zzh
/
gatk-3.8
1
0
Fork 0
Code Issues Pull Requests Packages Projects Releases Wiki Activity

leftAlignCigarSequentially now supports haplotypes with insertions and deletions where the deletion allele was previously removed by the leftAlignSingleIndel during it's cleanup phase.

This commit is contained in:
Mark DePristo 2013-04-19 16:11:29 -04:00
parent aefddaa219
commit 2bcbdd469f
3 changed files with 24 additions and 15 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

14
protected/java/src/org/broadinstitute/sting/gatk/walkers/haplotypecaller/DeBruijnAssembler.java
View File

@ -410,9 +410,6 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
// extend partial haplotypes which are anchored in the reference to include the full active region
h = extendPartialHaplotype(h, activeRegionStart, refWithPadding);
final Cigar leftAlignedCigar = leftAlignCigarSequentially(AlignmentUtils.consolidateCigar(h.getCigar()), refWithPadding, h.getBases(), activeRegionStart, 0);
if( leftAlignedCigar.getReferenceLength() != refHaplotype.getCigar().getReferenceLength() ) { // left alignment failure
continue;
}
if( !returnHaplotypes.contains(h) ) {
h.setAlignmentStartHapwrtRef(activeRegionStart);
h.setCigar(leftAlignedCigar);
@ -548,9 +545,8 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
final CigarElement ce = cigar.getCigarElement(i);
if (ce.getOperator() == CigarOperator.D || ce.getOperator() == CigarOperator.I) {
cigarToAlign.add(ce);
for( final CigarElement toAdd : AlignmentUtils.leftAlignIndel(cigarToAlign, refSeq, readSeq, refIndex, readIndex, false).getCigarElements() ) {
cigarToReturn.add(toAdd);
}
final Cigar leftAligned = AlignmentUtils.leftAlignSingleIndel(cigarToAlign, refSeq, readSeq, refIndex, readIndex, false);
for ( final CigarElement toAdd : leftAligned.getCigarElements() ) { cigarToReturn.add(toAdd); }
refIndex += cigarToAlign.getReferenceLength();
readIndex += cigarToAlign.getReadLength();
cigarToAlign = new Cigar();
@ -563,7 +559,11 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
cigarToReturn.add(toAdd);
}
}
return cigarToReturn;
final Cigar result = AlignmentUtils.consolidateCigar(cigarToReturn);
if( result.getReferenceLength() != cigar.getReferenceLength() )
throw new IllegalStateException("leftAlignCigarSequentially failed to produce a valid CIGAR. Reference lengths differ. Initial cigar " + cigar + " left aligned into " + result);
return result;
}
/**

18
protected/java/test/org/broadinstitute/sting/gatk/walkers/haplotypecaller/DeBruijnAssemblerUnitTest.java
View File

@ -52,10 +52,7 @@ package org.broadinstitute.sting.gatk.walkers.haplotypecaller;
* Date: 3/27/12
*/
import net.sf.samtools.Cigar;
import net.sf.samtools.CigarElement;
import net.sf.samtools.CigarOperator;
import net.sf.samtools.SAMFileHeader;
import net.sf.samtools.*;
import org.broadinstitute.sting.BaseTest;
import org.broadinstitute.sting.gatk.walkers.haplotypecaller.graphs.DeBruijnGraph;
import org.broadinstitute.sting.utils.haplotype.Haplotype;
@ -125,6 +122,17 @@ public class DeBruijnAssemblerUnitTest extends BaseTest {
}
}
@Test(enabled = true)
public void testLeftAlignCigarSequentiallyAdjacentID() {
final String ref = "GTCTCTCTCTCTCTCTCTATATATATATATATATTT";
final String hap = "GTCTCTCTCTCTCTCTCTCTCTATATATATATATTT";
final Cigar originalCigar = TextCigarCodec.getSingleton().decode("18M4I12M4D2M");
final Cigar result = new DeBruijnAssembler().leftAlignCigarSequentially(originalCigar, ref.getBytes(), hap.getBytes(), 0, 0);
logger.warn("Result is " + result);
Assert.assertEquals(originalCigar.getReferenceLength(), result.getReferenceLength(), "Reference lengths are different");
}
private static class MockBuilder extends DeBruijnGraphBuilder {
public final List<Kmer> addedPairs = new LinkedList<Kmer>();
@ -165,7 +173,7 @@ public class DeBruijnAssemblerUnitTest extends BaseTest {
return tests.toArray(new Object[][]{});
}
@Test(dataProvider = "AddReadKmersToGraph")
@Test(dataProvider = "AddReadKmersToGraph", enabled = ! DEBUG)
public void testAddReadKmersToGraph(final String bases, final int kmerSize, final List<Integer> badQualsSites) {
final int readLen = bases.length();
final DeBruijnAssembler assembler = new DeBruijnAssembler();

7
public/java/src/org/broadinstitute/sting/utils/sam/AlignmentUtils.java
View File

@ -664,7 +664,7 @@ public final class AlignmentUtils {
if ( numIndels == 0 )
return cigar;
if ( numIndels == 1 )
return leftAlignSingleIndel(cigar, refSeq, readSeq, refIndex, readIndex);
return leftAlignSingleIndel(cigar, refSeq, readSeq, refIndex, readIndex, true);
// if we got here then there is more than 1 indel in the alignment
if ( doNotThrowExceptionForMultipleIndels )
@ -709,10 +709,11 @@ public final class AlignmentUtils {
* @param readSeq read sequence
* @param refIndex 0-based alignment start position on ref
* @param readIndex 0-based alignment start position on read
* @param cleanupCigar if true, we'll cleanup the resulting cigar element, removing 0 length elements and deletions from the first cigar position
* @return a non-null cigar, in which the single indel is guaranteed to be placed at the leftmost possible position across a repeat (if any)
*/
@Ensures("result != null")
public static Cigar leftAlignSingleIndel(Cigar cigar, final byte[] refSeq, final byte[] readSeq, final int refIndex, final int readIndex) {
public static Cigar leftAlignSingleIndel(Cigar cigar, final byte[] refSeq, final byte[] readSeq, final int refIndex, final int readIndex, final boolean cleanupCigar) {
ensureLeftAlignmentHasGoodArguments(cigar, refSeq, readSeq, refIndex, readIndex);
int indexOfIndel = -1;
@ -751,7 +752,7 @@ public final class AlignmentUtils {
cigar = newCigar;
i = -1;
if (reachedEndOfRead)
cigar = cleanUpCigar(cigar);
cigar = cleanupCigar ? cleanUpCigar(cigar) : cigar;
}
if (reachedEndOfRead)