Revert "1) RFCombine switched to the new ROD system"

This reverts commit cf989bd3cfae119ba9011873c5f5d5b80e37f67b.
This commit is contained in:
David Roazen 2011-08-15 18:45:38 -04:00
parent 1968b65ca8
commit 3e9ef0622d
5 changed files with 12 additions and 279 deletions

View File

@ -28,9 +28,6 @@ package org.broadinstitute.sting.gatk.walkers.filters;
import org.broad.tribble.Feature; import org.broad.tribble.Feature;
import org.broadinstitute.sting.commandline.*; import org.broadinstitute.sting.commandline.*;
import org.broadinstitute.sting.gatk.arguments.StandardVariantContextInputArgumentCollection; import org.broadinstitute.sting.gatk.arguments.StandardVariantContextInputArgumentCollection;
import org.broadinstitute.sting.gatk.walkers.TreeReducible;
import org.broadinstitute.sting.commandline.Argument;
import org.broadinstitute.sting.commandline.Output;
import org.broadinstitute.sting.gatk.contexts.AlignmentContext; import org.broadinstitute.sting.gatk.contexts.AlignmentContext;
import org.broadinstitute.sting.gatk.contexts.ReferenceContext; import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
@ -50,7 +47,7 @@ import java.util.*;
* Filters variant calls using a number of user-selectable, parameterizable criteria. * Filters variant calls using a number of user-selectable, parameterizable criteria.
*/ */
@Reference(window=@Window(start=-50,stop=50)) @Reference(window=@Window(start=-50,stop=50))
public class VariantFiltrationWalker extends RodWalker<Integer, Integer> implements TreeReducible<Integer> { public class VariantFiltrationWalker extends RodWalker<Integer, Integer> {
@ArgumentCollection @ArgumentCollection
protected StandardVariantContextInputArgumentCollection variantCollection = new StandardVariantContextInputArgumentCollection(); protected StandardVariantContextInputArgumentCollection variantCollection = new StandardVariantContextInputArgumentCollection();
@ -281,10 +278,6 @@ public class VariantFiltrationWalker extends RodWalker<Integer, Integer> impleme
return sum + value; return sum + value;
} }
public Integer treeReduce(Integer left, Integer right) {
return left + right;
}
/** /**
* Tell the user the number of loci processed and close out the new variants file. * Tell the user the number of loci processed and close out the new variants file.
* *

View File

@ -34,7 +34,6 @@ import org.broadinstitute.sting.utils.Utils;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import org.broadinstitute.sting.utils.variantcontext.Allele; import org.broadinstitute.sting.utils.variantcontext.Allele;
import org.broadinstitute.sting.utils.variantcontext.Genotype; import org.broadinstitute.sting.utils.variantcontext.Genotype;
import org.broadinstitute.sting.utils.variantcontext.GenotypeLikelihoods;
import org.broadinstitute.sting.utils.variantcontext.VariantContext; import org.broadinstitute.sting.utils.variantcontext.VariantContext;
import sun.reflect.generics.reflectiveObjects.NotImplementedException; import sun.reflect.generics.reflectiveObjects.NotImplementedException;
@ -581,7 +580,7 @@ public class ExactAFCalculationModel extends AlleleFrequencyCalculationModel {
// TODO -- remove me for clarity in this code // TODO -- remove me for clarity in this code
// //
// ------------------------------------------------------------------------------------- // -------------------------------------------------------------------------------------
public static int gdaN2GoldStandard(Map<String, Genotype> GLs, public int gdaN2GoldStandard(Map<String, Genotype> GLs,
double[] log10AlleleFrequencyPriors, double[] log10AlleleFrequencyPriors,
double[] log10AlleleFrequencyPosteriors, int idxAA, int idxAB, int idxBB) { double[] log10AlleleFrequencyPosteriors, int idxAA, int idxAB, int idxBB) {
int numSamples = GLs.size(); int numSamples = GLs.size();
@ -659,70 +658,4 @@ public class ExactAFCalculationModel extends AlleleFrequencyCalculationModel {
} }
} }
// todo -- generalize and merge into gdaN2GoldStandard
public static int rfaN2GoldStandard(Map<String, GenotypeLikelihoods> GLs,
double[] log10AlleleFrequencyPriors,
double[] log10AlleleFrequencyPosteriors, int idxAA, int idxAB, int idxBB) {
int numSamples = GLs.size();
int numChr = 2*numSamples;
double[][] logYMatrix = new double[1+numSamples][1+numChr];
for (int i=0; i <=numSamples; i++)
for (int j=0; j <=numChr; j++)
logYMatrix[i][j] = Double.NEGATIVE_INFINITY;
//YMatrix[0][0] = 1.0;
logYMatrix[0][0] = 0.0;
int j=0;
for ( Map.Entry<String, GenotypeLikelihoods> sample : GLs.entrySet() ) {
j++;
//double[] genotypeLikelihoods = MathUtils.normalizeFromLog10(GLs.get(sample).getLikelihoods());
double[] genotypeLikelihoods = sample.getValue().getAsVector();
//double logDenominator = Math.log10(2.0*j*(2.0*j-1));
double logDenominator = MathUtils.log10Cache[2*j] + MathUtils.log10Cache[2*j-1];
// special treatment for k=0: iteration reduces to:
//YMatrix[j][0] = YMatrix[j-1][0]*genotypeLikelihoods[GenotypeType.AA.ordinal()];
logYMatrix[j][0] = logYMatrix[j-1][0] + genotypeLikelihoods[idxAA];
for (int k=1; k <= 2*j; k++ ) {
//double num = (2.0*j-k)*(2.0*j-k-1)*YMatrix[j-1][k] * genotypeLikelihoods[GenotypeType.AA.ordinal()];
double logNumerator[];
logNumerator = new double[3];
if (k < 2*j-1)
logNumerator[0] = MathUtils.log10Cache[2*j-k] + MathUtils.log10Cache[2*j-k-1] + logYMatrix[j-1][k] +
genotypeLikelihoods[idxAA];
else
logNumerator[0] = Double.NEGATIVE_INFINITY;
if (k < 2*j)
logNumerator[1] = MathUtils.log10Cache[2*k] + MathUtils.log10Cache[2*j-k]+ logYMatrix[j-1][k-1] +
genotypeLikelihoods[idxAB];
else
logNumerator[1] = Double.NEGATIVE_INFINITY;
if (k > 1)
logNumerator[2] = MathUtils.log10Cache[k] + MathUtils.log10Cache[k-1] + logYMatrix[j-1][k-2] +
genotypeLikelihoods[idxBB];
else
logNumerator[2] = Double.NEGATIVE_INFINITY;
double logNum = MathUtils.softMax(logNumerator);
//YMatrix[j][k] = num/den;
logYMatrix[j][k] = logNum - logDenominator;
}
}
for (int k=0; k <= numChr; k++)
log10AlleleFrequencyPosteriors[k] = logYMatrix[j][k] + log10AlleleFrequencyPriors[k];
return numChr;
}
} }

View File

@ -31,77 +31,21 @@ import java.util.LinkedList;
import java.util.List; import java.util.List;
/** /**
* Creates FASTA sequences for use in Seqenom or PCR utilities for site amplification and subsequent validation * Created by IntelliJ IDEA.
* * User: chartl
* <p> * Date: 6/13/11
* ValidationAmplicons consumes a VCF and an Interval list and produces FASTA sequences from which PCR primers or probe * Time: 2:12 PM
* sequences can be designed. In addition, ValidationAmplicons uses BWA to check for specificity of tracts of bases within * To change this template use File | Settings | File Templates.
* the output amplicon, lower-casing non-specific tracts, allows for users to provide sites to mask out, and specifies
* reasons why the site may fail validation (nearby variation, for example).
* </p>
*
* <h2>Input</h2>
* <p>
* Requires a VCF containing alleles to design amplicons towards, a VCF of variants to mask out of the amplicons, and an
* interval list defining the size of the amplicons around the sites to be validated
* </p>
*
* <h2>Output</h2>
* <p>
* Output is a FASTA-formatted file with some modifications at probe sites. For instance:
*
* >20:207414 INSERTION=1,VARIANT_TOO_NEAR_PROBE=1, 20_207414
* CCAACGTTAAGAAAGAGACATGCGACTGGGTgcggtggctcatgcctggaaccccagcactttgggaggccaaggtgggc[A/G*]gNNcacttgaggtcaggagtttgagaccagcctggccaacatggtgaaaccccgtctctactgaaaatacaaaagttagC
* >20:792122 Valid 20_792122
* TTTTTTTTTagatggagtctcgctcttatcgcccaggcNggagtgggtggtgtgatcttggctNactgcaacttctgcct[-/CCC*]cccaggttcaagtgattNtcctgcctcagccacctgagtagctgggattacaggcatccgccaccatgcctggctaatTT
* >20:994145 Valid 20_994145
* TCCATGGCCTCCCCCTGGCCCACGAAGTCCTCAGCCACCTCCTTCCTGGAGGGCTCAGCCAAAATCAGACTGAGGAAGAAG[AAG/-*]TGGTGGGCACCCACCTTCTGGCCTTCCTCAGCCCCTTATTCCTAGGACCAGTCCCCATCTAGGGGTCCTCACTGCCTCCC
* >20:1074230 SITE_IS_FILTERED=1, 20_1074230
* ACCTGATTACCATCAATCAGAACTCATTTCTGTTCCTATCTTCCACCCACAATTGTAATGCCTTTTCCATTTTAACCAAG[T/C*]ACTTATTATAtactatggccataacttttgcagtttgaggtatgacagcaaaaTTAGCATACATTTCATTTTCCTTCTTC
* >20:1084330 DELETION=1, 20_1084330
* CACGTTCGGcttgtgcagagcctcaaggtcatccagaggtgatAGTTTAGGGCCCTCTCAAGTCTTTCCNGTGCGCATGG[GT/AC*]CAGCCCTGGGCACCTGTNNNNNNNNNNNNNTGCTCATGGCCTTCTAGATTCCCAGGAAATGTCAGAGCTTTTCAAAGCCC
*
* are amplicon sequences resulting from running the tool. The flags (preceding the sequence itself) can be:
*
* Valid // amplicon is valid
* SITE_IS_FILTERED=1 // validation site is not marked 'PASS' or '.' in its filter field ("you are trying to validate a filtered variant")
* VARIANT_TOO_NEAR_PROBE=1 // there is a variant too near to the variant to be validated, potentially shifting the mass-spec peak
* MULTIPLE_PROBES=1, // multiple variants to be validated found inside the same amplicon
* DELETION=6,INSERTION=5, // 6 deletions and 5 insertions found inside the amplicon region (from the "mask" VCF), will be potentially difficult to validate
* DELETION=1, // deletion found inside the amplicon region, could shift mass-spec peak
* START_TOO_CLOSE, // variant is too close to the start of the amplicon region to give sequenom a good chance to find a suitable primer
* END_TOO_CLOSE, // variant is too close to the end of the amplicon region to give sequenom a good chance to find a suitable primer
* NO_VARIANTS_FOUND, // no variants found within the amplicon region
* INDEL_OVERLAPS_VALIDATION_SITE, // an insertion or deletion interferes directly with the site to be validated (i.e. insertion directly preceding or postceding, or a deletion that spans the site itself)
* </p>
*
* <h2>Examples</h2>
* PRE-TAG
* java
* -jar GenomeAnalysisTK.jar
* -T ValidationAmplicons
* -R /humgen/1kg/reference/human_g1k_v37.fasta
* -BTI ProbeIntervals
* -ProbeIntervals:table interval_table.table
* -ValidateAlleles:vcf sites_to_validate.vcf
* -MaskAlleles:vcf mask_sites.vcf
* --virtualPrimerSize 30
* -o probes.fasta
* PRE-TAG
*
* @author chartl
* @since July 2011
*/ */
@Requires(value={DataSource.REFERENCE}) @Requires(value={DataSource.REFERENCE})
public class ValidationAmplicons extends RodWalker<Integer,Integer> { public class ValidationAmplicons extends RodWalker<Integer,Integer> {
@Input(fullName = "ProbeIntervals", doc="A collection of intervals in table format with optional names that represent the "+ @Input(fullName = "ProbeIntervals", doc="Chris document me", required=true)
"intervals surrounding the probe sites amplicons should be designed for", required=true)
RodBinding<TableFeature> probeIntervals; RodBinding<TableFeature> probeIntervals;
@Input(fullName = "ValidateAlleles", doc="A VCF containing the sites and alleles you want to validate. Restricted to *BI-Allelic* sites", required=true) @Input(fullName = "ValidateAlleles", doc="Chris document me", required=true)
RodBinding<VariantContext> validateAlleles; RodBinding<VariantContext> validateAlleles;
@Input(fullName = "MaskAlleles", doc="A VCF containing the sites you want to MASK from the designed amplicon (e.g. by Ns or lower-cased bases)", required=true) @Input(fullName = "MaskAlleles", doc="Chris document me", required=true)
RodBinding<VariantContext> maskAlleles; RodBinding<VariantContext> maskAlleles;

View File

@ -31,8 +31,6 @@ import org.broadinstitute.sting.gatk.contexts.ReferenceContext;
import org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub; import org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub;
import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker; import org.broadinstitute.sting.gatk.refdata.RefMetaDataTracker;
import org.broadinstitute.sting.gatk.walkers.Reference; import org.broadinstitute.sting.gatk.walkers.Reference;
import org.broadinstitute.sting.gatk.walkers.TreeReducible;
import org.broadinstitute.sting.gatk.walkers.Requires;
import org.broadinstitute.sting.gatk.walkers.RodWalker; import org.broadinstitute.sting.gatk.walkers.RodWalker;
import org.broadinstitute.sting.gatk.walkers.Window; import org.broadinstitute.sting.gatk.walkers.Window;
import org.broadinstitute.sting.utils.SampleUtils; import org.broadinstitute.sting.utils.SampleUtils;
@ -51,7 +49,7 @@ import java.util.*;
* priority list (if provided), emits a single record instance at every position represented in the rods. * priority list (if provided), emits a single record instance at every position represented in the rods.
*/ */
@Reference(window=@Window(start=-50,stop=50)) @Reference(window=@Window(start=-50,stop=50))
public class CombineVariants extends RodWalker<Integer, Integer> implements TreeReducible<Integer>{ public class CombineVariants extends RodWalker<Integer, Integer> {
/** /**
* The VCF files to merge together * The VCF files to merge together
* *
@ -212,8 +210,6 @@ public class CombineVariants extends RodWalker<Integer, Integer> implements Tree
return 0; return 0;
} }
public Integer treeReduce(Integer left, Integer right) { return left + right; }
public Integer reduce(Integer counter, Integer sum) { public Integer reduce(Integer counter, Integer sum) {
return counter + sum; return counter + sum;
} }

View File

@ -25,13 +25,10 @@
package org.broadinstitute.sting.utils; package org.broadinstitute.sting.utils;
import cern.jet.random.ChiSquare;
import cern.jet.math.Arithmetic;
import com.google.java.contract.Requires; import com.google.java.contract.Requires;
import net.sf.samtools.SAMRecord; import net.sf.samtools.SAMRecord;
import org.apache.lucene.messages.NLS; import org.apache.lucene.messages.NLS;
import org.broadinstitute.sting.gatk.GenomeAnalysisEngine; import org.broadinstitute.sting.gatk.GenomeAnalysisEngine;
import org.broadinstitute.sting.utils.exceptions.ReviewedStingException;
import org.broadinstitute.sting.utils.exceptions.UserException; import org.broadinstitute.sting.utils.exceptions.UserException;
import java.math.BigDecimal; import java.math.BigDecimal;
@ -896,7 +893,6 @@ public class MathUtils {
return orderStatisticSearch((int) Math.ceil(list.size()/2), list); return orderStatisticSearch((int) Math.ceil(list.size()/2), list);
} }
/*
public static byte getQScoreOrderStatistic(List<SAMRecord> reads, List<Integer> offsets, int k) { public static byte getQScoreOrderStatistic(List<SAMRecord> reads, List<Integer> offsets, int k) {
// version of the order statistic calculator for SAMRecord/Integer lists, where the // version of the order statistic calculator for SAMRecord/Integer lists, where the
// list index maps to a q-score only through the offset index // list index maps to a q-score only through the offset index
@ -941,7 +937,7 @@ public class MathUtils {
public static byte getQScoreMedian(List<SAMRecord> reads, List<Integer> offsets) { public static byte getQScoreMedian(List<SAMRecord> reads, List<Integer> offsets) {
return getQScoreOrderStatistic(reads, offsets, (int)Math.floor(reads.size()/2.)); return getQScoreOrderStatistic(reads, offsets, (int)Math.floor(reads.size()/2.));
}*/ }
/** A utility class that computes on the fly average and standard deviation for a stream of numbers. /** A utility class that computes on the fly average and standard deviation for a stream of numbers.
* The number of observations does not have to be known in advance, and can be also very big (so that * The number of observations does not have to be known in advance, and can be also very big (so that
@ -1359,133 +1355,4 @@ public class MathUtils {
public static double log10Factorial (int x) { public static double log10Factorial (int x) {
return log10Gamma(x+1); return log10Gamma(x+1);
} }
/**
* Computes the p-value for the null hypothesis that the rows of the table are i.i.d. using a pearson chi-square test
* @param contingencyTable - a contingency table
* @return - the ensuing p-value (via chi-square)
*/
public static double contingencyChiSquare(short[][] contingencyTable ) {
int[] rowSum = new int[contingencyTable.length];
int[] colSum = new int[contingencyTable[0].length];
int total = 0;
for ( int i = 0; i < contingencyTable.length; i++ ) {
for ( int j = 0; j < contingencyTable[0].length; j++ ) {
rowSum[i] += contingencyTable[i][j];
colSum[j] += contingencyTable[i][j];
total += contingencyTable[i][j];
}
}
double chi = 0;
for ( int i = 0; i < contingencyTable.length; i ++ ) {
for ( int j = 0; j < contingencyTable[0].length; j++ ) {
double expected = (((double) colSum[j])/total)*rowSum[i];
double resid = contingencyTable[i][j] - expected;
chi += resid*resid/expected;
}
}
return 1.0-(new ChiSquare(contingencyTable.length*contingencyTable[0].length,null)).cdf(chi);
}
/**
* Exactly the same as above, but using int arrays rather than short arrays on input
* @param contingencyTable
* @return
*/
public static double contingencyChiSquare(int[][] contingencyTable ) {
int[] rowSum = new int[contingencyTable.length];
int[] colSum = new int[contingencyTable[0].length];
int total = 0;
for ( int i = 0; i < contingencyTable.length; i++ ) {
for ( int j = 0; j < contingencyTable[0].length; j++ ) {
rowSum[i] += contingencyTable[i][j];
colSum[j] += contingencyTable[i][j];
total += contingencyTable[i][j];
}
}
double chi = 0;
for ( int i = 0; i < contingencyTable.length; i ++ ) {
for ( int j = 0; j < contingencyTable[0].length; j++ ) {
double expected = (((double) colSum[j])/total)*rowSum[i];
double resid = contingencyTable[i][j] - expected;
chi += resid*resid/expected;
}
}
return 1.0-(new ChiSquare(contingencyTable.length*contingencyTable[0].length,null)).cdf(chi);
}
=======
public static double marginalizedFisherExact(double[] spectrum1, double[] spectrum2, int ns1, int ns2) {
int N = ns1 + ns2;
int[] rowSums = { ns1, ns2 };
double logP = Double.NEGATIVE_INFINITY;
// todo -- sorting and strobing should chage this n^2 loop to a nlog(n) algorithm
for ( int ac1 = 0; ac1 < spectrum1.length; ac1++ ) {
for ( int ac2 = 0; ac2 < spectrum2.length; ac2++ ) {
double logPTable = spectrum1[ac1] + spectrum2[ac2];
int[][] table = {
{ ac1, ns1-ac1 },
{ ac2, ns2-ac2 }
};
int[] colSums = { ac1 + ac2, N-ac1-ac2};
double logPH0 = Math.log10(fisherExact(table,rowSums,colSums,N));
logP = log10sumLog10(new double[]{logP,logPTable+logPH0});
}
}
return Math.pow(10,logP);
}
/**
* Calculates the p-value for a fisher exact test for a 2x2 contingency table
*/
public static double fisherExact(int[][] table) {
if ( table.length > 2 || table[0].length > 2 ) {
throw new ReviewedStingException("Fisher exact is only implemented for 2x2 contingency tables");
}
int[] rowSums = { sumRow(table, 0), sumRow(table, 1) };
int[] colSums = { sumColumn(table, 0), sumColumn(table, 1) };
int N = rowSums[0] + rowSums[1];
return fisherExact(table,rowSums,colSums,N);
}
public static double fisherExact(int[][] table, int[] rowSums, int[] colSums, int N ) {
// calculate in log space so we don't die with high numbers
double pCutoff = Arithmetic.logFactorial(rowSums[0])
+ Arithmetic.logFactorial(rowSums[1])
+ Arithmetic.logFactorial(colSums[0])
+ Arithmetic.logFactorial(colSums[1])
- Arithmetic.logFactorial(table[0][0])
- Arithmetic.logFactorial(table[0][1])
- Arithmetic.logFactorial(table[1][0])
- Arithmetic.logFactorial(table[1][1])
- Arithmetic.logFactorial(N);
return Math.exp(pCutoff);
}
public static int sumRow(int[][] table, int column) {
int sum = 0;
for (int r = 0; r < table.length; r++) {
sum += table[r][column];
}
return sum;
}
public static int sumColumn(int[][] table, int row) {
int sum = 0;
for (int c = 0; c < table[row].length; c++) {
sum += table[row][c];
}
return sum;
}
} }