From 36b8b344907c4121dd3456f0ca4515f3786d19b8 Mon Sep 17 00:00:00 2001 From: asivache Date: Mon, 16 Mar 2009 22:03:31 +0000 Subject: [PATCH] Main tool that builds the clusters (multiple alignments) - so far; to be heavily refactored; most methods should find their proper homes in other classes git-svn-id: file:///humgen/gsa-scr1/gsa-engineering/svn_contents/trunk@74 348d0f76-0448-11de-a6fe-93d51630548a --- .../sting/indels/PileBuilder.java | 337 ++++++++++++++++++ 1 file changed, 337 insertions(+) create mode 100755 playground/java/src/org/broadinstitute/sting/indels/PileBuilder.java diff --git a/playground/java/src/org/broadinstitute/sting/indels/PileBuilder.java b/playground/java/src/org/broadinstitute/sting/indels/PileBuilder.java new file mode 100755 index 000000000..f853e767b --- /dev/null +++ b/playground/java/src/org/broadinstitute/sting/indels/PileBuilder.java @@ -0,0 +1,337 @@ +package org.broadinstitute.sting.indels; + + +public class PileBuilder { + private StrictlyUpperTriangularMatrix distances ; + private Matrix alignments ; + + private static class SelectedPair { + private int i_; + private int j_; + private double d_; + + private SelectedPair(int i, int j, double d) { + set(i,j,d); + } + + private SelectedPair() { + set(-1,-1,1e100); + } + + private double d() { return d_; } + private int i() { return i_; } + private int j() { return j_; } + + private void set(int i, int j, double d) { + i_ = i; + j_ = j; + d_ = d; + } + + /** Returns true if any of the two indices kept by this pair is equal to i. + * + * @param i + * @return + */ + private boolean contains(int i) { + return ( ( i_ == i ) || ( j_ == i ) ); + } + + } + + public PileBuilder() {} + + public void initPairwiseAlignments( IndexedSequence [] seqs ) { + distances = new StrictlyUpperTriangularMatrix( seqs.length ); + alignments = new Matrix( seqs.length ); + for( int i = 0; i < seqs.length ; i++ ) { + for ( int j = i+1 ; j < seqs.length ; j++ ) { + PairwiseAlignment a = new PairwiseAlignment(seqs[i],seqs[j],i,j); // compute pairwise alignment + alignments.set(i, j, a); // save it + distances.set(i,j,a.distance()); + } + } + } + + /** Finds the best pairwise alignment across all available ones. The object must be initialized first, + * so that the alignments are pre-computed. + * @return id's of the two sequences and the distance between them in a compound object. + */ + public SelectedPair findBest() { + + SelectedPair p = new SelectedPair(-1,-1,1e100); + + for( int i = 0; i < distances.size() ; i++ ) { + for ( int j = i+1 ; j < distances.size() ; j++ ) { + double d = distances.get(i,j); + if ( d < p.d() ) p.set(i,j,d); + } + } + return p; + } + + /** Finds the worst pairwise alignment across all available ones. The object must be initialized first, + * so that the alignments are pre-computed. + * @return id's of the two sequences and the distance between them in a compound object. + */ + public SelectedPair findWorst() { + + SelectedPair p = new SelectedPair(-1,-1,-1.0); + + for( int i = 0; i < distances.size() ; i++ ) { + for ( int j = i+1 ; j < distances.size() ; j++ ) { + double d = distances.get(i,j); + if ( d > p.d() ) p.set(i,j,d); + } + } + return p; + } + + + /** Finds the best pairwise alignment across all available ones, subject to the constraint that neither + * of the two sequences found can be listed (by its id) in the supplied SelectedPair object. If the best pair is passed + * as an argument, this method will find the next best pair. + * + * @param pexclude neither of the two sequences in the returned pair can have its id listed in pexclude pair. + * @return Best pairwise alignment excluding alignments between pairs involving at least one sequence from pexclude + */ + public SelectedPair findBest(SelectedPair pexclude) { + + SelectedPair p = new SelectedPair(-1,-1,1e100); + + for( int i = 0; i < distances.size() ; i++ ) { + if ( pexclude.contains(i) ) continue; + for ( int j = i+1 ; j < distances.size() ; j++ ) { + if ( pexclude.contains(j)) continue; + double d = distances.get(i,j); + if ( d < p.d() ) p.set(i,j,d); + } + } + return p; + } + + /** Finds the closest sequence to the specified pile among all sequences, which are not yet in that pile. Being + * the 'closest' is defined in terms of minimum distance. + * + * @param a alignment pile to find the closest sequence for + * @return a compound SelectedPair object that contains the index of the closest sequence found (is guaranteed to + * be not in the pile), the index of the sequence in the pile it is closest to, and the actual distance between the two. + */ + public SelectedPair findClosest(MultipleAlignment a) { + + SelectedPair p = new SelectedPair(-1,-1,1e100); + + for ( Integer id : a ) { + for (int i = 0; i < id; i++) { + if (a.contains(i)) continue; // a already contains both sequences (i,id) + double d = distances.get(i, id); + if (d < p.d() ) p.set(i,id,d); + } + for (int j = id + 1; j < distances.size() ; j++) { + if (a.contains(j)) continue; // a already contains both sequences (id, j) + double d = distances.get(id, j); + if (d < p.d()) p.set(id,j,d); + } + } + return p; + } + + + /** Finds, among all sequences, the one farthest from the specified pile. Being + * the 'farthest' is defined as having the largest lower bound of the distances to all sequences in the pile. + * + * @param a alignment pile to find the closest sequence for + * @return index of the farthest sequence + */ + public int findFarthest(MultipleAlignment a) { + + double dmaxmin = 0; + int i_out = -1; + + for ( int i = 0 ; i < distances.size() ; i++ ) { + + if ( a.contains(i) ) continue; + double d_min = 1e100; // smallest distance from sequence i to the pile + + for ( Integer id : a ) { + double d = ( i < id ? distances.get(i, id) : distances.get(id,i) ); + if (d < d_min ) d_min = d; + } + // d_min is the smallest distance from sequence i to pile a + if ( d_min > dmaxmin ) { + // sequence i is so far the farthest... + dmaxmin = d_min; + i_out = i; + } + } + return i_out; + } + + public double distance(MultipleAlignment a1, MultipleAlignment a2) { + double d = 1e100; + for ( Integer id1 : a1 ) { + for ( Integer id2 : a2 ) { + if ( id1 < id2 && distances.get(id1,id2) < d ) d = distances.get(id1,id2); + if ( id1 > id2 && distances.get(id2,id1) < d ) d = distances.get(id2,id1); + } + } + return d; + } + + /** Computes the distances from each sequence in the pile to its closest + * neighbor (within the same pile), and returns the greatest among these distances. + * In other words, no sequence in the pile is farther than diameter() from its closest neighbor. + * @param a alignment pile to compute diameter for + * @return the greatest distance from a sequence to its closest neighbor within the pile + */ + public double diameter(MultipleAlignment a) { + double dmaxmin = 0.0; + for ( Integer id1 : a ) { + double d = 1e100; + for ( Integer id2 : a ) { + if ( id2 <= id1 ) continue; + if ( distances.get(id1,id2) < d ) d = distances.get(id1,id2); + } + // d = distance from id1 to its closest neighbor within the pile + if ( d < 1e99 ) System.out.printf("%8.4g",d); + if ( d < 1e99 && d > dmaxmin ) dmaxmin = d; + } + // dmaxmin = the largest distance from a sequence in this pile to its closest neighbor + System.out.println(); + return dmaxmin; + } + + public static void main(String argv[]) { + + int K=8; +// IndexedSequence [] seqs = testSet1(K); // initialize test set data +// IndexedSequence [] seqs = testSet2(K); // initialize test set data + IndexedSequence [] seqs = testSet3(K); // initialize test set data + + PileBuilder pb = new PileBuilder(); + // two piles we are going to grow until all sequences are assigned to one of them. + // we intend to keep the piles disjoint, e.g. no sequence should be placed in both + MultipleAlignment pile1 = new MultipleAlignment(); + MultipleAlignment pile2 = new MultipleAlignment(); + + pb.initPairwiseAlignments(seqs); + + + // all the pairwise alignments are computed and disjoint best and next-best pairs are found + + System.out.println( pb.distances.format("%8.4g ")); + + /* + SelectedPair pworst = pb.findWorst(); + + pile1.add(seqs[pworst.i()].getSequence(), pworst.i()); + pile2.add(seqs[pworst.j()].getSequence(), pworst.j()); +*/ + + // initialize piles with best and next-best pairs + SelectedPair p_best = pb.findBest(); + SelectedPair p_nextbest = pb.findBest(p_best); + pile1.add( pb.alignments.get(p_best.i(), p_best.j()),p_best.i(),p_best.j()); + pile2.add( pb.alignments.get(p_nextbest.i(), p_nextbest.j()),p_nextbest.i(),p_nextbest.j()); +/* + System.out.println("Best pair ("+p_best.i() + "," + p_best.j()+", d="+p_best.d()+"):"); + System.out.println(pile1.toString()); + System.out.println("Next best pair ("+p_nextbest.i() + "," + p_nextbest.j()+", d="+p_nextbest.d()+ "):"); + System.out.println(pile2.toString()); +*/ + SelectedPair p1 = null; + SelectedPair p2 = null; + + // grow piles hierarchical clustering-style + while ( pile1.size() + pile2.size() < seqs.length ) { + // find candidate sequences closest to each of the two piles + p1 = pb.findClosest(pile1); + p2 = pb.findClosest(pile2); + int id1_cand = pile1.selectExternal(p1.i(), p1.j()); // id of the sequence closest to the pile 1 + int id2_cand = pile2.selectExternal(p2.i(), p2.j()); // id of the sequence closest to the pile 2 + if ( pile2.contains(id1_cand) && pile1.contains(id2_cand)) { + // pile1 and pile 2 are mutually the closest, so we need to merge them. + // if piles are mutually the closest, then p1 and p2 are the same pair (id1, id2), + // so we just merge on one of the (redundant) instances: + pile1.add(pile2, pb.alignments.get( p1.i(), p1.j()),p1.i(), p1.j()); + pile2.clear(); // need to reset pile 2 to something else + int z = pb.findFarthest(pile1); // get sequence farthest from merged pile 1 + pile2.add(seqs[z].getSequence(), z); // and reinitialize pile 2 with that sequence + } else { + if ( p1.d() < p2.d() ) { + if ( pile2.contains(id1_cand) ) { + pile1.add(pile2, pb.alignments.get( p1.i(), p1.j()),p1.i(), p1.j()); + pile2.clear(); // need to reset pile 2 to something else + int z = pb.findFarthest(pile1); // get sequence farthest from merged pile 1 + pile2.add(seqs[z].getSequence(), z); // and reinitialize pile 2 with that sequence + } else pile1.add( pb.alignments.get(p1.i(), p1.j()) ); + } else { + if ( pile1.contains(id2_cand) ) { + pile2.add(pile1, pb.alignments.get( p2.i(), p2.j()),p2.i(), p2.j()); + pile1.clear(); // need to reset pile 2 to something else + int z = pb.findFarthest(pile2); // get sequence farthest from merged pile 1 + pile1.add(seqs[z].getSequence(), z); // and reinitialize pile 2 with that sequence + } else pile2.add( pb.alignments.get(p2.i(), p2.j()) ); + } + } + System.out.println("PILE 1: \n"+pile1.toString()); + System.out.println("PILE 2: \n"+pile2.toString()); + } // end WHILE + + System.out.println("Distance between final piles: "+pb.distance(pile1, pile2)); + System.out.println("Diameter of PILE1: "+ pb.diameter(pile1)); + System.out.println("Diameter of PILE2: "+ pb.diameter(pile2)); +/* + * System.out.println("Closest distance to the pile: " + best_d + + "(adding: " + best_i + "," + best_j + "):"); + System.out.println(pile.toString()); + } +*/ + } + + public static IndexedSequence[] testSet1(int K) { + IndexedSequence [] seqs = new IndexedSequence[9]; + seqs[0] = new IndexedSequence("CAAAAAAAGCAAAACTCTGAAGAAAGAGAGAGAGAGGGAGAGAGGGAGAGAGAAAGGGAGAGACGATGAGAGACAG",K); + seqs[1] = new IndexedSequence("GCAAAACTCTGAAGAAAGAGAGAGAGAGGGAGAGAGGGAGAGAGAAAGGAAGAGACGAT",K); + seqs[2] = new IndexedSequence("AACTCTGAAGAAAGAGAGAGAGAGGGAGAGAGGGAGAGAGAAAGGAAGAGACGATGAGA",K); + seqs[3] = new IndexedSequence("GAGAGGGAGAGAGAAAGGAAGAGACGATGAGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAAC",K); + seqs[4] = new IndexedSequence("ACGATGAGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAAAA",K); + seqs[5] = new IndexedSequence("GAGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAACCTTGGA",K); + seqs[6] = new IndexedSequence("TGAGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATC",K); + seqs[7] = new IndexedSequence("AGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAACCTTGGAGGA",K); + seqs[8] = new IndexedSequence("AGACAGAGAAGGAGAGAGAAAGTACAAAAGAACGAATGAACGAACAAACTAGAAATCGAGCAGGAACCTTGGAGGA",K); + return seqs; + } + + public static IndexedSequence[] testSet2(int K) { + IndexedSequence [] seqs = new IndexedSequence[11]; + seqs[0] = new IndexedSequence("TGCAATGAGATGAGATCGTGCCTCTGCACTCCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAA",K); + seqs[1] = new IndexedSequence("AATGAGATGAGATCGTGCCTCTGCACTCCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACA",K); + seqs[2] = new IndexedSequence("CCTCTGCACTCCAGCCTGGGCGACAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACA",K); + seqs[3] = new IndexedSequence("CAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCT",K); + seqs[4] = new IndexedSequence("CAGAGTGAGAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCT",K); + seqs[5] = new IndexedSequence("GAGACCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAG",K); + seqs[6] = new IndexedSequence("CCCTGTCTCAAAAACACAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTT",K); + seqs[7] = new IndexedSequence("CCAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTG",K); + seqs[8] = new IndexedSequence("CAAAAACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGTTATCTCTGGGGAGT",K); + seqs[9] = new IndexedSequence("AACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGTTATCTCTGGGTAGTTTGG",K); + seqs[10] = new IndexedSequence("ACAACAACAACAAAAAAACACCAATCTGAGCAAATACTGCCCTAAACCGAGTGTTGTTATCTCTGGGTAGCTTGGA",K); + return seqs; + } + + public static IndexedSequence[] testSet3(int K) { + IndexedSequence [] seqs = new IndexedSequence[11]; + seqs[0] = new IndexedSequence("TGGAAATTTATTTCTCAGAGTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGG",K); + seqs[1] = new IndexedSequence("TGGAAATTTATTTCTCAAAGTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGG",K); + seqs[2] = new IndexedSequence("GGAAATTTATTTCTCAGAGTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGG",K); + seqs[3] = new IndexedSequence("GGAAATTTATTTCACAGAGTAATGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGCTTCTAAGTCTGCTGAGGG",K); + seqs[4] = new IndexedSequence("ATTTCTCAGAGTACTGGAAGCTGGGAATCCAAGATCGAAATGCCAGCAGATTCTAAGTC",K); + seqs[5] = new IndexedSequence("ATTTCTCAGAGTACTGGAAGCTGGGACTCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGC",K); + seqs[6] = new IndexedSequence("GTACTGGAAGCTGGGAATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGCACTCTCTGCT",K); + seqs[7] = new IndexedSequence("AATCCAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGCACTCTCTGCTTCATAAATGGGTCTC",K); + seqs[8] = new IndexedSequence("CAAGATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGCGCACTCTCTGCTTCATAAATGGGTCTCTTGC",K); + seqs[9] = new IndexedSequence("ATCAAAATGCCAGCAGATTCTAAGTCTGGTGAGGGTAGGGTGCACTCTCTGCTTCATAAATGGGTCTCTTGCCGCA",K); + seqs[10] = new IndexedSequence("GTCTGGTGAGGGTAGGGTGCACTCTCTGCTTCATAAATGGGTCTCTTGCCGCAAAAAAATCTGTTTGCTCCTCCAG",K); + return seqs; + } +}