From e7c9e3639e4802dfce987163a58dc2ad86d6bca7 Mon Sep 17 00:00:00 2001 From: Mauricio Carneiro Date: Fri, 25 Jan 2013 17:49:15 -0500 Subject: [PATCH 01/22] Making metrics a required parameter in MarkDuplicates As requested by user (forum) --- .../sting/queue/extensions/picard/MarkDuplicates.scala | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/public/scala/src/org/broadinstitute/sting/queue/extensions/picard/MarkDuplicates.scala b/public/scala/src/org/broadinstitute/sting/queue/extensions/picard/MarkDuplicates.scala index 59a51db96..7567434e2 100644 --- a/public/scala/src/org/broadinstitute/sting/queue/extensions/picard/MarkDuplicates.scala +++ b/public/scala/src/org/broadinstitute/sting/queue/extensions/picard/MarkDuplicates.scala @@ -48,7 +48,7 @@ class MarkDuplicates extends org.broadinstitute.sting.queue.function.JavaCommand @Output(doc="The output bam index", shortName = "out_index", fullName = "output_bam_index_file", required = false) var outputIndex: File = _ - @Output(doc="File to write duplication metrics to", shortName = "out_metrics", fullName = "output_metrics_file", required = false) + @Output(doc="File to write duplication metrics to", shortName = "out_metrics", fullName = "output_metrics_file", required = true) var metrics: File = new File(output + ".metrics") @Argument(doc="If true do not write duplicates to the output file instead of writing them with appropriate flags set.", shortName = "remdup", fullName = "remove_duplicates", required = false) From ef4cc742e590ead64feb10ba17054f92bdd3dd8b Mon Sep 17 00:00:00 2001 From: Mauricio Carneiro Date: Sat, 26 Jan 2013 12:36:30 -0500 Subject: [PATCH 02/22] Fixing the licensing scripts - Fixed shell glob limitation that was failing license updates on big commits - Hook will now force user to re-commit after updating the licenses (pre-commit hook can't update and commit in the same process) - Moved all scripts to bash/zsh - Separated the license utilities in a separate python module to avoid copying code GSATDG-28 #resolve --- .gitignore | 1 + 1 file changed, 1 insertion(+) diff --git a/.gitignore b/.gitignore index 6e2c2f224..9a20b68ca 100644 --- a/.gitignore +++ b/.gitignore @@ -12,6 +12,7 @@ *.ipr *.iws *.iml +*.pyc .DS_Store queueScatterGather /foo* From 6ea7133d95cffb5979d66106d11e6061c0da1314 Mon Sep 17 00:00:00 2001 From: Mauricio Carneiro Date: Sat, 26 Jan 2013 13:21:25 -0500 Subject: [PATCH 03/22] Updating licenses of latest moved files --- .../AlleleBiasedDownsamplingUtils.java | 65 +++++++------------ .../gatk/walkers/annotator/AlleleBalance.java | 65 +++++++------------ .../annotator/AlleleBalanceBySample.java | 65 +++++++------------ .../annotator/AverageAltAlleleLength.java | 65 +++++++------------ .../gatk/walkers/annotator/BaseCounts.java | 65 +++++++------------ .../sting/gatk/walkers/annotator/LowMQ.java | 65 +++++++------------ .../annotator/MappingQualityZeroBySample.java | 65 +++++++------------ .../annotator/MappingQualityZeroFraction.java | 65 +++++++------------ .../gatk/walkers/annotator/NBaseCount.java | 65 +++++++------------ .../sting/gatk/walkers/annotator/SnpEff.java | 65 +++++++------------ .../annotator/TechnologyComposition.java | 65 +++++++------------ .../walkers/annotator/VariantAnnotator.java | 65 +++++++------------ .../annotator/VariantAnnotatorEngine.java | 65 +++++++------------ .../ActiveRegionBasedAnnotation.java | 65 +++++++------------ .../AnnotationInterfaceManager.java | 65 +++++++------------ .../annotator/interfaces/AnnotationType.java | 65 +++++++------------ .../interfaces/AnnotatorCompatible.java | 65 +++++++------------ .../interfaces/ExperimentalAnnotation.java | 65 +++++++------------ .../interfaces/GenotypeAnnotation.java | 65 +++++++------------ .../interfaces/InfoFieldAnnotation.java | 65 +++++++------------ .../interfaces/RodRequiringAnnotation.java | 65 +++++++------------ .../interfaces/StandardAnnotation.java | 65 +++++++------------ .../VariantAnnotatorAnnotation.java | 65 +++++++------------ .../interfaces/WorkInProgressAnnotation.java | 65 +++++++------------ .../walkers/beagle/BeagleOutputToVCF.java | 65 +++++++------------ .../walkers/beagle/ProduceBeagleInput.java | 65 +++++++------------ .../beagle/VariantsToBeagleUnphased.java | 65 +++++++------------ .../walkers/coverage/DepthOfCoverage.java | 65 +++++++------------ .../coverage/DepthOfCoverageStats.java | 65 +++++++------------ .../walkers/diffengine/BAMDiffableReader.java | 65 +++++++------------ .../diffengine/GATKReportDiffableReader.java | 65 +++++++------------ .../walkers/diffengine/VCFDiffableReader.java | 65 +++++++------------ .../fasta/FastaAlternateReferenceMaker.java | 65 +++++++------------ .../walkers/fasta/FastaReferenceMaker.java | 65 +++++++------------ .../gatk/walkers/fasta/FastaSequence.java | 65 +++++++------------ .../gatk/walkers/filters/ClusteredSnps.java | 65 +++++++------------ .../walkers/filters/FiltrationContext.java | 65 +++++++------------ .../filters/FiltrationContextWindow.java | 65 +++++++------------ .../walkers/filters/VariantFiltration.java | 65 +++++++------------ .../validation/ValidationAmplicons.java | 65 +++++++------------ .../gatk/walkers/varianteval/VariantEval.java | 65 +++++++------------ .../varianteval/VariantEvalReportWriter.java | 65 +++++++------------ .../varianteval/evaluators/CompOverlap.java | 65 +++++++------------ .../varianteval/evaluators/CountVariants.java | 65 +++++++------------ .../evaluators/IndelLengthHistogram.java | 65 +++++++------------ .../varianteval/evaluators/IndelSummary.java | 65 +++++++------------ .../MendelianViolationEvaluator.java | 65 +++++++------------ .../evaluators/MultiallelicSummary.java | 65 +++++++------------ .../evaluators/PrintMissingComp.java | 65 +++++++------------ .../varianteval/evaluators/StandardEval.java | 65 +++++++------------ .../evaluators/ThetaVariantEvaluator.java | 65 +++++++------------ .../evaluators/TiTvVariantEvaluator.java | 65 +++++++------------ .../evaluators/ValidationReport.java | 65 +++++++------------ .../evaluators/VariantEvaluator.java | 65 +++++++------------ .../evaluators/VariantSummary.java | 65 +++++++------------ .../stratifications/AlleleCount.java | 65 +++++++------------ .../stratifications/AlleleFrequency.java | 65 +++++++------------ .../varianteval/stratifications/CompRod.java | 65 +++++++------------ .../varianteval/stratifications/Contig.java | 65 +++++++------------ .../varianteval/stratifications/CpG.java | 65 +++++++------------ .../stratifications/Degeneracy.java | 65 +++++++------------ .../DynamicStratification.java | 65 +++++++------------ .../varianteval/stratifications/EvalRod.java | 65 +++++++------------ .../varianteval/stratifications/Filter.java | 65 +++++++------------ .../stratifications/FunctionalClass.java | 65 +++++++------------ .../stratifications/IndelSize.java | 65 +++++++------------ .../IntervalStratification.java | 65 +++++++------------ .../stratifications/JexlExpression.java | 65 +++++++------------ .../varianteval/stratifications/Novelty.java | 65 +++++++------------ .../stratifications/OneBPIndel.java | 65 +++++++------------ .../RequiredStratification.java | 65 +++++++------------ .../varianteval/stratifications/Sample.java | 65 +++++++------------ .../StandardStratification.java | 65 +++++++------------ .../stratifications/TandemRepeat.java | 65 +++++++------------ .../stratifications/VariantStratifier.java | 65 +++++++------------ .../stratifications/VariantType.java | 65 +++++++------------ .../stratifications/manager/StratNode.java | 65 +++++++------------ .../manager/StratNodeIterator.java | 65 +++++++------------ .../manager/StratificationManager.java | 65 +++++++------------ .../stratifications/manager/Stratifier.java | 65 +++++++------------ .../walkers/varianteval/util/Analysis.java | 65 +++++++------------ .../util/AnalysisModuleScanner.java | 65 +++++++------------ .../walkers/varianteval/util/DataPoint.java | 65 +++++++------------ .../varianteval/util/EvaluationContext.java | 65 +++++++------------ .../gatk/walkers/varianteval/util/Molten.java | 65 +++++++------------ .../util/SortableJexlVCMatchExp.java | 65 +++++++------------ .../varianteval/util/VariantEvalUtils.java | 65 +++++++------------ .../VQSRCalibrationCurve.java | 65 +++++++------------ .../variantutils/ConcordanceMetrics.java | 65 +++++++------------ .../variantutils/FilterLiftedVariants.java | 65 +++++++------------ .../variantutils/GenotypeConcordance.java | 65 +++++++------------ .../variantutils/LeftAlignVariants.java | 65 +++++++------------ .../variantutils/LiftoverVariants.java | 65 +++++++------------ .../variantutils/RandomlySplitVariants.java | 65 +++++++------------ .../walkers/variantutils/SelectHeaders.java | 65 +++++++------------ .../walkers/variantutils/SelectVariants.java | 65 +++++++------------ .../variantutils/ValidateVariants.java | 65 +++++++------------ .../VariantValidationAssessor.java | 65 +++++++------------ .../variantutils/VariantsToBinaryPed.java | 65 +++++++------------ .../walkers/variantutils/VariantsToTable.java | 65 +++++++------------ .../walkers/variantutils/VariantsToVCF.java | 65 +++++++------------ .../utils/activeregion/ActivityProfile.java | 46 ++++++------- .../activeregion/BandPassActivityProfile.java | 46 ++++++------- .../genotyper/PerReadAlleleLikelihoodMap.java | 65 +++++++------------ .../ActivityProfileStateUnitTest.java | 46 ++++++------- .../activeregion/ActivityProfileUnitTest.java | 46 ++++++------- .../BandPassActivityProfileUnitTest.java | 46 ++++++------- 107 files changed, 2359 insertions(+), 4501 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/downsampling/AlleleBiasedDownsamplingUtils.java b/public/java/src/org/broadinstitute/sting/gatk/downsampling/AlleleBiasedDownsamplingUtils.java index 02821ab50..11f03ce36 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/downsampling/AlleleBiasedDownsamplingUtils.java +++ b/public/java/src/org/broadinstitute/sting/gatk/downsampling/AlleleBiasedDownsamplingUtils.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.downsampling; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalance.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalance.java index 146f71e16..73c31ef66 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalance.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalance.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java index c501c2f5f..fbba6722e 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AlleleBalanceBySample.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AverageAltAlleleLength.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AverageAltAlleleLength.java index d5c9bcef2..17a33bdca 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AverageAltAlleleLength.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/AverageAltAlleleLength.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/BaseCounts.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/BaseCounts.java index c3500fbc0..704422308 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/BaseCounts.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/BaseCounts.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/LowMQ.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/LowMQ.java index 94f5aac56..8ed9a9fe0 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/LowMQ.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/LowMQ.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroBySample.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroBySample.java index 9e334847d..fa1a5dde5 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroBySample.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroBySample.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroFraction.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroFraction.java index 659a94d9e..65d2f0757 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroFraction.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/MappingQualityZeroFraction.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java index c5142b285..8cabb7c82 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/NBaseCount.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SnpEff.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SnpEff.java index 58f606066..17002ba39 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SnpEff.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/SnpEff.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TechnologyComposition.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TechnologyComposition.java index 6d8f015f0..dbaafb1ed 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TechnologyComposition.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TechnologyComposition.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotator.java index c3f738c92..e30d43185 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotator.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorEngine.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorEngine.java index f03a25c04..29f6ed388 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/VariantAnnotatorEngine.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ActiveRegionBasedAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ActiveRegionBasedAnnotation.java index 32ca332ca..bc725815d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ActiveRegionBasedAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ActiveRegionBasedAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationInterfaceManager.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationInterfaceManager.java index 1e7a2fa80..221887158 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationInterfaceManager.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationInterfaceManager.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationType.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationType.java index 70cb5bef1..515efab5b 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationType.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotationType.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotatorCompatible.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotatorCompatible.java index 44102899b..98b7cad9c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotatorCompatible.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/AnnotatorCompatible.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ExperimentalAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ExperimentalAnnotation.java index ce6974101..4161f6c22 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ExperimentalAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/ExperimentalAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/GenotypeAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/GenotypeAnnotation.java index cb10de73d..ec058708c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/GenotypeAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/GenotypeAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/InfoFieldAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/InfoFieldAnnotation.java index 092dc6e36..ce1bb47e5 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/InfoFieldAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/InfoFieldAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/RodRequiringAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/RodRequiringAnnotation.java index 4b893cb01..4a6a47418 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/RodRequiringAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/RodRequiringAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/StandardAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/StandardAnnotation.java index c63875ed6..62734fe6c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/StandardAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/StandardAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/VariantAnnotatorAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/VariantAnnotatorAnnotation.java index f8442f4dc..1415c1d7c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/VariantAnnotatorAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/VariantAnnotatorAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/WorkInProgressAnnotation.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/WorkInProgressAnnotation.java index eb6b617bf..14f39de17 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/WorkInProgressAnnotation.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/annotator/interfaces/WorkInProgressAnnotation.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.annotator.interfaces; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/BeagleOutputToVCF.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/BeagleOutputToVCF.java index 03df03a14..09b2cba80 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/BeagleOutputToVCF.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/BeagleOutputToVCF.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.beagle; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/ProduceBeagleInput.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/ProduceBeagleInput.java index 409c8dca8..15527d34a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/ProduceBeagleInput.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/ProduceBeagleInput.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.beagle; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/VariantsToBeagleUnphased.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/VariantsToBeagleUnphased.java index e5b5286b6..3ef688d02 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/VariantsToBeagleUnphased.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/beagle/VariantsToBeagleUnphased.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.beagle; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java index b10daab58..dbb8ed5a6 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.coverage; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageStats.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageStats.java index 6fe452a82..56aa6f2d7 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageStats.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverageStats.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.coverage; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java index 6badc0d78..57d903f4d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/BAMDiffableReader.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.diffengine; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/GATKReportDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/GATKReportDiffableReader.java index a69ac4181..55f52a32a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/GATKReportDiffableReader.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/GATKReportDiffableReader.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.diffengine; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java index 4c1989cdc..59f3d512c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diffengine/VCFDiffableReader.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.diffengine; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java index 3562b3d75..8a5b3530e 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.fasta; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java index 4cac2f119..e9728601d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.fasta; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaSequence.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaSequence.java index bcdf6c3a6..41f701f1a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaSequence.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaSequence.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.fasta; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/ClusteredSnps.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/ClusteredSnps.java index d73ac9220..f186fc73d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/ClusteredSnps.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/ClusteredSnps.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.filters; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContext.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContext.java index faddf97da..bce20d31a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContext.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContext.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.filters; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContextWindow.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContextWindow.java index 56a5b6289..f41053f75 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContextWindow.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/FiltrationContextWindow.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.filters; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltration.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltration.java index 461afd049..091d5e428 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltration.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/filters/VariantFiltration.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.filters; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java index 8547c0993..1a9ce5ad5 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/validation/ValidationAmplicons.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.validation; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java index e1450a428..d586ee7da 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java index 77459a0de..a63f32485 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java index dc11b1032..c0b87b5b7 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CompOverlap.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java index 2392f4901..33a5a9fc9 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/CountVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java index 548b0ab42..643948b45 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelLengthHistogram.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelSummary.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelSummary.java index 4793aa390..68fcc6aba 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelSummary.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/IndelSummary.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java index 0ad5c8c31..3d082f23c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MendelianViolationEvaluator.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MultiallelicSummary.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MultiallelicSummary.java index e839d73b8..e9fc8114b 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MultiallelicSummary.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/MultiallelicSummary.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java index bf370a9ad..8553ed376 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/PrintMissingComp.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/StandardEval.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/StandardEval.java index 55712772e..206fc9560 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/StandardEval.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/StandardEval.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java index 54cccb52c..c5e73a875 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ThetaVariantEvaluator.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java index 129b67e81..4ad7be045 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/TiTvVariantEvaluator.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java index 92a1c6c43..c31cf9f86 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/ValidationReport.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantEvaluator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantEvaluator.java index d3660cf32..13130ccb0 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantEvaluator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantEvaluator.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantSummary.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantSummary.java index d5aedaf04..a3b703ad3 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantSummary.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/evaluators/VariantSummary.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.evaluators; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleCount.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleCount.java index fdd4b1ef4..f18f73bac 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleCount.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleCount.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleFrequency.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleFrequency.java index 1d8b05fce..179161ee2 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleFrequency.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/AlleleFrequency.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CompRod.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CompRod.java index 0609260f0..202f6528a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CompRod.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CompRod.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Contig.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Contig.java index f0cb84930..411aed94f 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Contig.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Contig.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CpG.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CpG.java index e3457cad1..bba431ab4 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CpG.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/CpG.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Degeneracy.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Degeneracy.java index 02c306c43..120bd3cf0 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Degeneracy.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Degeneracy.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/DynamicStratification.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/DynamicStratification.java index 6e03f2bce..afb36cdc6 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/DynamicStratification.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/DynamicStratification.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/EvalRod.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/EvalRod.java index e1a0f9ea4..6d00bf16a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/EvalRod.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/EvalRod.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Filter.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Filter.java index 9c85a84c1..49c2a8808 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Filter.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Filter.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/FunctionalClass.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/FunctionalClass.java index 60b05c966..d43db70fa 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/FunctionalClass.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/FunctionalClass.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IndelSize.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IndelSize.java index 18d7ed3f8..3e10d3b98 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IndelSize.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IndelSize.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IntervalStratification.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IntervalStratification.java index c2555b3c9..be689fe55 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IntervalStratification.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/IntervalStratification.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/JexlExpression.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/JexlExpression.java index a83c2941c..a1a10294f 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/JexlExpression.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/JexlExpression.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java index 2be5c350b..ef077c678 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Novelty.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/OneBPIndel.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/OneBPIndel.java index 6eb607879..65fb2dd11 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/OneBPIndel.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/OneBPIndel.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/RequiredStratification.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/RequiredStratification.java index 5a1f51f05..de4ab5db8 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/RequiredStratification.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/RequiredStratification.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Sample.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Sample.java index 144eeb841..ca9a1df85 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Sample.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/Sample.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/StandardStratification.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/StandardStratification.java index 06fc29e16..5267513ad 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/StandardStratification.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/StandardStratification.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java index 621644df8..de82b18cc 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantStratifier.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantStratifier.java index 91005e3c3..3ca8c0bdc 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantStratifier.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantStratifier.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantType.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantType.java index ecca7aecb..01862cf3a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantType.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/VariantType.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNode.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNode.java index 256a7b7ff..4ab6262be 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNode.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNode.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.manager; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNodeIterator.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNodeIterator.java index 7bda94916..87fb3dfa4 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNodeIterator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratNodeIterator.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.manager; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java index 9d95313a1..053a88218 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.manager; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/Stratifier.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/Stratifier.java index be2a0dad5..d211eee50 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/Stratifier.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/Stratifier.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.manager; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java index 9cc7e88de..838500ab8 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Analysis.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java index 4394e17a8..a5c3b125e 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/AnalysisModuleScanner.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java index aacbb29e5..34c9368f2 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/DataPoint.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/EvaluationContext.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/EvaluationContext.java index 3059de37b..2e9512639 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/EvaluationContext.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/EvaluationContext.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Molten.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Molten.java index a2f3acb4e..d65887090 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Molten.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/Molten.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/SortableJexlVCMatchExp.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/SortableJexlVCMatchExp.java index 74020ed18..1cd68c610 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/SortableJexlVCMatchExp.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/SortableJexlVCMatchExp.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java index fc6aaea76..7e751e4a0 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/util/VariantEvalUtils.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.varianteval.util; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VQSRCalibrationCurve.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VQSRCalibrationCurve.java index d3a79221e..d416d5d16 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VQSRCalibrationCurve.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantrecalibration/VQSRCalibrationCurve.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantrecalibration; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetrics.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetrics.java index 9d5495351..b7f88a330 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetrics.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetrics.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/FilterLiftedVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/FilterLiftedVariants.java index f824ea4d1..c2785e920 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/FilterLiftedVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/FilterLiftedVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java index 47e2ea052..048c7ef77 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LeftAlignVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LeftAlignVariants.java index 7ac36b2f8..17f75229a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LeftAlignVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LeftAlignVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariants.java index 940f2faf4..3ef9fa3d7 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/LiftoverVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RandomlySplitVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RandomlySplitVariants.java index 23516b5ed..896f36e6c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RandomlySplitVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RandomlySplitVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java index 38fa060cc..abd0956fb 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java index f79946a2e..6da6d14b1 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ValidateVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ValidateVariants.java index f3e8167df..4b9f2c6c1 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ValidateVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/ValidateVariants.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantValidationAssessor.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantValidationAssessor.java index 5ac70a8c3..17d5ab1b1 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantValidationAssessor.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantValidationAssessor.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToBinaryPed.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToBinaryPed.java index e3cc27570..3bd95d9ec 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToBinaryPed.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToBinaryPed.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToTable.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToTable.java index 46bb4a48b..91057c812 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToTable.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToTable.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java index 9f2aa68e3..61746cbf1 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/VariantsToVCF.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.gatk.walkers.variantutils; diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java index f265f9d60..15aca4162 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.activeregion; diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java index 75ae72f9e..37798410d 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.activeregion; diff --git a/public/java/src/org/broadinstitute/sting/utils/genotyper/PerReadAlleleLikelihoodMap.java b/public/java/src/org/broadinstitute/sting/utils/genotyper/PerReadAlleleLikelihoodMap.java index 28c20921e..46a3f58d0 100644 --- a/public/java/src/org/broadinstitute/sting/utils/genotyper/PerReadAlleleLikelihoodMap.java +++ b/public/java/src/org/broadinstitute/sting/utils/genotyper/PerReadAlleleLikelihoodMap.java @@ -1,47 +1,26 @@ /* -* By downloading the PROGRAM you agree to the following terms of use: -* -* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY -* -* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). -* -* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and -* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. -* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: -* -* 1. DEFINITIONS -* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. -* -* 2. LICENSE -* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. -* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. -* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. -* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. -* -* 3. OWNERSHIP OF INTELLECTUAL PROPERTY -* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. -* Copyright 2012 Broad Institute, Inc. -* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. -* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. -* -* 4. INDEMNIFICATION -* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. -* -* 5. NO REPRESENTATIONS OR WARRANTIES -* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. -* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. -* -* 6. ASSIGNMENT -* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. -* -* 7. MISCELLANEOUS -* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. -* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. -* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. -* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. -* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. -* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. -* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ package org.broadinstitute.sting.utils.genotyper; diff --git a/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileStateUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileStateUnitTest.java index 019cf82da..f199a0d82 100644 --- a/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileStateUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileStateUnitTest.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.activeregion; diff --git a/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileUnitTest.java index 792361ac3..1df4a3348 100644 --- a/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/activeregion/ActivityProfileUnitTest.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.activeregion; diff --git a/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java index ff1c9bdef..540e9470a 100644 --- a/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java @@ -1,27 +1,27 @@ /* - * Copyright (c) 2012 The Broad Institute - * - * Permission is hereby granted, free of charge, to any person - * obtaining a copy of this software and associated documentation - * files (the "Software"), to deal in the Software without - * restriction, including without limitation the rights to use, - * copy, modify, merge, publish, distribute, sublicense, and/or sell - * copies of the Software, and to permit persons to whom the - * Software is furnished to do so, subject to the following - * conditions: - * - * The above copyright notice and this permission notice shall be - * included in all copies or substantial portions of the Software. - * - * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, - * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES - * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND - * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT - * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, - * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING - * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR - * THE USE OR OTHER DEALINGS IN THE SOFTWARE. - */ +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ package org.broadinstitute.sting.utils.activeregion; From 705cccaf63c57e42fb3fe7450ba998d85ef324f7 Mon Sep 17 00:00:00 2001 From: Mauricio Carneiro Date: Sun, 27 Jan 2013 02:36:31 -0500 Subject: [PATCH 05/22] Making SplitReads output FastQ's instead of BAM - eliminates one step in my pipeline - BAM is too finicky and maintaining parameters that wouldn't be useful was becoming a headache, better avoided. --- .../sting/gatk/io/FastqFileWriter.java | 77 +++++++++++++++++++ .../sting/utils/sam/GATKSAMRecord.java | 12 ++- .../sting/utils/sam/ReadUtils.java | 63 +++++++++++++++ .../variant/utils/BaseUtils.java | 23 ++++++ .../sting/utils/sam/ReadUtilsUnitTest.java | 20 +++++ 5 files changed, 191 insertions(+), 4 deletions(-) create mode 100644 public/java/src/org/broadinstitute/sting/gatk/io/FastqFileWriter.java diff --git a/public/java/src/org/broadinstitute/sting/gatk/io/FastqFileWriter.java b/public/java/src/org/broadinstitute/sting/gatk/io/FastqFileWriter.java new file mode 100644 index 000000000..acef3e500 --- /dev/null +++ b/public/java/src/org/broadinstitute/sting/gatk/io/FastqFileWriter.java @@ -0,0 +1,77 @@ +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + +package org.broadinstitute.sting.gatk.io; + +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; +import org.broadinstitute.sting.utils.sam.GATKSAMRecord; +import org.broadinstitute.sting.utils.sam.ReadUtils; + +import java.io.FileNotFoundException; +import java.io.PrintStream; + +/** + * User: carneiro + * Date: 1/27/13 + * Time: 12:54 AM + */ +public class FastqFileWriter { + private PrintStream output; + + public FastqFileWriter(String filename) { + try { + this.output = new PrintStream(filename); + } catch (FileNotFoundException e) { + throw new ReviewedStingException("Can't open file " + filename); + } + } + + public void addAlignment(GATKSAMRecord read) { + output.println("@" + read.getReadName()); + + if (read.getReadNegativeStrandFlag()) { + output.println(ReadUtils.getBasesReverseComplement(read)); + output.println("+"); + output.println(ReadUtils.convertReadQualToString(invertQuals(read.getBaseQualities()))); + } else { + output.println(ReadUtils.convertReadBasesToString(read)); + output.println("+"); + output.println(ReadUtils.convertReadQualToString(read)); + } + } + + public void close() { + this.output.close(); + } + + private byte[] invertQuals (byte[] quals) { + final int l = quals.length; + byte[] invertedQuals = new byte[l]; + for (int i=0; i cigarElements = new LinkedList(); + cigarElements.add(new CigarElement(length, CigarOperator.M)); + Cigar cigar = new Cigar(cigarElements); + return ArtificialSAMUtils.createArtificialRead(cigar); + } + /////////////////////////////////////////////////////////////////////////////// // *** The following methods are overloaded to cache the appropriate data ***// /////////////////////////////////////////////////////////////////////////////// diff --git a/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java b/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java index c17e81b9c..29f8c8dcd 100644 --- a/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java @@ -34,6 +34,7 @@ import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.NGSPlatform; import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; +import org.broadinstitute.variant.utils.BaseUtils; import java.io.File; import java.util.*; @@ -850,4 +851,66 @@ public class ReadUtils { return events; } + /** + * Given a read, outputs the read bases in a string format + * + * @param read the read + * @return a string representation of the read bases + */ + public static String convertReadBasesToString(GATKSAMRecord read) { + String bases = ""; + for (byte b : read.getReadBases()) { + bases += (char) b; + } + return bases.toUpperCase(); + } + + /** + * Given a read, outputs the base qualities in a string format + * + * @param quals the read qualities + * @return a string representation of the base qualities + */ + public static String convertReadQualToString(byte[] quals) { + String result = ""; + for (byte b : quals) { + result += (char) (33 + b); + } + return result; + } + + /** + * Given a read, outputs the base qualities in a string format + * + * @param read the read + * @return a string representation of the base qualities + */ + public static String convertReadQualToString(GATKSAMRecord read) { + return convertReadQualToString(read.getBaseQualities()); + } + + /** + * Returns the reverse complement of the read bases + * + * @param bases the read bases + * @return the reverse complement of the read bases + */ + public static String getBasesReverseComplement(byte[] bases) { + String reverse = ""; + for (int i = bases.length-1; i >=0; i--) { + reverse += (char) BaseUtils.getComplement(bases[i]); + } + return reverse; + } + + /** + * Returns the reverse complement of the read bases + * + * @param read the read + * @return the reverse complement of the read bases + */ + public static String getBasesReverseComplement(GATKSAMRecord read) { + return getBasesReverseComplement(read.getReadBases()); + } + } diff --git a/public/java/src/org/broadinstitute/variant/utils/BaseUtils.java b/public/java/src/org/broadinstitute/variant/utils/BaseUtils.java index a6ac2ca53..bbd02e0a6 100644 --- a/public/java/src/org/broadinstitute/variant/utils/BaseUtils.java +++ b/public/java/src/org/broadinstitute/variant/utils/BaseUtils.java @@ -26,6 +26,7 @@ package org.broadinstitute.variant.utils; import net.sf.samtools.util.StringUtil; +import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import java.util.Arrays; @@ -497,4 +498,26 @@ public class BaseUtils { return randomBaseIndex; } + + public static byte getComplement(byte base) { + switch(base) { + case 'a': + case 'A': + return 'T'; + case 'c': + case 'C': + return 'G'; + case 'g': + case 'G': + return 'C'; + case 't': + case 'T': + return 'A'; + case 'n': + case 'N': + return 'N'; + default: + throw new ReviewedStingException("base must be A, C, G or T. " + (char) base + " is not a valid base."); + } + } } diff --git a/public/java/test/org/broadinstitute/sting/utils/sam/ReadUtilsUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/sam/ReadUtilsUnitTest.java index 7b48b1b69..20971643e 100644 --- a/public/java/test/org/broadinstitute/sting/utils/sam/ReadUtilsUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/sam/ReadUtilsUnitTest.java @@ -26,12 +26,15 @@ package org.broadinstitute.sting.utils.sam; import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; +import org.broadinstitute.variant.utils.BaseUtils; import org.testng.Assert; import org.testng.annotations.DataProvider; import org.testng.annotations.Test; import java.util.LinkedList; import java.util.List; +import java.util.Random; public class ReadUtilsUnitTest extends BaseTest { @@ -145,4 +148,21 @@ public class ReadUtilsUnitTest extends BaseTest { boundary = get.getAdaptor(read); Assert.assertEquals(boundary, ReadUtils.CANNOT_COMPUTE_ADAPTOR_BOUNDARY); } + + @Test (enabled = true) + public void testGetBasesReverseComplement() { + int iterations = 1000; + Random random = GenomeAnalysisEngine.getRandomGenerator(); + while(iterations-- > 0) { + final int l = random.nextInt(1000); + GATKSAMRecord read = GATKSAMRecord.createRandomRead(l); + byte [] original = read.getReadBases(); + byte [] reconverted = new byte[l]; + String revComp = ReadUtils.getBasesReverseComplement(read); + for (int i=0; i Date: Fri, 25 Jan 2013 17:20:13 -0500 Subject: [PATCH 06/22] ART optimization: BandPassActivityProfile only applies the gaussian filter if the state probability > 0 --- .../activeregion/BandPassActivityProfile.java | 14 +++++++++----- 1 file changed, 9 insertions(+), 5 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java index 37798410d..a1f1fc580 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java @@ -153,12 +153,16 @@ public class BandPassActivityProfile extends ActivityProfile { final Collection states = new LinkedList(); for ( final ActivityProfileState superState : super.processState(justAddedState) ) { - for( int jjj = -filterSize; jjj <= filterSize; jjj++ ) { - final GenomeLoc loc = getLocForOffset(justAddedState.getLoc(), jjj); - if ( loc != null ) { - final double newProb = superState.isActiveProb * GaussianKernel[jjj + filterSize]; - states.add(new ActivityProfileState(loc, newProb)); + if ( superState.isActiveProb > 0.0 ) { + for( int jjj = -filterSize; jjj <= filterSize; jjj++ ) { + final GenomeLoc loc = getLocForOffset(justAddedState.getLoc(), jjj); + if ( loc != null ) { + final double newProb = superState.isActiveProb * GaussianKernel[jjj + filterSize]; + states.add(new ActivityProfileState(loc, newProb)); + } } + } else { + states.add(justAddedState); } } From 93d88cdc68e2f715fb570f8a86579b042b4a02d4 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Fri, 25 Jan 2013 17:21:05 -0500 Subject: [PATCH 07/22] Optimization: LocusReferenceView now passes along the contig index to createGenomeLoc, speeding up their creation -- Also cleaned up some unused methods --- .../providers/LocusReferenceView.java | 43 ++----------------- 1 file changed, 3 insertions(+), 40 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusReferenceView.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusReferenceView.java index f74724795..d5b7d0487 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusReferenceView.java +++ b/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusReferenceView.java @@ -123,38 +123,10 @@ public class LocusReferenceView extends ReferenceView { if(bounds != null) { int expandedStart = getWindowStart( bounds ); int expandedStop = getWindowStop( bounds ); - initializeReferenceSequence(genomeLocParser.createGenomeLoc(bounds.getContig(), expandedStart, expandedStop)); + initializeReferenceSequence(genomeLocParser.createGenomeLoc(bounds.getContig(), bounds.getContigIndex(), expandedStart, expandedStop)); } } - /** Returns true if the specified location is fully within the bounds of the reference window loaded into - * this LocusReferenceView object. - */ - public boolean isLocationWithinBounds(GenomeLoc loc) { - return bounds.containsP(loc); - } - - /** Ensures that specified location is within the bounds of the reference window loaded into this - * LocusReferenceView object. If the location loc is within the current bounds (or if it is null), then nothing is done. - * Otherwise, the bounds are expanded on either side, as needed, to accomodate the location, and the reference seuqence for the - * new bounds is reloaded (can be costly!). If loc spans beyond the current contig, the expansion is performed - * to the start/stop of that contig only. - * @param loc - */ - public void expandBoundsToAccomodateLoc(GenomeLoc loc) { - if ( bounds==null || loc==null) return; // can bounds be null actually??? - if ( isLocationWithinBounds(loc) ) return; - if ( loc.getContigIndex() != bounds.getContigIndex() ) - throw new ReviewedStingException("Illegal attempt to expand reference view bounds to accommodate location on a different contig."); - - bounds = genomeLocParser.createGenomeLoc(bounds.getContig(), - Math.min(bounds.getStart(),loc.getStart()), - Math.max(bounds.getStop(),loc.getStop())); - int expandedStart = getWindowStart( bounds ); - int expandedStop = getWindowStop( bounds ); - initializeReferenceSequence(genomeLocParser.createGenomeLoc(bounds.getContig(), expandedStart, expandedStop)); - } - /** * Initialize the bounds of this shard, trimming the bounds so that they match the reference. * @param provider Provider covering the appropriate locus. @@ -210,7 +182,8 @@ public class LocusReferenceView extends ReferenceView { public ReferenceContext getReferenceContext( GenomeLoc genomeLoc ) { //validateLocation( genomeLoc ); - GenomeLoc window = genomeLocParser.createGenomeLoc( genomeLoc.getContig(), getWindowStart(genomeLoc), getWindowStop(genomeLoc) ); + GenomeLoc window = genomeLocParser.createGenomeLoc( genomeLoc.getContig(), bounds.getContigIndex(), + getWindowStart(genomeLoc), getWindowStop(genomeLoc) ); int refStart = -1; if (bounds != null) { @@ -237,16 +210,6 @@ public class LocusReferenceView extends ReferenceView { return super.getReferenceBases(genomeLoc); } - /** - * Validates that the genomeLoc is one base wide and is in the reference sequence. - * @param genomeLoc location to verify. - */ - private void validateLocation( GenomeLoc genomeLoc ) throws InvalidPositionException { - if( bounds != null && !bounds.containsP(genomeLoc) ) - throw new InvalidPositionException( - String.format("Requested position %s not within interval %s", genomeLoc, bounds)); - } - /** * Gets the start of the expanded window, bounded if necessary by the contig. * @param locus The locus to expand. From 804caf7a45505f9be1c041dd42241ede1d7022c5 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Fri, 25 Jan 2013 17:23:15 -0500 Subject: [PATCH 08/22] HaplotypeCaller Optimization: return a inactive (p = 0.0) activity if the context has no bases in the pileup -- Allows us to avoid doing a lot of misc. work to set up the genotype when we don't have any data to genotype. Valuable in the case where we are passing through large regions without any data --- .../sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java index a3d764141..8b3eb9f1b 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java @@ -398,7 +398,9 @@ public class HaplotypeCaller extends ActiveRegionWalker implem return new ActivityProfileState( ref.getLocus(), tracker.getValues(UG_engine.getUAC().alleles, ref.getLocus()).size() > 0 ? 1.0 : 0.0 ); } - if( context == null ) { return new ActivityProfileState(ref.getLocus(), 0.0); } + if( context == null || context.getBasePileup().isEmpty() ) + // if we don't have any data, just abort early + return new ActivityProfileState(ref.getLocus(), 0.0); final List noCall = new ArrayList(); // used to noCall all genotypes until the exact model is applied noCall.add(Allele.NO_CALL); From 0fb238b61e767fc32a93cc9f89ff67c86a279f86 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Fri, 25 Jan 2013 17:25:42 -0500 Subject: [PATCH 09/22] TraverseActiveRegions Optimizations and Bugfixes: make sure to record position of current locus to discharge active regions when there's no data -- Now records the position of the current locus, as well as that of the last read. Necessary when passing through regions with no reads. The previous version would keep accumulating empty active regions, and never discharge them until end of traversal (if there was no reads in the future) or until a read was finally found -- Protected a call to logger.debug with if ( logger.isDebugEnabled()) to avoid a lot of overhead in writing unseen debugger logging information --- .../traversals/TraverseActiveRegions.java | 31 +++++++++++++++---- 1 file changed, 25 insertions(+), 6 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/gatk/traversals/TraverseActiveRegions.java b/public/java/src/org/broadinstitute/sting/gatk/traversals/TraverseActiveRegions.java index bff696f13..6933b45a7 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/traversals/TraverseActiveRegions.java +++ b/public/java/src/org/broadinstitute/sting/gatk/traversals/TraverseActiveRegions.java @@ -68,7 +68,6 @@ import java.util.*; */ public class TraverseActiveRegions extends TraversalEngine,LocusShardDataProvider> { protected final static Logger logger = Logger.getLogger(TraversalEngine.class); - protected final static boolean DEBUG = false; protected final static boolean LOG_READ_CARRYING = false; // set by the tranversal @@ -221,12 +220,13 @@ public class TraverseActiveRegions extends TraversalEngine reads = locusView.getLIBS().transferReadsFromAllPreviousPileups(); for( final GATKSAMRecord read : reads ) { if ( ! appearedInLastShard(locOfLastReadAtTraversalStart, read) ) { - if ( DEBUG ) logger.warn("Adding read " + read.getReadName() + " at " + engine.getGenomeLocParser().createGenomeLoc(read) + " from provider " + dataProvider); rememberLastReadLocation(read); myReads.add(read); } @@ -295,6 +295,26 @@ public class TraverseActiveRegions extends TraversalEngine extends TraversalEngine extends TraversalEngine extends TraversalEngine> Map call with " + activeRegion.getReads().size() + " " + (activeRegion.isActive ? "active" : "inactive") + " reads @ " + activeRegion.getLocation() + " with full extent: " + activeRegion.getReferenceLoc()); + if ( logger.isDebugEnabled() ) { + logger.debug(">> Map call with " + activeRegion.getReads().size() + " " + (activeRegion.isActive ? "active" : "inactive") + " reads @ " + activeRegion.getLocation() + " with full extent: " + activeRegion.getReferenceLoc()); + } if ( LOG_READ_CARRYING ) logger.info(String.format("Processing region %20s span=%3d active?=%5b with %4d reads. Overall max reads carried is %s", From 72b2e77eed3295b8ef09b512a464bf2d2e6cafc4 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Sat, 26 Jan 2013 15:23:40 -0500 Subject: [PATCH 10/22] Linearize the findEndOfRegion algorithm in ActivityProfile, radically improving its performance -- Previous algorithm was O(N^2) -- #resolve GSA-723 https://jira.broadinstitute.org/browse/GSA-723 --- .../utils/activeregion/ActivityProfile.java | 99 +++++++++++++++---- 1 file changed, 79 insertions(+), 20 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java index 15aca4162..14a8e6dcb 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java @@ -49,6 +49,14 @@ public class ActivityProfile { protected GenomeLoc regionStartLoc = null; protected GenomeLoc regionStopLoc = null; + /** + * Optimization variable. Keeps track of the right-most state we looked at in our + * last unsuccessful call to findEndOfRegion. This variable allows us to + * avoid an O(N^2) algorithm to find the end of the current region in the profile. It + * must be reset to 0 when a region is popped off the stack. + */ + int startSearchForEndOfRegionHere = 0; + /** * A cached value of the regionStartLoc contig length, to make calls to * getCurrentContigLength efficient @@ -77,10 +85,10 @@ public class ActivityProfile { /** * How far away can probability mass be moved around in this profile? * - * This distance puts an upper limit on how far, in bp, we will ever propogate probability max around + * This distance puts an upper limit on how far, in bp, we will ever propagate probability max around * when adding a new ActivityProfileState. For example, if the value of this function is * 10, and you are looking at a state at bp 5, and we know that no states beyond 5 + 10 will have - * their probability propograted back to that state. + * their probability propagated back to that state. * * @return a positive integer distance in bp */ @@ -344,6 +352,9 @@ public class ActivityProfile { // couldn't find a valid ending offset, so we return null return null; + // reset the start site of findEndOfRegion to the first element + startSearchForEndOfRegionHere = 0; + // we need to create the active region, and clip out the states we're extracting from this profile final List sub = stateList.subList(0, offsetOfNextRegionEnd + 1); final List supportingStates = new ArrayList(sub); @@ -384,8 +395,72 @@ public class ActivityProfile { "result == -1 || result < maxRegionSize", "! (result == -1 && forceConversion)"}) private int findEndOfRegion(final boolean isActiveRegion, final int minRegionSize, final int maxRegionSize, final boolean forceConversion) { + int endOfActiveRegion = findFirstActivityBoundary(isActiveRegion, maxRegionSize, startSearchForEndOfRegionHere); + startSearchForEndOfRegionHere = Math.max(endOfActiveRegion - getMaxProbPropagationDistance(), 0); + + if ( isActiveRegion && endOfActiveRegion == maxRegionSize ) + // we've run to the end of the region, let's find a good place to cut + endOfActiveRegion = findBestCutSite(endOfActiveRegion, minRegionSize); + + // we're one past the end, so i must be decremented + return forceConversion || endOfActiveRegion + getMaxProbPropagationDistance() < stateList.size() + ? endOfActiveRegion - 1 + : -1; + } + + /** + * Find the the local minimum within 0 - endOfActiveRegion where we should divide region + * + * This algorithm finds the global minimum probability state within the region [minRegionSize, endOfActiveRegion) + * (exclusive of endOfActiveRegion), and returns the state index of that state. + * that it + * + * @param endOfActiveRegion the last state of the current active region (exclusive) + * @param minRegionSize the minimum of the left-most region, after cutting + * @return the index of state after the cut site (just like endOfActiveRegion) + */ + @Requires({"endOfActiveRegion >= minRegionSize", "minRegionSize >= 0"}) + @Ensures({"result >= minRegionSize", "result <= endOfActiveRegion"}) + private int findBestCutSite(final int endOfActiveRegion, final int minRegionSize) { + int minI = endOfActiveRegion - 1; + double minP = Double.MAX_VALUE; + + for ( int i = minI; i >= minRegionSize - 1; i-- ) { + double cur = getProb(i); + if ( cur < minP && isMinimum(i) ) { + minP = cur; + minI = i; + } + } + + return minI + 1; + } + + /** + * Find the first index into the state list where the state is considered ! isActiveRegion + * + * Note that each state has a probability of being active, and this function thresholds that + * value on ACTIVE_PROB_THRESHOLD, coloring each state as active or inactive. Finds the + * largest contiguous stretch of states starting at startSearchAt with the same isActive + * state as isActiveRegion. If the entire state list has the same isActive value, then returns + * maxRegionSize + * + * @param isActiveRegion are we looking for a stretch of active states, or inactive ones? + * @param maxRegionSize don't look for a boundary that would yield a region of size > maxRegionSize + * @param startSearchAt start looking not at 0 but rather at this offset into the state list. This + * parameter allows us to remember where we looked before across calls, so that + * we don't keep searching from 0 -> 1, then 0 -> 2, then 0 -> 3 on each subsequent + * call to this function. Use with caution, as an incorrect value could result in + * skipping a true boundary + * @return the index of the first state in the state list with isActive value != isActiveRegion, or maxRegionSize + * if no such element exists + */ + @Requires({"maxRegionSize > 0", "startSearchAt >= 0", "startSearchAt <= maxRegionSize", "startSearchAt <= stateList.size()"}) + @Ensures({"result >= 0", "result <= stateList.size()"}) + private int findFirstActivityBoundary(final boolean isActiveRegion, final int maxRegionSize, final int startSearchAt) { final int nStates = stateList.size(); - int endOfActiveRegion = 0; + int endOfActiveRegion = startSearchAt; + while ( endOfActiveRegion < nStates && endOfActiveRegion < maxRegionSize ) { if ( getProb(endOfActiveRegion) > ACTIVE_PROB_THRESHOLD != isActiveRegion ) { break; @@ -393,23 +468,7 @@ public class ActivityProfile { endOfActiveRegion++; } - if ( isActiveRegion && endOfActiveRegion == maxRegionSize ) { - // we've run to the end of the region, let's find a good place to cut - int minI = endOfActiveRegion - 1; - double minP = Double.MAX_VALUE; - for ( int i = minI; i >= minRegionSize - 1; i-- ) { - double cur = getProb(i); - if ( cur < minP && isMinimum(i) ) { - minP = cur; - minI = i; - } - } - - endOfActiveRegion = minI + 1; - } - - // we're one past the end, so i must be decremented - return forceConversion || endOfActiveRegion + getMaxProbPropagationDistance() < stateList.size() ? endOfActiveRegion - 1 : -1; + return endOfActiveRegion; } /** From c97a361b5d3d3d3d213c9081e84d96778e046cf0 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Sun, 27 Jan 2013 13:39:35 -0500 Subject: [PATCH 11/22] Added realistic BandPassFilterUnitTest that ensures quality results for 1000G phase I VCF and NA12878 VCF -- Helped ID more bugs in the ActivityProfile, necessitating a new algorithm for popping off active regions. This new algorithm requires that at least maxRegionSize + prob. propagation distance states have been examined. This ensures that the incremental results are the same as you get reading in an entire profile and running getRegions on the full profile -- TODO is to remove incremental search start algorithm, as this is no longer necessary, and nicely eliminates a state variable I was always uncomfortable with --- .../utils/activeregion/ActivityProfile.java | 11 +- .../activeregion/ActivityProfileState.java | 2 + .../activeregion/BandPassActivityProfile.java | 8 ++ .../BandPassActivityProfileUnitTest.java | 110 +++++++++++++++++- .../VariantContextTestProvider.java | 4 +- 5 files changed, 126 insertions(+), 9 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java index 14a8e6dcb..ae181463b 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java @@ -395,6 +395,13 @@ public class ActivityProfile { "result == -1 || result < maxRegionSize", "! (result == -1 && forceConversion)"}) private int findEndOfRegion(final boolean isActiveRegion, final int minRegionSize, final int maxRegionSize, final boolean forceConversion) { + if ( ! forceConversion && stateList.size() < maxRegionSize + getMaxProbPropagationDistance() ) { + // we really haven't finalized at the probability mass that might affect our decision, so keep + // waiting until we do before we try to make any decisions + return -1; + } + + // TODO -- don't need startSearchForEndOfRegionHere with the above check int endOfActiveRegion = findFirstActivityBoundary(isActiveRegion, maxRegionSize, startSearchForEndOfRegionHere); startSearchForEndOfRegionHere = Math.max(endOfActiveRegion - getMaxProbPropagationDistance(), 0); @@ -403,9 +410,7 @@ public class ActivityProfile { endOfActiveRegion = findBestCutSite(endOfActiveRegion, minRegionSize); // we're one past the end, so i must be decremented - return forceConversion || endOfActiveRegion + getMaxProbPropagationDistance() < stateList.size() - ? endOfActiveRegion - 1 - : -1; + return endOfActiveRegion - 1; } /** diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfileState.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfileState.java index 5bba7db17..309405be0 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfileState.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfileState.java @@ -72,6 +72,8 @@ public class ActivityProfileState { // make sure the location of that activity profile is 1 if ( loc.size() != 1 ) throw new IllegalArgumentException("Location for an ActivityProfileState must have to size 1 bp but saw " + loc); + if ( resultValue != null && resultValue.doubleValue() < 0 ) + throw new IllegalArgumentException("Result value isn't null and its < 0, which is illegal: " + resultValue); this.loc = loc; this.isActiveProb = isActiveProb; diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java index a1f1fc580..abbc74df4 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfile.java @@ -52,6 +52,14 @@ public class BandPassActivityProfile extends ActivityProfile { private final double sigma; private final double[] GaussianKernel; + /** + * Create a new BandPassActivityProfile with default sigma and file sizes + * @param parser our genome loc parser + */ + public BandPassActivityProfile(final GenomeLocParser parser) { + this(parser, MAX_FILTER_SIZE, DEFAULT_SIGMA, true); + } + /** * Create an activity profile that implements a band pass filter on the states * @param parser our genome loc parser diff --git a/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java index 540e9470a..2c7d78169 100644 --- a/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java @@ -35,7 +35,12 @@ import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.MathUtils; +import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; +import org.broadinstitute.variant.variantcontext.VariantContext; +import org.broadinstitute.variant.variantcontext.VariantContextTestProvider; +import org.broadinstitute.variant.vcf.VCFCodec; +import org.broadinstitute.variant.vcf.VCFHeader; import org.testng.Assert; import org.testng.annotations.BeforeClass; import org.testng.annotations.DataProvider; @@ -47,12 +52,13 @@ import java.util.*; public class BandPassActivityProfileUnitTest extends BaseTest { + private final static boolean DEBUG = false; private GenomeLocParser genomeLocParser; @BeforeClass public void init() throws FileNotFoundException { // sequence - ReferenceSequenceFile seq = new CachingIndexedFastaSequenceFile(new File(hg18Reference)); + ReferenceSequenceFile seq = new CachingIndexedFastaSequenceFile(new File(b37KGReference)); genomeLocParser = new GenomeLocParser(seq); } @@ -79,7 +85,7 @@ public class BandPassActivityProfileUnitTest extends BaseTest { return tests.toArray(new Object[][]{}); } - @Test(dataProvider = "BandPassBasicTest") + @Test(enabled = ! DEBUG, dataProvider = "BandPassBasicTest") public void testBandPass(final int start, final boolean precedingIsActive, final int nPrecedingSites, final int bandPassSize, final double sigma) { final BandPassActivityProfile profile = new BandPassActivityProfile(genomeLocParser, bandPassSize, sigma, false); @@ -133,7 +139,7 @@ public class BandPassActivityProfileUnitTest extends BaseTest { return tests.toArray(new Object[][]{}); } - @Test( dataProvider = "BandPassComposition") + @Test( enabled = ! DEBUG, dataProvider = "BandPassComposition") public void testBandPassComposition(final int bandPassSize, final int integrationLength) { final int start = 1; final BandPassActivityProfile profile = new BandPassActivityProfile(genomeLocParser, bandPassSize, BandPassActivityProfile.DEFAULT_SIGMA); @@ -207,7 +213,7 @@ public class BandPassActivityProfileUnitTest extends BaseTest { return tests.toArray(new Object[][]{}); } - @Test( dataProvider = "KernelCreation") + @Test( enabled = ! DEBUG, dataProvider = "KernelCreation") public void testKernelCreation(final double sigma, final int maxSize, final double[] expectedKernel) { final BandPassActivityProfile profile = new BandPassActivityProfile(genomeLocParser, maxSize, sigma, true); @@ -216,4 +222,100 @@ public class BandPassActivityProfileUnitTest extends BaseTest { for ( int i = 0; i < kernel.length; i++ ) Assert.assertEquals(kernel[i], expectedKernel[i], 1e-3, "Kernels not equal at " + i); } + + // ------------------------------------------------------------------------------------ + // + // Large-scale test, reading in 1000G Phase I chr20 calls and making sure that + // the regions returned are the same if you run on the entire profile vs. doing it + // incremental + // + // ------------------------------------------------------------------------------------ + + @DataProvider(name = "VCFProfile") + public Object[][] makeVCFProfile() { + final List tests = new LinkedList(); + + //tests.add(new Object[]{ privateTestDir + "ALL.chr20.phase1_release_v3.20101123.snps_indels_svs.sites.vcf", "20", 60470, 61000}); + //tests.add(new Object[]{ privateTestDir + "ALL.chr20.phase1_release_v3.20101123.snps_indels_svs.sites.vcf", "20", 60470, 100000}); + //tests.add(new Object[]{ privateTestDir + "ALL.chr20.phase1_release_v3.20101123.snps_indels_svs.sites.vcf", "20", 60470, 1000000}); + tests.add(new Object[]{ privateTestDir + "ALL.chr20.phase1_release_v3.20101123.snps_indels_svs.sites.vcf", "20", 60470, 1000000}); + tests.add(new Object[]{ privateTestDir + "NA12878.WGS.b37.chr20.firstMB.vcf", "20", 1, 1000000}); + + return tests.toArray(new Object[][]{}); + } + + @Test( dataProvider = "VCFProfile") + public void testVCFProfile(final String path, final String contig, final int start, final int end) throws Exception { + final int extension = 50; + final int minRegionSize = 50; + final int maxRegionSize = 300; + + final File file = new File(path); + final VCFCodec codec = new VCFCodec(); + final Pair> reader = VariantContextTestProvider.readAllVCs(file, codec); + + final List incRegions = new ArrayList(); + final BandPassActivityProfile incProfile = new BandPassActivityProfile(genomeLocParser); + final BandPassActivityProfile fullProfile = new BandPassActivityProfile(genomeLocParser); + int pos = start; + for ( final VariantContext vc : reader.getSecond() ) { + if ( vc == null ) continue; + while ( pos < vc.getStart() ) { + final GenomeLoc loc = genomeLocParser.createGenomeLoc(contig, pos); + //logger.warn("Adding 0.0 at " + loc + " because vc.getStart is " + vc.getStart()); + incProfile.add(new ActivityProfileState(loc, 0.0)); + fullProfile.add(new ActivityProfileState(loc, 0.0)); + pos++; + } + if ( vc.getStart() >= start && vc.getEnd() <= end ) { + final GenomeLoc loc = genomeLocParser.createGenomeLoc(contig, pos); + //logger.warn("Adding 1.0 at " + loc); + ActivityProfileState.Type type = ActivityProfileState.Type.NONE; + Number value = null; + if ( vc.isBiallelic() && vc.isIndel() ) { + type = ActivityProfileState.Type.HIGH_QUALITY_SOFT_CLIPS; + value = Math.abs(vc.getIndelLengths().get(0)); + } + final ActivityProfileState state = new ActivityProfileState(loc, 1.0, type, value); + incProfile.add(state); + fullProfile.add(state); + pos++; + } + + incRegions.addAll(incProfile.popReadyActiveRegions(extension, minRegionSize, maxRegionSize, false)); + + if ( vc.getStart() > end ) + break; + } + + incRegions.addAll(incProfile.popReadyActiveRegions(extension, minRegionSize, maxRegionSize, true)); + + final List fullRegions = fullProfile.popReadyActiveRegions(extension, minRegionSize, maxRegionSize, true); + assertGoodRegions(fullRegions, start, end, maxRegionSize); + assertGoodRegions(incRegions, start, end, maxRegionSize); + + Assert.assertEquals(incRegions.size(), fullRegions.size(), "incremental and full region sizes aren't the same"); + for ( int i = 0; i < fullRegions.size(); i++ ) { + final ActiveRegion incRegion = incRegions.get(i); + final ActiveRegion fullRegion = fullRegions.get(i); + Assert.assertTrue(incRegion.equalExceptReads(fullRegion), "Full and incremental regions are not equal: full = " + fullRegion + " inc = " + incRegion); + } + } + + private void assertGoodRegions(final List regions, final int start, final int end, final int maxRegionSize) { + int lastPosSeen = start - 1; + for ( int regionI = 0; regionI < regions.size(); regionI++ ) { + final ActiveRegion region = regions.get(regionI); + Assert.assertEquals(region.getLocation().getStart(), lastPosSeen + 1, "discontinuous with previous region. lastPosSeen " + lastPosSeen + " but region is " + region); + Assert.assertTrue(region.getLocation().size() <= maxRegionSize, "Region is too big: " + region); + lastPosSeen = region.getLocation().getStop(); + + for ( final ActivityProfileState state : region.getSupportingStates() ) { + Assert.assertEquals(state.isActiveProb > ActivityProfile.ACTIVE_PROB_THRESHOLD, region.isActive, + "Region is active=" + region.isActive + " but contains a state " + state + " with prob " + + state.isActiveProb + " not within expected values given threshold for activity of " + + ActivityProfile.ACTIVE_PROB_THRESHOLD); + } + } + } } diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java index 0a2dc384e..f489806f6 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java @@ -688,7 +688,7 @@ public class VariantContextTestProvider { * @return * @throws IOException */ - private final static Pair> readAllVCs( final File source, final FeatureCodec codec ) throws IOException { + public final static Pair> readAllVCs( final File source, final FeatureCodec codec ) throws IOException { // read in the features PositionalBufferedStream pbs = new PositionalBufferedStream(new FileInputStream(source)); FeatureCodecHeader header = codec.readHeader(pbs); @@ -701,7 +701,7 @@ public class VariantContextTestProvider { return new Pair>(vcfHeader, new VCIterable(pbs, codec, vcfHeader)); } - private static class VCIterable implements Iterable, Iterator { + public static class VCIterable implements Iterable, Iterator { final PositionalBufferedStream pbs; final FeatureCodec codec; final VCFHeader header; From 14d8afe413e608c83f194ad40d00b2e3399de699 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Sun, 27 Jan 2013 13:51:53 -0500 Subject: [PATCH 12/22] Remove startSearchAt state variable from ActivityProfile -- New algorithm will only try to create an active region if there's at least maxREgionSize + propagation distance states in the list. When that's true, we are guaranteed to actually find a region. So this algorithm is not only truly correct but as super fast, as we only ever do the search for the end of the region when we will certainly find one, and actually generate a region. --- .../utils/activeregion/ActiveRegion.java | 1 - .../utils/activeregion/ActivityProfile.java | 28 ++++--------------- 2 files changed, 5 insertions(+), 24 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActiveRegion.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActiveRegion.java index 575e94b99..194f61933 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActiveRegion.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActiveRegion.java @@ -125,7 +125,6 @@ public class ActiveRegion implements HasGenomeLocation { public int getExtension() { return extension; } public int size() { return reads.size(); } public void clearReads() { reads.clear(); } - public void remove( final GATKSAMRecord read ) { reads.remove( read ); } public void removeAll( final ArrayList readsToRemove ) { reads.removeAll( readsToRemove ); } public boolean equalExceptReads(final ActiveRegion other) { diff --git a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java index ae181463b..ff4673717 100644 --- a/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java +++ b/public/java/src/org/broadinstitute/sting/utils/activeregion/ActivityProfile.java @@ -49,14 +49,6 @@ public class ActivityProfile { protected GenomeLoc regionStartLoc = null; protected GenomeLoc regionStopLoc = null; - /** - * Optimization variable. Keeps track of the right-most state we looked at in our - * last unsuccessful call to findEndOfRegion. This variable allows us to - * avoid an O(N^2) algorithm to find the end of the current region in the profile. It - * must be reset to 0 when a region is popped off the stack. - */ - int startSearchForEndOfRegionHere = 0; - /** * A cached value of the regionStartLoc contig length, to make calls to * getCurrentContigLength efficient @@ -352,9 +344,6 @@ public class ActivityProfile { // couldn't find a valid ending offset, so we return null return null; - // reset the start site of findEndOfRegion to the first element - startSearchForEndOfRegionHere = 0; - // we need to create the active region, and clip out the states we're extracting from this profile final List sub = stateList.subList(0, offsetOfNextRegionEnd + 1); final List supportingStates = new ArrayList(sub); @@ -401,9 +390,7 @@ public class ActivityProfile { return -1; } - // TODO -- don't need startSearchForEndOfRegionHere with the above check - int endOfActiveRegion = findFirstActivityBoundary(isActiveRegion, maxRegionSize, startSearchForEndOfRegionHere); - startSearchForEndOfRegionHere = Math.max(endOfActiveRegion - getMaxProbPropagationDistance(), 0); + int endOfActiveRegion = findFirstActivityBoundary(isActiveRegion, maxRegionSize); if ( isActiveRegion && endOfActiveRegion == maxRegionSize ) // we've run to the end of the region, let's find a good place to cut @@ -446,25 +433,20 @@ public class ActivityProfile { * * Note that each state has a probability of being active, and this function thresholds that * value on ACTIVE_PROB_THRESHOLD, coloring each state as active or inactive. Finds the - * largest contiguous stretch of states starting at startSearchAt with the same isActive + * largest contiguous stretch of states starting at the first state (index 0) with the same isActive * state as isActiveRegion. If the entire state list has the same isActive value, then returns * maxRegionSize * * @param isActiveRegion are we looking for a stretch of active states, or inactive ones? * @param maxRegionSize don't look for a boundary that would yield a region of size > maxRegionSize - * @param startSearchAt start looking not at 0 but rather at this offset into the state list. This - * parameter allows us to remember where we looked before across calls, so that - * we don't keep searching from 0 -> 1, then 0 -> 2, then 0 -> 3 on each subsequent - * call to this function. Use with caution, as an incorrect value could result in - * skipping a true boundary * @return the index of the first state in the state list with isActive value != isActiveRegion, or maxRegionSize * if no such element exists */ - @Requires({"maxRegionSize > 0", "startSearchAt >= 0", "startSearchAt <= maxRegionSize", "startSearchAt <= stateList.size()"}) + @Requires({"maxRegionSize > 0"}) @Ensures({"result >= 0", "result <= stateList.size()"}) - private int findFirstActivityBoundary(final boolean isActiveRegion, final int maxRegionSize, final int startSearchAt) { + private int findFirstActivityBoundary(final boolean isActiveRegion, final int maxRegionSize) { final int nStates = stateList.size(); - int endOfActiveRegion = startSearchAt; + int endOfActiveRegion = 0; while ( endOfActiveRegion < nStates && endOfActiveRegion < maxRegionSize ) { if ( getProb(endOfActiveRegion) > ACTIVE_PROB_THRESHOLD != isActiveRegion ) { From 63913d516f35be9cfecce9dd8b8fdc8b5137c592 Mon Sep 17 00:00:00 2001 From: Mark DePristo Date: Sun, 27 Jan 2013 16:52:45 -0500 Subject: [PATCH 14/22] Add join call to Progress meter unit test so we actually know the daemon thread has finished --- .../utils/progressmeter/ProgressMeterDaemonUnitTest.java | 5 ++++- 1 file changed, 4 insertions(+), 1 deletion(-) diff --git a/public/java/test/org/broadinstitute/sting/utils/progressmeter/ProgressMeterDaemonUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/progressmeter/ProgressMeterDaemonUnitTest.java index 4de24bc15..c33c1976b 100644 --- a/public/java/test/org/broadinstitute/sting/utils/progressmeter/ProgressMeterDaemonUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/progressmeter/ProgressMeterDaemonUnitTest.java @@ -84,7 +84,7 @@ public class ProgressMeterDaemonUnitTest extends BaseTest { } @Test(dataProvider = "PollingData", invocationCount = 10, successPercentage = 90) - public void testMe(final long poll, final int ticks) throws InterruptedException { + public void testProgressMeterDaemon(final long poll, final int ticks) throws InterruptedException { final TestingProgressMeter meter = new TestingProgressMeter(poll); final ProgressMeterDaemon daemon = meter.getProgressMeterDaemon(); Assert.assertTrue(daemon.isDaemon()); @@ -96,6 +96,9 @@ public class ProgressMeterDaemonUnitTest extends BaseTest { daemon.done(); Assert.assertTrue(daemon.isDone()); + // wait for the thread to actually finish + daemon.join(); + Assert.assertTrue(meter.progressCalls.size() >= 1, "Expected at least one progress update call from daemon thread, but only got " + meter.progressCalls.size() + " with exact calls " + meter.progressCalls); From 1aee8f205e83bd30f4bee1a2201924a11dcc24f5 Mon Sep 17 00:00:00 2001 From: Mauricio Carneiro Date: Sun, 27 Jan 2013 16:48:44 -0500 Subject: [PATCH 15/22] Tool to calculate per base coverage distribution GSATDG-29 #resolve --- .../targets/BaseCoverageDistribution.java | 101 ++++++++++++++++++ 1 file changed, 101 insertions(+) create mode 100644 protected/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/targets/BaseCoverageDistribution.java diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/targets/BaseCoverageDistribution.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/targets/BaseCoverageDistribution.java new file mode 100644 index 000000000..a12008eb4 --- /dev/null +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/targets/BaseCoverageDistribution.java @@ -0,0 +1,101 @@ +/* +* By downloading the PROGRAM you agree to the following terms of use: +* +* BROAD INSTITUTE - SOFTWARE LICENSE AGREEMENT - FOR ACADEMIC NON-COMMERCIAL RESEARCH PURPOSES ONLY +* +* This Agreement is made between the Broad Institute, Inc. with a principal address at 7 Cambridge Center, Cambridge, MA 02142 (BROAD) and the LICENSEE and is effective at the date the downloading is completed (EFFECTIVE DATE). +* +* WHEREAS, LICENSEE desires to license the PROGRAM, as defined hereinafter, and BROAD wishes to have this PROGRAM utilized in the public interest, subject only to the royalty-free, nonexclusive, nontransferable license rights of the United States Government pursuant to 48 CFR 52.227-14; and +* WHEREAS, LICENSEE desires to license the PROGRAM and BROAD desires to grant a license on the following terms and conditions. +* NOW, THEREFORE, in consideration of the promises and covenants made herein, the parties hereto agree as follows: +* +* 1. DEFINITIONS +* 1.1 PROGRAM shall mean copyright in the object code and source code known as GATK2 and related documentation, if any, as they exist on the EFFECTIVE DATE and can be downloaded from http://www.broadinstitute/GATK on the EFFECTIVE DATE. +* +* 2. LICENSE +* 2.1 Grant. Subject to the terms of this Agreement, BROAD hereby grants to LICENSEE, solely for academic non-commercial research purposes, a non-exclusive, non-transferable license to: (a) download, execute and display the PROGRAM and (b) create bug fixes and modify the PROGRAM. +* The LICENSEE may apply the PROGRAM in a pipeline to data owned by users other than the LICENSEE and provide these users the results of the PROGRAM provided LICENSEE does so for academic non-commercial purposes only. For clarification purposes, academic sponsored research is not a commercial use under the terms of this Agreement. +* 2.2 No Sublicensing or Additional Rights. LICENSEE shall not sublicense or distribute the PROGRAM, in whole or in part, without prior written permission from BROAD. LICENSEE shall ensure that all of its users agree to the terms of this Agreement. LICENSEE further agrees that it shall not put the PROGRAM on a network, server, or other similar technology that may be accessed by anyone other than the LICENSEE and its employees and users who have agreed to the terms of this agreement. +* 2.3 License Limitations. Nothing in this Agreement shall be construed to confer any rights upon LICENSEE by implication, estoppel, or otherwise to any computer software, trademark, intellectual property, or patent rights of BROAD, or of any other entity, except as expressly granted herein. LICENSEE agrees that the PROGRAM, in whole or part, shall not be used for any commercial purpose, including without limitation, as the basis of a commercial software or hardware product or to provide services. LICENSEE further agrees that the PROGRAM shall not be copied or otherwise adapted in order to circumvent the need for obtaining a license for use of the PROGRAM. +* +* 3. OWNERSHIP OF INTELLECTUAL PROPERTY +* LICENSEE acknowledges that title to the PROGRAM shall remain with BROAD. The PROGRAM is marked with the following BROAD copyright notice and notice of attribution to contributors. LICENSEE shall retain such notice on all copies. LICENSEE agrees to include appropriate attribution if any results obtained from use of the PROGRAM are included in any publication. +* Copyright 2012 Broad Institute, Inc. +* Notice of attribution: The GATK2 program was made available through the generosity of Medical and Population Genetics program at the Broad Institute, Inc. +* LICENSEE shall not use any trademark or trade name of BROAD, or any variation, adaptation, or abbreviation, of such marks or trade names, or any names of officers, faculty, students, employees, or agents of BROAD except as states above for attribution purposes. +* +* 4. INDEMNIFICATION +* LICENSEE shall indemnify, defend, and hold harmless BROAD, and their respective officers, faculty, students, employees, associated investigators and agents, and their respective successors, heirs and assigns, (Indemnitees), against any liability, damage, loss, or expense (including reasonable attorneys fees and expenses) incurred by or imposed upon any of the Indemnitees in connection with any claims, suits, actions, demands or judgments arising out of any theory of liability (including, without limitation, actions in the form of tort, warranty, or strict liability and regardless of whether such action has any factual basis) pursuant to any right or license granted under this Agreement. +* +* 5. NO REPRESENTATIONS OR WARRANTIES +* THE PROGRAM IS DELIVERED AS IS. BROAD MAKES NO REPRESENTATIONS OR WARRANTIES OF ANY KIND CONCERNING THE PROGRAM OR THE COPYRIGHT, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS, WHETHER OR NOT DISCOVERABLE. BROAD EXTENDS NO WARRANTIES OF ANY KIND AS TO PROGRAM CONFORMITY WITH WHATEVER USER MANUALS OR OTHER LITERATURE MAY BE ISSUED FROM TIME TO TIME. +* IN NO EVENT SHALL BROAD OR ITS RESPECTIVE DIRECTORS, OFFICERS, EMPLOYEES, AFFILIATED INVESTIGATORS AND AFFILIATES BE LIABLE FOR INCIDENTAL OR CONSEQUENTIAL DAMAGES OF ANY KIND, INCLUDING, WITHOUT LIMITATION, ECONOMIC DAMAGES OR INJURY TO PROPERTY AND LOST PROFITS, REGARDLESS OF WHETHER BROAD SHALL BE ADVISED, SHALL HAVE OTHER REASON TO KNOW, OR IN FACT SHALL KNOW OF THE POSSIBILITY OF THE FOREGOING. +* +* 6. ASSIGNMENT +* This Agreement is personal to LICENSEE and any rights or obligations assigned by LICENSEE without the prior written consent of BROAD shall be null and void. +* +* 7. MISCELLANEOUS +* 7.1 Export Control. LICENSEE gives assurance that it will comply with all United States export control laws and regulations controlling the export of the PROGRAM, including, without limitation, all Export Administration Regulations of the United States Department of Commerce. Among other things, these laws and regulations prohibit, or require a license for, the export of certain types of software to specified countries. +* 7.2 Termination. LICENSEE shall have the right to terminate this Agreement for any reason upon prior written notice to BROAD. If LICENSEE breaches any provision hereunder, and fails to cure such breach within thirty (30) days, BROAD may terminate this Agreement immediately. Upon termination, LICENSEE shall provide BROAD with written assurance that the original and all copies of the PROGRAM have been destroyed, except that, upon prior written authorization from BROAD, LICENSEE may retain a copy for archive purposes. +* 7.3 Survival. The following provisions shall survive the expiration or termination of this Agreement: Articles 1, 3, 4, 5 and Sections 2.2, 2.3, 7.3, and 7.4. +* 7.4 Notice. Any notices under this Agreement shall be in writing, shall specifically refer to this Agreement, and shall be sent by hand, recognized national overnight courier, confirmed facsimile transmission, confirmed electronic mail, or registered or certified mail, postage prepaid, return receipt requested. All notices under this Agreement shall be deemed effective upon receipt. +* 7.5 Amendment and Waiver; Entire Agreement. This Agreement may be amended, supplemented, or otherwise modified only by means of a written instrument signed by all parties. Any waiver of any rights or failure to act in a specific instance shall relate only to such instance and shall not be construed as an agreement to waive any rights or fail to act in any other instance, whether or not similar. This Agreement constitutes the entire agreement among the parties with respect to its subject matter and supersedes prior agreements or understandings between the parties relating to its subject matter. +* 7.6 Binding Effect; Headings. This Agreement shall be binding upon and inure to the benefit of the parties and their respective permitted successors and assigns. All headings are for convenience only and shall not affect the meaning of any provision of this Agreement. +* 7.7 Governing Law. This Agreement shall be construed, governed, interpreted and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A., without regard to conflict of laws principles. +*/ + +package org.broadinstitute.sting.gatk.walkers.diagnostics.targets; + +import org.broadinstitute.sting.commandline.Output; +import org.broadinstitute.sting.gatk.contexts.AlignmentContext; +import org.broadinstitute.sting.gatk.contexts.ReferenceContext; +import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; +import org.broadinstitute.sting.gatk.report.GATKReport; +import org.broadinstitute.sting.gatk.walkers.LocusWalker; + +import java.io.PrintStream; +import java.util.HashMap; +import java.util.Map; + +/** + * User: carneiro + * Date: 1/27/13 + * Time: 11:16 AM + */ +public class BaseCoverageDistribution extends LocusWalker> { + @Output(required = true) + private PrintStream out; + + @Override + public boolean includeReadsWithDeletionAtLoci() { + return true; + } + + @Override + public Integer map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) { + return context.getBasePileup().getReads().size(); // I want the reads instead of the base pileup because I want to count deletions. + } + + @Override + public Map reduceInit() { + return new HashMap(10000); + } + + @Override + public Map reduce(Integer value, Map sum) { + Long curr = sum.get(value); + if (curr == null) + curr = 0L; + sum.put(value, curr + 1); + return sum; + } + + @Override + public void onTraversalDone(Map result) { + GATKReport report = GATKReport.newSimpleReport("BaseCoverageDistribution", "Coverage", "Count"); + for (Map.Entry entry : result.entrySet()) { + report.addRow(entry.getKey(), entry.getValue()); + } + report.print(out); + } +} From 3744d1a5961ab117b2f67b6cc7c4f7bd2184591a Mon Sep 17 00:00:00 2001 From: David Roazen Date: Mon, 28 Jan 2013 01:19:44 -0500 Subject: [PATCH 17/22] Collapse the downsampling fork in the GATK engine With LegacyLocusIteratorByState deleted, the legacy downsampling implementation was already non-functional. This commit removes all remaining code in the engine belonging to the legacy implementation. --- .../sting/gatk/GenomeAnalysisEngine.java | 18 +- .../sting/gatk/WalkerManager.java | 10 +- .../arguments/GATKArgumentCollection.java | 6 +- .../gatk/datasources/providers/LocusView.java | 8 - .../gatk/datasources/reads/BAMScheduler.java | 9 +- .../reads/LegacyReadShardBalancer.java | 130 ------------ .../gatk/datasources/reads/SAMDataSource.java | 128 ++---------- .../gatk/downsampling/DownsamplingMethod.java | 73 +++---- .../sting/gatk/executive/WindowMaker.java | 3 - .../iterators/LegacyDownsampleIterator.java | 77 ------- .../utils/LegacyReservoirDownsampler.java | 153 -------------- .../reads/DownsamplerBenchmark.java | 2 +- .../reads/ReadShardBalancerUnitTest.java | 28 +-- .../traversals/TraverseReadsUnitTest.java | 7 +- .../LegacyReservoirDownsamplerUnitTest.java | 191 ------------------ .../LocusIteratorByStateUnitTest.java | 8 +- 16 files changed, 78 insertions(+), 773 deletions(-) delete mode 100644 public/java/src/org/broadinstitute/sting/gatk/datasources/reads/LegacyReadShardBalancer.java delete mode 100644 public/java/src/org/broadinstitute/sting/gatk/iterators/LegacyDownsampleIterator.java delete mode 100644 public/java/src/org/broadinstitute/sting/utils/LegacyReservoirDownsampler.java delete mode 100644 public/java/test/org/broadinstitute/sting/utils/LegacyReservoirDownsamplerUnitTest.java diff --git a/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java b/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java index 9b801be7d..389b1371a 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java +++ b/public/java/src/org/broadinstitute/sting/gatk/GenomeAnalysisEngine.java @@ -434,12 +434,9 @@ public class GenomeAnalysisEngine { protected DownsamplingMethod getDownsamplingMethod() { GATKArgumentCollection argCollection = this.getArguments(); - // Legacy downsampler can only be selected via the command line, not via walker annotations - boolean useLegacyDownsampler = argCollection.useLegacyDownsampler; - DownsamplingMethod commandLineMethod = argCollection.getDownsamplingMethod(); - DownsamplingMethod walkerMethod = WalkerManager.getDownsamplingMethod(walker, useLegacyDownsampler); - DownsamplingMethod defaultMethod = DownsamplingMethod.getDefaultDownsamplingMethod(walker, useLegacyDownsampler); + DownsamplingMethod walkerMethod = WalkerManager.getDownsamplingMethod(walker); + DownsamplingMethod defaultMethod = DownsamplingMethod.getDefaultDownsamplingMethod(walker); DownsamplingMethod method = commandLineMethod != null ? commandLineMethod : (walkerMethod != null ? walkerMethod : defaultMethod); method.checkCompatibilityWithWalker(walker); @@ -572,15 +569,10 @@ public class GenomeAnalysisEngine { throw new UserException.CommandLineException("Pairs traversal cannot be used in conjunction with intervals."); } - // Use the legacy ReadShardBalancer if legacy downsampling is enabled - ShardBalancer readShardBalancer = downsamplingMethod != null && downsamplingMethod.useLegacyDownsampler ? - new LegacyReadShardBalancer() : - new ReadShardBalancer(); - if(intervals == null) - return readsDataSource.createShardIteratorOverAllReads(readShardBalancer); + return readsDataSource.createShardIteratorOverAllReads(new ReadShardBalancer()); else - return readsDataSource.createShardIteratorOverIntervals(intervals, readShardBalancer); + return readsDataSource.createShardIteratorOverIntervals(intervals, new ReadShardBalancer()); } else throw new ReviewedStingException("Unable to determine walker type for walker " + walker.getClass().getName()); @@ -793,7 +785,7 @@ public class GenomeAnalysisEngine { DownsamplingMethod downsamplingMethod = getDownsamplingMethod(); // Synchronize the method back into the collection so that it shows up when - // interrogating for the downsample method during command line recreation. + // interrogating for the downsampling method during command line recreation. setDownsamplingMethod(downsamplingMethod); logger.info(downsamplingMethod); diff --git a/public/java/src/org/broadinstitute/sting/gatk/WalkerManager.java b/public/java/src/org/broadinstitute/sting/gatk/WalkerManager.java index 62c2cdd13..6dfb2c2a5 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/WalkerManager.java +++ b/public/java/src/org/broadinstitute/sting/gatk/WalkerManager.java @@ -306,11 +306,10 @@ public class WalkerManager extends PluginManager { * downsampling method is specified on the command-line, the command-line version will * be used instead. * @param walker The walker to interrogate. - * @param useLegacyDownsampler If true, use the legacy downsampling implementation * @return The downsampling method, as specified by the walker. Null if none exists. */ - public static DownsamplingMethod getDownsamplingMethod(Walker walker, boolean useLegacyDownsampler) { - return getDownsamplingMethod(walker.getClass(), useLegacyDownsampler); + public static DownsamplingMethod getDownsamplingMethod( Walker walker ) { + return getDownsamplingMethod(walker.getClass()); } /** @@ -318,10 +317,9 @@ public class WalkerManager extends PluginManager { * downsampling method is specified on the command-line, the command-line version will * be used instead. * @param walkerClass The class of the walker to interrogate. - * @param useLegacyDownsampler If true, use the legacy downsampling implementation * @return The downsampling method, as specified by the walker. Null if none exists. */ - public static DownsamplingMethod getDownsamplingMethod(Class walkerClass, boolean useLegacyDownsampler) { + public static DownsamplingMethod getDownsamplingMethod( Class walkerClass ) { DownsamplingMethod downsamplingMethod = null; if( walkerClass.isAnnotationPresent(Downsample.class) ) { @@ -329,7 +327,7 @@ public class WalkerManager extends PluginManager { DownsampleType type = downsampleParameters.by(); Integer toCoverage = downsampleParameters.toCoverage() >= 0 ? downsampleParameters.toCoverage() : null; Double toFraction = downsampleParameters.toFraction() >= 0.0d ? downsampleParameters.toFraction() : null; - downsamplingMethod = new DownsamplingMethod(type,toCoverage,toFraction,useLegacyDownsampler); + downsamplingMethod = new DownsamplingMethod(type, toCoverage, toFraction); } return downsamplingMethod; diff --git a/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java b/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java index 62ca38ad2..9cd88001c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java +++ b/public/java/src/org/broadinstitute/sting/gatk/arguments/GATKArgumentCollection.java @@ -126,9 +126,6 @@ public class GATKArgumentCollection { @Argument(fullName = "downsample_to_coverage", shortName = "dcov", doc = "Coverage [integer] to downsample to at any given locus; note that downsampled reads are randomly selected from all possible reads at a locus. For non-locus-based traversals (eg., ReadWalkers), this sets the maximum number of reads at each alignment start position.", required = false) public Integer downsampleCoverage = null; - @Argument(fullName = "use_legacy_downsampler", shortName = "use_legacy_downsampler", doc = "Use the legacy downsampling implementation instead of the newer, less-tested implementation", required = false) - public boolean useLegacyDownsampler = false; - /** * Gets the downsampling method explicitly specified by the user. If the user didn't specify * a default downsampling mechanism, return the default. @@ -138,7 +135,7 @@ public class GATKArgumentCollection { if ( downsamplingType == null && downsampleFraction == null && downsampleCoverage == null ) return null; - return new DownsamplingMethod(downsamplingType, downsampleCoverage, downsampleFraction, useLegacyDownsampler); + return new DownsamplingMethod(downsamplingType, downsampleCoverage, downsampleFraction); } /** @@ -152,7 +149,6 @@ public class GATKArgumentCollection { downsamplingType = method.type; downsampleCoverage = method.toCoverage; downsampleFraction = method.toFraction; - useLegacyDownsampler = method.useLegacyDownsampler; } // -------------------------------------------------------------------------------------------------------------- diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusView.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusView.java index 3ff6e34fb..6b3661baa 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusView.java +++ b/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/LocusView.java @@ -162,14 +162,6 @@ public abstract class LocusView extends LocusIterator implements View { // Cache the current and apply filtering. AlignmentContext current = nextLocus; - // The old ALL_READS downsampling implementation -- use only if legacy downsampling was requested: - if ( sourceInfo.getDownsamplingMethod().useLegacyDownsampler && - sourceInfo.getDownsamplingMethod().type == DownsampleType.ALL_READS && - sourceInfo.getDownsamplingMethod().toCoverage != null ) { - - current.downsampleToCoverage(sourceInfo.getDownsamplingMethod().toCoverage); - } - // Indicate that the next operation will need to advance. nextLocus = null; diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/BAMScheduler.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/BAMScheduler.java index 0b41f15c0..8d7cfbaa7 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/BAMScheduler.java +++ b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/BAMScheduler.java @@ -133,14 +133,7 @@ public class BAMScheduler implements Iterator { Map currentPosition; - // Only use the deprecated SAMDataSource.getCurrentPosition() if we're not using experimental downsampling - // TODO: clean this up once the experimental downsampling engine fork collapses - if ( dataSource.getReadsInfo().getDownsamplingMethod() != null && dataSource.getReadsInfo().getDownsamplingMethod().useLegacyDownsampler ) { - currentPosition = dataSource.getCurrentPosition(); - } - else { - currentPosition = dataSource.getInitialReaderPositions(); - } + currentPosition = dataSource.getInitialReaderPositions(); for(SAMReaderID reader: dataSource.getReaderIDs()) filePointer.addFileSpans(reader,createSpanToEndOfFile(currentPosition.get(reader).getGATKChunks().get(0).getChunkStart())); diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/LegacyReadShardBalancer.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/LegacyReadShardBalancer.java deleted file mode 100644 index 510398157..000000000 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/LegacyReadShardBalancer.java +++ /dev/null @@ -1,130 +0,0 @@ -/* -* Copyright (c) 2012 The Broad Institute -* -* Permission is hereby granted, free of charge, to any person -* obtaining a copy of this software and associated documentation -* files (the "Software"), to deal in the Software without -* restriction, including without limitation the rights to use, -* copy, modify, merge, publish, distribute, sublicense, and/or sell -* copies of the Software, and to permit persons to whom the -* Software is furnished to do so, subject to the following -* conditions: -* -* The above copyright notice and this permission notice shall be -* included in all copies or substantial portions of the Software. -* -* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, -* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES -* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND -* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT -* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, -* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING -* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR -* THE USE OR OTHER DEALINGS IN THE SOFTWARE. -*/ - -package org.broadinstitute.sting.gatk.datasources.reads; - -import net.sf.samtools.GATKBAMFileSpan; -import net.sf.samtools.SAMFileSpan; - -import java.util.HashMap; -import java.util.Iterator; -import java.util.Map; -import java.util.NoSuchElementException; - -/** - * Divide up large file pointers containing reads into more manageable subcomponents. - * - * TODO: delete this class once the experimental downsampling engine fork collapses - */ -public class LegacyReadShardBalancer extends ShardBalancer { - /** - * Convert iterators of file pointers into balanced iterators of shards. - * @return An iterator over balanced shards. - */ - public Iterator iterator() { - return new Iterator() { - /** - * The cached shard to be returned next. Prefetched in the peekable iterator style. - */ - private Shard nextShard = null; - - /** - * The file pointer currently being processed. - */ - private FilePointer currentFilePointer; - - /** - * Ending position of the last shard in the file. - */ - private Map position = readsDataSource.getCurrentPosition(); - - { - if(filePointers.hasNext()) - currentFilePointer = filePointers.next(); - advance(); - } - - public boolean hasNext() { - return nextShard != null; - } - - public Shard next() { - if(!hasNext()) - throw new NoSuchElementException("No next read shard available"); - Shard currentShard = nextShard; - advance(); - return currentShard; - } - - public void remove() { - throw new UnsupportedOperationException("Unable to remove from shard balancing iterator"); - } - - private void advance() { - Map shardPosition; - nextShard = null; - - Map selectedReaders = new HashMap(); - while(selectedReaders.size() == 0 && currentFilePointer != null) { - shardPosition = currentFilePointer.fileSpans; - - for(SAMReaderID id: shardPosition.keySet()) { - SAMFileSpan fileSpan = new GATKBAMFileSpan(shardPosition.get(id).removeContentsBefore(position.get(id))); - selectedReaders.put(id,fileSpan); - } - - if(!isEmpty(selectedReaders)) { - Shard shard = new ReadShard(parser,readsDataSource,selectedReaders,currentFilePointer.locations,currentFilePointer.isRegionUnmapped); - readsDataSource.fillShard(shard); - - if(!shard.isBufferEmpty()) { - nextShard = shard; - break; - } - } - - selectedReaders.clear(); - currentFilePointer = filePointers.hasNext() ? filePointers.next() : null; - } - - position = readsDataSource.getCurrentPosition(); - } - - /** - * Detects whether the list of file spans contain any read data. - * @param selectedSpans Mapping of readers to file spans. - * @return True if file spans are completely empty; false otherwise. - */ - private boolean isEmpty(Map selectedSpans) { - for(SAMFileSpan fileSpan: selectedSpans.values()) { - if(!fileSpan.isEmpty()) - return false; - } - return true; - } - }; - } - -} diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java index c9a3b0df0..d52e55d6d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java +++ b/public/java/src/org/broadinstitute/sting/gatk/datasources/reads/SAMDataSource.java @@ -97,13 +97,6 @@ public class SAMDataSource { */ private final Map bamIndices = new HashMap(); - /** - * How far along is each reader? - * - * TODO: delete this once the experimental downsampling engine fork collapses - */ - private final Map readerPositions = new HashMap(); - /** * The merged header. */ @@ -298,8 +291,6 @@ public class SAMDataSource { this.sortOrder = sortOrder; } - initializeReaderPositions(readers); - mergedHeader = readers.getMergedHeader(); hasReadGroupCollisions = readers.hasReadGroupCollisions(); @@ -387,17 +378,6 @@ public class SAMDataSource { return resourcePool.getReaderID(read.getFileSource().getReader()); } - /** - * Retrieves the current position within the BAM file. - * @return A mapping of reader to current position. - * - * TODO: delete this once the experimental downsampling engine fork collapses - */ - @Deprecated - public Map getCurrentPosition() { - return readerPositions; - } - /** * Gets the merged header from the SAM file. * @return The merged header. @@ -475,67 +455,6 @@ public class SAMDataSource { } } - /** - * Legacy method to fill the given buffering shard with reads. - * - * Shard.fill() is used instead of this method unless legacy downsampling is enabled - * - * TODO: delete this method once the experimental downsampling engine fork collapses - * - * @param shard Shard to fill. - */ - @Deprecated - public void fillShard(Shard shard) { - if(!shard.buffersReads()) - throw new ReviewedStingException("Attempting to fill a non-buffering shard."); - - SAMReaders readers = resourcePool.getAvailableReaders(); - // Cache the most recently viewed read so that we can check whether we've reached the end of a pair. - SAMRecord read = null; - - Map positionUpdates = new IdentityHashMap(); - - CloseableIterator iterator = getIterator(readers,shard,sortOrder == SAMFileHeader.SortOrder.coordinate); - while(!shard.isBufferFull() && iterator.hasNext()) { - final SAMRecord nextRead = iterator.next(); - if ( read == null || (nextRead.getReferenceIndex().equals(read.getReferenceIndex())) ) { - // only add reads to the shard if they are on the same contig - read = nextRead; - shard.addRead(read); - noteFilePositionUpdate(positionUpdates,read); - } else { - break; - } - } - - // If the reads are sorted in queryname order, ensure that all reads - // having the same queryname become part of the same shard. - if(sortOrder == SAMFileHeader.SortOrder.queryname) { - while(iterator.hasNext()) { - SAMRecord nextRead = iterator.next(); - if(read == null || !read.getReadName().equals(nextRead.getReadName())) - break; - shard.addRead(nextRead); - noteFilePositionUpdate(positionUpdates,nextRead); - } - } - - iterator.close(); - - // Make the updates specified by the reader. - for(Map.Entry positionUpdate: positionUpdates.entrySet()) - readerPositions.put(readers.getReaderID(positionUpdate.getKey()),positionUpdate.getValue()); - } - - /* - * TODO: delete this method once the experimental downsampling engine fork collapses - */ - @Deprecated - private void noteFilePositionUpdate(Map positionMapping, SAMRecord read) { - GATKBAMFileSpan endChunk = new GATKBAMFileSpan(read.getFileSource().getFilePointer().getContentsFollowing()); - positionMapping.put(read.getFileSource().getReader(),endChunk); - } - public StingSAMIterator seek(Shard shard) { if(shard.buffersReads()) { return shard.iterator(); @@ -559,19 +478,6 @@ public class SAMDataSource { throw new ReviewedStingException("Unable to find id for reader associated with read " + read.getReadName()); } - /** - * Initialize the current reader positions - * - * TODO: delete this once the experimental downsampling engine fork collapses - * - * @param readers - */ - @Deprecated - private void initializeReaderPositions(SAMReaders readers) { - for(SAMReaderID id: getReaderIDs()) - readerPositions.put(id,new GATKBAMFileSpan(readers.getReader(id).getFilePointerSpanningReads())); - } - /** * Get the initial reader positions across all BAM files * @@ -646,7 +552,6 @@ public class SAMDataSource { enableVerification, readProperties.useOriginalBaseQualities(), new ReleasingIterator(readers,StingSAMIteratorAdapter.adapt(mergingIterator)), - readProperties.getDownsamplingMethod().toFraction, readProperties.getValidationExclusionList().contains(ValidationExclusion.TYPE.NO_READ_ORDER_VERIFICATION), readProperties.getSupplementalFilters(), readProperties.getReadTransformers(), @@ -704,7 +609,6 @@ public class SAMDataSource { * @param enableVerification Verify the order of reads. * @param useOriginalBaseQualities True if original base qualities should be used. * @param wrappedIterator the raw data source. - * @param downsamplingFraction whether and how much to downsample the reads themselves (not at a locus). * @param noValidationOfReadOrder Another trigger for the verifying iterator? TODO: look into this. * @param supplementalFilters additional filters to apply to the reads. * @param defaultBaseQualities if the reads have incomplete quality scores, set them all to defaultBaseQuality. @@ -715,7 +619,6 @@ public class SAMDataSource { boolean enableVerification, boolean useOriginalBaseQualities, StingSAMIterator wrappedIterator, - Double downsamplingFraction, Boolean noValidationOfReadOrder, Collection supplementalFilters, List readTransformers, @@ -727,30 +630,25 @@ public class SAMDataSource { // * (otherwise we will process something that we may end up throwing away) * // // ************************************************************************************************ // + // Filters: wrappedIterator = StingSAMIteratorAdapter.adapt(new CountingFilteringIterator(readMetrics,wrappedIterator,supplementalFilters)); - // If we're using the new downsampling implementation, apply downsampling iterators at this - // point in the read stream for most (but not all) cases - if ( ! readProperties.getDownsamplingMethod().useLegacyDownsampler ) { + // Downsampling: - // For locus traversals where we're downsampling to coverage by sample, assume that the downsamplers - // will be invoked downstream from us in LocusIteratorByState. This improves performance by avoiding - // splitting/re-assembly of the read stream at this stage, and also allows for partial downsampling - // of individual reads. - boolean assumeDownstreamLIBSDownsampling = isLocusBasedTraversal && - readProperties.getDownsamplingMethod().type == DownsampleType.BY_SAMPLE && - readProperties.getDownsamplingMethod().toCoverage != null; + // For locus traversals where we're downsampling to coverage by sample, assume that the downsamplers + // will be invoked downstream from us in LocusIteratorByState. This improves performance by avoiding + // splitting/re-assembly of the read stream at this stage, and also allows for partial downsampling + // of individual reads. + boolean assumeDownstreamLIBSDownsampling = isLocusBasedTraversal && + readProperties.getDownsamplingMethod().type == DownsampleType.BY_SAMPLE && + readProperties.getDownsamplingMethod().toCoverage != null; - if ( ! assumeDownstreamLIBSDownsampling ) { - wrappedIterator = applyDownsamplingIterator(wrappedIterator); - } + // Apply downsampling iterators here only in cases where we know that LocusIteratorByState won't be + // doing any downsampling downstream of us + if ( ! assumeDownstreamLIBSDownsampling ) { + wrappedIterator = applyDownsamplingIterator(wrappedIterator); } - // Use the old fractional downsampler only if we're using legacy downsampling: - // TODO: remove this statement (and associated classes) once the downsampling engine fork collapses - if ( readProperties.getDownsamplingMethod().useLegacyDownsampler && downsamplingFraction != null ) - wrappedIterator = new LegacyDownsampleIterator(wrappedIterator, downsamplingFraction); - // unless they've said not to validate read ordering (!noValidationOfReadOrder) and we've enabled verification, // verify the read ordering by applying a sort order iterator if (!noValidationOfReadOrder && enableVerification) diff --git a/public/java/src/org/broadinstitute/sting/gatk/downsampling/DownsamplingMethod.java b/public/java/src/org/broadinstitute/sting/gatk/downsampling/DownsamplingMethod.java index bc32f9188..5aa27608d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/downsampling/DownsamplingMethod.java +++ b/public/java/src/org/broadinstitute/sting/gatk/downsampling/DownsamplingMethod.java @@ -50,35 +50,43 @@ public class DownsamplingMethod { */ public final Double toFraction; - /** - * Use the legacy downsampling implementation instead of the newer implementation? - */ - public final boolean useLegacyDownsampler; - /** * Expresses no downsampling applied at all. */ - public static final DownsamplingMethod NONE = new DownsamplingMethod(DownsampleType.NONE,null,null,false); + public static final DownsamplingMethod NONE = new DownsamplingMethod(DownsampleType.NONE, null, null); /** * Default type to use if no type is specified */ - public static DownsampleType DEFAULT_DOWNSAMPLING_TYPE = DownsampleType.BY_SAMPLE; + public static final DownsampleType DEFAULT_DOWNSAMPLING_TYPE = DownsampleType.BY_SAMPLE; /** * Default target coverage for locus-based traversals */ - public static int DEFAULT_LOCUS_BASED_TRAVERSAL_DOWNSAMPLING_COVERAGE = 1000; + public static final int DEFAULT_LOCUS_TRAVERSAL_DOWNSAMPLING_COVERAGE = 1000; - public DownsamplingMethod( DownsampleType type, Integer toCoverage, Double toFraction, boolean useLegacyDownsampler ) { + /** + * Default downsampling method for locus-based traversals + */ + public static final DownsamplingMethod DEFAULT_LOCUS_TRAVERSAL_DOWNSAMPLING_METHOD = + new DownsamplingMethod(DEFAULT_DOWNSAMPLING_TYPE, DEFAULT_LOCUS_TRAVERSAL_DOWNSAMPLING_COVERAGE, null); + + /** + * Default downsampling method for read-based traversals + */ + public static final DownsamplingMethod DEFAULT_READ_TRAVERSAL_DOWNSAMPLING_METHOD = NONE; + + + public DownsamplingMethod( DownsampleType type, Integer toCoverage, Double toFraction ) { this.type = type != null ? type : DEFAULT_DOWNSAMPLING_TYPE; - this.toCoverage = toCoverage; - this.toFraction = toFraction; - this.useLegacyDownsampler = useLegacyDownsampler; if ( type == DownsampleType.NONE ) { - toCoverage = null; - toFraction = null; + this.toCoverage = null; + this.toFraction = null; + } + else { + this.toCoverage = toCoverage; + this.toFraction = toFraction; } validate(); @@ -87,34 +95,28 @@ public class DownsamplingMethod { private void validate() { // Can't leave toFraction and toCoverage null unless type is NONE if ( type != DownsampleType.NONE && toFraction == null && toCoverage == null ) - throw new UserException.CommandLineException("Must specify either toFraction or toCoverage when downsampling."); + throw new UserException("Must specify either toFraction or toCoverage when downsampling."); // Fraction and coverage cannot both be specified. if ( toFraction != null && toCoverage != null ) - throw new UserException.CommandLineException("Downsampling coverage and fraction are both specified. Please choose only one."); + throw new UserException("Downsampling coverage and fraction are both specified. Please choose only one."); // toCoverage must be > 0 when specified if ( toCoverage != null && toCoverage <= 0 ) { - throw new UserException.CommandLineException("toCoverage must be > 0 when downsampling to coverage"); + throw new UserException("toCoverage must be > 0 when downsampling to coverage"); } // toFraction must be >= 0.0 and <= 1.0 when specified if ( toFraction != null && (toFraction < 0.0 || toFraction > 1.0) ) { - throw new UserException.CommandLineException("toFraction must be >= 0.0 and <= 1.0 when downsampling to a fraction of reads"); + throw new UserException("toFraction must be >= 0.0 and <= 1.0 when downsampling to a fraction of reads"); } } public void checkCompatibilityWithWalker( Walker walker ) { boolean isLocusTraversal = walker instanceof LocusWalker || walker instanceof ActiveRegionWalker; - if ( ! isLocusTraversal && useLegacyDownsampler && toCoverage != null ) { - throw new UserException.CommandLineException("Downsampling to coverage for read-based traversals (eg., ReadWalkers) is not supported in the legacy downsampling implementation. " + - "The newer downsampling implementation does not have this limitation."); - } - - if ( isLocusTraversal && ! useLegacyDownsampler && type == DownsampleType.ALL_READS && toCoverage != null ) { - throw new UserException.CommandLineException("Downsampling to coverage with the ALL_READS method for locus-based traversals (eg., LocusWalkers) is not yet supported in the new downsampling implementation (though it is supported for ReadWalkers). " + - "You can run with --use_legacy_downsampler for a broken and poorly-maintained implementation of ALL_READS to-coverage downsampling, but this is not recommended."); + if ( isLocusTraversal && type == DownsampleType.ALL_READS && toCoverage != null ) { + throw new UserException("Downsampling to coverage with the ALL_READS method for locus-based traversals (eg., LocusWalkers) is not currently supported (though it is supported for ReadWalkers)."); } } @@ -128,31 +130,22 @@ public class DownsamplingMethod { builder.append(String.format("Method: %s, ", type)); if ( toCoverage != null ) { - builder.append(String.format("Target Coverage: %d, ", toCoverage)); + builder.append(String.format("Target Coverage: %d", toCoverage)); } else { - builder.append(String.format("Target Fraction: %.2f, ", toFraction)); - } - - if ( useLegacyDownsampler ) { - builder.append("Using the legacy downsampling implementation"); - } - else { - builder.append("Using the new downsampling implementation"); + builder.append(String.format("Target Fraction: %.2f", toFraction)); } } return builder.toString(); } - public static DownsamplingMethod getDefaultDownsamplingMethod( Walker walker, boolean useLegacyDownsampler ) { + public static DownsamplingMethod getDefaultDownsamplingMethod( Walker walker ) { if ( walker instanceof LocusWalker || walker instanceof ActiveRegionWalker ) { - return new DownsamplingMethod(DEFAULT_DOWNSAMPLING_TYPE, DEFAULT_LOCUS_BASED_TRAVERSAL_DOWNSAMPLING_COVERAGE, - null, useLegacyDownsampler); + return DEFAULT_LOCUS_TRAVERSAL_DOWNSAMPLING_METHOD; } else { - // Downsampling is off by default for non-locus-based traversals - return new DownsamplingMethod(DownsampleType.NONE, null, null, useLegacyDownsampler); + return DEFAULT_READ_TRAVERSAL_DOWNSAMPLING_METHOD; } } } diff --git a/public/java/src/org/broadinstitute/sting/gatk/executive/WindowMaker.java b/public/java/src/org/broadinstitute/sting/gatk/executive/WindowMaker.java index f587442d7..e9a2b56c2 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/executive/WindowMaker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/executive/WindowMaker.java @@ -111,9 +111,6 @@ public class WindowMaker implements Iterable, I this.sourceInfo = shard.getReadProperties(); this.readIterator = new GATKSAMIterator(iterator); - // Use the legacy version of LocusIteratorByState if legacy downsampling was requested: - if ( sourceInfo.getDownsamplingMethod().useLegacyDownsampler ) - throw new IllegalArgumentException("legacy downsampler no longer supported in the window maker"); this.libs = new LocusIteratorByState(readIterator,sourceInfo,genomeLocParser,sampleNames); this.sourceIterator = new PeekableIterator(libs); diff --git a/public/java/src/org/broadinstitute/sting/gatk/iterators/LegacyDownsampleIterator.java b/public/java/src/org/broadinstitute/sting/gatk/iterators/LegacyDownsampleIterator.java deleted file mode 100644 index d0992149e..000000000 --- a/public/java/src/org/broadinstitute/sting/gatk/iterators/LegacyDownsampleIterator.java +++ /dev/null @@ -1,77 +0,0 @@ -/* -* Copyright (c) 2012 The Broad Institute -* -* Permission is hereby granted, free of charge, to any person -* obtaining a copy of this software and associated documentation -* files (the "Software"), to deal in the Software without -* restriction, including without limitation the rights to use, -* copy, modify, merge, publish, distribute, sublicense, and/or sell -* copies of the Software, and to permit persons to whom the -* Software is furnished to do so, subject to the following -* conditions: -* -* The above copyright notice and this permission notice shall be -* included in all copies or substantial portions of the Software. -* -* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, -* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES -* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND -* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT -* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, -* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING -* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR -* THE USE OR OTHER DEALINGS IN THE SOFTWARE. -*/ - -package org.broadinstitute.sting.gatk.iterators; - -import net.sf.samtools.SAMRecord; -import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; - -import java.util.Iterator; - - -public class LegacyDownsampleIterator implements StingSAMIterator { - - StingSAMIterator it; - int cutoff; - SAMRecord next; - - public LegacyDownsampleIterator(StingSAMIterator it, double fraction) { - this.it = it; - cutoff = (int)(fraction * 10000); - next = getNextRecord(); - } - - public boolean hasNext() { - return next != null; - } - - public SAMRecord next() { - SAMRecord result = next; - next = getNextRecord(); - return result; - } - - public void remove() { - throw new UnsupportedOperationException("Can not remove records from a SAM file via an iterator!"); - } - - private SAMRecord getNextRecord() { - while ( true ) { - if ( !it.hasNext() ) - return null; - SAMRecord rec = it.next(); - if ( GenomeAnalysisEngine.getRandomGenerator().nextInt(10000) < cutoff ) - return rec; - } - } - - public void close() { - it.close(); - } - - public Iterator iterator() { - return this; - } -} \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/LegacyReservoirDownsampler.java b/public/java/src/org/broadinstitute/sting/utils/LegacyReservoirDownsampler.java deleted file mode 100644 index 2d590dd80..000000000 --- a/public/java/src/org/broadinstitute/sting/utils/LegacyReservoirDownsampler.java +++ /dev/null @@ -1,153 +0,0 @@ -/* -* Copyright (c) 2012 The Broad Institute -* -* Permission is hereby granted, free of charge, to any person -* obtaining a copy of this software and associated documentation -* files (the "Software"), to deal in the Software without -* restriction, including without limitation the rights to use, -* copy, modify, merge, publish, distribute, sublicense, and/or sell -* copies of the Software, and to permit persons to whom the -* Software is furnished to do so, subject to the following -* conditions: -* -* The above copyright notice and this permission notice shall be -* included in all copies or substantial portions of the Software. -* -* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, -* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES -* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND -* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT -* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, -* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING -* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR -* THE USE OR OTHER DEALINGS IN THE SOFTWARE. -*/ - -package org.broadinstitute.sting.utils; - -import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; -import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; - -import java.util.ArrayList; -import java.util.Collection; -import java.util.Iterator; - -/** - * THIS IMPLEMENTATION IS BROKEN AND WILL BE REMOVED ONCE THE DOWNSAMPLING ENGINE FORK COLLAPSES - * - * Randomly downsample from a stream of elements. This algorithm is a direct, - * naive implementation of reservoir downsampling as described in "Random Downsampling - * with a Reservoir" (Vitter 1985). At time of writing, this paper is located here: - * http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.138.784&rep=rep1&type=pdf - - * @author mhanna - * @version 0.1 - */ -public class LegacyReservoirDownsampler { - /** - * The reservoir of elements tracked by this downsampler. - */ - private final ArrayList reservoir; - - /** - * What is the maximum number of reads that can be returned in a single batch. - */ - private final int maxElements; - - /** - * Create a new downsampler with the given source iterator and given comparator. - * @param maxElements What is the maximum number of reads that can be returned in any call of this - */ - public LegacyReservoirDownsampler(final int maxElements) { - if(maxElements < 0) - throw new ReviewedStingException("Unable to work with an negative size collection of elements"); - this.reservoir = new ArrayList(maxElements); - this.maxElements = maxElements; - } - - /** - * Returns the eliminated element. - * @param element Eliminated element; null if no element has been eliminated. - * @return - */ - public T add(T element) { - if(maxElements <= 0) - return element; - else if(reservoir.size() < maxElements) { - reservoir.add(element); - return null; - } - else { - // Get a uniformly distributed int. If the chosen slot lives within the partition, replace the entry in that slot with the newest entry. - int slot = GenomeAnalysisEngine.getRandomGenerator().nextInt(maxElements); - if(slot >= 0 && slot < maxElements) { - T displaced = reservoir.get(slot); - reservoir.set(slot,element); - return displaced; - } - else - return element; - } - } - - public boolean addAll(Collection elements) { - boolean added = false; - for(T element: elements) - added |= (add(element) != null); - return added; - } - - /** - * Returns the contents of this reservoir, downsampled to the given value. Note that the return value - * @return The downsampled contents of this reservoir. - */ - public Collection getDownsampledContents() { - return reservoir; - } - - public void clear() { - reservoir.clear(); - } - - public boolean isEmpty() { - return reservoir.isEmpty(); - } - - public int size() { - return reservoir.size(); - } - - public Iterator iterator() { - return reservoir.iterator(); - } - - public boolean contains(Object o) { - return reservoir.contains(o); - } - - public boolean containsAll(Collection elements) { - return reservoir.containsAll(elements); - } - - public boolean retainAll(Collection elements) { - return reservoir.retainAll(elements); - } - - public boolean remove(Object o) { - return reservoir.remove(o); - } - - public boolean removeAll(Collection elements) { - return reservoir.removeAll(elements); - } - - public Object[] toArray() { - Object[] contents = new Object[reservoir.size()]; - reservoir.toArray(contents); - return contents; - } - - public T[] toArray(T[] array) { - return reservoir.toArray(array); - } -} diff --git a/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/DownsamplerBenchmark.java b/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/DownsamplerBenchmark.java index d960177d9..00389be97 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/DownsamplerBenchmark.java +++ b/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/DownsamplerBenchmark.java @@ -86,7 +86,7 @@ public class DownsamplerBenchmark extends ReadProcessingBenchmark { }, PER_SAMPLE { @Override - DownsamplingMethod create() { return DownsamplingMethod.getDefaultDownsamplingMethod(new CountLoci(), false); } + DownsamplingMethod create() { return DownsamplingMethod.getDefaultDownsamplingMethod(new CountLoci()); } }; abstract DownsamplingMethod create(); } diff --git a/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/ReadShardBalancerUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/ReadShardBalancerUnitTest.java index 049e8d6bb..40ec42ef1 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/ReadShardBalancerUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/datasources/reads/ReadShardBalancerUnitTest.java @@ -52,7 +52,7 @@ public class ReadShardBalancerUnitTest extends BaseTest { * Tests to ensure that ReadShardBalancer works as expected and does not place shard boundaries * at inappropriate places, such as within an alignment start position */ - private static class ExperimentalReadShardBalancerTest extends TestDataProvider { + private static class ReadShardBalancerTest extends TestDataProvider { private int numContigs; private int numStacksPerContig; private int stackSize; @@ -63,19 +63,19 @@ public class ReadShardBalancerUnitTest extends BaseTest { private SAMFileHeader header; private SAMReaderID testBAM; - public ExperimentalReadShardBalancerTest( int numContigs, - int numStacksPerContig, - int stackSize, - int numUnmappedReads, - int downsamplingTargetCoverage ) { - super(ExperimentalReadShardBalancerTest.class); + public ReadShardBalancerTest( int numContigs, + int numStacksPerContig, + int stackSize, + int numUnmappedReads, + int downsamplingTargetCoverage ) { + super(ReadShardBalancerTest.class); this.numContigs = numContigs; this.numStacksPerContig = numStacksPerContig; this.stackSize = stackSize; this.numUnmappedReads = numUnmappedReads; - this.downsamplingMethod = new DownsamplingMethod(DownsampleType.BY_SAMPLE, downsamplingTargetCoverage, null, false); + this.downsamplingMethod = new DownsamplingMethod(DownsampleType.BY_SAMPLE, downsamplingTargetCoverage, null); this.expectedReadCount = Math.min(stackSize, downsamplingTargetCoverage) * numStacksPerContig * numContigs + numUnmappedReads; setName(String.format("%s: numContigs=%d numStacksPerContig=%d stackSize=%d numUnmappedReads=%d downsamplingTargetCoverage=%d", @@ -176,8 +176,8 @@ public class ReadShardBalancerUnitTest extends BaseTest { } } - @DataProvider(name = "ExperimentalReadShardBalancerTestDataProvider") - public Object[][] createExperimentalReadShardBalancerTests() { + @DataProvider(name = "ReadShardBalancerTestDataProvider") + public Object[][] createReadShardBalancerTests() { for ( int numContigs = 1; numContigs <= 3; numContigs++ ) { for ( int numStacksPerContig : Arrays.asList(1, 2, 4) ) { // Use crucial read shard boundary values as the stack sizes @@ -185,18 +185,18 @@ public class ReadShardBalancerUnitTest extends BaseTest { for ( int numUnmappedReads : Arrays.asList(0, ReadShard.DEFAULT_MAX_READS / 2, ReadShard.DEFAULT_MAX_READS * 2) ) { // The first value will result in no downsampling at all, the others in some downsampling for ( int downsamplingTargetCoverage : Arrays.asList(ReadShard.DEFAULT_MAX_READS * 10, ReadShard.DEFAULT_MAX_READS, ReadShard.DEFAULT_MAX_READS / 2) ) { - new ExperimentalReadShardBalancerTest(numContigs, numStacksPerContig, stackSize, numUnmappedReads, downsamplingTargetCoverage); + new ReadShardBalancerTest(numContigs, numStacksPerContig, stackSize, numUnmappedReads, downsamplingTargetCoverage); } } } } } - return ExperimentalReadShardBalancerTest.getTests(ExperimentalReadShardBalancerTest.class); + return ReadShardBalancerTest.getTests(ReadShardBalancerTest.class); } - @Test(dataProvider = "ExperimentalReadShardBalancerTestDataProvider") - public void runExperimentalReadShardBalancerTest( ExperimentalReadShardBalancerTest test ) { + @Test(dataProvider = "ReadShardBalancerTestDataProvider") + public void runReadShardBalancerTest( ReadShardBalancerTest test ) { logger.warn("Running test: " + test); test.run(); diff --git a/public/java/test/org/broadinstitute/sting/gatk/traversals/TraverseReadsUnitTest.java b/public/java/test/org/broadinstitute/sting/gatk/traversals/TraverseReadsUnitTest.java index 4328e3047..8bc373fe8 100644 --- a/public/java/test/org/broadinstitute/sting/gatk/traversals/TraverseReadsUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/gatk/traversals/TraverseReadsUnitTest.java @@ -31,10 +31,7 @@ import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.commandline.Tags; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.datasources.providers.ReadShardDataProvider; -import org.broadinstitute.sting.gatk.datasources.reads.LegacyReadShardBalancer; -import org.broadinstitute.sting.gatk.datasources.reads.SAMDataSource; -import org.broadinstitute.sting.gatk.datasources.reads.SAMReaderID; -import org.broadinstitute.sting.gatk.datasources.reads.Shard; +import org.broadinstitute.sting.gatk.datasources.reads.*; import org.broadinstitute.sting.gatk.resourcemanagement.ThreadAllocation; import org.broadinstitute.sting.gatk.walkers.ReadWalker; import org.broadinstitute.sting.gatk.walkers.qc.CountReads; @@ -139,7 +136,7 @@ public class TraverseReadsUnitTest extends BaseTest { @Test public void testUnmappedReadCount() { SAMDataSource dataSource = new SAMDataSource(bamList,new ThreadAllocation(),null,genomeLocParser); - Iterable shardStrategy = dataSource.createShardIteratorOverAllReads(new LegacyReadShardBalancer()); + Iterable shardStrategy = dataSource.createShardIteratorOverAllReads(new ReadShardBalancer()); countReadWalker.initialize(); Object accumulator = countReadWalker.reduceInit(); diff --git a/public/java/test/org/broadinstitute/sting/utils/LegacyReservoirDownsamplerUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/LegacyReservoirDownsamplerUnitTest.java deleted file mode 100644 index bdcd4f600..000000000 --- a/public/java/test/org/broadinstitute/sting/utils/LegacyReservoirDownsamplerUnitTest.java +++ /dev/null @@ -1,191 +0,0 @@ -/* -* Copyright (c) 2012 The Broad Institute -* -* Permission is hereby granted, free of charge, to any person -* obtaining a copy of this software and associated documentation -* files (the "Software"), to deal in the Software without -* restriction, including without limitation the rights to use, -* copy, modify, merge, publish, distribute, sublicense, and/or sell -* copies of the Software, and to permit persons to whom the -* Software is furnished to do so, subject to the following -* conditions: -* -* The above copyright notice and this permission notice shall be -* included in all copies or substantial portions of the Software. -* -* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, -* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES -* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND -* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT -* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, -* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING -* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR -* THE USE OR OTHER DEALINGS IN THE SOFTWARE. -*/ - -package org.broadinstitute.sting.utils; - -import org.broadinstitute.sting.utils.sam.GATKSAMRecord; -import org.testng.Assert; -import org.testng.annotations.Test; -import org.broadinstitute.sting.utils.sam.ArtificialSAMUtils; -import net.sf.samtools.SAMRecord; -import net.sf.samtools.SAMFileHeader; - -import java.util.*; - -/** - * Basic tests to prove the integrity of the reservoir downsampler. - * At the moment, always run tests on SAM records as that's the task - * for which the downsampler was conceived. - * - * @author mhanna - * @version 0.1 - */ -public class LegacyReservoirDownsamplerUnitTest { - private static final SAMFileHeader header = ArtificialSAMUtils.createArtificialSamHeader(1,1,200); - - - @Test - public void testEmptyIterator() { - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(1); - Assert.assertTrue(downsampler.isEmpty(),"Downsampler is not empty but should be."); - } - - @Test - public void testOneElementWithPoolSizeOne() { - List reads = Collections.singletonList(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(1); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - Collection batchedReads = downsampler.getDownsampledContents(); - Assert.assertEquals(batchedReads.size(), 1, "Downsampler is returning the wrong number of reads"); - Assert.assertSame(batchedReads.iterator().next(), reads.get(0), "Downsampler is returning an incorrect read"); - } - - @Test - public void testOneElementWithPoolSizeGreaterThanOne() { - List reads = Collections.singletonList(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(5); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - Collection batchedReads = downsampler.getDownsampledContents(); - Assert.assertEquals(batchedReads.size(), 1, "Downsampler is returning the wrong number of reads"); - Assert.assertSame(batchedReads.iterator().next(), reads.get(0), "Downsampler is returning an incorrect read"); - - } - - @Test - public void testPoolFilledPartially() { - List reads = new ArrayList(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read2",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read3",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(5); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - List batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 3, "Downsampler is returning the wrong number of reads"); - - Assert.assertSame(batchedReads.get(0), reads.get(0), "Downsampler read 1 is incorrect"); - Assert.assertSame(batchedReads.get(1), reads.get(1), "Downsampler read 2 is incorrect"); - Assert.assertSame(batchedReads.get(2), reads.get(2), "Downsampler read 3 is incorrect"); - } - - @Test - public void testPoolFilledExactly() { - List reads = new ArrayList(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read2",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read3",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read4",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read5",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(5); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - List batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 5, "Downsampler is returning the wrong number of reads"); - Assert.assertSame(batchedReads.iterator().next(), reads.get(0), "Downsampler is returning an incorrect read"); - - Assert.assertSame(batchedReads.get(0), reads.get(0), "Downsampler read 1 is incorrect"); - Assert.assertSame(batchedReads.get(1), reads.get(1), "Downsampler read 2 is incorrect"); - Assert.assertSame(batchedReads.get(2), reads.get(2), "Downsampler read 3 is incorrect"); - Assert.assertSame(batchedReads.get(3), reads.get(3), "Downsampler read 4 is incorrect"); - Assert.assertSame(batchedReads.get(4), reads.get(4), "Downsampler read 5 is incorrect"); - } - - @Test - public void testLargerPileWithZeroElementPool() { - List reads = new ArrayList(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read2",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read3",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(0); - downsampler.addAll(reads); - - Assert.assertTrue(downsampler.isEmpty(),"Downsampler isn't empty but should be"); - List batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 0, "Downsampler is returning the wrong number of reads"); - } - - @Test - public void testLargerPileWithSingleElementPool() { - List reads = new ArrayList(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read2",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read3",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read4",0,1,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read5",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(1); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - List batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 1, "Downsampler is returning the wrong number of reads"); - Assert.assertTrue(reads.contains(batchedReads.get(0)),"Downsampler is returning a bad read."); - } - - @Test - public void testFillingAcrossLoci() { - List reads = new ArrayList(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read1",0,1,76)); - LegacyReservoirDownsampler downsampler = new LegacyReservoirDownsampler(5); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - List batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 1, "Downsampler is returning the wrong number of reads"); - Assert.assertEquals(batchedReads.get(0), reads.get(0), "Downsampler is returning an incorrect read."); - - reads.clear(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read2",0,2,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read3",0,2,76)); - - downsampler.clear(); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 2, "Downsampler is returning the wrong number of reads"); - Assert.assertEquals(batchedReads.get(0), reads.get(0), "Downsampler is returning an incorrect read."); - Assert.assertEquals(batchedReads.get(1), reads.get(1), "Downsampler is returning an incorrect read."); - - reads.clear(); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read4",0,3,76)); - reads.add(ArtificialSAMUtils.createArtificialRead(header,"read5",0,3,76)); - - downsampler.clear(); - downsampler.addAll(reads); - - Assert.assertFalse(downsampler.isEmpty(),"Downsampler is empty but shouldn't be"); - batchedReads = new ArrayList(downsampler.getDownsampledContents()); - Assert.assertEquals(batchedReads.size(), 2, "Downsampler is returning the wrong number of reads"); - Assert.assertEquals(batchedReads.get(0), reads.get(0), "Downsampler is returning an incorrect read."); - Assert.assertEquals(batchedReads.get(1), reads.get(1), "Downsampler is returning an incorrect read."); - } - -} diff --git a/public/java/test/org/broadinstitute/sting/utils/locusiterator/LocusIteratorByStateUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/locusiterator/LocusIteratorByStateUnitTest.java index 4e7a783e5..eb7e61ed8 100644 --- a/public/java/test/org/broadinstitute/sting/utils/locusiterator/LocusIteratorByStateUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/locusiterator/LocusIteratorByStateUnitTest.java @@ -474,8 +474,8 @@ public class LocusIteratorByStateUnitTest extends LocusIteratorByStateBaseTest { final boolean downsample = downsampleTo != -1; final DownsamplingMethod downsampler = downsample - ? new DownsamplingMethod(DownsampleType.BY_SAMPLE, downsampleTo, null, false) - : new DownsamplingMethod(DownsampleType.NONE, null, null, false); + ? new DownsamplingMethod(DownsampleType.BY_SAMPLE, downsampleTo, null) + : new DownsamplingMethod(DownsampleType.NONE, null, null); final ArtificialBAMBuilder bamBuilder = new ArtificialBAMBuilder(header.getSequenceDictionary(), nReadsPerLocus, nLoci); bamBuilder.createAndSetHeader(nSamples).setReadLength(readLength).setAlignmentStart(1); @@ -635,8 +635,8 @@ public class LocusIteratorByStateUnitTest extends LocusIteratorByStateBaseTest { final boolean downsample = downsampleTo != -1; final DownsamplingMethod downsampler = downsample - ? new DownsamplingMethod(DownsampleType.BY_SAMPLE, downsampleTo, null, false) - : new DownsamplingMethod(DownsampleType.NONE, null, null, false); + ? new DownsamplingMethod(DownsampleType.BY_SAMPLE, downsampleTo, null) + : new DownsamplingMethod(DownsampleType.NONE, null, null); // final List reads = ArtificialSAMUtils.createReadStream(nReadsPerLocus, nLoci, header, 1, readLength); From 1599c9a20e3c25faa899f496d76f7344c38e1e9b Mon Sep 17 00:00:00 2001 From: David Roazen Date: Mon, 28 Jan 2013 02:40:18 -0500 Subject: [PATCH 18/22] Remove the ability to package GATK/Queue Lite from the build system Still need to reconfigure Bamboo to open-source protected, but this can be done during the 2.4 release freeze. --- build.xml | 27 ---------------- public/packages/GenomeAnalysisTKLite.xml | 39 ----------------------- public/packages/QueueLite.xml | 40 ------------------------ 3 files changed, 106 deletions(-) delete mode 100644 public/packages/GenomeAnalysisTKLite.xml delete mode 100644 public/packages/QueueLite.xml diff --git a/build.xml b/build.xml index 2dfff0cc2..e92e41c10 100644 --- a/build.xml +++ b/build.xml @@ -873,10 +873,6 @@ - - - - @@ -885,10 +881,6 @@ - - - - @@ -939,15 +931,10 @@ - - - - - @@ -956,13 +943,8 @@ - - - - - @@ -1006,14 +988,10 @@ - - - - @@ -1363,13 +1341,8 @@ - - - - - diff --git a/public/packages/GenomeAnalysisTKLite.xml b/public/packages/GenomeAnalysisTKLite.xml deleted file mode 100644 index b2f73434c..000000000 --- a/public/packages/GenomeAnalysisTKLite.xml +++ /dev/null @@ -1,39 +0,0 @@ - - - - - - - - - - - - - - - - - diff --git a/public/packages/QueueLite.xml b/public/packages/QueueLite.xml deleted file mode 100644 index 0ead68fb0..000000000 --- a/public/packages/QueueLite.xml +++ /dev/null @@ -1,40 +0,0 @@ - - - - - - - - - - - - - - - - - - From f63f27aa13250afd9730d192b2ce362dd6a11f14 Mon Sep 17 00:00:00 2001 From: David Roazen Date: Tue, 8 Jan 2013 14:45:50 -0500 Subject: [PATCH 19/22] org.broadinstitute.variant refactor, part 2 -removed sting dependencies from test classes -removed org.apache.log4j dependency -misc cleanup --- .../gatk/walkers/annotator/RankSumTest.java | 2 +- .../annotator/TandemRepeatAnnotator.java | 6 +- .../gatk/walkers/bqsr/BaseRecalibrator.java | 2 +- .../reducereads/MultiSampleCompressor.java | 2 +- .../reducereads/SingleSampleCompressor.java | 2 +- .../reducereads/SlidingWindow.java | 2 +- .../genotyper/ConsensusAlleleCounter.java | 2 +- .../GeneralPloidyGenotypeLikelihoods.java | 2 +- ...dyGenotypeLikelihoodsCalculationModel.java | 2 +- .../genotyper/UnifiedArgumentCollection.java | 4 +- .../walkers/genotyper/UnifiedGenotyper.java | 4 +- .../genotyper/UnifiedGenotyperEngine.java | 7 +- .../genotyper/afcalc/DiploidExactAFCalc.java | 5 +- .../walkers/genotyper/afcalc/ExactAFCalc.java | 4 +- .../afcalc/GeneralPloidyExactAFCalc.java | 5 +- .../afcalc/OriginalDiploidExactAFCalc.java | 2 +- .../haplotypecaller/GenotypingEngine.java | 3 +- .../haplotypecaller/HaplotypeCaller.java | 5 +- .../gatk/walkers/indels/IndelRealigner.java | 2 +- .../validation/GenotypeAndValidate.java | 2 +- .../variantutils/RegenotypeVariants.java | 3 +- .../utils/recalibration/RecalDatumNode.java | 2 +- .../sting/utils/recalibration/RecalUtils.java | 2 +- .../recalibration/RecalibrationReport.java | 2 +- .../covariates/RepeatLengthCovariate.java | 4 +- ...eralPloidyGenotypeLikelihoodsUnitTest.java | 2 +- .../afcalc/AFCalcPerformanceUnitTest.java | 2 +- .../StratificationManagerUnitTest.java | 2 +- .../variantutils/CombineVariantsUnitTest.java | 6 +- .../ConcordanceMetricsUnitTest.java | 8 +- .../sting/commandline/ParsingEngine.java | 2 +- .../providers/RODMetaDataContainer.java | 2 +- .../sting/gatk/executive/Accumulator.java | 2 +- .../gatk/refdata/tracks/RMDTrackBuilder.java | 2 +- .../sting/gatk/walkers/Walker.java | 2 +- .../walkers/coverage/DepthOfCoverage.java | 2 +- .../walkers/coverage/GCContentByInterval.java | 2 +- .../diagnostics/CoveredByNSamplesSites.java | 5 - .../fasta/FastaAlternateReferenceMaker.java | 2 +- .../walkers/fasta/FastaReferenceMaker.java | 3 +- .../sting/gatk/walkers/qc/CountIntervals.java | 2 +- .../sting/gatk/walkers/qc/CountRODs.java | 2 +- .../sting/gatk/walkers/qc/CountRODsByRef.java | 2 +- .../gatk/walkers/qc/CountTerminusEvent.java | 2 +- .../gatk/walkers/readutils/ClipReads.java | 2 +- .../gatk/walkers/varianteval/VariantEval.java | 3 +- .../varianteval/VariantEvalReportWriter.java | 2 +- .../stratifications/TandemRepeat.java | 4 +- .../manager/StratificationManager.java | 3 +- .../walkers/variantutils/CombineVariants.java | 2 +- .../variantutils/GenotypeConcordance.java | 2 +- .../walkers/variantutils/SelectHeaders.java | 2 +- .../walkers/variantutils/SelectVariants.java | 2 +- .../sting/tools/CatVariants.java | 2 +- .../sting/utils/MannWhitneyU.java | 2 +- .../sting/utils/SWPairwiseAlignment.java | 52 +- .../sting/utils/SampleUtils.java | 2 +- .../broadinstitute/sting/utils/baq/BAQ.java | 2 +- .../sting/utils/duplicates/DupUtils.java | 2 +- .../sting/utils/fragments/FragmentUtils.java | 2 +- .../help/GenericDocumentationHandler.java | 2 +- .../sting/utils/interval/IntervalUtils.java | 2 +- .../sting/utils/sam/ReadUtils.java | 2 +- .../sting/utils/variant/GATKVCFUtils.java | 30 +- .../variant/GATKVariantContextUtils.java | 431 ----------------- .../variant/bcf2/BCF2Codec.java | 8 +- .../variant/bcf2/BCF2Decoder.java | 10 +- .../bcf2/BCF2GenotypeFieldDecoders.java | 2 - .../bcf2/BCF2LazyGenotypesDecoder.java | 5 - .../utils/{Utils.java => GeneralUtils.java} | 102 +++- .../collections => variant/utils}/Pair.java | 2 +- .../variantcontext/GenotypeLikelihoods.java | 6 +- .../variantcontext/VariantContext.java | 11 +- .../variantcontext/VariantContextUtils.java | 445 +++++++++++++++++- .../variantcontext/VariantJEXLContext.java | 4 +- .../writer/BCF2FieldWriterManager.java | 7 +- .../variantcontext/writer/BCF2Writer.java | 9 +- .../variant/vcf/AbstractVCFCodec.java | 14 +- .../variant/vcf/VCFCompoundHeaderLine.java | 7 +- .../broadinstitute/variant/vcf/VCFHeader.java | 21 +- .../variant/vcf/VCFStandardHeaderLines.java | 15 +- .../broadinstitute/variant/vcf/VCFUtils.java | 52 +- .../org/broadinstitute/sting/WalkerTest.java | 2 +- .../sting/utils/MWUnitTest.java | 4 +- .../BandPassActivityProfileUnitTest.java | 2 +- .../utils/variant}/VCFIntegrationTest.java | 3 +- .../variant}/VariantContextBenchmark.java | 6 +- .../variant/VariantBaseTest.java | 141 ++++++ .../bcf2/BCF2EncoderDecoderUnitTest.java | 9 +- .../variant/bcf2/BCF2UtilsUnitTest.java | 10 +- .../variant/utils/BaseUtilsUnitTest.java | 13 +- .../variantcontext/AlleleUnitTest.java | 3 +- .../GenotypeLikelihoodsUnitTest.java | 10 +- .../variantcontext/GenotypeUnitTest.java | 4 +- .../GenotypesContextUnitTest.java | 8 +- .../VariantContextTestProvider.java | 31 +- .../VariantContextUnitTest.java | 39 +- .../VariantContextUtilsUnitTest.java | 26 +- .../VariantJEXLContextUnitTest.java | 26 +- .../writer/VCFWriterUnitTest.java | 23 +- .../writer/VariantContextWritersUnitTest.java | 9 +- .../variant/vcf/IndexFactoryUnitTest.java | 15 +- .../variant/vcf/VCFHeaderUnitTest.java | 13 +- .../vcf/VCFStandardHeaderLinesUnitTest.java | 4 +- 104 files changed, 979 insertions(+), 825 deletions(-) rename public/java/src/org/broadinstitute/variant/utils/{Utils.java => GeneralUtils.java} (64%) rename public/java/src/org/broadinstitute/{sting/utils/collections => variant/utils}/Pair.java (98%) rename public/java/test/org/broadinstitute/{variant/vcf => sting/utils/variant}/VCFIntegrationTest.java (98%) rename public/java/test/org/broadinstitute/{variant/variantcontext => sting/utils/variant}/VariantContextBenchmark.java (99%) create mode 100644 public/java/test/org/broadinstitute/variant/VariantBaseTest.java diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java index ec107512a..6f965227c 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/RankSumTest.java @@ -57,7 +57,7 @@ import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.sting.utils.MannWhitneyU; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.variant.vcf.VCFHeaderLine; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.variant.variantcontext.Allele; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TandemRepeatAnnotator.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TandemRepeatAnnotator.java index 2ec53133d..a6b713551 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TandemRepeatAnnotator.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/annotator/TandemRepeatAnnotator.java @@ -53,11 +53,11 @@ import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompa import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.InfoFieldAnnotation; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.StandardAnnotation; import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.variant.utils.Pair; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; import org.broadinstitute.variant.vcf.VCFHeaderLineCount; import org.broadinstitute.variant.vcf.VCFHeaderLineType; import org.broadinstitute.variant.vcf.VCFInfoHeaderLine; -import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.variant.variantcontext.VariantContext; import java.util.Arrays; @@ -79,7 +79,7 @@ public class TandemRepeatAnnotator extends InfoFieldAnnotation implements Standa if ( !vc.isIndel()) return null; - Pair,byte[]> result = GATKVariantContextUtils.getNumTandemRepeatUnits(vc, ref.getForwardBases()); + Pair,byte[]> result = VariantContextUtils.getNumTandemRepeatUnits(vc, ref.getForwardBases()); if (result == null) return null; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java index 76e4374d1..d6c5e82f6 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/bqsr/BaseRecalibrator.java @@ -63,7 +63,7 @@ import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.variant.utils.BaseUtils; import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.clipping.ReadClipper; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/MultiSampleCompressor.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/MultiSampleCompressor.java index 6818669df..50d741f13 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/MultiSampleCompressor.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/MultiSampleCompressor.java @@ -49,7 +49,7 @@ package org.broadinstitute.sting.gatk.walkers.compression.reducereads; import net.sf.samtools.SAMFileHeader; import org.apache.log4j.Logger; import org.broadinstitute.sting.utils.SampleUtils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.sam.AlignmentStartWithNoTiesComparator; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SingleSampleCompressor.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SingleSampleCompressor.java index 036d2782a..5b08e99a0 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SingleSampleCompressor.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SingleSampleCompressor.java @@ -46,7 +46,7 @@ package org.broadinstitute.sting.gatk.walkers.compression.reducereads; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.sam.AlignmentStartWithNoTiesComparator; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java index 58282e216..e91120f1c 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/compression/reducereads/SlidingWindow.java @@ -52,7 +52,7 @@ import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import net.sf.samtools.SAMFileHeader; import org.broadinstitute.sting.gatk.downsampling.ReservoirDownsampler; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.recalibration.EventType; import org.broadinstitute.sting.utils.sam.AlignmentStartWithNoTiesComparator; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ConsensusAlleleCounter.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ConsensusAlleleCounter.java index 2257adf6a..90904ab29 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ConsensusAlleleCounter.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/ConsensusAlleleCounter.java @@ -53,7 +53,7 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.clipping.ReadClipper; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java index cf144a735..6a5fbce39 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoods.java @@ -51,7 +51,7 @@ import org.broadinstitute.sting.gatk.walkers.genotyper.afcalc.ExactACcounts; import org.broadinstitute.sting.gatk.walkers.genotyper.afcalc.ExactACset; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.variant.vcf.VCFConstants; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java index 3e0437edb..23804bb23 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsCalculationModel.java @@ -56,7 +56,7 @@ import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.variant.vcf.VCFConstants; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.variant.variantcontext.*; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java index a7f90ebec..e97c92309 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedArgumentCollection.java @@ -49,8 +49,8 @@ package org.broadinstitute.sting.gatk.walkers.genotyper; import org.broadinstitute.sting.commandline.*; import org.broadinstitute.sting.gatk.arguments.StandardCallerArgumentCollection; import org.broadinstitute.sting.utils.pairhmm.PairHMM; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.VariantContext; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; public class UnifiedArgumentCollection extends StandardCallerArgumentCollection { @@ -172,7 +172,7 @@ public class UnifiedArgumentCollection extends StandardCallerArgumentCollection Sample ploidy - equivalent to number of chromosomes per pool. In pooled experiments this should be = # of samples in pool * individual sample ploidy */ @Argument(shortName="ploidy", fullName="sample_ploidy", doc="Plody (number of chromosomes) per sample. For pooled data, set to (Number of samples in each pool * Sample Ploidy).", required=false) - public int samplePloidy = GATKVariantContextUtils.DEFAULT_PLOIDY; + public int samplePloidy = VariantContextUtils.DEFAULT_PLOIDY; @Hidden @Argument(shortName="minqs", fullName="min_quality_score", doc="Min quality score to consider. Smaller numbers process faster. Default: Q1.", required=false) diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java index d16ece4fd..46ac10d90 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyper.java @@ -61,7 +61,7 @@ import org.broadinstitute.sting.gatk.walkers.annotator.VariantAnnotatorEngine; import org.broadinstitute.sting.gatk.walkers.annotator.interfaces.AnnotatorCompatible; import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.baq.BAQ; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; import org.broadinstitute.variant.vcf.*; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; @@ -304,7 +304,7 @@ public class UnifiedGenotyper extends LocusWalker, Unif headerInfo.add(new VCFInfoHeaderLine(UnifiedGenotyperEngine.NUMBER_OF_DISCOVERED_ALLELES_KEY, 1, VCFHeaderLineType.Integer, "Number of alternate alleles discovered (but not necessarily genotyped) at this site")); // add the pool values for each genotype - if (UAC.samplePloidy != GATKVariantContextUtils.DEFAULT_PLOIDY) { + if (UAC.samplePloidy != VariantContextUtils.DEFAULT_PLOIDY) { headerInfo.add(new VCFFormatHeaderLine(VCFConstants.MLE_PER_SAMPLE_ALLELE_COUNT_KEY, VCFHeaderLineCount.A, VCFHeaderLineType.Integer, "Maximum likelihood expectation (MLE) for the alternate allele count, in the same order as listed, for each individual sample")); headerInfo.add(new VCFFormatHeaderLine(VCFConstants.MLE_PER_SAMPLE_ALLELE_FRACTION_KEY, VCFHeaderLineCount.A, VCFHeaderLineType.Float, "Maximum likelihood expectation (MLE) for the alternate allele fraction, in the same order as listed, for each individual sample")); } diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java index 8f6097661..b1aaf8190 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/UnifiedGenotyperEngine.java @@ -61,7 +61,6 @@ import org.broadinstitute.sting.gatk.walkers.genotyper.afcalc.AFCalcResult; import org.broadinstitute.sting.utils.*; import org.broadinstitute.sting.utils.baq.BAQ; import org.broadinstitute.sting.utils.classloader.PluginManager; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.utils.BaseUtils; import org.broadinstitute.variant.vcf.VCFConstants; import org.broadinstitute.sting.utils.exceptions.UserException; @@ -135,7 +134,7 @@ public class UnifiedGenotyperEngine { // --------------------------------------------------------------------------------------------------------- @Requires({"toolkit != null", "UAC != null"}) public UnifiedGenotyperEngine(GenomeAnalysisEngine toolkit, UnifiedArgumentCollection UAC) { - this(toolkit, UAC, Logger.getLogger(UnifiedGenotyperEngine.class), null, null, SampleUtils.getSAMFileSamples(toolkit.getSAMFileHeader()), GATKVariantContextUtils.DEFAULT_PLOIDY); + this(toolkit, UAC, Logger.getLogger(UnifiedGenotyperEngine.class), null, null, SampleUtils.getSAMFileSamples(toolkit.getSAMFileHeader()), VariantContextUtils.DEFAULT_PLOIDY); } @Requires({"toolkit != null", "UAC != null", "logger != null", "samples != null && samples.size() > 0","ploidy>0"}) @@ -526,7 +525,7 @@ public class UnifiedGenotyperEngine { // if we are subsetting alleles (either because there were too many or because some were not polymorphic) // then we may need to trim the alleles (because the original VariantContext may have had to pad at the end). if ( myAlleles.size() != vc.getAlleles().size() && !limitedContext ) // limitedContext callers need to handle allele trimming on their own to keep their perReadAlleleLikelihoodMap alleles in sync - vcCall = GATKVariantContextUtils.reverseTrimAlleles(vcCall); + vcCall = VariantContextUtils.reverseTrimAlleles(vcCall); if ( annotationEngine != null && !limitedContext ) { // limitedContext callers need to handle annotations on their own by calling their own annotationEngine // Note: we want to use the *unfiltered* and *unBAQed* context for the annotations @@ -663,7 +662,7 @@ public class UnifiedGenotyperEngine { private void determineGLModelsToUse() { String modelPrefix = ""; - if ( !UAC.GLmodel.name().contains(GPSTRING) && UAC.samplePloidy != GATKVariantContextUtils.DEFAULT_PLOIDY ) + if ( !UAC.GLmodel.name().contains(GPSTRING) && UAC.samplePloidy != VariantContextUtils.DEFAULT_PLOIDY ) modelPrefix = GPSTRING; if ( UAC.GLmodel.name().toUpperCase().contains("BOTH") ) { diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/DiploidExactAFCalc.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/DiploidExactAFCalc.java index 170b6e250..68f57a300 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/DiploidExactAFCalc.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/DiploidExactAFCalc.java @@ -47,7 +47,6 @@ package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.*; import java.util.*; @@ -106,7 +105,7 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc { alleles.add(vc.getReference()); alleles.addAll(chooseMostLikelyAlternateAlleles(vc, getMaxAltAlleles())); builder.alleles(alleles); - builder.genotypes(GATKVariantContextUtils.subsetDiploidAlleles(vc, alleles, false)); + builder.genotypes(VariantContextUtils.subsetDiploidAlleles(vc, alleles, false)); return builder.make(); } else { return vc; @@ -352,6 +351,6 @@ public abstract class DiploidExactAFCalc extends ExactAFCalc { final List allelesToUse, final boolean assignGenotypes, final int ploidy) { - return GATKVariantContextUtils.subsetDiploidAlleles(vc, allelesToUse, assignGenotypes); + return VariantContextUtils.subsetDiploidAlleles(vc, allelesToUse, assignGenotypes); } } diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/ExactAFCalc.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/ExactAFCalc.java index 3d28db159..cf6b67afd 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/ExactAFCalc.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/ExactAFCalc.java @@ -47,10 +47,10 @@ package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.Allele; import org.broadinstitute.variant.variantcontext.Genotype; import org.broadinstitute.variant.variantcontext.GenotypesContext; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; import java.util.ArrayList; @@ -92,7 +92,7 @@ abstract class ExactAFCalc extends AFCalc { if ( sample.hasLikelihoods() ) { double[] gls = sample.getLikelihoods().getAsVector(); - if ( MathUtils.sum(gls) < GATKVariantContextUtils.SUM_GL_THRESH_NOCALL ) + if ( MathUtils.sum(gls) < VariantContextUtils.SUM_GL_THRESH_NOCALL ) genotypeLikelihoods.add(gls); } } diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java index f8c364e82..1e1652c68 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/GeneralPloidyExactAFCalc.java @@ -48,7 +48,6 @@ package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; import org.broadinstitute.sting.gatk.walkers.genotyper.GeneralPloidyGenotypeLikelihoods; import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.vcf.VCFConstants; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.variant.variantcontext.*; @@ -554,7 +553,7 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc { } // if there is no mass on the (new) likelihoods, then just no-call the sample - if ( MathUtils.sum(newLikelihoods) > GATKVariantContextUtils.SUM_GL_THRESH_NOCALL ) { + if ( MathUtils.sum(newLikelihoods) > VariantContextUtils.SUM_GL_THRESH_NOCALL ) { newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES)); } else { @@ -566,7 +565,7 @@ public class GeneralPloidyExactAFCalc extends ExactAFCalc { gb.PL(newLikelihoods); // if we weren't asked to assign a genotype, then just no-call the sample - if ( !assignGenotypes || MathUtils.sum(newLikelihoods) > GATKVariantContextUtils.SUM_GL_THRESH_NOCALL ) + if ( !assignGenotypes || MathUtils.sum(newLikelihoods) > VariantContextUtils.SUM_GL_THRESH_NOCALL ) gb.alleles(NO_CALL_ALLELES); else assignGenotype(gb, newLikelihoods, allelesToUse, ploidy); diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/OriginalDiploidExactAFCalc.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/OriginalDiploidExactAFCalc.java index 325d3b722..92305fe4b 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/OriginalDiploidExactAFCalc.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/OriginalDiploidExactAFCalc.java @@ -47,7 +47,7 @@ package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.Allele; import org.broadinstitute.variant.variantcontext.VariantContext; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java index 27e921432..fa15eccdf 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/GenotypingEngine.java @@ -57,7 +57,6 @@ import org.broadinstitute.sting.utils.*; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.genotyper.PerReadAlleleLikelihoodMap; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.utils.BaseUtils; import org.broadinstitute.variant.variantcontext.*; @@ -204,7 +203,7 @@ public class GenotypingEngine { VariantContext annotatedCall = annotationEngine.annotateContext(stratifiedReadMap, call); if( annotatedCall.getAlleles().size() != mergedVC.getAlleles().size() ) { // some alleles were removed so reverseTrimming might be necessary! - annotatedCall = GATKVariantContextUtils.reverseTrimAlleles(annotatedCall); + annotatedCall = VariantContextUtils.reverseTrimAlleles(annotatedCall); } returnCalls.add( annotatedCall ); diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java index 8b3eb9f1b..455809a17 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/HaplotypeCaller.java @@ -72,7 +72,6 @@ import org.broadinstitute.sting.utils.activeregion.ActiveRegion; import org.broadinstitute.sting.utils.activeregion.ActiveRegionReadState; import org.broadinstitute.sting.utils.activeregion.ActivityProfileState; import org.broadinstitute.sting.utils.clipping.ReadClipper; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.vcf.*; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; @@ -298,7 +297,7 @@ public class HaplotypeCaller extends ActiveRegionWalker implem samplesList.addAll( samples ); // initialize the UnifiedGenotyper Engine which is used to call into the exact model final UnifiedArgumentCollection UAC = new UnifiedArgumentCollection( SCAC ); // this adapter is used so that the full set of unused UG arguments aren't exposed to the HC user - UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC, logger, null, null, samples, GATKVariantContextUtils.DEFAULT_PLOIDY); + UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY); // create a UAC but with the exactCallsLog = null, so we only output the log for the HC caller itself, if requested UnifiedArgumentCollection simpleUAC = new UnifiedArgumentCollection(UAC); @@ -308,7 +307,7 @@ public class HaplotypeCaller extends ActiveRegionWalker implem simpleUAC.STANDARD_CONFIDENCE_FOR_EMITTING = Math.min( 4.0, UAC.STANDARD_CONFIDENCE_FOR_EMITTING ); // low values used for isActive determination only, default/user-specified values used for actual calling simpleUAC.CONTAMINATION_FRACTION = 0.0; simpleUAC.exactCallsLog = null; - UG_engine_simple_genotyper = new UnifiedGenotyperEngine(getToolkit(), simpleUAC, logger, null, null, samples, GATKVariantContextUtils.DEFAULT_PLOIDY); + UG_engine_simple_genotyper = new UnifiedGenotyperEngine(getToolkit(), simpleUAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY); // initialize the output VCF header annotationEngine = new VariantAnnotatorEngine(Arrays.asList(annotationClassesToUse), annotationsToUse, annotationsToExclude, this, getToolkit()); diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/IndelRealigner.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/IndelRealigner.java index 851703648..1865cadea 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/IndelRealigner.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/indels/IndelRealigner.java @@ -63,7 +63,7 @@ import org.broadinstitute.sting.gatk.walkers.BAQMode; import org.broadinstitute.sting.gatk.walkers.ReadWalker; import org.broadinstitute.sting.utils.*; import org.broadinstitute.sting.utils.baq.BAQ; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.StingException; import org.broadinstitute.sting.utils.exceptions.UserException; diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/validation/GenotypeAndValidate.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/validation/GenotypeAndValidate.java index 33187f79a..927e1e607 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/validation/GenotypeAndValidate.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/validation/GenotypeAndValidate.java @@ -328,7 +328,7 @@ public class GenotypeAndValidate extends RodWalker header = GATKVCFUtils.getVCFHeadersFromRodPrefix(getToolkit(), alleles.getName()); samples = SampleUtils.getSampleList(header, VariantContextUtils.GenotypeMergeType.REQUIRE_UNIQUE); - Set headerLines = VCFUtils.smartMergeHeaders(header.values(), logger); + Set headerLines = VCFUtils.smartMergeHeaders(header.values(), true); headerLines.add(new VCFHeaderLine("source", "GenotypeAndValidate")); vcfWriter.writeHeader(new VCFHeader(headerLines, samples)); } diff --git a/protected/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RegenotypeVariants.java b/protected/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RegenotypeVariants.java index c8fc27e6a..74ab8f073 100644 --- a/protected/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RegenotypeVariants.java +++ b/protected/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/RegenotypeVariants.java @@ -61,7 +61,6 @@ import org.broadinstitute.sting.gatk.walkers.genotyper.UnifiedGenotyperEngine; import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.variant.GATKVCFUtils; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.*; import org.broadinstitute.variant.variantcontext.writer.VariantContextWriter; import org.broadinstitute.variant.vcf.*; @@ -116,7 +115,7 @@ public class RegenotypeVariants extends RodWalker implements T String trackName = variantCollection.variants.getName(); Set samples = SampleUtils.getSampleListWithVCFHeader(getToolkit(), Arrays.asList(trackName)); - UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC, logger, null, null, samples, GATKVariantContextUtils.DEFAULT_PLOIDY); + UG_engine = new UnifiedGenotyperEngine(getToolkit(), UAC, logger, null, null, samples, VariantContextUtils.DEFAULT_PLOIDY); final Set hInfo = new HashSet(); hInfo.addAll(GATKVCFUtils.getHeaderFields(getToolkit(), Arrays.asList(trackName))); diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java index 637d9fb2d..9122c9ab6 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalDatumNode.java @@ -51,7 +51,7 @@ import com.google.java.contract.Requires; import org.apache.commons.math.MathException; import org.apache.commons.math.stat.inference.ChiSquareTestImpl; import org.apache.log4j.Logger; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import java.util.Collection; diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java index 4cde2916d..e8fc713f1 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java @@ -58,7 +58,7 @@ import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.classloader.PluginManager; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; import org.broadinstitute.sting.utils.collections.NestedHashMap; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.DynamicClassResolutionException; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java index 3ecc41109..3fdbd63bd 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalibrationReport.java @@ -51,7 +51,7 @@ import org.broadinstitute.sting.gatk.report.GATKReportTable; import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.QualityUtils; import org.broadinstitute.sting.utils.collections.NestedIntegerArray; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.recalibration.covariates.Covariate; diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java index 6586782b8..638d9fb93 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/covariates/RepeatLengthCovariate.java @@ -49,7 +49,7 @@ package org.broadinstitute.sting.utils.recalibration.covariates; import org.broadinstitute.sting.gatk.walkers.bqsr.RecalibrationArgumentCollection; import org.broadinstitute.sting.utils.recalibration.ReadCovariates; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; import java.util.Arrays; @@ -73,7 +73,7 @@ public class RepeatLengthCovariate implements ExperimentalCovariate { int maxRL = 0; for (int str = 1; str <= 8; str++) { if (i + str <= readBytes.length) { - maxRL = Math.max(maxRL, GATKVariantContextUtils.findNumberofRepetitions( + maxRL = Math.max(maxRL, VariantContextUtils.findNumberofRepetitions( Arrays.copyOfRange(readBytes, i, i + str), Arrays.copyOfRange(readBytes, i, readBytes.length) )); diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java index 14dedebc4..08d333f8b 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/GeneralPloidyGenotypeLikelihoodsUnitTest.java @@ -52,7 +52,7 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.variant.utils.BaseUtils; import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; import org.broadinstitute.variant.variantcontext.*; import org.testng.Assert; diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/AFCalcPerformanceUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/AFCalcPerformanceUnitTest.java index 8deddc357..291489984 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/AFCalcPerformanceUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/genotyper/afcalc/AFCalcPerformanceUnitTest.java @@ -49,7 +49,7 @@ package org.broadinstitute.sting.gatk.walkers.genotyper.afcalc; import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.Utils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.Allele; import org.broadinstitute.variant.variantcontext.VariantContext; import org.testng.Assert; diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManagerUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManagerUnitTest.java index aabcd374d..f144f9b59 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManagerUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManagerUnitTest.java @@ -52,7 +52,7 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.manage import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.utils.Utils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.testng.Assert; import org.testng.annotations.BeforeClass; import org.testng.annotations.DataProvider; diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsUnitTest.java index 46bd5af3c..31ed3dcc8 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariantsUnitTest.java @@ -164,7 +164,7 @@ public class CombineVariantsUnitTest { ArrayList headers = new ArrayList(); headers.add(one); headers.add(two); - Set lines = VCFUtils.smartMergeHeaders(headers, null); + Set lines = VCFUtils.smartMergeHeaders(headers, false); Assert.assertEquals(lines.size(), VCFHeaderUnitTest.VCF4headerStringCount); } @@ -175,7 +175,7 @@ public class CombineVariantsUnitTest { ArrayList headers = new ArrayList(); headers.add(one); headers.add(two); - Set lines = VCFUtils.smartMergeHeaders(headers, null); + Set lines = VCFUtils.smartMergeHeaders(headers, false); Assert.assertEquals(lines.size(), VCFHeaderUnitTest.VCF4headerStringCount); } @@ -186,7 +186,7 @@ public class CombineVariantsUnitTest { ArrayList headers = new ArrayList(); headers.add(one); headers.add(two); - Set lines = VCFUtils.smartMergeHeaders(headers, null); + Set lines = VCFUtils.smartMergeHeaders(headers, false); Assert.assertEquals(lines.size(), VCFHeaderUnitTest.VCF4headerStringCount); } } diff --git a/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetricsUnitTest.java b/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetricsUnitTest.java index 0fff41d52..300dd633d 100644 --- a/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetricsUnitTest.java +++ b/protected/java/test/org/broadinstitute/sting/gatk/walkers/variantutils/ConcordanceMetricsUnitTest.java @@ -46,20 +46,16 @@ package org.broadinstitute.sting.gatk.walkers.variantutils; -import com.sun.org.apache.xpath.internal.operations.Gt; import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.gatk.walkers.variantutils.ConcordanceMetrics; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; import org.broadinstitute.variant.utils.BaseUtils; -import org.broadinstitute.variant.variantcontext.*; import org.broadinstitute.variant.variantcontext.Allele; import org.broadinstitute.variant.variantcontext.Genotype; import org.broadinstitute.variant.variantcontext.GenotypeBuilder; import org.broadinstitute.variant.variantcontext.GenotypeType; -import org.broadinstitute.variant.variantcontext.GenotypesContext; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.variantcontext.VariantContextBuilder; import org.broadinstitute.variant.vcf.VCFCodec; @@ -67,7 +63,6 @@ import org.broadinstitute.variant.vcf.VCFHeader; import org.testng.annotations.Test; import org.broad.tribble.readers.AsciiLineReader; import org.broad.tribble.readers.PositionalBufferedStream; -import org.broadinstitute.variant.vcf.*; import org.testng.Assert; import org.testng.annotations.BeforeClass; @@ -75,7 +70,6 @@ import java.io.File; import java.io.FileNotFoundException; import java.io.StringBufferInputStream; import java.util.ArrayList; -import java.util.Set; import java.util.Arrays; import java.util.List; import net.sf.picard.reference.ReferenceSequenceFile; diff --git a/public/java/src/org/broadinstitute/sting/commandline/ParsingEngine.java b/public/java/src/org/broadinstitute/sting/commandline/ParsingEngine.java index 5e863f4f7..071bd2cad 100644 --- a/public/java/src/org/broadinstitute/sting/commandline/ParsingEngine.java +++ b/public/java/src/org/broadinstitute/sting/commandline/ParsingEngine.java @@ -31,7 +31,7 @@ import org.apache.log4j.Logger; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.classloader.JVMUtils; import org.broadinstitute.sting.utils.classloader.PluginManager; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.help.ApplicationDetails; diff --git a/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/RODMetaDataContainer.java b/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/RODMetaDataContainer.java index e078e678b..b7c824360 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/RODMetaDataContainer.java +++ b/public/java/src/org/broadinstitute/sting/gatk/datasources/providers/RODMetaDataContainer.java @@ -26,7 +26,7 @@ package org.broadinstitute.sting.gatk.datasources.providers; import org.broadinstitute.sting.gatk.refdata.utils.GATKFeature; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import java.util.*; diff --git a/public/java/src/org/broadinstitute/sting/gatk/executive/Accumulator.java b/public/java/src/org/broadinstitute/sting/gatk/executive/Accumulator.java index d0ba0fa21..ea83aab53 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/executive/Accumulator.java +++ b/public/java/src/org/broadinstitute/sting/gatk/executive/Accumulator.java @@ -31,7 +31,7 @@ import org.broadinstitute.sting.gatk.datasources.providers.ShardDataProvider; import org.broadinstitute.sting.gatk.walkers.Walker; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocSortedSet; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import java.util.ArrayList; diff --git a/public/java/src/org/broadinstitute/sting/gatk/refdata/tracks/RMDTrackBuilder.java b/public/java/src/org/broadinstitute/sting/gatk/refdata/tracks/RMDTrackBuilder.java index c5f87d625..ec51b2f53 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/refdata/tracks/RMDTrackBuilder.java +++ b/public/java/src/org/broadinstitute/sting/gatk/refdata/tracks/RMDTrackBuilder.java @@ -40,7 +40,7 @@ import org.broadinstitute.sting.gatk.arguments.ValidationExclusion; import org.broadinstitute.sting.gatk.refdata.utils.RMDTriplet; import org.broadinstitute.sting.gatk.refdata.utils.RMDTriplet.RMDStorageType; import org.broadinstitute.sting.utils.GenomeLocParser; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.file.FSLockWithShared; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/Walker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/Walker.java index 522414c00..979cc2fbf 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/Walker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/Walker.java @@ -35,7 +35,7 @@ import org.broadinstitute.sting.gatk.samples.Sample; import org.broadinstitute.sting.gatk.samples.SampleDB; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.baq.BAQ; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.recalibration.BQSRMode; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java index dbb8ed5a6..383b22295 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/DepthOfCoverage.java @@ -46,7 +46,7 @@ import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.codecs.refseq.RefSeqCodec; import org.broadinstitute.sting.utils.codecs.refseq.RefSeqFeature; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/GCContentByInterval.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/GCContentByInterval.java index 668d3fd5f..77a4af1cd 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/GCContentByInterval.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/coverage/GCContentByInterval.java @@ -33,7 +33,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.*; import org.broadinstitute.variant.utils.BaseUtils; import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import java.io.PrintStream; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/CoveredByNSamplesSites.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/CoveredByNSamplesSites.java index 0ad6e9d3b..a5a8edb0c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/CoveredByNSamplesSites.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/diagnostics/CoveredByNSamplesSites.java @@ -26,7 +26,6 @@ package org.broadinstitute.sting.gatk.walkers.diagnostics; -import ca.mcgill.mcb.pcingola.interval.Intron; import org.broadinstitute.sting.commandline.Argument; import org.broadinstitute.sting.commandline.ArgumentCollection; import org.broadinstitute.sting.commandline.Output; @@ -36,17 +35,13 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.*; import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.collections.Pair; -import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.variant.variantcontext.Genotype; import org.broadinstitute.variant.variantcontext.GenotypesContext; import org.broadinstitute.variant.variantcontext.VariantContext; import java.io.*; -import java.util.ArrayList; import java.util.Collection; -import java.util.List; /** * print intervals file with all the variant sites that have "most" ( >= 90% by default) of the samples with "good" (>= 10 by default)coverage ("most" and "good" can be set in the command line). diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java index 8a5b3530e..ac6d82375 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaAlternateReferenceMaker.java @@ -33,7 +33,7 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.*; import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.variant.variantcontext.VariantContext; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java index e9728601d..d12ad3183 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/fasta/FastaReferenceMaker.java @@ -32,9 +32,8 @@ import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.RefWalker; -import org.broadinstitute.sting.gatk.walkers.WalkerName; import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import java.io.PrintStream; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountIntervals.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountIntervals.java index 0423c6f0a..82247d160 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountIntervals.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountIntervals.java @@ -36,7 +36,7 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.RefWalker; import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import java.io.PrintStream; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODs.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODs.java index a0f943f7e..be1e264c6 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODs.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODs.java @@ -43,7 +43,7 @@ import org.broadinstitute.sting.gatk.walkers.TreeReducible; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.collections.ExpandingArrayList; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import java.io.PrintStream; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODsByRef.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODsByRef.java index 77490be93..7135bffce 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODsByRef.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountRODsByRef.java @@ -35,7 +35,7 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.RefWalker; import org.broadinstitute.sting.utils.collections.ExpandingArrayList; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import java.util.Collections; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountTerminusEvent.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountTerminusEvent.java index cabc2f467..4e05033ec 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountTerminusEvent.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/qc/CountTerminusEvent.java @@ -33,7 +33,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.walkers.DataSource; import org.broadinstitute.sting.gatk.walkers.ReadWalker; import org.broadinstitute.sting.gatk.walkers.Requires; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/readutils/ClipReads.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/readutils/ClipReads.java index fe2b75464..6b2c0f75c 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/readutils/ClipReads.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/readutils/ClipReads.java @@ -45,7 +45,7 @@ import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.clipping.ClippingOp; import org.broadinstitute.sting.utils.clipping.ClippingRepresentation; import org.broadinstitute.sting.utils.clipping.ReadClipper; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.help.DocumentedGATKFeature; import org.broadinstitute.sting.utils.sam.GATKSAMRecord; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java index d586ee7da..9f758706e 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEval.java @@ -49,7 +49,6 @@ import org.broadinstitute.sting.gatk.walkers.varianteval.util.VariantEvalUtils; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.variant.GATKVCFUtils; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.vcf.VCFHeader; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; @@ -198,7 +197,7 @@ public class VariantEval extends RodWalker implements TreeRedu protected double MENDELIAN_VIOLATION_QUAL_THRESHOLD = 50; @Argument(shortName="ploidy", fullName="samplePloidy", doc="Per-sample ploidy (number of chromosomes per sample)", required=false) - protected int ploidy = GATKVariantContextUtils.DEFAULT_PLOIDY; + protected int ploidy = VariantContextUtils.DEFAULT_PLOIDY; @Argument(fullName="ancestralAlignments", shortName="aa", doc="Fasta file with ancestral alleles", required=false) private File ancestralAlignmentsFile = null; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java index a63f32485..5c16c7385 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/VariantEvalReportWriter.java @@ -34,7 +34,7 @@ import org.broadinstitute.sting.gatk.walkers.varianteval.util.Analysis; import org.broadinstitute.sting.gatk.walkers.varianteval.util.AnalysisModuleScanner; import org.broadinstitute.sting.gatk.walkers.varianteval.util.DataPoint; import org.broadinstitute.sting.gatk.walkers.varianteval.util.EvaluationContext; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.StingException; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java index de82b18cc..5ef414b00 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/TandemRepeat.java @@ -27,8 +27,8 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications; import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; import org.broadinstitute.variant.variantcontext.VariantContext; +import org.broadinstitute.variant.variantcontext.VariantContextUtils; import java.util.Arrays; import java.util.List; @@ -51,7 +51,7 @@ public class TandemRepeat extends VariantStratifier { public List getRelevantStates(ReferenceContext ref, RefMetaDataTracker tracker, VariantContext comp, String compName, VariantContext eval, String evalName, String sampleName) { if ( eval == null || ! eval.isIndel() ) return ALL; - else if ( GATKVariantContextUtils.isTandemRepeat(eval, ref.getForwardBases()) ) { + else if ( VariantContextUtils.isTandemRepeat(eval, ref.getForwardBases()) ) { print("REPEAT", eval, ref); return REPEAT; } else { diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java index 053a88218..d792e4c67 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/varianteval/stratifications/manager/StratificationManager.java @@ -27,9 +27,8 @@ package org.broadinstitute.sting.gatk.walkers.varianteval.stratifications.manage import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.broadinstitute.sting.gatk.walkers.varianteval.util.EvaluationContext; import org.broadinstitute.sting.utils.Utils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import java.util.*; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariants.java index 3ebac3e58..c54a57385 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/CombineVariants.java @@ -217,7 +217,7 @@ public class CombineVariants extends RodWalker implements Tree if ( SET_KEY.toLowerCase().equals("null") ) SET_KEY = null; - Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), logger); + Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), true); if ( SET_KEY != null ) headerLines.add(new VCFInfoHeaderLine(SET_KEY, 1, VCFHeaderLineType.String, "Source VCF for the merged record in CombineVariants")); if ( !ASSUME_IDENTICAL_SAMPLES ) diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java index 048c7ef77..8d5e7c2b8 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/GenotypeConcordance.java @@ -32,7 +32,7 @@ import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.report.GATKReport; import org.broadinstitute.sting.gatk.report.GATKReportTable; import org.broadinstitute.sting.gatk.walkers.RodWalker; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.variant.GATKVCFUtils; import org.broadinstitute.variant.variantcontext.*; import org.broadinstitute.variant.vcf.VCFHeader; diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java index abd0956fb..e94a771d3 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectHeaders.java @@ -153,7 +153,7 @@ public class SelectHeaders extends RodWalker implements TreeRe List rodNames = Arrays.asList(variantCollection.variants.getName()); Map vcfRods = GATKVCFUtils.getVCFHeadersFromRods(getToolkit(), rodNames); - Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), logger); + Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), true); headerLines.add(new VCFHeaderLine(VCFHeader.SOURCE_KEY, "SelectHeaders")); diff --git a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java index 6da6d14b1..dfe604a7d 100644 --- a/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java +++ b/public/java/src/org/broadinstitute/sting/gatk/walkers/variantutils/SelectVariants.java @@ -400,7 +400,7 @@ public class SelectVariants extends RodWalker implements TreeR } // Initialize VCF header - Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), logger); + Set headerLines = VCFUtils.smartMergeHeaders(vcfRods.values(), true); headerLines.add(new VCFHeaderLine("source", "SelectVariants")); if (KEEP_ORIGINAL_CHR_COUNTS) { diff --git a/public/java/src/org/broadinstitute/sting/tools/CatVariants.java b/public/java/src/org/broadinstitute/sting/tools/CatVariants.java index 1feb4e009..07a90bb11 100644 --- a/public/java/src/org/broadinstitute/sting/tools/CatVariants.java +++ b/public/java/src/org/broadinstitute/sting/tools/CatVariants.java @@ -36,9 +36,9 @@ import org.broadinstitute.sting.commandline.Input; import org.broadinstitute.sting.commandline.Output; import org.broadinstitute.sting.commandline.CommandLineProgram; import org.broadinstitute.variant.bcf2.BCF2Codec; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.vcf.VCFCodec; import org.broadinstitute.variant.vcf.VCFHeader; -import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.variantcontext.writer.Options; diff --git a/public/java/src/org/broadinstitute/sting/utils/MannWhitneyU.java b/public/java/src/org/broadinstitute/sting/utils/MannWhitneyU.java index 74009682a..05468c6c2 100644 --- a/public/java/src/org/broadinstitute/sting/utils/MannWhitneyU.java +++ b/public/java/src/org/broadinstitute/sting/utils/MannWhitneyU.java @@ -33,7 +33,7 @@ import org.apache.commons.math.MathException; import org.apache.commons.math.distribution.NormalDistribution; import org.apache.commons.math.distribution.NormalDistributionImpl; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.StingException; import java.io.Serializable; diff --git a/public/java/src/org/broadinstitute/sting/utils/SWPairwiseAlignment.java b/public/java/src/org/broadinstitute/sting/utils/SWPairwiseAlignment.java index 7bd937af9..b316d1117 100644 --- a/public/java/src/org/broadinstitute/sting/utils/SWPairwiseAlignment.java +++ b/public/java/src/org/broadinstitute/sting/utils/SWPairwiseAlignment.java @@ -1,34 +1,34 @@ -/* -* Copyright (c) 2012 The Broad Institute -* -* Permission is hereby granted, free of charge, to any person -* obtaining a copy of this software and associated documentation -* files (the "Software"), to deal in the Software without -* restriction, including without limitation the rights to use, -* copy, modify, merge, publish, distribute, sublicense, and/or sell -* copies of the Software, and to permit persons to whom the -* Software is furnished to do so, subject to the following -* conditions: -* -* The above copyright notice and this permission notice shall be -* included in all copies or substantial portions of the Software. -* -* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, -* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES -* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND -* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT -* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, -* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING -* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR -* THE USE OR OTHER DEALINGS IN THE SOFTWARE. -*/ - +/* +* Copyright (c) 2012 The Broad Institute +* +* Permission is hereby granted, free of charge, to any person +* obtaining a copy of this software and associated documentation +* files (the "Software"), to deal in the Software without +* restriction, including without limitation the rights to use, +* copy, modify, merge, publish, distribute, sublicense, and/or sell +* copies of the Software, and to permit persons to whom the +* Software is furnished to do so, subject to the following +* conditions: +* +* The above copyright notice and this permission notice shall be +* included in all copies or substantial portions of the Software. +* +* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, +* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES +* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND +* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT +* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, +* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING +* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR +* THE USE OR OTHER DEALINGS IN THE SOFTWARE. +*/ + package org.broadinstitute.sting.utils; import net.sf.samtools.Cigar; import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.StingException; import java.util.*; diff --git a/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java b/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java index 6a430588b..4e98897cf 100644 --- a/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/SampleUtils.java @@ -29,8 +29,8 @@ import net.sf.samtools.SAMFileHeader; import net.sf.samtools.SAMReadGroupRecord; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.utils.variant.GATKVCFUtils; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.vcf.VCFHeader; -import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.text.ListFileUtils; import org.broadinstitute.sting.utils.text.XReadLines; import org.broadinstitute.variant.variantcontext.VariantContextUtils; diff --git a/public/java/src/org/broadinstitute/sting/utils/baq/BAQ.java b/public/java/src/org/broadinstitute/sting/utils/baq/BAQ.java index 8c7bce6ac..794caa315 100644 --- a/public/java/src/org/broadinstitute/sting/utils/baq/BAQ.java +++ b/public/java/src/org/broadinstitute/sting/utils/baq/BAQ.java @@ -32,7 +32,7 @@ import net.sf.samtools.CigarOperator; import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMUtils; import org.apache.log4j.Logger; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.sam.ReadUtils; diff --git a/public/java/src/org/broadinstitute/sting/utils/duplicates/DupUtils.java b/public/java/src/org/broadinstitute/sting/utils/duplicates/DupUtils.java index 39f5b06c6..1072fb1b7 100644 --- a/public/java/src/org/broadinstitute/sting/utils/duplicates/DupUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/duplicates/DupUtils.java @@ -29,7 +29,7 @@ import org.broadinstitute.variant.utils.BaseUtils; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.QualityUtils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; diff --git a/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java b/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java index 76ccede62..00dd037db 100644 --- a/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/fragments/FragmentUtils.java @@ -30,7 +30,7 @@ import net.sf.samtools.CigarElement; import net.sf.samtools.CigarOperator; import net.sf.samtools.SAMRecord; import org.broadinstitute.sting.utils.recalibration.EventType; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.pileup.PileupElement; import org.broadinstitute.sting.utils.pileup.ReadBackedPileup; diff --git a/public/java/src/org/broadinstitute/sting/utils/help/GenericDocumentationHandler.java b/public/java/src/org/broadinstitute/sting/utils/help/GenericDocumentationHandler.java index bb0dc670b..099554a2c 100644 --- a/public/java/src/org/broadinstitute/sting/utils/help/GenericDocumentationHandler.java +++ b/public/java/src/org/broadinstitute/sting/utils/help/GenericDocumentationHandler.java @@ -37,7 +37,7 @@ import org.broadinstitute.sting.gatk.CommandLineGATK; import org.broadinstitute.sting.gatk.refdata.tracks.FeatureManager; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.sting.utils.classloader.JVMUtils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.StingException; diff --git a/public/java/src/org/broadinstitute/sting/utils/interval/IntervalUtils.java b/public/java/src/org/broadinstitute/sting/utils/interval/IntervalUtils.java index 7374dda14..403e166c5 100644 --- a/public/java/src/org/broadinstitute/sting/utils/interval/IntervalUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/interval/IntervalUtils.java @@ -39,7 +39,7 @@ import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.GenomeLocSortedSet; import org.broadinstitute.sting.utils.Utils; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.text.XReadLines; diff --git a/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java b/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java index 29f8c8dcd..46eceefd5 100644 --- a/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/sam/ReadUtils.java @@ -32,7 +32,7 @@ import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.MathUtils; import org.broadinstitute.sting.utils.NGSPlatform; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.variant.utils.BaseUtils; diff --git a/public/java/src/org/broadinstitute/sting/utils/variant/GATKVCFUtils.java b/public/java/src/org/broadinstitute/sting/utils/variant/GATKVCFUtils.java index 8602a2bd3..b2069c7ee 100644 --- a/public/java/src/org/broadinstitute/sting/utils/variant/GATKVCFUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/variant/GATKVCFUtils.java @@ -31,7 +31,7 @@ import org.broad.tribble.readers.PositionalBufferedStream; import org.broadinstitute.sting.commandline.RodBinding; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.datasources.rmd.ReferenceOrderedDataSource; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.vcf.*; @@ -147,32 +147,4 @@ public class GATKVCFUtils { return VCFUtils.withUpdatedContigs(header, engine.getArguments().referenceFile, engine.getMasterSequenceDictionary()); } - /** - * Read all of the VCF records from source into memory, returning the header and the VariantContexts - * - * @param source the file to read, must be in VCF4 format - * @return - * @throws java.io.IOException - */ - public static Pair> readVCF(final File source) throws IOException { - // read in the features - final List vcs = new ArrayList(); - final VCFCodec codec = new VCFCodec(); - PositionalBufferedStream pbs = new PositionalBufferedStream(new FileInputStream(source)); - FeatureCodecHeader header = codec.readHeader(pbs); - pbs.close(); - - pbs = new PositionalBufferedStream(new FileInputStream(source)); - pbs.skip(header.getHeaderEnd()); - - final VCFHeader vcfHeader = (VCFHeader)header.getHeaderValue(); - - while ( ! pbs.isDone() ) { - final VariantContext vc = codec.decode(pbs); - if ( vc != null ) - vcs.add(vc); - } - - return new Pair>(vcfHeader, vcs); - } } \ No newline at end of file diff --git a/public/java/src/org/broadinstitute/sting/utils/variant/GATKVariantContextUtils.java b/public/java/src/org/broadinstitute/sting/utils/variant/GATKVariantContextUtils.java index 8accb1643..82241ad55 100644 --- a/public/java/src/org/broadinstitute/sting/utils/variant/GATKVariantContextUtils.java +++ b/public/java/src/org/broadinstitute/sting/utils/variant/GATKVariantContextUtils.java @@ -25,22 +25,12 @@ package org.broadinstitute.sting.utils.variant; -import com.google.java.contract.Requires; -import org.apache.commons.lang.ArrayUtils; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; -import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.variant.variantcontext.*; -import java.util.*; - public class GATKVariantContextUtils { - public static final int DEFAULT_PLOIDY = 2; - public static final double SUM_GL_THRESH_NOCALL = -0.1; // if sum(gl) is bigger than this threshold, we treat GL's as non-informative and will force a no-call. - private static final List NO_CALL_ALLELES = Arrays.asList(Allele.NO_CALL, Allele.NO_CALL); - /** * create a genome location, given a variant context * @param genomeLocParser parser @@ -51,425 +41,4 @@ public class GATKVariantContextUtils { return genomeLocParser.createGenomeLoc(vc.getChr(), vc.getStart(), vc.getEnd(), true); } - /** - * Returns true iff VC is an non-complex indel where every allele represents an expansion or - * contraction of a series of identical bases in the reference. - * - * For example, suppose the ref bases are CTCTCTGA, which includes a 3x repeat of CTCTCT - * - * If VC = -/CT, then this function returns true because the CT insertion matches exactly the - * upcoming reference. - * If VC = -/CTA then this function returns false because the CTA isn't a perfect match - * - * Now consider deletions: - * - * If VC = CT/- then again the same logic applies and this returns true - * The case of CTA/- makes no sense because it doesn't actually match the reference bases. - * - * The logic of this function is pretty simple. Take all of the non-null alleles in VC. For - * each insertion allele of n bases, check if that allele matches the next n reference bases. - * For each deletion allele of n bases, check if this matches the reference bases at n - 2 n, - * as it must necessarily match the first n bases. If this test returns true for all - * alleles you are a tandem repeat, otherwise you are not. - * - * @param vc - * @param refBasesStartingAtVCWithPad not this is assumed to include the PADDED reference - * @return - */ - @Requires({"vc != null", "refBasesStartingAtVCWithPad != null && refBasesStartingAtVCWithPad.length > 0"}) - public static boolean isTandemRepeat(final VariantContext vc, final byte[] refBasesStartingAtVCWithPad) { - final String refBasesStartingAtVCWithoutPad = new String(refBasesStartingAtVCWithPad).substring(1); - if ( ! vc.isIndel() ) // only indels are tandem repeats - return false; - - final Allele ref = vc.getReference(); - - for ( final Allele allele : vc.getAlternateAlleles() ) { - if ( ! isRepeatAllele(ref, allele, refBasesStartingAtVCWithoutPad) ) - return false; - } - - // we've passed all of the tests, so we are a repeat - return true; - } - - /** - * - * @param vc - * @param refBasesStartingAtVCWithPad - * @return - */ - @Requires({"vc != null", "refBasesStartingAtVCWithPad != null && refBasesStartingAtVCWithPad.length > 0"}) - public static Pair,byte[]> getNumTandemRepeatUnits(final VariantContext vc, final byte[] refBasesStartingAtVCWithPad) { - final boolean VERBOSE = false; - final String refBasesStartingAtVCWithoutPad = new String(refBasesStartingAtVCWithPad).substring(1); - if ( ! vc.isIndel() ) // only indels are tandem repeats - return null; - - final Allele refAllele = vc.getReference(); - final byte[] refAlleleBases = Arrays.copyOfRange(refAllele.getBases(), 1, refAllele.length()); - - byte[] repeatUnit = null; - final ArrayList lengths = new ArrayList(); - - for ( final Allele allele : vc.getAlternateAlleles() ) { - Pair result = getNumTandemRepeatUnits(refAlleleBases, Arrays.copyOfRange(allele.getBases(), 1, allele.length()), refBasesStartingAtVCWithoutPad.getBytes()); - - final int[] repetitionCount = result.first; - // repetition count = 0 means allele is not a tandem expansion of context - if (repetitionCount[0] == 0 || repetitionCount[1] == 0) - return null; - - if (lengths.size() == 0) { - lengths.add(repetitionCount[0]); // add ref allele length only once - } - lengths.add(repetitionCount[1]); // add this alt allele's length - - repeatUnit = result.second; - if (VERBOSE) { - System.out.println("RefContext:"+refBasesStartingAtVCWithoutPad); - System.out.println("Ref:"+refAllele.toString()+" Count:" + String.valueOf(repetitionCount[0])); - System.out.println("Allele:"+allele.toString()+" Count:" + String.valueOf(repetitionCount[1])); - System.out.println("RU:"+new String(repeatUnit)); - } - } - - return new Pair, byte[]>(lengths,repeatUnit); - } - - protected static Pair getNumTandemRepeatUnits(final byte[] refBases, final byte[] altBases, final byte[] remainingRefContext) { - /* we can't exactly apply same logic as in basesAreRepeated() to compute tandem unit and number of repeated units. - Consider case where ref =ATATAT and we have an insertion of ATAT. Natural description is (AT)3 -> (AT)5. - */ - - byte[] longB; - // find first repeat unit based on either ref or alt, whichever is longer - if (altBases.length > refBases.length) - longB = altBases; - else - longB = refBases; - - // see if non-null allele (either ref or alt, whichever is longer) can be decomposed into several identical tandem units - // for example, -*,CACA needs to first be decomposed into (CA)2 - final int repeatUnitLength = findRepeatedSubstring(longB); - final byte[] repeatUnit = Arrays.copyOf(longB, repeatUnitLength); - - final int[] repetitionCount = new int[2]; -// repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext)); -// repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext)); - int repetitionsInRef = findNumberofRepetitions(repeatUnit,refBases); - repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext))-repetitionsInRef; - repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext))-repetitionsInRef; - - return new Pair(repetitionCount, repeatUnit); - - } - - /** - * Find out if a string can be represented as a tandem number of substrings. - * For example ACTACT is a 2-tandem of ACT, - * but ACTACA is not. - * - * @param bases String to be tested - * @return Length of repeat unit, if string can be represented as tandem of substring (if it can't - * be represented as one, it will be just the length of the input string) - */ - public static int findRepeatedSubstring(byte[] bases) { - - int repLength; - for (repLength=1; repLength <=bases.length; repLength++) { - final byte[] candidateRepeatUnit = Arrays.copyOf(bases,repLength); - boolean allBasesMatch = true; - for (int start = repLength; start < bases.length; start += repLength ) { - // check that remaining of string is exactly equal to repeat unit - final byte[] basePiece = Arrays.copyOfRange(bases,start,start+candidateRepeatUnit.length); - if (!Arrays.equals(candidateRepeatUnit, basePiece)) { - allBasesMatch = false; - break; - } - } - if (allBasesMatch) - return repLength; - } - - return repLength; - } - - /** - * Helper routine that finds number of repetitions a string consists of. - * For example, for string ATAT and repeat unit AT, number of repetitions = 2 - * @param repeatUnit Substring - * @param testString String to test - * @return Number of repetitions (0 if testString is not a concatenation of n repeatUnit's - */ - public static int findNumberofRepetitions(byte[] repeatUnit, byte[] testString) { - int numRepeats = 0; - for (int start = 0; start < testString.length; start += repeatUnit.length) { - int end = start + repeatUnit.length; - byte[] unit = Arrays.copyOfRange(testString,start, end); - if(Arrays.equals(unit,repeatUnit)) - numRepeats++; - else - return numRepeats; - } - return numRepeats; - } - - /** - * Helper function for isTandemRepeat that checks that allele matches somewhere on the reference - * @param ref - * @param alt - * @param refBasesStartingAtVCWithoutPad - * @return - */ - protected static boolean isRepeatAllele(final Allele ref, final Allele alt, final String refBasesStartingAtVCWithoutPad) { - if ( ! Allele.oneIsPrefixOfOther(ref, alt) ) - return false; // we require one allele be a prefix of another - - if ( ref.length() > alt.length() ) { // we are a deletion - return basesAreRepeated(ref.getBaseString(), alt.getBaseString(), refBasesStartingAtVCWithoutPad, 2); - } else { // we are an insertion - return basesAreRepeated(alt.getBaseString(), ref.getBaseString(), refBasesStartingAtVCWithoutPad, 1); - } - } - - protected static boolean basesAreRepeated(final String l, final String s, final String ref, final int minNumberOfMatches) { - final String potentialRepeat = l.substring(s.length()); // skip s bases - - for ( int i = 0; i < minNumberOfMatches; i++) { - final int start = i * potentialRepeat.length(); - final int end = (i+1) * potentialRepeat.length(); - if ( ref.length() < end ) - return false; // we ran out of bases to test - final String refSub = ref.substring(start, end); - if ( ! refSub.equals(potentialRepeat) ) - return false; // repeat didn't match, fail - } - - return true; // we passed all tests, we matched - } - - /** - * Assign genotypes (GTs) to the samples in the Variant Context greedily based on the PLs - * - * @param vc variant context with genotype likelihoods - * @return genotypes context - */ - public static GenotypesContext assignDiploidGenotypes(final VariantContext vc) { - return subsetDiploidAlleles(vc, vc.getAlleles(), true); - } - - /** - * Split variant context into its biallelic components if there are more than 2 alleles - * - * For VC has A/B/C alleles, returns A/B and A/C contexts. - * Genotypes are all no-calls now (it's not possible to fix them easily) - * Alleles are right trimmed to satisfy VCF conventions - * - * If vc is biallelic or non-variant it is just returned - * - * Chromosome counts are updated (but they are by definition 0) - * - * @param vc a potentially multi-allelic variant context - * @return a list of bi-allelic (or monomorphic) variant context - */ - public static List splitVariantContextToBiallelics(final VariantContext vc) { - if ( ! vc.isVariant() || vc.isBiallelic() ) - // non variant or biallelics already satisfy the contract - return Collections.singletonList(vc); - else { - final List biallelics = new LinkedList(); - - for ( final Allele alt : vc.getAlternateAlleles() ) { - VariantContextBuilder builder = new VariantContextBuilder(vc); - final List alleles = Arrays.asList(vc.getReference(), alt); - builder.alleles(alleles); - builder.genotypes(subsetDiploidAlleles(vc, alleles, false)); - VariantContextUtils.calculateChromosomeCounts(builder, true); - biallelics.add(reverseTrimAlleles(builder.make())); - } - - return biallelics; - } - } - - /** - * subset the Variant Context to the specific set of alleles passed in (pruning the PLs appropriately) - * - * @param vc variant context with genotype likelihoods - * @param allelesToUse which alleles from the vc are okay to use; *** must be in the same relative order as those in the original VC *** - * @param assignGenotypes true if we should update the genotypes based on the (subsetted) PLs - * @return genotypes - */ - public static GenotypesContext subsetDiploidAlleles(final VariantContext vc, - final List allelesToUse, - final boolean assignGenotypes) { - - // the genotypes with PLs - final GenotypesContext oldGTs = vc.getGenotypes(); - - // samples - final List sampleIndices = oldGTs.getSampleNamesOrderedByName(); - - // the new genotypes to create - final GenotypesContext newGTs = GenotypesContext.create(); - - // we need to determine which of the alternate alleles (and hence the likelihoods) to use and carry forward - final int numOriginalAltAlleles = vc.getAlternateAlleles().size(); - final int numNewAltAlleles = allelesToUse.size() - 1; - - // which PLs should be carried forward? - ArrayList likelihoodIndexesToUse = null; - - // an optimization: if we are supposed to use all (or none in the case of a ref call) of the alleles, - // then we can keep the PLs as is; otherwise, we determine which ones to keep - if ( numNewAltAlleles != numOriginalAltAlleles && numNewAltAlleles > 0 ) { - likelihoodIndexesToUse = new ArrayList(30); - - final boolean[] altAlleleIndexToUse = new boolean[numOriginalAltAlleles]; - for ( int i = 0; i < numOriginalAltAlleles; i++ ) { - if ( allelesToUse.contains(vc.getAlternateAllele(i)) ) - altAlleleIndexToUse[i] = true; - } - - // numLikelihoods takes total # of alleles. Use default # of chromosomes (ploidy) = 2 - final int numLikelihoods = GenotypeLikelihoods.numLikelihoods(1 + numOriginalAltAlleles, DEFAULT_PLOIDY); - for ( int PLindex = 0; PLindex < numLikelihoods; PLindex++ ) { - final GenotypeLikelihoods.GenotypeLikelihoodsAllelePair alleles = GenotypeLikelihoods.getAllelePair(PLindex); - // consider this entry only if both of the alleles are good - if ( (alleles.alleleIndex1 == 0 || altAlleleIndexToUse[alleles.alleleIndex1 - 1]) && (alleles.alleleIndex2 == 0 || altAlleleIndexToUse[alleles.alleleIndex2 - 1]) ) - likelihoodIndexesToUse.add(PLindex); - } - } - - // create the new genotypes - for ( int k = 0; k < oldGTs.size(); k++ ) { - final Genotype g = oldGTs.get(sampleIndices.get(k)); - if ( !g.hasLikelihoods() ) { - newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES)); - continue; - } - - // create the new likelihoods array from the alleles we are allowed to use - final double[] originalLikelihoods = g.getLikelihoods().getAsVector(); - double[] newLikelihoods; - if ( likelihoodIndexesToUse == null ) { - newLikelihoods = originalLikelihoods; - } else { - newLikelihoods = new double[likelihoodIndexesToUse.size()]; - int newIndex = 0; - for ( int oldIndex : likelihoodIndexesToUse ) - newLikelihoods[newIndex++] = originalLikelihoods[oldIndex]; - - // might need to re-normalize - newLikelihoods = MathUtils.normalizeFromLog10(newLikelihoods, false, true); - } - - // if there is no mass on the (new) likelihoods, then just no-call the sample - if ( MathUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL ) { - newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES)); - } - else { - final GenotypeBuilder gb = new GenotypeBuilder(g); - - if ( numNewAltAlleles == 0 ) - gb.noPL(); - else - gb.PL(newLikelihoods); - - // if we weren't asked to assign a genotype, then just no-call the sample - if ( !assignGenotypes || MathUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL ) { - gb.alleles(NO_CALL_ALLELES); - } - else { - // find the genotype with maximum likelihoods - int PLindex = numNewAltAlleles == 0 ? 0 : MathUtils.maxElementIndex(newLikelihoods); - GenotypeLikelihoods.GenotypeLikelihoodsAllelePair alleles = GenotypeLikelihoods.getAllelePair(PLindex); - - gb.alleles(Arrays.asList(allelesToUse.get(alleles.alleleIndex1), allelesToUse.get(alleles.alleleIndex2))); - if ( numNewAltAlleles != 0 ) gb.log10PError(GenotypeLikelihoods.getGQLog10FromLikelihoods(PLindex, newLikelihoods)); - } - newGTs.add(gb.make()); - } - } - - return newGTs; - } - - public static VariantContext reverseTrimAlleles( final VariantContext inputVC ) { - - // see whether we need to trim common reference base from all alleles - final int trimExtent = computeReverseClipping(inputVC.getAlleles(), inputVC.getReference().getDisplayString().getBytes(), 0, false); - if ( trimExtent <= 0 || inputVC.getAlleles().size() <= 1 ) - return inputVC; - - final List alleles = new ArrayList(); - final GenotypesContext genotypes = GenotypesContext.create(); - final Map originalToTrimmedAlleleMap = new HashMap(); - - for (final Allele a : inputVC.getAlleles()) { - if (a.isSymbolic()) { - alleles.add(a); - originalToTrimmedAlleleMap.put(a, a); - } else { - // get bases for current allele and create a new one with trimmed bases - final byte[] newBases = Arrays.copyOfRange(a.getBases(), 0, a.length()-trimExtent); - final Allele trimmedAllele = Allele.create(newBases, a.isReference()); - alleles.add(trimmedAllele); - originalToTrimmedAlleleMap.put(a, trimmedAllele); - } - } - - // now we can recreate new genotypes with trimmed alleles - for ( final Genotype genotype : inputVC.getGenotypes() ) { - final List originalAlleles = genotype.getAlleles(); - final List trimmedAlleles = new ArrayList(); - for ( final Allele a : originalAlleles ) { - if ( a.isCalled() ) - trimmedAlleles.add(originalToTrimmedAlleleMap.get(a)); - else - trimmedAlleles.add(Allele.NO_CALL); - } - genotypes.add(new GenotypeBuilder(genotype).alleles(trimmedAlleles).make()); - } - - return new VariantContextBuilder(inputVC).stop(inputVC.getStart() + alleles.get(0).length() - 1).alleles(alleles).genotypes(genotypes).make(); - } - - public static int computeReverseClipping(final List unclippedAlleles, - final byte[] ref, - final int forwardClipping, - final boolean allowFullClip) { - int clipping = 0; - boolean stillClipping = true; - - while ( stillClipping ) { - for ( final Allele a : unclippedAlleles ) { - if ( a.isSymbolic() ) - continue; - - // we need to ensure that we don't reverse clip out all of the bases from an allele because we then will have the wrong - // position set for the VariantContext (although it's okay to forward clip it all out, because the position will be fine). - if ( a.length() - clipping == 0 ) - return clipping - (allowFullClip ? 0 : 1); - - if ( a.length() - clipping <= forwardClipping || a.length() - forwardClipping == 0 ) { - stillClipping = false; - } - else if ( ref.length == clipping ) { - if ( allowFullClip ) - stillClipping = false; - else - return -1; - } - else if ( a.getBases()[a.length()-clipping-1] != ref[ref.length-clipping-1] ) { - stillClipping = false; - } - } - if ( stillClipping ) - clipping++; - } - - return clipping; - } } diff --git a/public/java/src/org/broadinstitute/variant/bcf2/BCF2Codec.java b/public/java/src/org/broadinstitute/variant/bcf2/BCF2Codec.java index 2dcd775c0..098b2a5b0 100644 --- a/public/java/src/org/broadinstitute/variant/bcf2/BCF2Codec.java +++ b/public/java/src/org/broadinstitute/variant/bcf2/BCF2Codec.java @@ -27,13 +27,13 @@ package org.broadinstitute.variant.bcf2; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.apache.log4j.Logger; import org.broad.tribble.Feature; import org.broad.tribble.FeatureCodec; import org.broad.tribble.FeatureCodecHeader; import org.broad.tribble.TribbleException; import org.broad.tribble.readers.AsciiLineReader; import org.broad.tribble.readers.PositionalBufferedStream; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.*; import org.broadinstitute.variant.variantcontext.*; @@ -50,8 +50,6 @@ import java.util.Map; * Decode BCF2 files */ public final class BCF2Codec implements FeatureCodec { - final protected static Logger logger = Logger.getLogger(BCF2Codec.class); - private final static int ALLOWED_MAJOR_VERSION = 2; private final static int MIN_MINOR_VERSION = 1; @@ -149,7 +147,9 @@ public final class BCF2Codec implements FeatureCodec { if ( bcfVersion.getMinorVersion() < MIN_MINOR_VERSION ) error("BCF2Codec can only process BCF2 files with minor version >= " + MIN_MINOR_VERSION + " but this file has minor version " + bcfVersion.getMinorVersion()); - logger.debug("Parsing data stream with BCF version " + bcfVersion); + if ( GeneralUtils.DEBUG_MODE_ENABLED ) { + System.err.println("Parsing data stream with BCF version " + bcfVersion); + } final int headerSizeInBytes = BCF2Type.INT32.read(inputStream); diff --git a/public/java/src/org/broadinstitute/variant/bcf2/BCF2Decoder.java b/public/java/src/org/broadinstitute/variant/bcf2/BCF2Decoder.java index c3a1b5f15..b9970706b 100644 --- a/public/java/src/org/broadinstitute/variant/bcf2/BCF2Decoder.java +++ b/public/java/src/org/broadinstitute/variant/bcf2/BCF2Decoder.java @@ -27,9 +27,8 @@ package org.broadinstitute.variant.bcf2; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.apache.log4j.Logger; -import org.broad.tribble.FeatureCodec; import org.broad.tribble.TribbleException; +import org.broadinstitute.variant.utils.GeneralUtils; import java.io.ByteArrayInputStream; import java.io.IOException; @@ -38,8 +37,6 @@ import java.util.ArrayList; import java.util.Arrays; public final class BCF2Decoder { - final protected static Logger logger = Logger.getLogger(FeatureCodec.class); - byte[] recordBytes = null; ByteArrayInputStream recordStream = null; @@ -343,8 +340,9 @@ public final class BCF2Decoder { bytesRead += read1; } - if ( nReadAttempts > 1 ) // TODO -- remove me - logger.warn("Required multiple read attempts to actually get the entire BCF2 block, unexpected behavior"); + if ( GeneralUtils.DEBUG_MODE_ENABLED && nReadAttempts > 1 ) { // TODO -- remove me + System.err.println("Required multiple read attempts to actually get the entire BCF2 block, unexpected behavior"); + } validateReadBytes(bytesRead, nReadAttempts, blockSizeInBytes); } catch ( IOException e ) { diff --git a/public/java/src/org/broadinstitute/variant/bcf2/BCF2GenotypeFieldDecoders.java b/public/java/src/org/broadinstitute/variant/bcf2/BCF2GenotypeFieldDecoders.java index 1b624a1b8..87d676526 100644 --- a/public/java/src/org/broadinstitute/variant/bcf2/BCF2GenotypeFieldDecoders.java +++ b/public/java/src/org/broadinstitute/variant/bcf2/BCF2GenotypeFieldDecoders.java @@ -27,7 +27,6 @@ package org.broadinstitute.variant.bcf2; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.apache.log4j.Logger; import org.broadinstitute.variant.vcf.VCFConstants; import org.broadinstitute.variant.vcf.VCFHeader; import org.broadinstitute.variant.variantcontext.Allele; @@ -46,7 +45,6 @@ import java.util.*; * @since 6/12 */ public class BCF2GenotypeFieldDecoders { - final protected static Logger logger = Logger.getLogger(BCF2GenotypeFieldDecoders.class); private final static boolean ENABLE_FASTPATH_GT = true; private final static int MIN_SAMPLES_FOR_FASTPATH_GENOTYPES = 0; // TODO -- update to reasonable number diff --git a/public/java/src/org/broadinstitute/variant/bcf2/BCF2LazyGenotypesDecoder.java b/public/java/src/org/broadinstitute/variant/bcf2/BCF2LazyGenotypesDecoder.java index bcd8e41d8..ffbfe81e6 100644 --- a/public/java/src/org/broadinstitute/variant/bcf2/BCF2LazyGenotypesDecoder.java +++ b/public/java/src/org/broadinstitute/variant/bcf2/BCF2LazyGenotypesDecoder.java @@ -26,7 +26,6 @@ package org.broadinstitute.variant.bcf2; import com.google.java.contract.Requires; -import org.apache.log4j.Logger; import org.broad.tribble.TribbleException; import org.broadinstitute.variant.variantcontext.*; @@ -40,8 +39,6 @@ import java.util.*; * @since 5/12 */ public class BCF2LazyGenotypesDecoder implements LazyGenotypesContext.LazyParser { - final protected static Logger logger = Logger.getLogger(BCF2LazyGenotypesDecoder.class); - // the essential information for us to use to decode the genotypes data // initialized when this lazy decoder is created, as we know all of this from the BCF2Codec // and its stored here again for code cleanliness @@ -63,8 +60,6 @@ public class BCF2LazyGenotypesDecoder implements LazyGenotypesContext.LazyParser @Override public LazyGenotypesContext.LazyData parse(final Object data) { -// if ( logger.isDebugEnabled() ) -// logger.debug("Decoding BCF genotypes for " + nSamples + " samples with " + nFields + " fields each"); try { // load our byte[] data into the decoder diff --git a/public/java/src/org/broadinstitute/variant/utils/Utils.java b/public/java/src/org/broadinstitute/variant/utils/GeneralUtils.java similarity index 64% rename from public/java/src/org/broadinstitute/variant/utils/Utils.java rename to public/java/src/org/broadinstitute/variant/utils/GeneralUtils.java index e61ce2ef3..79014a0eb 100644 --- a/public/java/src/org/broadinstitute/variant/utils/Utils.java +++ b/public/java/src/org/broadinstitute/variant/utils/GeneralUtils.java @@ -25,10 +25,18 @@ package org.broadinstitute.variant.utils; -import java.util.Collection; -import java.util.Iterator; +import java.util.*; -public class Utils { +/** + * Constants and utility methods used throughout the VCF/BCF/VariantContext classes + */ +public class GeneralUtils { + + /** + * Setting this to true causes the VCF/BCF/VariantContext classes to emit debugging information + * to standard error + */ + public static final boolean DEBUG_MODE_ENABLED = false; /** * The smallest log10 value we'll emit from normalizeFromLog10 and other functions @@ -66,7 +74,6 @@ public class Utils { } } - /** * normalizes the log10-based array. ASSUMES THAT ALL ARRAY ENTRIES ARE <= 0 (<= 1 IN REAL-SPACE). * @@ -134,10 +141,21 @@ public class Utils { return normalized; } + public static double sum(double[] values) { + double s = 0.0; + for (double v : values) + s += v; + return s; + } + public static double arrayMax(final double[] array) { return array[maxElementIndex(array, array.length)]; } + public static int maxElementIndex(final double[] array) { + return maxElementIndex(array, array.length); + } + public static int maxElementIndex(final double[] array, final int endIndex) { if (array == null || array.length == 0) throw new IllegalArgumentException("Array cannot be null!"); @@ -150,6 +168,82 @@ public class Utils { return maxI; } + + public static List cons(final T elt, final List l) { + List l2 = new ArrayList(); + l2.add(elt); + if (l != null) l2.addAll(l); + return l2; + } + + /** + * Make all combinations of N size of objects + * + * if objects = [A, B, C] + * if N = 1 => [[A], [B], [C]] + * if N = 2 => [[A, A], [B, A], [C, A], [A, B], [B, B], [C, B], [A, C], [B, C], [C, C]] + * + * @param objects + * @param n + * @param + * @param withReplacement if false, the resulting permutations will only contain unique objects from objects + * @return + */ + public static List> makePermutations(final List objects, final int n, final boolean withReplacement) { + final List> combinations = new ArrayList>(); + + if ( n <= 0 ) + ; + else if ( n == 1 ) { + for ( final T o : objects ) + combinations.add(Collections.singletonList(o)); + } else { + final List> sub = makePermutations(objects, n - 1, withReplacement); + for ( List subI : sub ) { + for ( final T a : objects ) { + if ( withReplacement || ! subI.contains(a) ) + combinations.add(cons(a, subI)); + } + } + } + + return combinations; + } + + /** + * Compares double values for equality (within 1e-6), or inequality. + * + * @param a the first double value + * @param b the second double value + * @return -1 if a is greater than b, 0 if a is equal to be within 1e-6, 1 if b is greater than a. + */ + public static byte compareDoubles(double a, double b) { + return compareDoubles(a, b, 1e-6); + } + + /** + * Compares double values for equality (within epsilon), or inequality. + * + * @param a the first double value + * @param b the second double value + * @param epsilon the precision within which two double values will be considered equal + * @return -1 if a is greater than b, 0 if a is equal to be within epsilon, 1 if b is greater than a. + */ + public static byte compareDoubles(double a, double b, double epsilon) { + if (Math.abs(a - b) < epsilon) { + return 0; + } + if (a > b) { + return -1; + } + return 1; + } + + static public final List reverse(final List l) { + final List newL = new ArrayList(l); + Collections.reverse(newL); + return newL; + } } diff --git a/public/java/src/org/broadinstitute/sting/utils/collections/Pair.java b/public/java/src/org/broadinstitute/variant/utils/Pair.java similarity index 98% rename from public/java/src/org/broadinstitute/sting/utils/collections/Pair.java rename to public/java/src/org/broadinstitute/variant/utils/Pair.java index 4c00331a9..858d5fbd7 100644 --- a/public/java/src/org/broadinstitute/sting/utils/collections/Pair.java +++ b/public/java/src/org/broadinstitute/variant/utils/Pair.java @@ -23,7 +23,7 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.sting.utils.collections; +package org.broadinstitute.variant.utils; public class Pair { diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/GenotypeLikelihoods.java b/public/java/src/org/broadinstitute/variant/variantcontext/GenotypeLikelihoods.java index 7d804fd1b..1f6da6ecc 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/GenotypeLikelihoods.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/GenotypeLikelihoods.java @@ -28,7 +28,7 @@ package org.broadinstitute.variant.variantcontext; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; import org.broad.tribble.TribbleException; -import org.broadinstitute.variant.utils.Utils; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.VCFConstants; import java.util.Arrays; @@ -155,7 +155,7 @@ public class GenotypeLikelihoods { //Returns null in case of missing likelihoods public EnumMap getAsMap(boolean normalizeFromLog10){ //Make sure that the log10likelihoods are set - double[] likelihoods = normalizeFromLog10 ? Utils.normalizeFromLog10(getAsVector()) : getAsVector(); + double[] likelihoods = normalizeFromLog10 ? GeneralUtils.normalizeFromLog10(getAsVector()) : getAsVector(); if(likelihoods == null) return null; EnumMap likelihoodsMap = new EnumMap(GenotypeType.class); @@ -215,7 +215,7 @@ public class GenotypeLikelihoods { if (qual < 0) { // QUAL can be negative if the chosen genotype is not the most likely one individually. // In this case, we compute the actual genotype probability and QUAL is the likelihood of it not being the chosen one - double[] normalized = Utils.normalizeFromLog10(likelihoods); + double[] normalized = GeneralUtils.normalizeFromLog10(likelihoods); double chosenGenotype = normalized[iOfChoosenGenotype]; return Math.log10(1.0 - chosenGenotype); } else { diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/VariantContext.java b/public/java/src/org/broadinstitute/variant/variantcontext/VariantContext.java index 003877088..05edee153 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/VariantContext.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/VariantContext.java @@ -25,10 +25,10 @@ package org.broadinstitute.variant.variantcontext; -import org.apache.log4j.Logger; import org.broad.tribble.Feature; import org.broad.tribble.TribbleException; import org.broad.tribble.util.ParsingUtils; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.*; import java.util.*; @@ -202,7 +202,6 @@ import java.util.*; public class VariantContext implements Feature { // to enable tribble integration private final static boolean WARN_ABOUT_BAD_END = true; private final static int MAX_ALLELE_SIZE_FOR_NON_SV = 150; - final protected static Logger logger = Logger.getLogger(VariantContext.class); private boolean fullyDecoded = false; protected CommonInfo commonInfo = null; public final static double NO_LOG10_PERROR = CommonInfo.NO_LOG10_PERROR; @@ -1176,10 +1175,12 @@ public class VariantContext implements Feature { // to enable tribble integratio final String message = "Badly formed variant context at location " + getChr() + ":" + getStart() + "; getEnd() was " + getEnd() + " but this VariantContext contains an END key with value " + end; - if ( WARN_ABOUT_BAD_END ) - logger.warn(message); - else + if ( GeneralUtils.DEBUG_MODE_ENABLED && WARN_ABOUT_BAD_END ) { + System.err.println(message); + } + else { throw new TribbleException(message); + } } } else { final long length = (stop - start) + 1; diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java b/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java index b2f41d43b..fb97d41ff 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/VariantContextUtils.java @@ -29,24 +29,27 @@ import com.google.java.contract.Ensures; import com.google.java.contract.Requires; import org.apache.commons.jexl2.Expression; import org.apache.commons.jexl2.JexlEngine; -import org.apache.log4j.Logger; +import org.apache.commons.lang.ArrayUtils; import org.broad.tribble.TribbleException; import org.broad.tribble.util.popgen.HardyWeinbergCalculation; import org.broadinstitute.variant.utils.BaseUtils; -import org.broadinstitute.variant.utils.Utils; +import org.broadinstitute.variant.utils.GeneralUtils; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.vcf.*; import java.io.Serializable; import java.util.*; public class VariantContextUtils { - private static Logger logger = Logger.getLogger(VariantContextUtils.class); public final static String MERGE_INTERSECTION = "Intersection"; public final static String MERGE_FILTER_IN_ALL = "FilteredInAll"; public final static String MERGE_REF_IN_ALL = "ReferenceInAll"; public final static String MERGE_FILTER_PREFIX = "filterIn"; + public static final int DEFAULT_PLOIDY = 2; + public static final double SUM_GL_THRESH_NOCALL = -0.1; // if sum(gl) is bigger than this threshold, we treat GL's as non-informative and will force a no-call. private static Set MISSING_KEYS_WARNED_ABOUT = new HashSet(); + private static final List NO_CALL_ALLELES = Arrays.asList(Allele.NO_CALL, Allele.NO_CALL); final public static JexlEngine engine = new JexlEngine(); private final static boolean ASSUME_MISSING_FIELDS_ARE_STRINGS = false; @@ -166,7 +169,8 @@ public class VariantContextUtils { if ( ASSUME_MISSING_FIELDS_ARE_STRINGS ) { if ( ! MISSING_KEYS_WARNED_ABOUT.contains(field) ) { MISSING_KEYS_WARNED_ABOUT.add(field); - logger.warn("Field " + field + " missing from VCF header, assuming it is an unbounded string type"); + if ( GeneralUtils.DEBUG_MODE_ENABLED ) + System.err.println("Field " + field + " missing from VCF header, assuming it is an unbounded string type"); } return new VCFInfoHeaderLine(field, VCFHeaderLineCount.UNBOUNDED, VCFHeaderLineType.String, "Auto-generated string header for " + field); } @@ -176,6 +180,428 @@ public class VariantContextUtils { return metaData; } + /** + * Returns true iff VC is an non-complex indel where every allele represents an expansion or + * contraction of a series of identical bases in the reference. + * + * For example, suppose the ref bases are CTCTCTGA, which includes a 3x repeat of CTCTCT + * + * If VC = -/CT, then this function returns true because the CT insertion matches exactly the + * upcoming reference. + * If VC = -/CTA then this function returns false because the CTA isn't a perfect match + * + * Now consider deletions: + * + * If VC = CT/- then again the same logic applies and this returns true + * The case of CTA/- makes no sense because it doesn't actually match the reference bases. + * + * The logic of this function is pretty simple. Take all of the non-null alleles in VC. For + * each insertion allele of n bases, check if that allele matches the next n reference bases. + * For each deletion allele of n bases, check if this matches the reference bases at n - 2 n, + * as it must necessarily match the first n bases. If this test returns true for all + * alleles you are a tandem repeat, otherwise you are not. + * + * @param vc + * @param refBasesStartingAtVCWithPad not this is assumed to include the PADDED reference + * @return + */ + @Requires({"vc != null", "refBasesStartingAtVCWithPad != null && refBasesStartingAtVCWithPad.length > 0"}) + public static boolean isTandemRepeat(final VariantContext vc, final byte[] refBasesStartingAtVCWithPad) { + final String refBasesStartingAtVCWithoutPad = new String(refBasesStartingAtVCWithPad).substring(1); + if ( ! vc.isIndel() ) // only indels are tandem repeats + return false; + + final Allele ref = vc.getReference(); + + for ( final Allele allele : vc.getAlternateAlleles() ) { + if ( ! isRepeatAllele(ref, allele, refBasesStartingAtVCWithoutPad) ) + return false; + } + + // we've passed all of the tests, so we are a repeat + return true; + } + + /** + * + * @param vc + * @param refBasesStartingAtVCWithPad + * @return + */ + @Requires({"vc != null", "refBasesStartingAtVCWithPad != null && refBasesStartingAtVCWithPad.length > 0"}) + public static Pair,byte[]> getNumTandemRepeatUnits(final VariantContext vc, final byte[] refBasesStartingAtVCWithPad) { + final boolean VERBOSE = false; + final String refBasesStartingAtVCWithoutPad = new String(refBasesStartingAtVCWithPad).substring(1); + if ( ! vc.isIndel() ) // only indels are tandem repeats + return null; + + final Allele refAllele = vc.getReference(); + final byte[] refAlleleBases = Arrays.copyOfRange(refAllele.getBases(), 1, refAllele.length()); + + byte[] repeatUnit = null; + final ArrayList lengths = new ArrayList(); + + for ( final Allele allele : vc.getAlternateAlleles() ) { + Pair result = getNumTandemRepeatUnits(refAlleleBases, Arrays.copyOfRange(allele.getBases(), 1, allele.length()), refBasesStartingAtVCWithoutPad.getBytes()); + + final int[] repetitionCount = result.first; + // repetition count = 0 means allele is not a tandem expansion of context + if (repetitionCount[0] == 0 || repetitionCount[1] == 0) + return null; + + if (lengths.size() == 0) { + lengths.add(repetitionCount[0]); // add ref allele length only once + } + lengths.add(repetitionCount[1]); // add this alt allele's length + + repeatUnit = result.second; + if (VERBOSE) { + System.out.println("RefContext:"+refBasesStartingAtVCWithoutPad); + System.out.println("Ref:"+refAllele.toString()+" Count:" + String.valueOf(repetitionCount[0])); + System.out.println("Allele:"+allele.toString()+" Count:" + String.valueOf(repetitionCount[1])); + System.out.println("RU:"+new String(repeatUnit)); + } + } + + return new Pair, byte[]>(lengths,repeatUnit); + } + + protected static Pair getNumTandemRepeatUnits(final byte[] refBases, final byte[] altBases, final byte[] remainingRefContext) { + /* we can't exactly apply same logic as in basesAreRepeated() to compute tandem unit and number of repeated units. + Consider case where ref =ATATAT and we have an insertion of ATAT. Natural description is (AT)3 -> (AT)5. + */ + + byte[] longB; + // find first repeat unit based on either ref or alt, whichever is longer + if (altBases.length > refBases.length) + longB = altBases; + else + longB = refBases; + + // see if non-null allele (either ref or alt, whichever is longer) can be decomposed into several identical tandem units + // for example, -*,CACA needs to first be decomposed into (CA)2 + final int repeatUnitLength = findRepeatedSubstring(longB); + final byte[] repeatUnit = Arrays.copyOf(longB, repeatUnitLength); + + final int[] repetitionCount = new int[2]; +// repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext)); +// repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext)); + int repetitionsInRef = findNumberofRepetitions(repeatUnit,refBases); + repetitionCount[0] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(refBases, remainingRefContext))-repetitionsInRef; + repetitionCount[1] = findNumberofRepetitions(repeatUnit, ArrayUtils.addAll(altBases, remainingRefContext))-repetitionsInRef; + + return new Pair(repetitionCount, repeatUnit); + + } + + /** + * Find out if a string can be represented as a tandem number of substrings. + * For example ACTACT is a 2-tandem of ACT, + * but ACTACA is not. + * + * @param bases String to be tested + * @return Length of repeat unit, if string can be represented as tandem of substring (if it can't + * be represented as one, it will be just the length of the input string) + */ + public static int findRepeatedSubstring(byte[] bases) { + + int repLength; + for (repLength=1; repLength <=bases.length; repLength++) { + final byte[] candidateRepeatUnit = Arrays.copyOf(bases,repLength); + boolean allBasesMatch = true; + for (int start = repLength; start < bases.length; start += repLength ) { + // check that remaining of string is exactly equal to repeat unit + final byte[] basePiece = Arrays.copyOfRange(bases,start,start+candidateRepeatUnit.length); + if (!Arrays.equals(candidateRepeatUnit, basePiece)) { + allBasesMatch = false; + break; + } + } + if (allBasesMatch) + return repLength; + } + + return repLength; + } + + /** + * Helper routine that finds number of repetitions a string consists of. + * For example, for string ATAT and repeat unit AT, number of repetitions = 2 + * @param repeatUnit Substring + * @param testString String to test + * @return Number of repetitions (0 if testString is not a concatenation of n repeatUnit's + */ + public static int findNumberofRepetitions(byte[] repeatUnit, byte[] testString) { + int numRepeats = 0; + for (int start = 0; start < testString.length; start += repeatUnit.length) { + int end = start + repeatUnit.length; + byte[] unit = Arrays.copyOfRange(testString,start, end); + if(Arrays.equals(unit,repeatUnit)) + numRepeats++; + else + return numRepeats; + } + return numRepeats; + } + + /** + * Helper function for isTandemRepeat that checks that allele matches somewhere on the reference + * @param ref + * @param alt + * @param refBasesStartingAtVCWithoutPad + * @return + */ + protected static boolean isRepeatAllele(final Allele ref, final Allele alt, final String refBasesStartingAtVCWithoutPad) { + if ( ! Allele.oneIsPrefixOfOther(ref, alt) ) + return false; // we require one allele be a prefix of another + + if ( ref.length() > alt.length() ) { // we are a deletion + return basesAreRepeated(ref.getBaseString(), alt.getBaseString(), refBasesStartingAtVCWithoutPad, 2); + } else { // we are an insertion + return basesAreRepeated(alt.getBaseString(), ref.getBaseString(), refBasesStartingAtVCWithoutPad, 1); + } + } + + protected static boolean basesAreRepeated(final String l, final String s, final String ref, final int minNumberOfMatches) { + final String potentialRepeat = l.substring(s.length()); // skip s bases + + for ( int i = 0; i < minNumberOfMatches; i++) { + final int start = i * potentialRepeat.length(); + final int end = (i+1) * potentialRepeat.length(); + if ( ref.length() < end ) + return false; // we ran out of bases to test + final String refSub = ref.substring(start, end); + if ( ! refSub.equals(potentialRepeat) ) + return false; // repeat didn't match, fail + } + + return true; // we passed all tests, we matched + } + + /** + * Assign genotypes (GTs) to the samples in the Variant Context greedily based on the PLs + * + * @param vc variant context with genotype likelihoods + * @return genotypes context + */ + public static GenotypesContext assignDiploidGenotypes(final VariantContext vc) { + return subsetDiploidAlleles(vc, vc.getAlleles(), true); + } + + /** + * Split variant context into its biallelic components if there are more than 2 alleles + * + * For VC has A/B/C alleles, returns A/B and A/C contexts. + * Genotypes are all no-calls now (it's not possible to fix them easily) + * Alleles are right trimmed to satisfy VCF conventions + * + * If vc is biallelic or non-variant it is just returned + * + * Chromosome counts are updated (but they are by definition 0) + * + * @param vc a potentially multi-allelic variant context + * @return a list of bi-allelic (or monomorphic) variant context + */ + public static List splitVariantContextToBiallelics(final VariantContext vc) { + if ( ! vc.isVariant() || vc.isBiallelic() ) + // non variant or biallelics already satisfy the contract + return Collections.singletonList(vc); + else { + final List biallelics = new LinkedList(); + + for ( final Allele alt : vc.getAlternateAlleles() ) { + VariantContextBuilder builder = new VariantContextBuilder(vc); + final List alleles = Arrays.asList(vc.getReference(), alt); + builder.alleles(alleles); + builder.genotypes(subsetDiploidAlleles(vc, alleles, false)); + calculateChromosomeCounts(builder, true); + biallelics.add(reverseTrimAlleles(builder.make())); + } + + return biallelics; + } + } + + /** + * subset the Variant Context to the specific set of alleles passed in (pruning the PLs appropriately) + * + * @param vc variant context with genotype likelihoods + * @param allelesToUse which alleles from the vc are okay to use; *** must be in the same relative order as those in the original VC *** + * @param assignGenotypes true if we should update the genotypes based on the (subsetted) PLs + * @return genotypes + */ + public static GenotypesContext subsetDiploidAlleles(final VariantContext vc, + final List allelesToUse, + final boolean assignGenotypes) { + + // the genotypes with PLs + final GenotypesContext oldGTs = vc.getGenotypes(); + + // samples + final List sampleIndices = oldGTs.getSampleNamesOrderedByName(); + + // the new genotypes to create + final GenotypesContext newGTs = GenotypesContext.create(); + + // we need to determine which of the alternate alleles (and hence the likelihoods) to use and carry forward + final int numOriginalAltAlleles = vc.getAlternateAlleles().size(); + final int numNewAltAlleles = allelesToUse.size() - 1; + + // which PLs should be carried forward? + ArrayList likelihoodIndexesToUse = null; + + // an optimization: if we are supposed to use all (or none in the case of a ref call) of the alleles, + // then we can keep the PLs as is; otherwise, we determine which ones to keep + if ( numNewAltAlleles != numOriginalAltAlleles && numNewAltAlleles > 0 ) { + likelihoodIndexesToUse = new ArrayList(30); + + final boolean[] altAlleleIndexToUse = new boolean[numOriginalAltAlleles]; + for ( int i = 0; i < numOriginalAltAlleles; i++ ) { + if ( allelesToUse.contains(vc.getAlternateAllele(i)) ) + altAlleleIndexToUse[i] = true; + } + + // numLikelihoods takes total # of alleles. Use default # of chromosomes (ploidy) = 2 + final int numLikelihoods = GenotypeLikelihoods.numLikelihoods(1 + numOriginalAltAlleles, DEFAULT_PLOIDY); + for ( int PLindex = 0; PLindex < numLikelihoods; PLindex++ ) { + final GenotypeLikelihoods.GenotypeLikelihoodsAllelePair alleles = GenotypeLikelihoods.getAllelePair(PLindex); + // consider this entry only if both of the alleles are good + if ( (alleles.alleleIndex1 == 0 || altAlleleIndexToUse[alleles.alleleIndex1 - 1]) && (alleles.alleleIndex2 == 0 || altAlleleIndexToUse[alleles.alleleIndex2 - 1]) ) + likelihoodIndexesToUse.add(PLindex); + } + } + + // create the new genotypes + for ( int k = 0; k < oldGTs.size(); k++ ) { + final Genotype g = oldGTs.get(sampleIndices.get(k)); + if ( !g.hasLikelihoods() ) { + newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES)); + continue; + } + + // create the new likelihoods array from the alleles we are allowed to use + final double[] originalLikelihoods = g.getLikelihoods().getAsVector(); + double[] newLikelihoods; + if ( likelihoodIndexesToUse == null ) { + newLikelihoods = originalLikelihoods; + } else { + newLikelihoods = new double[likelihoodIndexesToUse.size()]; + int newIndex = 0; + for ( int oldIndex : likelihoodIndexesToUse ) + newLikelihoods[newIndex++] = originalLikelihoods[oldIndex]; + + // might need to re-normalize + newLikelihoods = GeneralUtils.normalizeFromLog10(newLikelihoods, false, true); + } + + // if there is no mass on the (new) likelihoods, then just no-call the sample + if ( GeneralUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL ) { + newGTs.add(GenotypeBuilder.create(g.getSampleName(), NO_CALL_ALLELES)); + } + else { + final GenotypeBuilder gb = new GenotypeBuilder(g); + + if ( numNewAltAlleles == 0 ) + gb.noPL(); + else + gb.PL(newLikelihoods); + + // if we weren't asked to assign a genotype, then just no-call the sample + if ( !assignGenotypes || GeneralUtils.sum(newLikelihoods) > SUM_GL_THRESH_NOCALL ) { + gb.alleles(NO_CALL_ALLELES); + } + else { + // find the genotype with maximum likelihoods + int PLindex = numNewAltAlleles == 0 ? 0 : GeneralUtils.maxElementIndex(newLikelihoods); + GenotypeLikelihoods.GenotypeLikelihoodsAllelePair alleles = GenotypeLikelihoods.getAllelePair(PLindex); + + gb.alleles(Arrays.asList(allelesToUse.get(alleles.alleleIndex1), allelesToUse.get(alleles.alleleIndex2))); + if ( numNewAltAlleles != 0 ) gb.log10PError(GenotypeLikelihoods.getGQLog10FromLikelihoods(PLindex, newLikelihoods)); + } + newGTs.add(gb.make()); + } + } + + return newGTs; + } + + public static VariantContext reverseTrimAlleles( final VariantContext inputVC ) { + + // see whether we need to trim common reference base from all alleles + final int trimExtent = computeReverseClipping(inputVC.getAlleles(), inputVC.getReference().getDisplayString().getBytes(), 0, false); + if ( trimExtent <= 0 || inputVC.getAlleles().size() <= 1 ) + return inputVC; + + final List alleles = new ArrayList(); + final GenotypesContext genotypes = GenotypesContext.create(); + final Map originalToTrimmedAlleleMap = new HashMap(); + + for (final Allele a : inputVC.getAlleles()) { + if (a.isSymbolic()) { + alleles.add(a); + originalToTrimmedAlleleMap.put(a, a); + } else { + // get bases for current allele and create a new one with trimmed bases + final byte[] newBases = Arrays.copyOfRange(a.getBases(), 0, a.length()-trimExtent); + final Allele trimmedAllele = Allele.create(newBases, a.isReference()); + alleles.add(trimmedAllele); + originalToTrimmedAlleleMap.put(a, trimmedAllele); + } + } + + // now we can recreate new genotypes with trimmed alleles + for ( final Genotype genotype : inputVC.getGenotypes() ) { + final List originalAlleles = genotype.getAlleles(); + final List trimmedAlleles = new ArrayList(); + for ( final Allele a : originalAlleles ) { + if ( a.isCalled() ) + trimmedAlleles.add(originalToTrimmedAlleleMap.get(a)); + else + trimmedAlleles.add(Allele.NO_CALL); + } + genotypes.add(new GenotypeBuilder(genotype).alleles(trimmedAlleles).make()); + } + + return new VariantContextBuilder(inputVC).stop(inputVC.getStart() + alleles.get(0).length() - 1).alleles(alleles).genotypes(genotypes).make(); + } + + public static int computeReverseClipping(final List unclippedAlleles, + final byte[] ref, + final int forwardClipping, + final boolean allowFullClip) { + int clipping = 0; + boolean stillClipping = true; + + while ( stillClipping ) { + for ( final Allele a : unclippedAlleles ) { + if ( a.isSymbolic() ) + continue; + + // we need to ensure that we don't reverse clip out all of the bases from an allele because we then will have the wrong + // position set for the VariantContext (although it's okay to forward clip it all out, because the position will be fine). + if ( a.length() - clipping == 0 ) + return clipping - (allowFullClip ? 0 : 1); + + if ( a.length() - clipping <= forwardClipping || a.length() - forwardClipping == 0 ) { + stillClipping = false; + } + else if ( ref.length == clipping ) { + if ( allowFullClip ) + stillClipping = false; + else + return -1; + } + else if ( a.getBases()[a.length()-clipping-1] != ref[ref.length-clipping-1] ) { + stillClipping = false; + } + } + if ( stillClipping ) + clipping++; + } + + return clipping; + } + /** * A simple but common wrapper for matching VariantContext objects using JEXL expressions */ @@ -602,9 +1028,10 @@ public class VariantContextUtils { if (vc.alleles.size() == 1) continue; if ( hasPLIncompatibleAlleles(alleles, vc.alleles)) { - if ( ! genotypes.isEmpty() ) - logger.debug(String.format("Stripping PLs at %s:%d-%d due to incompatible alleles merged=%s vs. single=%s", - vc.getChr(), vc.getStart(), vc.getEnd(), alleles, vc.alleles)); + if ( GeneralUtils.DEBUG_MODE_ENABLED && ! genotypes.isEmpty() ) { + System.err.println(String.format("Stripping PLs at %s:%d-%d due to incompatible alleles merged=%s vs. single=%s", + vc.getChr(), vc.getStart(), vc.getEnd(), alleles, vc.alleles)); + } genotypes = stripPLsAndAD(genotypes); // this will remove stale AC,AF attributed from vc calculateChromosomeCounts(vc, attributes, true); @@ -635,7 +1062,7 @@ public class VariantContextUtils { for ( final VariantContext vc : VCs ) if ( vc.isVariant() ) s.add( vc.isFiltered() ? MERGE_FILTER_PREFIX + vc.getSource() : vc.getSource() ); - setValue = Utils.join("-", s); + setValue = GeneralUtils.join("-", s); } if ( setKey != null ) { @@ -649,7 +1076,7 @@ public class VariantContextUtils { if ( depth > 0 ) attributes.put(VCFConstants.DEPTH_KEY, String.valueOf(depth)); - final String ID = rsIDs.isEmpty() ? VCFConstants.EMPTY_ID_FIELD : Utils.join(",", rsIDs); + final String ID = rsIDs.isEmpty() ? VCFConstants.EMPTY_ID_FIELD : GeneralUtils.join(",", rsIDs); final VariantContextBuilder builder = new VariantContextBuilder().source(name).id(ID); builder.loc(longestVC.getChr(), longestVC.getStart(), longestVC.getEnd()); diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/VariantJEXLContext.java b/public/java/src/org/broadinstitute/variant/variantcontext/VariantJEXLContext.java index 2df3e3227..efdd54b57 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/VariantJEXLContext.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/VariantJEXLContext.java @@ -27,7 +27,7 @@ package org.broadinstitute.variant.variantcontext; import org.apache.commons.jexl2.JexlContext; import org.apache.commons.jexl2.MapContext; -import org.broadinstitute.variant.utils.Utils; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.VCFConstants; import java.util.Collection; @@ -168,7 +168,7 @@ class JEXLMap implements Map { infoMap.put("QUAL", String.valueOf(vc.getPhredScaledQual())); // add alleles - infoMap.put("ALLELES", Utils.join(";", vc.getAlleles())); + infoMap.put("ALLELES", GeneralUtils.join(";", vc.getAlleles())); infoMap.put("N_ALLELES", String.valueOf(vc.getNAlleles())); // add attributes diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2FieldWriterManager.java b/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2FieldWriterManager.java index c80f83855..a3cbc5bf3 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2FieldWriterManager.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2FieldWriterManager.java @@ -27,7 +27,7 @@ package org.broadinstitute.variant.variantcontext.writer; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.apache.log4j.Logger; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.*; import java.util.HashMap; @@ -40,7 +40,6 @@ import java.util.Map; * @since 06/12 */ public class BCF2FieldWriterManager { - final protected static Logger logger = Logger.getLogger(BCF2FieldWriterManager.class); final Map siteWriters = new HashMap(); final Map genotypesWriters = new HashMap(); final IntGenotypeFieldAccessors intGenotypeFieldAccessors = new IntGenotypeFieldAccessors(); @@ -98,8 +97,8 @@ public class BCF2FieldWriterManager { final boolean createGenotypesEncoders ) { if ( createGenotypesEncoders && intGenotypeFieldAccessors.getAccessor(line.getID()) != null ) { - if ( line.getType() != VCFHeaderLineType.Integer ) - logger.warn("Warning: field " + line.getID() + " expected to encode an integer but saw " + line.getType() + " for record " + line); + if ( GeneralUtils.DEBUG_MODE_ENABLED && line.getType() != VCFHeaderLineType.Integer ) + System.err.println("Warning: field " + line.getID() + " expected to encode an integer but saw " + line.getType() + " for record " + line); return new BCF2FieldEncoder.IntArray(line, dict); } else if ( createGenotypesEncoders && line.getID().equals(VCFConstants.GENOTYPE_KEY) ) { return new BCF2FieldEncoder.GenericInts(line, dict); diff --git a/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2Writer.java b/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2Writer.java index e01a39cfb..c24ffec48 100644 --- a/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2Writer.java +++ b/public/java/src/org/broadinstitute/variant/variantcontext/writer/BCF2Writer.java @@ -28,11 +28,11 @@ package org.broadinstitute.variant.variantcontext.writer; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; import net.sf.samtools.SAMSequenceDictionary; -import org.apache.log4j.Logger; import org.broadinstitute.variant.bcf2.BCF2Codec; import org.broadinstitute.variant.bcf2.BCF2Type; import org.broadinstitute.variant.bcf2.BCF2Utils; import org.broadinstitute.variant.bcf2.BCFVersion; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.VCFConstants; import org.broadinstitute.variant.vcf.VCFContigHeaderLine; import org.broadinstitute.variant.vcf.VCFHeader; @@ -89,7 +89,6 @@ class BCF2Writer extends IndexingVariantContextWriter { public static final int MAJOR_VERSION = 2; public static final int MINOR_VERSION = 1; - final protected static Logger logger = Logger.getLogger(BCF2Writer.class); final private static boolean ALLOW_MISSING_CONTIG_LINES = false; private final OutputStream outputStream; // Note: do not flush until completely done writing, to avoid issues with eventual BGZF support @@ -129,7 +128,9 @@ class BCF2Writer extends IndexingVariantContextWriter { // create the config offsets map if ( header.getContigLines().isEmpty() ) { if ( ALLOW_MISSING_CONTIG_LINES ) { - logger.warn("No contig dictionary found in header, falling back to reference sequence dictionary"); + if ( GeneralUtils.DEBUG_MODE_ENABLED ) { + System.err.println("No contig dictionary found in header, falling back to reference sequence dictionary"); + } createContigDictionary(VCFUtils.makeContigHeaderLines(getRefDict(), null)); } else { throw new IllegalStateException("Cannot write BCF2 file with missing contig lines"); @@ -275,10 +276,8 @@ class BCF2Writer extends IndexingVariantContextWriter { if ( lgc.getUnparsedGenotypeData() instanceof BCF2Codec.LazyData && canSafelyWriteRawGenotypesBytes((BCF2Codec.LazyData) lgc.getUnparsedGenotypeData())) { - //logger.info("Passing on raw BCF2 genotypes data"); return (BCF2Codec.LazyData)lgc.getUnparsedGenotypeData(); } else { - //logger.info("Decoding raw BCF2 genotypes data"); lgc.decode(); // WARNING -- required to avoid keeping around bad lazy data for too long } } diff --git a/public/java/src/org/broadinstitute/variant/vcf/AbstractVCFCodec.java b/public/java/src/org/broadinstitute/variant/vcf/AbstractVCFCodec.java index 8ad79364b..11d152e65 100644 --- a/public/java/src/org/broadinstitute/variant/vcf/AbstractVCFCodec.java +++ b/public/java/src/org/broadinstitute/variant/vcf/AbstractVCFCodec.java @@ -25,7 +25,6 @@ package org.broadinstitute.variant.vcf; -import org.apache.log4j.Logger; import org.broad.tribble.AsciiFeatureCodec; import org.broad.tribble.Feature; import org.broad.tribble.NameAwareCodec; @@ -33,6 +32,7 @@ import org.broad.tribble.TribbleException; import org.broad.tribble.readers.LineReader; import org.broad.tribble.util.BlockCompressedInputStream; import org.broad.tribble.util.ParsingUtils; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.variantcontext.*; import java.io.FileInputStream; @@ -46,7 +46,6 @@ import java.util.zip.GZIPInputStream; public abstract class AbstractVCFCodec extends AsciiFeatureCodec implements NameAwareCodec { public final static int MAX_ALLELE_SIZE_BEFORE_WARNING = (int)Math.pow(2, 20); - protected final static Logger log = Logger.getLogger(AbstractVCFCodec.class); protected final static int NUM_STANDARD_FIELDS = 8; // INFO is the 8th column // we have to store the list of strings that make up the header until they're needed @@ -397,9 +396,9 @@ public abstract class AbstractVCFCodec extends AsciiFeatureCodec key = infoFieldArray[i]; final VCFInfoHeaderLine headerLine = header.getInfoHeaderLine(key); if ( headerLine != null && headerLine.getType() != VCFHeaderLineType.Flag ) { - if ( ! warnedAboutNoEqualsForNonFlag ) { - log.warn("Found info key " + key + " without a = value, but the header says the field is of type " - + headerLine.getType() + " but this construct is only value for FLAG type fields"); + if ( GeneralUtils.DEBUG_MODE_ENABLED && ! warnedAboutNoEqualsForNonFlag ) { + System.err.println("Found info key " + key + " without a = value, but the header says the field is of type " + + headerLine.getType() + " but this construct is only value for FLAG type fields"); warnedAboutNoEqualsForNonFlag = true; } @@ -517,8 +516,9 @@ public abstract class AbstractVCFCodec extends AsciiFeatureCodec if ( allele == null || allele.length() == 0 ) generateException("Empty alleles are not permitted in VCF records", lineNo); - if ( MAX_ALLELE_SIZE_BEFORE_WARNING != -1 && allele.length() > MAX_ALLELE_SIZE_BEFORE_WARNING ) - log.warn(String.format("Allele detected with length %d exceeding max size %d at approximately line %d, likely resulting in degraded VCF processing performance", allele.length(), MAX_ALLELE_SIZE_BEFORE_WARNING, lineNo)); + if ( GeneralUtils.DEBUG_MODE_ENABLED && MAX_ALLELE_SIZE_BEFORE_WARNING != -1 && allele.length() > MAX_ALLELE_SIZE_BEFORE_WARNING ) { + System.err.println(String.format("Allele detected with length %d exceeding max size %d at approximately line %d, likely resulting in degraded VCF processing performance", allele.length(), MAX_ALLELE_SIZE_BEFORE_WARNING, lineNo)); + } if ( isSymbolicAllele(allele) ) { if ( isRef ) { diff --git a/public/java/src/org/broadinstitute/variant/vcf/VCFCompoundHeaderLine.java b/public/java/src/org/broadinstitute/variant/vcf/VCFCompoundHeaderLine.java index 7aa378642..3fc790f80 100644 --- a/public/java/src/org/broadinstitute/variant/vcf/VCFCompoundHeaderLine.java +++ b/public/java/src/org/broadinstitute/variant/vcf/VCFCompoundHeaderLine.java @@ -25,8 +25,8 @@ package org.broadinstitute.variant.vcf; -import org.apache.log4j.Logger; import org.broad.tribble.TribbleException; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.variantcontext.GenotypeLikelihoods; import org.broadinstitute.variant.variantcontext.VariantContext; @@ -38,7 +38,6 @@ import java.util.Map; * a base class for compound header lines, which include info lines and format lines (so far) */ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCFIDHeaderLine { - final protected static Logger logger = Logger.getLogger(VCFHeader.class); public enum SupportedHeaderLineType { INFO(true), FORMAT(false); @@ -197,7 +196,9 @@ public abstract class VCFCompoundHeaderLine extends VCFHeaderLine implements VCF if ( type == VCFHeaderLineType.Flag && count != 0 ) { count = 0; - logger.warn("FLAG fields must have a count value of 0, but saw " + count + " for header line " + getID() + ". Changing it to 0 inside the code"); + if ( GeneralUtils.DEBUG_MODE_ENABLED ) { + System.err.println("FLAG fields must have a count value of 0, but saw " + count + " for header line " + getID() + ". Changing it to 0 inside the code"); + } } } diff --git a/public/java/src/org/broadinstitute/variant/vcf/VCFHeader.java b/public/java/src/org/broadinstitute/variant/vcf/VCFHeader.java index 9bdb86a48..9d4c4d576 100644 --- a/public/java/src/org/broadinstitute/variant/vcf/VCFHeader.java +++ b/public/java/src/org/broadinstitute/variant/vcf/VCFHeader.java @@ -25,9 +25,9 @@ package org.broadinstitute.variant.vcf; -import org.apache.log4j.Logger; import org.broad.tribble.TribbleException; import org.broad.tribble.util.ParsingUtils; +import org.broadinstitute.variant.utils.GeneralUtils; import java.util.*; @@ -45,7 +45,6 @@ import java.util.*; * A class representing the VCF header */ public class VCFHeader { - final protected static Logger logger = Logger.getLogger(VCFHeader.class); // the mandatory header fields public enum HEADER_FIELDS { @@ -238,9 +237,11 @@ public class VCFHeader { } if ( hasFormatLine(VCFConstants.GENOTYPE_LIKELIHOODS_KEY) && ! hasFormatLine(VCFConstants.GENOTYPE_PL_KEY) ) { - logger.warn("Found " + VCFConstants.GENOTYPE_LIKELIHOODS_KEY + " format, but no " - + VCFConstants.GENOTYPE_PL_KEY + " field. We now only manage PL fields internally" - + " automatically adding a corresponding PL field to your VCF header"); + if ( GeneralUtils.DEBUG_MODE_ENABLED ) { + System.err.println("Found " + VCFConstants.GENOTYPE_LIKELIHOODS_KEY + " format, but no " + + VCFConstants.GENOTYPE_PL_KEY + " field. We now only manage PL fields internally" + + " automatically adding a corresponding PL field to your VCF header"); + } addMetaDataLine(new VCFFormatHeaderLine(VCFConstants.GENOTYPE_PL_KEY, VCFHeaderLineCount.G, VCFHeaderLineType.Integer, "Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification")); } } @@ -254,10 +255,14 @@ public class VCFHeader { */ private final void addMetaDataMapBinding(final Map map, T line) { final String key = line.getID(); - if ( map.containsKey(key) ) - logger.debug("Found duplicate VCF header lines for " + key + "; keeping the first only" ); - else + if ( map.containsKey(key) ) { + if ( GeneralUtils.DEBUG_MODE_ENABLED ) { + System.err.println("Found duplicate VCF header lines for " + key + "; keeping the first only" ); + } + } + else { map.put(key, line); + } } /** diff --git a/public/java/src/org/broadinstitute/variant/vcf/VCFStandardHeaderLines.java b/public/java/src/org/broadinstitute/variant/vcf/VCFStandardHeaderLines.java index b6f982193..d289c679e 100644 --- a/public/java/src/org/broadinstitute/variant/vcf/VCFStandardHeaderLines.java +++ b/public/java/src/org/broadinstitute/variant/vcf/VCFStandardHeaderLines.java @@ -27,8 +27,8 @@ package org.broadinstitute.variant.vcf; import com.google.java.contract.Ensures; import com.google.java.contract.Requires; -import org.apache.log4j.Logger; import org.broad.tribble.TribbleException; +import org.broadinstitute.variant.utils.GeneralUtils; import java.util.*; @@ -46,7 +46,6 @@ public class VCFStandardHeaderLines { * Enabling this causes us to repair header lines even if only their descriptions differ */ private final static boolean REPAIR_BAD_DESCRIPTIONS = false; - protected final static Logger logger = Logger.getLogger(VCFStandardHeaderLines.class); private static Standards formatStandards = new Standards(); private static Standards infoStandards = new Standards(); @@ -216,11 +215,13 @@ public class VCFStandardHeaderLines { final boolean needsRepair = badCountType || badCount || badType || (REPAIR_BAD_DESCRIPTIONS && badDesc); if ( needsRepair ) { - logger.warn("Repairing standard header line for field " + line.getID() + " because" - + (badCountType ? " -- count types disagree; header has " + line.getCountType() + " but standard is " + standard.getCountType() : "") - + (badType ? " -- type disagree; header has " + line.getType() + " but standard is " + standard.getType() : "") - + (badCount ? " -- counts disagree; header has " + line.getCount() + " but standard is " + standard.getCount() : "") - + (badDesc ? " -- descriptions disagree; header has '" + line.getDescription() + "' but standard is '" + standard.getDescription() + "'": "")); + if ( GeneralUtils.DEBUG_MODE_ENABLED ) { + System.err.println("Repairing standard header line for field " + line.getID() + " because" + + (badCountType ? " -- count types disagree; header has " + line.getCountType() + " but standard is " + standard.getCountType() : "") + + (badType ? " -- type disagree; header has " + line.getType() + " but standard is " + standard.getType() : "") + + (badCount ? " -- counts disagree; header has " + line.getCount() + " but standard is " + standard.getCount() : "") + + (badDesc ? " -- descriptions disagree; header has '" + line.getDescription() + "' but standard is '" + standard.getDescription() + "'": "")); + } return standard; } else return line; diff --git a/public/java/src/org/broadinstitute/variant/vcf/VCFUtils.java b/public/java/src/org/broadinstitute/variant/vcf/VCFUtils.java index f7d4c5b45..db2d47609 100644 --- a/public/java/src/org/broadinstitute/variant/vcf/VCFUtils.java +++ b/public/java/src/org/broadinstitute/variant/vcf/VCFUtils.java @@ -28,17 +28,22 @@ package org.broadinstitute.variant.vcf; import net.sf.samtools.SAMSequenceDictionary; import net.sf.samtools.SAMSequenceRecord; import org.apache.commons.io.FilenameUtils; -import org.apache.log4j.Logger; +import org.broad.tribble.FeatureCodecHeader; +import org.broad.tribble.readers.PositionalBufferedStream; +import org.broadinstitute.variant.utils.GeneralUtils; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.VariantContext; import java.io.File; +import java.io.FileInputStream; +import java.io.IOException; import java.util.*; public class VCFUtils { - public static Set smartMergeHeaders(Collection headers, Logger logger) throws IllegalStateException { + public static Set smartMergeHeaders(Collection headers, boolean emitWarnings) throws IllegalStateException { HashMap map = new HashMap(); // from KEY.NAME -> line - HeaderConflictWarner conflictWarner = new HeaderConflictWarner(logger); + HeaderConflictWarner conflictWarner = new HeaderConflictWarner(emitWarnings); // todo -- needs to remove all version headers from sources and add its own VCF version line for ( VCFHeader source : headers ) { @@ -193,19 +198,48 @@ public class VCFUtils { return assembly; } - /** Only displays a warning if a logger is provided and an identical warning hasn't been already issued */ + /** + * Read all of the VCF records from source into memory, returning the header and the VariantContexts + * + * @param source the file to read, must be in VCF4 format + * @return + * @throws java.io.IOException + */ + public static Pair> readVCF(final File source) throws IOException { + // read in the features + final List vcs = new ArrayList(); + final VCFCodec codec = new VCFCodec(); + PositionalBufferedStream pbs = new PositionalBufferedStream(new FileInputStream(source)); + FeatureCodecHeader header = codec.readHeader(pbs); + pbs.close(); + + pbs = new PositionalBufferedStream(new FileInputStream(source)); + pbs.skip(header.getHeaderEnd()); + + final VCFHeader vcfHeader = (VCFHeader)header.getHeaderValue(); + + while ( ! pbs.isDone() ) { + final VariantContext vc = codec.decode(pbs); + if ( vc != null ) + vcs.add(vc); + } + + return new Pair>(vcfHeader, vcs); + } + + /** Only displays a warning if warnings are enabled and an identical warning hasn't been already issued */ private static final class HeaderConflictWarner { - Logger logger; + boolean emitWarnings; Set alreadyIssued = new HashSet(); - private HeaderConflictWarner(final Logger logger) { - this.logger = logger; + private HeaderConflictWarner( final boolean emitWarnings ) { + this.emitWarnings = emitWarnings; } public void warn(final VCFHeaderLine line, final String msg) { - if ( logger != null && ! alreadyIssued.contains(line.getKey()) ) { + if ( GeneralUtils.DEBUG_MODE_ENABLED && emitWarnings && ! alreadyIssued.contains(line.getKey()) ) { alreadyIssued.add(line.getKey()); - logger.warn(msg); + System.err.println(msg); } } } diff --git a/public/java/test/org/broadinstitute/sting/WalkerTest.java b/public/java/test/org/broadinstitute/sting/WalkerTest.java index 9e4612de5..6c0a18f1d 100644 --- a/public/java/test/org/broadinstitute/sting/WalkerTest.java +++ b/public/java/test/org/broadinstitute/sting/WalkerTest.java @@ -35,8 +35,8 @@ import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.phonehome.GATKRunReport; import org.broadinstitute.sting.utils.Utils; import org.broadinstitute.variant.bcf2.BCF2Utils; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.vcf.VCFCodec; -import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; import org.broadinstitute.sting.utils.exceptions.StingException; import org.broadinstitute.variant.variantcontext.VariantContextTestProvider; diff --git a/public/java/test/org/broadinstitute/sting/utils/MWUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/MWUnitTest.java index c81043f90..a56045165 100644 --- a/public/java/test/org/broadinstitute/sting/utils/MWUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/MWUnitTest.java @@ -25,11 +25,9 @@ package org.broadinstitute.sting.utils; -import cern.jet.math.Arithmetic; import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; -import org.jgrapht.alg.StrongConnectivityInspector; import org.testng.annotations.BeforeClass; import org.testng.annotations.Test; import org.testng.Assert; diff --git a/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java b/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java index 2c7d78169..35fa47ede 100644 --- a/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/activeregion/BandPassActivityProfileUnitTest.java @@ -35,8 +35,8 @@ import org.broadinstitute.sting.BaseTest; import org.broadinstitute.sting.utils.GenomeLoc; import org.broadinstitute.sting.utils.GenomeLocParser; import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.collections.Pair; import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.variantcontext.VariantContextTestProvider; import org.broadinstitute.variant.vcf.VCFCodec; diff --git a/public/java/test/org/broadinstitute/variant/vcf/VCFIntegrationTest.java b/public/java/test/org/broadinstitute/sting/utils/variant/VCFIntegrationTest.java similarity index 98% rename from public/java/test/org/broadinstitute/variant/vcf/VCFIntegrationTest.java rename to public/java/test/org/broadinstitute/sting/utils/variant/VCFIntegrationTest.java index 2d36f09c2..f4cef7730 100644 --- a/public/java/test/org/broadinstitute/variant/vcf/VCFIntegrationTest.java +++ b/public/java/test/org/broadinstitute/sting/utils/variant/VCFIntegrationTest.java @@ -23,10 +23,9 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.variant.vcf; +package org.broadinstitute.sting.utils.variant; import org.broadinstitute.sting.WalkerTest; -import org.broadinstitute.sting.utils.exceptions.UserException; import org.testng.annotations.Test; import java.io.File; diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextBenchmark.java b/public/java/test/org/broadinstitute/sting/utils/variant/VariantContextBenchmark.java similarity index 99% rename from public/java/test/org/broadinstitute/variant/variantcontext/VariantContextBenchmark.java rename to public/java/test/org/broadinstitute/sting/utils/variant/VariantContextBenchmark.java index 34abe372f..8a6d2138e 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextBenchmark.java +++ b/public/java/test/org/broadinstitute/sting/utils/variant/VariantContextBenchmark.java @@ -23,13 +23,13 @@ * THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ -package org.broadinstitute.variant.variantcontext; +package org.broadinstitute.sting.utils.variant; import com.google.caliper.Param; import com.google.caliper.SimpleBenchmark; import org.broad.tribble.Feature; import org.broad.tribble.FeatureCodec; -import org.broadinstitute.sting.utils.GenomeLocParser; +import org.broadinstitute.variant.variantcontext.*; import org.broadinstitute.variant.vcf.VCFCodec; import java.util.ArrayList; @@ -73,8 +73,6 @@ public class VariantContextBenchmark extends SimpleBenchmark { MERGE } - private GenomeLocParser b37GenomeLocParser; - @Override protected void setUp() { // TODO -- update for new tribble interface // try { diff --git a/public/java/test/org/broadinstitute/variant/VariantBaseTest.java b/public/java/test/org/broadinstitute/variant/VariantBaseTest.java new file mode 100644 index 000000000..be70b22e6 --- /dev/null +++ b/public/java/test/org/broadinstitute/variant/VariantBaseTest.java @@ -0,0 +1,141 @@ +package org.broadinstitute.variant; + +import org.testng.Assert; + +import java.io.File; +import java.io.IOException; +import java.util.*; + +/** + * Base class for test classes within org.broadinstitute.variant + */ +public class VariantBaseTest { + + public static final String hg19Reference = "/seq/references/Homo_sapiens_assembly19/v1/Homo_sapiens_assembly19.fasta"; + public static final String b37KGReference = "/humgen/1kg/reference/human_g1k_v37.fasta"; + + // TODO: change this to an appropriate value once the move to the Picard repo takes place + public static final String variantTestDataRoot = new File("private/testdata/").getAbsolutePath() + "/"; + + /** + * Simple generic utility class to creating TestNG data providers: + * + * 1: inherit this class, as in + * + * private class SummarizeDifferenceTest extends TestDataProvider { + * public SummarizeDifferenceTest() { + * super(SummarizeDifferenceTest.class); + * } + * ... + * } + * + * Provide a reference to your class to the TestDataProvider constructor. + * + * 2: Create instances of your subclass. Return from it the call to getTests, providing + * the class type of your test + * + * @DataProvider(name = "summaries" + * public Object[][] createSummaries() { + * new SummarizeDifferenceTest().addDiff("A", "A").addSummary("A:2"); + * new SummarizeDifferenceTest().addDiff("A", "B").addSummary("A:1", "B:1"); + * return SummarizeDifferenceTest.getTests(SummarizeDifferenceTest.class); + * } + * + * This class magically tracks created objects of this + */ + public static class TestDataProvider { + private static final Map> tests = new HashMap>(); + protected String name; + + /** + * Create a new TestDataProvider instance bound to the class variable C + * @param c + */ + public TestDataProvider(Class c, String name) { + if ( ! tests.containsKey(c) ) + tests.put(c, new ArrayList()); + tests.get(c).add(this); + this.name = name; + } + + public TestDataProvider(Class c) { + this(c, ""); + } + + public void setName(final String name) { + this.name = name; + } + + /** + * Return all of the data providers in the form expected by TestNG of type class C + * @param c + * @return + */ + public static Object[][] getTests(Class c) { + List params2 = new ArrayList(); + for ( Object x : tests.get(c) ) params2.add(new Object[]{x}); + return params2.toArray(new Object[][]{}); + } + + @Override + public String toString() { + return "TestDataProvider("+name+")"; + } + } + + /** + * Creates a temp file that will be deleted on exit after tests are complete. + * @param name Prefix of the file. + * @param extension Extension to concat to the end of the file. + * @return A file in the temporary directory starting with name, ending with extension, which will be deleted after the program exits. + */ + public static File createTempFile(String name, String extension) { + try { + File file = File.createTempFile(name, extension); + file.deleteOnExit(); + return file; + } catch (IOException ex) { + throw new RuntimeException("Cannot create temp file: " + ex.getMessage(), ex); + } + } + + private static final double DEFAULT_FLOAT_TOLERANCE = 1e-1; + + public static final void assertEqualsDoubleSmart(final Object actual, final Double expected) { + Assert.assertTrue(actual instanceof Double, "Not a double"); + assertEqualsDoubleSmart((double)(Double)actual, (double)expected); + } + + public static final void assertEqualsDoubleSmart(final Object actual, final Double expected, final double tolerance) { + Assert.assertTrue(actual instanceof Double, "Not a double"); + assertEqualsDoubleSmart((double)(Double)actual, (double)expected, tolerance); + } + + public static final void assertEqualsDoubleSmart(final double actual, final double expected) { + assertEqualsDoubleSmart(actual, expected, DEFAULT_FLOAT_TOLERANCE); + } + + public static final void assertEqualsSet(final Set actual, final Set expected, final String info) { + final Set actualSet = new HashSet(actual); + final Set expectedSet = new HashSet(expected); + Assert.assertTrue(actualSet.equals(expectedSet), info); // note this is necessary due to testng bug for set comps + } + + public static void assertEqualsDoubleSmart(final double actual, final double expected, final double tolerance) { + assertEqualsDoubleSmart(actual, expected, tolerance, null); + } + + public static void assertEqualsDoubleSmart(final double actual, final double expected, final double tolerance, final String message) { + if ( Double.isNaN(expected) ) // NaN == NaN => false unfortunately + Assert.assertTrue(Double.isNaN(actual), "expected is nan, actual is not"); + else if ( Double.isInfinite(expected) ) // NaN == NaN => false unfortunately + Assert.assertTrue(Double.isInfinite(actual), "expected is infinite, actual is not"); + else { + final double delta = Math.abs(actual - expected); + final double ratio = Math.abs(actual / expected - 1.0); + Assert.assertTrue(delta < tolerance || ratio < tolerance, "expected = " + expected + " actual = " + actual + + " not within tolerance " + tolerance + + (message == null ? "" : "message: " + message)); + } + } +} diff --git a/public/java/test/org/broadinstitute/variant/bcf2/BCF2EncoderDecoderUnitTest.java b/public/java/test/org/broadinstitute/variant/bcf2/BCF2EncoderDecoderUnitTest.java index 35c4eacfb..8f3a216b7 100644 --- a/public/java/test/org/broadinstitute/variant/bcf2/BCF2EncoderDecoderUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/bcf2/BCF2EncoderDecoderUnitTest.java @@ -25,12 +25,9 @@ package org.broadinstitute.variant.bcf2; - // the imports for unit testing. - - import org.apache.commons.lang.ArrayUtils; -import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.variant.VariantBaseTest; import org.broadinstitute.variant.variantcontext.writer.BCF2Encoder; import org.testng.Assert; import org.testng.annotations.BeforeSuite; @@ -47,7 +44,7 @@ import java.util.Collections; import java.util.List; -public class BCF2EncoderDecoderUnitTest extends BaseTest { +public class BCF2EncoderDecoderUnitTest extends VariantBaseTest { private final double FLOAT_TOLERANCE = 1e-6; final List primitives = new ArrayList(); final List basicTypes = new ArrayList(); @@ -561,7 +558,7 @@ public class BCF2EncoderDecoderUnitTest extends BaseTest { final double valueFloat = (Double)tv.value; final double decodedFloat = (Double)decoded; - BaseTest.assertEqualsDoubleSmart(decodedFloat, valueFloat, FLOAT_TOLERANCE); + VariantBaseTest.assertEqualsDoubleSmart(decodedFloat, valueFloat, FLOAT_TOLERANCE); } else Assert.assertEquals(decoded, tv.value); } diff --git a/public/java/test/org/broadinstitute/variant/bcf2/BCF2UtilsUnitTest.java b/public/java/test/org/broadinstitute/variant/bcf2/BCF2UtilsUnitTest.java index 6d854f080..5d01a458b 100644 --- a/public/java/test/org/broadinstitute/variant/bcf2/BCF2UtilsUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/bcf2/BCF2UtilsUnitTest.java @@ -25,8 +25,8 @@ package org.broadinstitute.variant.bcf2; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.Utils; +import org.broadinstitute.variant.VariantBaseTest; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.*; import java.util.*; @@ -37,7 +37,7 @@ import org.testng.annotations.Test; /** * Tests for BCF2Utils */ -public final class BCF2UtilsUnitTest extends BaseTest { +public final class BCF2UtilsUnitTest extends VariantBaseTest { @DataProvider(name = "CollapseExpandTest") public Object[][] makeCollapseExpandTest() { List tests = new ArrayList(); @@ -87,7 +87,7 @@ public final class BCF2UtilsUnitTest extends BaseTest { final List empty = Collections.emptyList(); final List> permutations = extrasToTake == 0 ? Collections.singletonList(empty) - : Utils.makePermutations(extraLines, extrasToTake, false); + : GeneralUtils.makePermutations(extraLines, extrasToTake, false); for ( final List permutation : permutations ) { for ( int i = -1; i < inputLines.size(); i++ ) { final List allLines = new ArrayList(inputLines); @@ -113,7 +113,7 @@ public final class BCF2UtilsUnitTest extends BaseTest { final List> permutations = testSamples.isEmpty() ? Collections.singletonList(testSamples) - : Utils.makePermutations(testSamples, testSamples.size(), false); + : GeneralUtils.makePermutations(testSamples, testSamples.size(), false); for ( final List testSamplesPermutation : permutations ) { final VCFHeader testHeaderWithSamples = new VCFHeader(inputHeader.getMetaDataInInputOrder(), testSamplesPermutation); final boolean expectedConsistent = testSamples.equals(inSamples); diff --git a/public/java/test/org/broadinstitute/variant/utils/BaseUtilsUnitTest.java b/public/java/test/org/broadinstitute/variant/utils/BaseUtilsUnitTest.java index 37627204f..738fa28e2 100644 --- a/public/java/test/org/broadinstitute/variant/utils/BaseUtilsUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/utils/BaseUtilsUnitTest.java @@ -25,21 +25,18 @@ package org.broadinstitute.variant.utils; -import org.broadinstitute.sting.utils.MathUtils; +import org.broadinstitute.variant.VariantBaseTest; import org.testng.Assert; -import org.broadinstitute.sting.BaseTest; import org.testng.annotations.Test; import org.testng.annotations.BeforeClass; -public class BaseUtilsUnitTest extends BaseTest { +public class BaseUtilsUnitTest extends VariantBaseTest { @BeforeClass public void init() { } @Test public void testMostFrequentBaseFraction() { - logger.warn("Executing testMostFrequentBaseFraction"); - compareFrequentBaseFractionToExpected("AAAAA", 1.0); compareFrequentBaseFractionToExpected("ACCG", 0.5); compareFrequentBaseFractionToExpected("ACCCCTTTTG", 4.0/10.0); @@ -47,7 +44,7 @@ public class BaseUtilsUnitTest extends BaseTest { private void compareFrequentBaseFractionToExpected(String sequence, double expected) { double fraction = BaseUtils.mostFrequentBaseFraction(sequence.getBytes()); - Assert.assertTrue(MathUtils.compareDoubles(fraction, expected) == 0); + Assert.assertTrue(GeneralUtils.compareDoubles(fraction, expected) == 0); } @Test @@ -67,8 +64,6 @@ public class BaseUtilsUnitTest extends BaseTest { @Test public void testTransitionTransversion() { - logger.warn("Executing testTransitionTransversion"); - Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'T' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'C' ) == BaseUtils.BaseSubstitutionType.TRANSVERSION ); Assert.assertTrue( BaseUtils.SNPSubstitutionType( (byte)'A', (byte)'G' ) == BaseUtils.BaseSubstitutionType.TRANSITION ); @@ -94,8 +89,6 @@ public class BaseUtilsUnitTest extends BaseTest { @Test public void testReverseComplementString() { - logger.warn("Executing testReverseComplementString"); - compareRCStringToExpected("ACGGT", "ACCGT"); compareRCStringToExpected("TCGTATATCTCGCTATATATATATAGCTCTAGTATA", "TATACTAGAGCTATATATATATAGCGAGATATACGA"); compareRCStringToExpected("AAAN", "NTTT"); diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/AlleleUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/AlleleUnitTest.java index f1dff7ab1..7fa652f2f 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/AlleleUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/AlleleUnitTest.java @@ -28,6 +28,7 @@ package org.broadinstitute.variant.variantcontext; // the imports for unit testing. +import org.broadinstitute.variant.VariantBaseTest; import org.testng.Assert; import org.testng.annotations.BeforeSuite; import org.testng.annotations.Test; @@ -44,7 +45,7 @@ import org.testng.annotations.Test; /** * Basic unit test for RecalData */ -public class AlleleUnitTest { +public class AlleleUnitTest extends VariantBaseTest { Allele ARef, A, T, ATIns, ATCIns, NoCall; @BeforeSuite diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeLikelihoodsUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeLikelihoodsUnitTest.java index 03d6f457f..fb180c476 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeLikelihoodsUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeLikelihoodsUnitTest.java @@ -30,9 +30,9 @@ package org.broadinstitute.variant.variantcontext; import org.broad.tribble.TribbleException; +import org.broadinstitute.variant.VariantBaseTest; import org.broadinstitute.variant.utils.BaseUtils; -import org.broadinstitute.sting.utils.MathUtils; -import org.broadinstitute.sting.utils.exceptions.UserException; +import org.broadinstitute.variant.utils.GeneralUtils; import org.testng.Assert; import org.testng.annotations.Test; @@ -44,7 +44,7 @@ import java.util.List; /** * Basic unit test for Genotype likelihoods objects */ -public class GenotypeLikelihoodsUnitTest { +public class GenotypeLikelihoodsUnitTest extends VariantBaseTest { double [] v = new double[]{-10.5, -1.25, -5.11}; final static String vGLString = "-10.50,-1.25,-5.11"; final static String vPLString = "93,0,39"; @@ -88,7 +88,7 @@ public class GenotypeLikelihoodsUnitTest { //Linear scale glMap = gl.getAsMap(true); - double [] vl = MathUtils.normalizeFromLog10(v); + double [] vl = GeneralUtils.normalizeFromLog10(v); Assert.assertEquals(vl[GenotypeType.HOM_REF.ordinal()-1],glMap.get(GenotypeType.HOM_REF)); Assert.assertEquals(vl[GenotypeType.HET.ordinal()-1],glMap.get(GenotypeType.HET)); Assert.assertEquals(vl[GenotypeType.HOM_VAR.ordinal()-1],glMap.get(GenotypeType.HOM_VAR)); @@ -118,7 +118,7 @@ public class GenotypeLikelihoodsUnitTest { //GQ for the best guess genotype Assert.assertEquals(gl.getLog10GQ(GenotypeType.HET),-3.9); - double[] test = MathUtils.normalizeFromLog10(gl.getAsVector()); + double[] test = GeneralUtils.normalizeFromLog10(gl.getAsVector()); //GQ for the other genotypes Assert.assertEquals(gl.getLog10GQ(GenotypeType.HOM_REF), Math.log10(1.0 - test[GenotypeType.HOM_REF.ordinal()-1])); diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeUnitTest.java index 2148b555e..8d0d2af90 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/GenotypeUnitTest.java @@ -29,13 +29,13 @@ package org.broadinstitute.variant.variantcontext; // the imports for unit testing. -import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.variant.VariantBaseTest; import org.testng.Assert; import org.testng.annotations.BeforeSuite; import org.testng.annotations.Test; -public class GenotypeUnitTest extends BaseTest { +public class GenotypeUnitTest extends VariantBaseTest { Allele A, Aref, T; @BeforeSuite diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/GenotypesContextUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/GenotypesContextUnitTest.java index a7e7fe357..1618ad1f2 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/GenotypesContextUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/GenotypesContextUnitTest.java @@ -30,8 +30,8 @@ package org.broadinstitute.variant.variantcontext; import org.broad.tribble.util.ParsingUtils; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.Utils; +import org.broadinstitute.variant.VariantBaseTest; +import org.broadinstitute.variant.utils.GeneralUtils; import org.testng.Assert; import org.testng.annotations.BeforeSuite; import org.testng.annotations.DataProvider; @@ -40,7 +40,7 @@ import org.testng.annotations.Test; import java.util.*; -public class GenotypesContextUnitTest extends BaseTest { +public class GenotypesContextUnitTest extends VariantBaseTest { Allele Aref, C, T; Genotype AA, AT, TT, AC, CT, CC, MISSING; List allGenotypes; @@ -128,7 +128,7 @@ public class GenotypesContextUnitTest extends BaseTest { // sorted new GenotypesContextProvider(maker, samples); // unsorted - new GenotypesContextProvider(maker, Utils.reverse(samples)); + new GenotypesContextProvider(maker, GeneralUtils.reverse(samples)); } } diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java index f489806f6..d739e4aa5 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextTestProvider.java @@ -25,15 +25,14 @@ package org.broadinstitute.variant.variantcontext; -import org.apache.log4j.Logger; import org.broad.tribble.FeatureCodec; import org.broad.tribble.FeatureCodecHeader; import org.broad.tribble.readers.PositionalBufferedStream; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.Utils; +import org.broadinstitute.variant.VariantBaseTest; import org.broadinstitute.variant.bcf2.BCF2Codec; +import org.broadinstitute.variant.utils.GeneralUtils; import org.broadinstitute.variant.vcf.*; -import org.broadinstitute.sting.utils.collections.Pair; +import org.broadinstitute.variant.utils.Pair; import org.broadinstitute.variant.variantcontext.writer.Options; import org.broadinstitute.variant.variantcontext.writer.VariantContextWriter; import org.testng.Assert; @@ -50,8 +49,6 @@ import java.util.*; * @since Date created */ public class VariantContextTestProvider { - final protected static Logger logger = Logger.getLogger(VariantContextTestProvider.class); - final private static boolean ENABLE_GENOTYPE_TESTS = true; final private static boolean ENABLE_A_AND_G_TESTS = true; final private static boolean ENABLE_VARARRAY_TESTS = true; @@ -68,12 +65,12 @@ public class VariantContextTestProvider { private final static List testSourceVCFs = new ArrayList(); static { - testSourceVCFs.add(new File(BaseTest.privateTestDir + "ILLUMINA.wex.broad_phase2_baseline.20111114.both.exome.genotypes.1000.vcf")); - testSourceVCFs.add(new File(BaseTest.privateTestDir + "ex2.vcf")); - testSourceVCFs.add(new File(BaseTest.privateTestDir + "dbsnp_135.b37.1000.vcf")); + testSourceVCFs.add(new File(VariantBaseTest.variantTestDataRoot + "ILLUMINA.wex.broad_phase2_baseline.20111114.both.exome.genotypes.1000.vcf")); + testSourceVCFs.add(new File(VariantBaseTest.variantTestDataRoot + "ex2.vcf")); + testSourceVCFs.add(new File(VariantBaseTest.variantTestDataRoot + "dbsnp_135.b37.1000.vcf")); if ( ENABLE_SYMBOLIC_ALLELE_TESTS ) { - testSourceVCFs.add(new File(BaseTest.privateTestDir + "diagnosis_targets_testfile.vcf")); - testSourceVCFs.add(new File(BaseTest.privateTestDir + "VQSR.mixedTest.recal")); + testSourceVCFs.add(new File(VariantBaseTest.variantTestDataRoot + "diagnosis_targets_testfile.vcf")); + testSourceVCFs.add(new File(VariantBaseTest.variantTestDataRoot + "VQSR.mixedTest.recal")); } } @@ -156,12 +153,10 @@ public class VariantContextTestProvider { Pair> x = readAllVCs( file, codec ); List fullyDecoded = new ArrayList(); - logger.warn("Reading records from " + file); for ( final VariantContext raw : x.getSecond() ) { if ( raw != null ) fullyDecoded.add(raw.fullyDecode(x.getFirst(), false)); } - logger.warn("Done reading " + file); TEST_DATAs.add(new VariantContextTestData(x.getFirst(), fullyDecoded)); } @@ -788,12 +783,12 @@ public class VariantContextTestProvider { assertAttributesEquals(actual.getAttributes(), expected.getAttributes()); Assert.assertEquals(actual.filtersWereApplied(), expected.filtersWereApplied(), "filtersWereApplied"); Assert.assertEquals(actual.isFiltered(), expected.isFiltered(), "isFiltered"); - BaseTest.assertEqualsSet(actual.getFilters(), expected.getFilters(), "filters"); - BaseTest.assertEqualsDoubleSmart(actual.getPhredScaledQual(), expected.getPhredScaledQual()); + VariantBaseTest.assertEqualsSet(actual.getFilters(), expected.getFilters(), "filters"); + VariantBaseTest.assertEqualsDoubleSmart(actual.getPhredScaledQual(), expected.getPhredScaledQual()); Assert.assertEquals(actual.hasGenotypes(), expected.hasGenotypes(), "hasGenotypes"); if ( expected.hasGenotypes() ) { - BaseTest.assertEqualsSet(actual.getSampleNames(), expected.getSampleNames(), "sample names set"); + VariantBaseTest.assertEqualsSet(actual.getSampleNames(), expected.getSampleNames(), "sample names set"); Assert.assertEquals(actual.getSampleNamesOrderedByName(), expected.getSampleNamesOrderedByName(), "sample names"); final Set samples = expected.getSampleNames(); for ( final String sample : samples ) { @@ -879,7 +874,7 @@ public class VariantContextTestProvider { private static void assertAttributeEquals(final String key, final Object actual, final Object expected) { if ( expected instanceof Double ) { // must be very tolerant because doubles are being rounded to 2 sig figs - BaseTest.assertEqualsDoubleSmart(actual, (Double)expected, 1e-2); + VariantBaseTest.assertEqualsDoubleSmart(actual, (Double)expected, 1e-2); } else Assert.assertEquals(actual, expected, "Attribute " + key); } @@ -935,7 +930,7 @@ public class VariantContextTestProvider { } private static List> makeAllGenotypes(final List alleles, final int highestPloidy) { - return Utils.makePermutations(alleles, highestPloidy, true); + return GeneralUtils.makePermutations(alleles, highestPloidy, true); } public static void assertEquals(final VCFHeader actual, final VCFHeader expected) { diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java index d34e6396d..d09800760 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUnitTest.java @@ -29,9 +29,8 @@ package org.broadinstitute.variant.variantcontext; // the imports for unit testing. -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.collections.Pair; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.variant.VariantBaseTest; +import org.broadinstitute.variant.utils.Pair; import org.testng.annotations.BeforeSuite; import org.testng.annotations.BeforeMethod; import org.testng.annotations.DataProvider; @@ -41,7 +40,7 @@ import org.testng.Assert; import java.util.*; -public class VariantContextUnitTest extends BaseTest { +public class VariantContextUnitTest extends VariantBaseTest { Allele A, Aref, C, T, Tref; Allele del, delRef, ATC, ATCref; @@ -500,30 +499,30 @@ public class VariantContextUnitTest extends BaseTest { Pair,byte[]> result; byte[] refBytes = "TATCATCATCGGA".getBytes(); - Assert.assertEquals(GATKVariantContextUtils.findNumberofRepetitions("ATG".getBytes(), "ATGATGATGATG".getBytes()),4); - Assert.assertEquals(GATKVariantContextUtils.findNumberofRepetitions("G".getBytes(), "ATGATGATGATG".getBytes()),0); - Assert.assertEquals(GATKVariantContextUtils.findNumberofRepetitions("T".getBytes(), "T".getBytes()),1); - Assert.assertEquals(GATKVariantContextUtils.findNumberofRepetitions("AT".getBytes(), "ATGATGATCATG".getBytes()),1); - Assert.assertEquals(GATKVariantContextUtils.findNumberofRepetitions("CCC".getBytes(), "CCCCCCCC".getBytes()),2); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("ATG".getBytes(), "ATGATGATGATG".getBytes()),4); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("G".getBytes(), "ATGATGATGATG".getBytes()),0); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("T".getBytes(), "T".getBytes()),1); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("AT".getBytes(), "ATGATGATCATG".getBytes()),1); + Assert.assertEquals(VariantContextUtils.findNumberofRepetitions("CCC".getBytes(), "CCCCCCCC".getBytes()),2); - Assert.assertEquals(GATKVariantContextUtils.findRepeatedSubstring("ATG".getBytes()),3); - Assert.assertEquals(GATKVariantContextUtils.findRepeatedSubstring("AAA".getBytes()),1); - Assert.assertEquals(GATKVariantContextUtils.findRepeatedSubstring("CACACAC".getBytes()),7); - Assert.assertEquals(GATKVariantContextUtils.findRepeatedSubstring("CACACA".getBytes()),2); - Assert.assertEquals(GATKVariantContextUtils.findRepeatedSubstring("CATGCATG".getBytes()),4); - Assert.assertEquals(GATKVariantContextUtils.findRepeatedSubstring("AATAATA".getBytes()),7); + Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("ATG".getBytes()),3); + Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("AAA".getBytes()),1); + Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("CACACAC".getBytes()),7); + Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("CACACA".getBytes()),2); + Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("CATGCATG".getBytes()),4); + Assert.assertEquals(VariantContextUtils.findRepeatedSubstring("AATAATA".getBytes()),7); // A*,ATC, context = ATC ATC ATC : (ATC)3 -> (ATC)4 VariantContext vc = new VariantContextBuilder("foo", insLoc, insLocStart, insLocStop, Arrays.asList(nullR,atc)).make(); - result = GATKVariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); + result = VariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); Assert.assertEquals(result.getFirst().toArray()[0],3); Assert.assertEquals(result.getFirst().toArray()[1],4); Assert.assertEquals(result.getSecond().length,3); // ATC*,A,ATCATC vc = new VariantContextBuilder("foo", insLoc, insLocStart, insLocStart+3, Arrays.asList(Allele.create("AATC", true),nullA,atcatc)).make(); - result = GATKVariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); + result = VariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); Assert.assertEquals(result.getFirst().toArray()[0],3); Assert.assertEquals(result.getFirst().toArray()[1],2); Assert.assertEquals(result.getFirst().toArray()[2],4); @@ -532,7 +531,7 @@ public class VariantContextUnitTest extends BaseTest { // simple non-tandem deletion: CCCC*, - refBytes = "TCCCCCCCCATG".getBytes(); vc = new VariantContextBuilder("foo", delLoc, 10, 14, Arrays.asList(ccccR,nullA)).make(); - result = GATKVariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); + result = VariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); Assert.assertEquals(result.getFirst().toArray()[0],8); Assert.assertEquals(result.getFirst().toArray()[1],4); Assert.assertEquals(result.getSecond().length,1); @@ -540,7 +539,7 @@ public class VariantContextUnitTest extends BaseTest { // CCCC*,CC,-,CCCCCC, context = CCC: (C)7 -> (C)5,(C)3,(C)9 refBytes = "TCCCCCCCAGAGAGAG".getBytes(); vc = new VariantContextBuilder("foo", insLoc, insLocStart, insLocStart+4, Arrays.asList(ccccR,cc, nullA,cccccc)).make(); - result = GATKVariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); + result = VariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); Assert.assertEquals(result.getFirst().toArray()[0],7); Assert.assertEquals(result.getFirst().toArray()[1],5); Assert.assertEquals(result.getFirst().toArray()[2],3); @@ -550,7 +549,7 @@ public class VariantContextUnitTest extends BaseTest { // GAGA*,-,GAGAGAGA refBytes = "TGAGAGAGAGATTT".getBytes(); vc = new VariantContextBuilder("foo", insLoc, insLocStart, insLocStart+4, Arrays.asList(gagaR, nullA,gagagaga)).make(); - result = GATKVariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); + result = VariantContextUtils.getNumTandemRepeatUnits(vc, refBytes); Assert.assertEquals(result.getFirst().toArray()[0],5); Assert.assertEquals(result.getFirst().toArray()[1],3); Assert.assertEquals(result.getFirst().toArray()[2],7); diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUtilsUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUtilsUnitTest.java index 9c1486cf7..9b24f64e7 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUtilsUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/VariantContextUtilsUnitTest.java @@ -26,12 +26,8 @@ package org.broadinstitute.variant.variantcontext; import net.sf.picard.reference.IndexedFastaSequenceFile; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.GenomeLocParser; -import org.broadinstitute.sting.utils.Utils; -import org.broadinstitute.sting.utils.exceptions.UserException; -import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; -import org.broadinstitute.sting.utils.variant.GATKVariantContextUtils; +import org.broadinstitute.variant.VariantBaseTest; +import org.broadinstitute.variant.utils.GeneralUtils; import org.testng.Assert; import org.testng.annotations.BeforeSuite; import org.testng.annotations.DataProvider; @@ -41,19 +37,17 @@ import java.io.File; import java.io.FileNotFoundException; import java.util.*; -public class VariantContextUtilsUnitTest extends BaseTest { +public class VariantContextUtilsUnitTest extends VariantBaseTest { Allele Aref, T, C, G, Cref, ATC, ATCATC; - private GenomeLocParser genomeLocParser; @BeforeSuite public void setup() { final File referenceFile = new File(b37KGReference); try { - IndexedFastaSequenceFile seq = new CachingIndexedFastaSequenceFile(referenceFile); - genomeLocParser = new GenomeLocParser(seq); + IndexedFastaSequenceFile seq = new IndexedFastaSequenceFile(referenceFile); } catch(FileNotFoundException ex) { - throw new UserException.CouldNotReadInputFile(referenceFile,ex); + throw new RuntimeException(referenceFile.getAbsolutePath(),ex); } // alleles @@ -658,7 +652,7 @@ public class VariantContextUtilsUnitTest extends BaseTest { public void testRepeatDetectorTest(RepeatDetectorTest cfg) { // test alleles are equal - Assert.assertEquals(GATKVariantContextUtils.isTandemRepeat(cfg.vc, cfg.ref.getBytes()), cfg.isTrueRepeat); + Assert.assertEquals(VariantContextUtils.isTandemRepeat(cfg.vc, cfg.ref.getBytes()), cfg.isTrueRepeat); } // -------------------------------------------------------------------------------- @@ -704,7 +698,7 @@ public class VariantContextUtilsUnitTest extends BaseTest { @Test(dataProvider = "ReverseClippingPositionTestProvider") public void testReverseClippingPositionTestProvider(ReverseClippingPositionTestProvider cfg) { - int result = GATKVariantContextUtils.computeReverseClipping(cfg.alleles, cfg.ref.getBytes(), 0, false); + int result = VariantContextUtils.computeReverseClipping(cfg.alleles, cfg.ref.getBytes(), 0, false); Assert.assertEquals(result, cfg.expectedClip); } @@ -782,7 +776,7 @@ public class VariantContextUtilsUnitTest extends BaseTest { @Test(dataProvider = "SplitBiallelics") public void testSplitBiallelicsNoGenotypes(final VariantContext vc, final List expectedBiallelics) { - final List biallelics = GATKVariantContextUtils.splitVariantContextToBiallelics(vc); + final List biallelics = VariantContextUtils.splitVariantContextToBiallelics(vc); Assert.assertEquals(biallelics.size(), expectedBiallelics.size()); for ( int i = 0; i < biallelics.size(); i++ ) { final VariantContext actual = biallelics.get(i); @@ -796,14 +790,14 @@ public class VariantContextUtilsUnitTest extends BaseTest { final List genotypes = new ArrayList(); int sampleI = 0; - for ( final List alleles : Utils.makePermutations(vc.getAlleles(), 2, true) ) { + for ( final List alleles : GeneralUtils.makePermutations(vc.getAlleles(), 2, true) ) { genotypes.add(GenotypeBuilder.create("sample" + sampleI++, alleles)); } genotypes.add(GenotypeBuilder.createMissing("missing", 2)); final VariantContext vcWithGenotypes = new VariantContextBuilder(vc).genotypes(genotypes).make(); - final List biallelics = GATKVariantContextUtils.splitVariantContextToBiallelics(vcWithGenotypes); + final List biallelics = VariantContextUtils.splitVariantContextToBiallelics(vcWithGenotypes); for ( int i = 0; i < biallelics.size(); i++ ) { final VariantContext actual = biallelics.get(i); Assert.assertEquals(actual.getNSamples(), vcWithGenotypes.getNSamples()); // not dropping any samples diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/VariantJEXLContextUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/VariantJEXLContextUnitTest.java index f2213e088..8d2569771 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/VariantJEXLContextUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/VariantJEXLContextUnitTest.java @@ -25,13 +25,8 @@ package org.broadinstitute.variant.variantcontext; -import net.sf.samtools.SAMFileHeader; +import org.broadinstitute.variant.VariantBaseTest; import org.testng.Assert; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.GenomeLocParser; -import org.broadinstitute.sting.utils.sam.ArtificialSAMUtils; - import org.testng.annotations.BeforeClass; import org.testng.annotations.BeforeMethod; import org.testng.annotations.Test; @@ -49,8 +44,7 @@ import java.util.Map; * * Test out parts of the VariantJEXLContext */ -public class VariantJEXLContextUnitTest extends BaseTest { - +public class VariantJEXLContextUnitTest extends VariantBaseTest { private static String expression = "QUAL > 500.0"; private static VariantContextUtils.JexlVCMatchExp exp; @@ -60,27 +54,15 @@ public class VariantJEXLContextUnitTest extends BaseTest { Allele ATC, ATCref; // A [ref] / T at 10 - GenomeLoc snpLoc; // - / ATC [ref] from 20-23 - private static int startingChr = 1; - private static int endingChr = 2; - private static int readCount = 100; - private static int DEFAULT_READ_LENGTH = ArtificialSAMUtils.DEFAULT_READ_LENGTH; - static SAMFileHeader header; - - private static GenomeLocParser genomeLocParser; - @BeforeClass public void beforeClass() { - header = ArtificialSAMUtils.createArtificialSamHeader(( endingChr - startingChr ) + 1, startingChr, readCount + DEFAULT_READ_LENGTH); - genomeLocParser = new GenomeLocParser(header.getSequenceDictionary()); try { exp = new VariantContextUtils.JexlVCMatchExp("name", VariantContextUtils.engine.createExpression(expression)); } catch (Exception e) { Assert.fail("Unable to create expression" + e.getMessage()); } - snpLoc = genomeLocParser.createGenomeLoc("chr1", 10, 10, true); } @BeforeMethod @@ -142,9 +124,7 @@ public class VariantJEXLContextUnitTest extends BaseTest { private JEXLMap getVarContext() { List alleles = Arrays.asList(Aref, T); - VariantContext vc = new VariantContextBuilder("test", snpLoc.getContig(), snpLoc.getStart(), snpLoc.getStop(), alleles).make(); + VariantContext vc = new VariantContextBuilder("test", "chr1", 10, 10, alleles).make(); return new JEXLMap(Arrays.asList(exp),vc); } - - } diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/writer/VCFWriterUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/writer/VCFWriterUnitTest.java index 79258e844..bbfac11cb 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/writer/VCFWriterUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/writer/VCFWriterUnitTest.java @@ -29,16 +29,11 @@ import net.sf.picard.reference.IndexedFastaSequenceFile; import org.broad.tribble.AbstractFeatureReader; import org.broad.tribble.FeatureReader; import org.broad.tribble.Tribble; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.GenomeLoc; -import org.broadinstitute.sting.utils.GenomeLocParser; +import org.broadinstitute.variant.VariantBaseTest; import org.broadinstitute.variant.vcf.VCFCodec; import org.broadinstitute.variant.vcf.VCFHeader; import org.broadinstitute.variant.vcf.VCFHeaderLine; import org.broadinstitute.variant.vcf.VCFHeaderVersion; -import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; -import org.broadinstitute.sting.utils.exceptions.UserException; -import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; import org.broadinstitute.variant.variantcontext.*; import org.testng.Assert; import org.testng.annotations.BeforeClass; @@ -58,22 +53,20 @@ import java.util.*; *

* This class tests out the ability of the VCF writer to correctly write VCF files */ -public class VCFWriterUnitTest extends BaseTest { +public class VCFWriterUnitTest extends VariantBaseTest { private Set metaData = new HashSet(); private Set additionalColumns = new HashSet(); private File fakeVCFFile = new File("FAKEVCFFILEFORTESTING.vcf"); - private GenomeLocParser genomeLocParser; private IndexedFastaSequenceFile seq; @BeforeClass public void beforeTests() { - File referenceFile = new File(hg18Reference); + File referenceFile = new File(hg19Reference); try { - seq = new CachingIndexedFastaSequenceFile(referenceFile); - genomeLocParser = new GenomeLocParser(seq); + seq = new IndexedFastaSequenceFile(referenceFile); } catch(FileNotFoundException ex) { - throw new UserException.CouldNotReadInputFile(referenceFile,ex); + throw new RuntimeException(referenceFile.getAbsolutePath(), ex); } } @@ -108,7 +101,7 @@ public class VCFWriterUnitTest extends BaseTest { fakeVCFFile.delete(); } catch (IOException e ) { - throw new ReviewedStingException(e.getMessage()); + throw new RuntimeException(e.getMessage()); } } @@ -133,8 +126,6 @@ public class VCFWriterUnitTest extends BaseTest { * @return a VCFRecord */ private VariantContext createVC(VCFHeader header) { - - GenomeLoc loc = genomeLocParser.createGenomeLoc("chr1",1); List alleles = new ArrayList(); Set filters = null; Map attributes = new HashMap(); @@ -148,7 +139,7 @@ public class VCFWriterUnitTest extends BaseTest { Genotype gt = new GenotypeBuilder(name,alleles.subList(1,2)).GQ(0).attribute("BB", "1").phased(true).make(); genotypes.add(gt); } - return new VariantContextBuilder("RANDOM", loc.getContig(), loc.getStart(), loc.getStop(), alleles) + return new VariantContextBuilder("RANDOM", "chr1", 1, 1, alleles) .genotypes(genotypes).attributes(attributes).make(); } diff --git a/public/java/test/org/broadinstitute/variant/variantcontext/writer/VariantContextWritersUnitTest.java b/public/java/test/org/broadinstitute/variant/variantcontext/writer/VariantContextWritersUnitTest.java index 023f48928..9e6541bfa 100644 --- a/public/java/test/org/broadinstitute/variant/variantcontext/writer/VariantContextWritersUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/variantcontext/writer/VariantContextWritersUnitTest.java @@ -32,11 +32,10 @@ package org.broadinstitute.variant.variantcontext.writer; import net.sf.picard.reference.IndexedFastaSequenceFile; import net.sf.samtools.SAMSequenceDictionary; import org.broad.tribble.FeatureCodec; -import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.variant.VariantBaseTest; import org.broadinstitute.variant.bcf2.BCF2Codec; import org.broadinstitute.variant.vcf.VCFCodec; import org.broadinstitute.variant.vcf.VCFHeader; -import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.variantcontext.VariantContextTestProvider; import org.testng.annotations.BeforeSuite; @@ -50,15 +49,13 @@ import java.util.EnumSet; import java.util.List; -public class VariantContextWritersUnitTest extends BaseTest { +public class VariantContextWritersUnitTest extends VariantBaseTest { private SAMSequenceDictionary dictionary; @BeforeSuite public void before() throws IOException { final File source = new File(b37KGReference); - //final File source = new File("/Users/depristo/Desktop/broadLocal/localData/human_g1k_v37.fasta"); - IndexedFastaSequenceFile seq = new CachingIndexedFastaSequenceFile(source); - //IndexedFastaSequenceFile seq = new CachingIndexedFastaSequenceFile(new File(b37KGReference)); + IndexedFastaSequenceFile seq = new IndexedFastaSequenceFile(source); dictionary = seq.getSequenceDictionary(); VariantContextTestProvider.initializeTests(); } diff --git a/public/java/test/org/broadinstitute/variant/vcf/IndexFactoryUnitTest.java b/public/java/test/org/broadinstitute/variant/vcf/IndexFactoryUnitTest.java index b0b07d148..6292baae3 100644 --- a/public/java/test/org/broadinstitute/variant/vcf/IndexFactoryUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/vcf/IndexFactoryUnitTest.java @@ -25,15 +25,14 @@ package org.broadinstitute.variant.vcf; +import net.sf.picard.reference.IndexedFastaSequenceFile; import net.sf.samtools.SAMSequenceDictionary; import org.broad.tribble.AbstractFeatureReader; import org.broad.tribble.CloseableTribbleIterator; import org.broad.tribble.Tribble; import org.broad.tribble.index.Index; import org.broad.tribble.index.IndexFactory; -import org.broadinstitute.sting.BaseTest; -import org.broadinstitute.sting.utils.exceptions.UserException; -import org.broadinstitute.sting.utils.fasta.CachingIndexedFastaSequenceFile; +import org.broadinstitute.variant.VariantBaseTest; import org.broadinstitute.variant.variantcontext.VariantContext; import org.broadinstitute.variant.variantcontext.writer.Options; import org.broadinstitute.variant.variantcontext.writer.VariantContextWriter; @@ -50,10 +49,10 @@ import java.util.EnumSet; /** * tests out the various functions in the index factory class */ -public class IndexFactoryUnitTest extends BaseTest { +public class IndexFactoryUnitTest extends VariantBaseTest { - File inputFile = new File(privateTestDir + "HiSeq.10000.vcf"); - File outputFile = new File(privateTestDir + "onTheFlyOutputTest.vcf"); + File inputFile = new File(variantTestDataRoot + "HiSeq.10000.vcf"); + File outputFile = new File(variantTestDataRoot + "onTheFlyOutputTest.vcf"); File outputFileIndex = Tribble.indexFile(outputFile); private SAMSequenceDictionary dict; @@ -61,10 +60,10 @@ public class IndexFactoryUnitTest extends BaseTest { @BeforeTest public void setup() { try { - dict = new CachingIndexedFastaSequenceFile(new File(b37KGReference)).getSequenceDictionary(); + dict = new IndexedFastaSequenceFile(new File(b37KGReference)).getSequenceDictionary(); } catch(FileNotFoundException ex) { - throw new UserException.CouldNotReadInputFile(b37KGReference,ex); + throw new RuntimeException(b37KGReference,ex); } } diff --git a/public/java/test/org/broadinstitute/variant/vcf/VCFHeaderUnitTest.java b/public/java/test/org/broadinstitute/variant/vcf/VCFHeaderUnitTest.java index d7d3c8d6c..7d6b11953 100644 --- a/public/java/test/org/broadinstitute/variant/vcf/VCFHeaderUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/vcf/VCFHeaderUnitTest.java @@ -27,9 +27,8 @@ package org.broadinstitute.variant.vcf; import org.broad.tribble.readers.AsciiLineReader; import org.broad.tribble.readers.PositionalBufferedStream; -import org.broadinstitute.sting.utils.exceptions.ReviewedStingException; +import org.broadinstitute.variant.VariantBaseTest; import org.testng.Assert; -import org.broadinstitute.sting.BaseTest; import org.testng.annotations.Test; @@ -45,7 +44,7 @@ import java.security.NoSuchAlgorithmException; * Time: 3:32:08 PM * To change this template use File | Settings | File Templates. */ -public class VCFHeaderUnitTest extends BaseTest { +public class VCFHeaderUnitTest extends VariantBaseTest { private VCFHeader createHeader(String headerStr) { VCFCodec codec = new VCFCodec(); @@ -80,13 +79,13 @@ public class VCFHeaderUnitTest extends BaseTest { try { digest = MessageDigest.getInstance("MD5"); } catch (NoSuchAlgorithmException e) { - throw new ReviewedStingException("Unable to find MD5 digest"); + throw new RuntimeException("Unable to find MD5 digest"); } InputStream is; try { is = new FileInputStream(file); } catch (FileNotFoundException e) { - throw new ReviewedStingException("Unable to open file " + file); + throw new RuntimeException("Unable to open file " + file); } byte[] buffer = new byte[8192]; int read; @@ -100,14 +99,14 @@ public class VCFHeaderUnitTest extends BaseTest { } catch (IOException e) { - throw new ReviewedStingException("Unable to process file for MD5", e); + throw new RuntimeException("Unable to process file for MD5", e); } finally { try { is.close(); } catch (IOException e) { - throw new ReviewedStingException("Unable to close input stream for MD5 calculation", e); + throw new RuntimeException("Unable to close input stream for MD5 calculation", e); } } } diff --git a/public/java/test/org/broadinstitute/variant/vcf/VCFStandardHeaderLinesUnitTest.java b/public/java/test/org/broadinstitute/variant/vcf/VCFStandardHeaderLinesUnitTest.java index b77191051..02090c9cd 100644 --- a/public/java/test/org/broadinstitute/variant/vcf/VCFStandardHeaderLinesUnitTest.java +++ b/public/java/test/org/broadinstitute/variant/vcf/VCFStandardHeaderLinesUnitTest.java @@ -25,7 +25,7 @@ package org.broadinstitute.variant.vcf; -import org.broadinstitute.sting.BaseTest; +import org.broadinstitute.variant.VariantBaseTest; import org.testng.annotations.DataProvider; import org.testng.annotations.Test; import org.testng.Assert; @@ -41,7 +41,7 @@ import java.util.List; * Time: 3:32:08 PM * To change this template use File | Settings | File Templates. */ -public class VCFStandardHeaderLinesUnitTest extends BaseTest { +public class VCFStandardHeaderLinesUnitTest extends VariantBaseTest { @DataProvider(name = "getStandardLines") public Object[][] makeGetStandardLines() { List tests = new ArrayList(); From aab160372a63bcca13c8e8740f0351a3cf5b164a Mon Sep 17 00:00:00 2001 From: Ryan Poplin Date: Mon, 28 Jan 2013 11:26:01 -0500 Subject: [PATCH 20/22] No need to sort the BQSR tables by default. --- .../broadinstitute/sting/utils/recalibration/RecalUtils.java | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java index e8fc713f1..34aa5abc7 100644 --- a/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java +++ b/protected/java/src/org/broadinstitute/sting/utils/recalibration/RecalUtils.java @@ -310,7 +310,7 @@ public class RecalUtils { if(sortByCols) { reportTable = new GATKReportTable("RecalTable" + reportTableIndex++, "", columnNames.size(), GATKReportTable.TableSortingWay.SORT_BY_COLUMN); } else { - reportTable = new GATKReportTable("RecalTable" + reportTableIndex++, "", columnNames.size()); + reportTable = new GATKReportTable("RecalTable" + reportTableIndex++, "", columnNames.size(), GATKReportTable.TableSortingWay.DO_NOT_SORT); } for (final Pair columnName : columnNames) reportTable.addColumn(columnName.getFirst(), columnName.getSecond()); From 8777e02aa5d31a1679239891789324f21fdfe50c Mon Sep 17 00:00:00 2001 From: Tad Jordan Date: Mon, 28 Jan 2013 11:33:49 -0500 Subject: [PATCH 21/22] R issue in Queue fixed. GSA-721 --- .../broadinstitute/sting/utils/R/RScriptExecutor.java | 10 ++++++---- .../broadinstitute/sting/utils/R/RScriptLibrary.java | 6 ++++++ 2 files changed, 12 insertions(+), 4 deletions(-) diff --git a/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java b/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java index 0d6450c8f..04205350f 100644 --- a/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java +++ b/public/java/src/org/broadinstitute/sting/utils/R/RScriptExecutor.java @@ -110,15 +110,17 @@ public class RScriptExecutor { List tempFiles = new ArrayList(); try { - File tempLibDir = IOUtils.tempDir("Rlib.", ""); - tempFiles.add(tempLibDir); + File tempLibSourceDir = IOUtils.tempDir("RlibSources.", ""); + File tempLibInstallationDir = IOUtils.tempDir("Rlib.", ""); + tempFiles.add(tempLibSourceDir); + tempFiles.add(tempLibInstallationDir); - StringBuilder expression = new StringBuilder("tempLibDir = '").append(tempLibDir).append("';"); + StringBuilder expression = new StringBuilder("tempLibDir = '").append(tempLibInstallationDir).append("';"); if (this.libraries.size() > 0) { List tempLibraryPaths = new ArrayList(); for (RScriptLibrary library: this.libraries) { - File tempLibrary = library.writeTemp(); + File tempLibrary = library.writeLibrary(tempLibSourceDir); tempFiles.add(tempLibrary); tempLibraryPaths.add(tempLibrary.getAbsolutePath()); } diff --git a/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java b/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java index 685979d83..93110ccdc 100644 --- a/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java +++ b/public/java/src/org/broadinstitute/sting/utils/R/RScriptLibrary.java @@ -57,4 +57,10 @@ public enum RScriptLibrary { public File writeTemp() { return IOUtils.writeTempResource(new Resource(getResourcePath(), RScriptLibrary.class)); } + + public File writeLibrary(File tempDir) { + File libraryFile = new File(tempDir, getLibraryName()); + IOUtils.writeResource(new Resource(getResourcePath(), RScriptLibrary.class), libraryFile); + return libraryFile; + } }