAMDataSourceTest.java
View File

@ -2,6 +2,7 @@ package org.broadinstitute.sting.gatk.dataSources.simpleDataSources;
import static junit.framework.Assert.fail; import static junit.framework.Assert.fail;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.gatk.dataSources.shards.Shard; import org.broadinstitute.sting.gatk.dataSources.shards.Shard;
import org.broadinstitute.sting.gatk.dataSources.shards.ShardStrategy; import org.broadinstitute.sting.gatk.dataSources.shards.ShardStrategy;
import org.broadinstitute.sting.gatk.dataSources.shards.ShardStrategyFactory; import org.broadinstitute.sting.gatk.dataSources.shards.ShardStrategyFactory;
@ -42,7 +43,7 @@ import java.util.List;
* <p/> * <p/>
* A descriptions should go here. Blame aaron if it's missing. * A descriptions should go here. Blame aaron if it's missing.
*/ */
public class SAMBAMDataSourceTest { public class SAMBAMDataSourceTest extends BaseTest {
private List<String> fl; private List<String> fl;
private FastaSequenceFile2 seq; private FastaSequenceFile2 seq;
@ -57,7 +58,7 @@ public class SAMBAMDataSourceTest {
fl = new ArrayList<String>(); fl = new ArrayList<String>();
// sequence // sequence
seq = new FastaSequenceFile2(new File("/seq/references/Homo_sapiens_assembly18/v0/Homo_sapiens_assembly18.fasta")); seq = new FastaSequenceFile2(new File(seqLocation + "/references/Homo_sapiens_assembly18/v0/Homo_sapiens_assembly18.fasta"));
GenomeLoc.setupRefContigOrdering(seq.getSequenceDictionary()); GenomeLoc.setupRefContigOrdering(seq.getSequenceDictionary());
} }
@ -81,7 +82,7 @@ public class SAMBAMDataSourceTest {
int count = 0; int count = 0;
// setup the data // setup the data
fl.add("/humgen/gsa-scr1/aaron/stink/NA12892.bam"); fl.add(oneKGLocation + "/pilot3/sams/NA12892.bam");
try { try {
@ -90,8 +91,8 @@ public class SAMBAMDataSourceTest {
int readCount = 0; int readCount = 0;
count++; count++;
System.out.println("Start : " + sh.getGenomeLoc().getStart() + " stop : " + sh.getGenomeLoc().getStop() + " contig " + sh.getGenomeLoc().getContig()); logger.debug("Start : " + sh.getGenomeLoc().getStart() + " stop : " + sh.getGenomeLoc().getStop() + " contig " + sh.getGenomeLoc().getContig());
System.out.println("count = " + count); logger.debug("count = " + count);
MergingSamRecordIterator2 datum = data.seek(sh.getGenomeLoc()); MergingSamRecordIterator2 datum = data.seek(sh.getGenomeLoc());
// for the first couple of shards make sure we can see the reads // for the first couple of shards make sure we can see the reads
@ -118,7 +119,7 @@ public class SAMBAMDataSourceTest {
// setup the test files // setup the test files
fl.add("/seq/dirseq/analysis/cancer_exome/sams/TCGA-06-0188.aligned.duplicates_marked.bam"); fl.add(seqLocation + "/dirseq/analysis/cancer_exome/sams/TCGA-06-0188.aligned.duplicates_marked.bam");
ArrayList<Integer> readcountPerShard = new ArrayList<Integer>(); ArrayList<Integer> readcountPerShard = new ArrayList<Integer>();
ArrayList<Integer> readcountPerShard2 = new ArrayList<Integer>(); ArrayList<Integer> readcountPerShard2 = new ArrayList<Integer>();
@ -143,7 +144,7 @@ public class SAMBAMDataSourceTest {
} }
readcountPerShard.add(readCount); readcountPerShard.add(readCount);
System.out.println("read count = " + readCount); logger.debug("read count = " + readCount);
datum.close(); datum.close();
} }
} }
@ -155,13 +156,13 @@ public class SAMBAMDataSourceTest {
// setup the data and the counter before our second run // setup the data and the counter before our second run
fl.clear(); fl.clear();
fl.add("/seq/dirseq/analysis/cancer_exome/sams/TCGA-06-0188-01A-01W.aligned.duplicates_marked.bam"); fl.add(seqLocation + "/dirseq/analysis/cancer_exome/sams/TCGA-06-0188-01A-01W.aligned.duplicates_marked.bam");
fl.add("/seq/dirseq/analysis/cancer_exome/sams/TCGA-06-0188-10B-01W.aligned.duplicates_marked.bam"); fl.add(seqLocation + "/dirseq/analysis/cancer_exome/sams/TCGA-06-0188-10B-01W.aligned.duplicates_marked.bam");
count = 0; count = 0;
// the sharding strat. // the sharding strat.
strat = ShardStrategyFactory.shatter(ShardStrategyFactory.SHATTER_STRATEGY.LINEAR, seq.getSequenceDictionary(), 100000); strat = ShardStrategyFactory.shatter(ShardStrategyFactory.SHATTER_STRATEGY.LINEAR, seq.getSequenceDictionary(), 100000);
System.err.println("Pile two:"); logger.debug("Pile two:");
try { try {
SAMBAMDataSource data = new SAMBAMDataSource(fl); SAMBAMDataSource data = new SAMBAMDataSource(fl);
for (Shard sh : strat) { for (Shard sh : strat) {
@ -180,7 +181,7 @@ public class SAMBAMDataSourceTest {
} }
readcountPerShard2.add(readCount); readcountPerShard2.add(readCount);
System.out.println("read count = " + readCount); logger.debug("read count = " + readCount);
datum.close(); datum.close();
} }
} }

16
java/test/org/broadinstitute/sting/utils/FastaSequenceFile2Test.java
View File

@ -1,12 +1,11 @@
package org.broadinstitute.sting.utils; package org.broadinstitute.sting.utils;
import org.junit.*;
import org.apache.log4j.BasicConfigurator;
import java.io.File;
import edu.mit.broad.picard.reference.ReferenceSequence; import edu.mit.broad.picard.reference.ReferenceSequence;
import net.sf.samtools.util.StringUtil; import net.sf.samtools.util.StringUtil;
import org.broadinstitute.sting.BaseTest;
import org.junit.*;
import java.io.File;
/** /**
* Created by IntelliJ IDEA. * Created by IntelliJ IDEA.
@ -14,9 +13,9 @@ import net.sf.samtools.util.StringUtil;
* Date: Apr 11, 2009 * Date: Apr 11, 2009
* Time: 2:32:52 PM * Time: 2:32:52 PM
*/ */
public class FastaSequenceFile2Test { public class FastaSequenceFile2Test extends BaseTest {
private final String sequenceFileName = "/seq/references/Homo_sapiens_assembly18/v0/Homo_sapiens_assembly18.fasta"; private static String sequenceFileName;
private FastaSequenceFile2 sequenceFile = null; private FastaSequenceFile2 sequenceFile = null;
private final String firstBasesOfChrM = "GATCACAGGTCTATCACCCT"; private final String firstBasesOfChrM = "GATCACAGGTCTATCACCCT";
@ -25,7 +24,7 @@ public class FastaSequenceFile2Test {
@BeforeClass @BeforeClass
public static void initialize() { public static void initialize() {
BasicConfigurator.configure(); sequenceFileName = seqLocation + "/references/Homo_sapiens_assembly18/v0/Homo_sapiens_assembly18.fasta";
} }
@Before @Before
@ -116,6 +115,7 @@ public class FastaSequenceFile2Test {
try { try {
startTime = System.currentTimeMillis(); startTime = System.currentTimeMillis();
boolean success = sequenceFile.seekToContig("absent");
} }
finally { finally {
endTime = System.currentTimeMillis(); endTime = System.currentTimeMillis();

3
java/test/org/broadinstitute/sting/utils/cmdLine/ArgumentParserTest.java
View File

@ -7,6 +7,7 @@ package org.broadinstitute.sting.utils.cmdLine;
import org.junit.*; import org.junit.*;
import static org.junit.Assert.*; import static org.junit.Assert.*;
import org.apache.commons.cli.ParseException; import org.apache.commons.cli.ParseException;
import org.broadinstitute.sting.BaseTest;
/** /**
* The ArgumentParserTest test class. In JUnit 4, you don't have to extent the * The ArgumentParserTest test class. In JUnit 4, you don't have to extent the
@ -24,7 +25,7 @@ import org.apache.commons.cli.ParseException;
* <p/> * <p/>
* You should use the methods like * You should use the methods like
*/ */
public class ArgumentParserTest { public class ArgumentParserTest extends BaseTest {
// our argument parser // our argument parser
private ArgumentParser m_parser = null; private ArgumentParser m_parser = null;