leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase.

protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/DeBruijnAssembler.java

@@ -410,9 +410,6 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
                     // extend partial haplotypes which are anchored in the reference to include the full active region
                     h = extendPartialHaplotype(h, activeRegionStart, refWithPadding);
                     final Cigar leftAlignedCigar = leftAlignCigarSequentially(AlignmentUtils.consolidateCigar(h.getCigar()), refWithPadding, h.getBases(), activeRegionStart, 0);
-                    if( leftAlignedCigar.getReferenceLength() != refHaplotype.getCigar().getReferenceLength() ) { // left alignment failure
-                        continue;
-                    }
                     if( !returnHaplotypes.contains(h) ) {
                         h.setAlignmentStartHapwrtRef(activeRegionStart);
                         h.setCigar(leftAlignedCigar);
@@ -548,9 +545,8 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
             final CigarElement ce = cigar.getCigarElement(i);
             if (ce.getOperator() == CigarOperator.D || ce.getOperator() == CigarOperator.I) {
                 cigarToAlign.add(ce);
-                for( final CigarElement toAdd : AlignmentUtils.leftAlignIndel(cigarToAlign, refSeq, readSeq, refIndex, readIndex, false).getCigarElements() ) {
+                final Cigar leftAligned = AlignmentUtils.leftAlignSingleIndel(cigarToAlign, refSeq, readSeq, refIndex, readIndex, false);
-                    cigarToReturn.add(toAdd);
+                for ( final CigarElement toAdd : leftAligned.getCigarElements() ) { cigarToReturn.add(toAdd); }
-                }
                 refIndex += cigarToAlign.getReferenceLength();
                 readIndex += cigarToAlign.getReadLength();
                 cigarToAlign = new Cigar();
@@ -563,7 +559,11 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
                 cigarToReturn.add(toAdd);
             }
         }
-        return cigarToReturn;
+
+        final Cigar result = AlignmentUtils.consolidateCigar(cigarToReturn);
+        if( result.getReferenceLength() != cigar.getReferenceLength() )
+            throw new IllegalStateException("leftAlignCigarSequentially failed to produce a valid CIGAR.  Reference lengths differ.  Initial cigar " + cigar + " left aligned into " + result);
+        return result;
     }
 
     /**

protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/DeBruijnAssemblerUnitTest.java

@@ -52,10 +52,7 @@ package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
  * Date: 3/27/12
  */
 
-import net.sf.samtools.Cigar;
+import net.sf.samtools.*;
-import net.sf.samtools.CigarElement;
-import net.sf.samtools.CigarOperator;
-import net.sf.samtools.SAMFileHeader;
 import org.broadinstitute.sting.BaseTest;
 import org.broadinstitute.sting.gatk.walkers.haplotypecaller.graphs.DeBruijnGraph;
 import org.broadinstitute.sting.utils.haplotype.Haplotype;
@@ -125,6 +122,17 @@ public class DeBruijnAssemblerUnitTest extends BaseTest {
         }
     }
 
+    @Test(enabled = true)
+    public void testLeftAlignCigarSequentiallyAdjacentID() {
+        final String ref = "GTCTCTCTCTCTCTCTCTATATATATATATATATTT";
+        final String hap = "GTCTCTCTCTCTCTCTCTCTCTATATATATATATTT";
+        final Cigar originalCigar = TextCigarCodec.getSingleton().decode("18M4I12M4D2M");
+
+        final Cigar result = new DeBruijnAssembler().leftAlignCigarSequentially(originalCigar, ref.getBytes(), hap.getBytes(), 0, 0);
+        logger.warn("Result is " + result);
+        Assert.assertEquals(originalCigar.getReferenceLength(), result.getReferenceLength(), "Reference lengths are different");
+    }
+
     private static class MockBuilder extends DeBruijnGraphBuilder {
         public final List<Kmer> addedPairs = new LinkedList<Kmer>();
 
@@ -165,7 +173,7 @@ public class DeBruijnAssemblerUnitTest extends BaseTest {
         return tests.toArray(new Object[][]{});
     }
 
-    @Test(dataProvider = "AddReadKmersToGraph")
+    @Test(dataProvider = "AddReadKmersToGraph", enabled = ! DEBUG)
     public void testAddReadKmersToGraph(final String bases, final int kmerSize, final List<Integer> badQualsSites) {
         final int readLen = bases.length();
         final DeBruijnAssembler assembler = new DeBruijnAssembler();

public/java/src/org/broadinstitute/sting/utils/sam/AlignmentUtils.java

@@ -664,7 +664,7 @@ public final class AlignmentUtils {
         if ( numIndels == 0 )
             return cigar;
         if ( numIndels == 1 )
-            return leftAlignSingleIndel(cigar, refSeq, readSeq, refIndex, readIndex);
+            return leftAlignSingleIndel(cigar, refSeq, readSeq, refIndex, readIndex, true);
 
         // if we got here then there is more than 1 indel in the alignment
         if ( doNotThrowExceptionForMultipleIndels )
@@ -709,10 +709,11 @@ public final class AlignmentUtils {
      * @param readSeq   read sequence
      * @param refIndex  0-based alignment start position on ref
      * @param readIndex 0-based alignment start position on read
+     * @param cleanupCigar if true, we'll cleanup the resulting cigar element, removing 0 length elements and deletions from the first cigar position
      * @return a non-null cigar, in which the single indel is guaranteed to be placed at the leftmost possible position across a repeat (if any)
      */
     @Ensures("result != null")
-    public static Cigar leftAlignSingleIndel(Cigar cigar, final byte[] refSeq, final byte[] readSeq, final int refIndex, final int readIndex) {
+    public static Cigar leftAlignSingleIndel(Cigar cigar, final byte[] refSeq, final byte[] readSeq, final int refIndex, final int readIndex, final boolean cleanupCigar) {
         ensureLeftAlignmentHasGoodArguments(cigar, refSeq, readSeq, refIndex, readIndex);
 
         int indexOfIndel = -1;
@@ -751,7 +752,7 @@ public final class AlignmentUtils {
                 cigar = newCigar;
                 i = -1;
                 if (reachedEndOfRead)
-                    cigar = cleanUpCigar(cigar);
+                    cigar = cleanupCigar ? cleanUpCigar(cigar) : cigar;
             }
 
             if (reachedEndOfRead)