HC bug fixes: no longer create reference graphs with cycles
-- Though not intended, it was possible to create reference graphs with cycles in the case where you started the graph with a homopolymer of length > the kmer. The previous test would fail to catch this case. Now its not possible -- Lots of code cleanup and refactoring in this push. Split the monolithic createGraphFromSequences into simple calls to addReferenceKmersToGraph and addReadKmersToGraph which themselves share lower level functions like addKmerPairFromSeqToGraph. -- Fix performance problem with reduced reads and the HC, where we were calling add kmer pair for each count in the reduced read, instead of just calling it once with a multiplicity of count. -- Refactor addKmersToGraph() to use things like addOrUpdateEdge, now the code is very clear
This commit is contained in:
parent
1917d55dc2
commit
2472828e1c
|
|
@ -154,7 +154,7 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
|
|||
continue;
|
||||
|
||||
if ( debug ) logger.info("Creating de Bruijn graph for " + kmer + " kmer using " + reads.size() + " reads");
|
||||
DeBruijnGraph graph = createGraphFromSequences( reads, kmer, refHaplotype, debug);
|
||||
DeBruijnGraph graph = createGraphFromSequences( reads, kmer, refHaplotype);
|
||||
if( graph != null ) { // graphs that fail during creation ( for example, because there are cycles in the reference graph ) will show up here as a null graph object
|
||||
// do a series of steps to clean up the raw assembly graph to make it analysis-ready
|
||||
if ( debugGraphTransformations ) graph.printGraph(new File("unpruned.dot"), pruneFactor);
|
||||
|
|
@ -189,10 +189,12 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
|
|||
seqGraph.simplifyGraph();
|
||||
if ( debugGraphTransformations ) seqGraph.printGraph(new File("sequenceGraph.3.merged.dot"), pruneFactor);
|
||||
|
||||
// if we've assembled just to the reference, just leave now otherwise removePathsNotConnectedToRef
|
||||
// might blow up because there's no reference source node
|
||||
if ( seqGraph.vertexSet().size() == 1 )
|
||||
return seqGraph;
|
||||
// The graph has degenerated in some way, so the reference source and/or sink cannot be id'd. Can
|
||||
// happen in cases where for example the reference somehow manages to acquire a cycle, or
|
||||
// where the entire assembly collapses back into the reference sequence.
|
||||
if ( seqGraph.getReferenceSourceVertex() == null || seqGraph.getReferenceSinkVertex() == null )
|
||||
return null;
|
||||
|
||||
seqGraph.removePathsNotConnectedToRef();
|
||||
if ( debugGraphTransformations ) seqGraph.printGraph(new File("sequenceGraph.4.refcleaned.dot"), pruneFactor);
|
||||
|
||||
|
|
@ -214,64 +216,102 @@ public class DeBruijnAssembler extends LocalAssemblyEngine {
|
|||
}
|
||||
}
|
||||
|
||||
@Requires({"reads != null", "KMER_LENGTH > 0", "refHaplotype != null"})
|
||||
protected DeBruijnGraph createGraphFromSequences( final List<GATKSAMRecord> reads, final int KMER_LENGTH, final Haplotype refHaplotype, final boolean DEBUG ) {
|
||||
final DeBruijnGraph graph = new DeBruijnGraph(KMER_LENGTH);
|
||||
@Requires({"reads != null", "kmerLength > 0", "refHaplotype != null"})
|
||||
protected DeBruijnGraph createGraphFromSequences( final List<GATKSAMRecord> reads, final int kmerLength, final Haplotype refHaplotype ) {
|
||||
final DeBruijnGraph graph = new DeBruijnGraph(kmerLength);
|
||||
|
||||
// First pull kmers from the reference haplotype and add them to the graph
|
||||
final byte[] refSequence = refHaplotype.getBases();
|
||||
if( refSequence.length >= KMER_LENGTH + KMER_OVERLAP ) {
|
||||
final int kmersInSequence = refSequence.length - KMER_LENGTH + 1;
|
||||
for( int iii = 0; iii < kmersInSequence - 1; iii++ ) {
|
||||
if( !graph.addKmersToGraph(Arrays.copyOfRange(refSequence, iii, iii + KMER_LENGTH), Arrays.copyOfRange(refSequence, iii + 1, iii + 1 + KMER_LENGTH), true, 1) ) {
|
||||
if( DEBUG ) {
|
||||
System.out.println("Cycle detected in reference graph for kmer = " + KMER_LENGTH + " ...skipping");
|
||||
}
|
||||
return null;
|
||||
}
|
||||
}
|
||||
} else {
|
||||
// not enough reference sequence to build a kmer graph of this length, return null
|
||||
if ( ! addReferenceKmersToGraph(graph, refHaplotype.getBases()) )
|
||||
// something went wrong, so abort right now with a null graph
|
||||
return null;
|
||||
}
|
||||
|
||||
// now go through the graph already seeded with the reference sequence and add the read kmers to it
|
||||
if ( ! addReadKmersToGraph(graph, reads) )
|
||||
// some problem was detected adding the reads to the graph, return null to indicate we failed
|
||||
return null;
|
||||
|
||||
graph.cleanNonRefPaths();
|
||||
return graph;
|
||||
}
|
||||
|
||||
/**
|
||||
* Add the high-quality kmers from the reads to the graph
|
||||
*
|
||||
* @param graph a graph to add the read kmers to
|
||||
* @param reads a non-null list of reads whose kmers we want to add to the graph
|
||||
* @return true if we successfully added the read kmers to the graph without corrupting it in some way
|
||||
*/
|
||||
protected boolean addReadKmersToGraph(final DeBruijnGraph graph, final List<GATKSAMRecord> reads) {
|
||||
final int kmerLength = graph.getKmerSize();
|
||||
|
||||
// Next pull kmers out of every read and throw them on the graph
|
||||
for( final GATKSAMRecord read : reads ) {
|
||||
final byte[] sequence = read.getReadBases();
|
||||
final byte[] qualities = read.getBaseQualities();
|
||||
final byte[] reducedReadCounts = read.getReducedReadCounts(); // will be null if read is not reduced
|
||||
if( sequence.length > KMER_LENGTH + KMER_OVERLAP ) {
|
||||
final int kmersInSequence = sequence.length - KMER_LENGTH + 1;
|
||||
if( sequence.length > kmerLength + KMER_OVERLAP ) {
|
||||
final int kmersInSequence = sequence.length - kmerLength + 1;
|
||||
for( int iii = 0; iii < kmersInSequence - 1; iii++ ) {
|
||||
// if the qualities of all the bases in the kmers are high enough
|
||||
boolean badKmer = false;
|
||||
for( int jjj = iii; jjj < iii + KMER_LENGTH + 1; jjj++) {
|
||||
for( int jjj = iii; jjj < iii + kmerLength + 1; jjj++) {
|
||||
if( qualities[jjj] < minBaseQualityToUseInAssembly ) {
|
||||
badKmer = true;
|
||||
break;
|
||||
}
|
||||
}
|
||||
if( !badKmer ) {
|
||||
// how many observations of this kmer have we seen? A normal read counts for 1, but
|
||||
// a reduced read might imply a higher multiplicity for our the edge
|
||||
int countNumber = 1;
|
||||
if( read.isReducedRead() ) {
|
||||
// compute mean number of reduced read counts in current kmer span
|
||||
// precise rounding can make a difference with low consensus counts
|
||||
countNumber = MathUtils.arrayMax(Arrays.copyOfRange(reducedReadCounts, iii, iii + KMER_LENGTH));
|
||||
// TODO -- optimization: should extend arrayMax function to take start stop values
|
||||
countNumber = MathUtils.arrayMax(Arrays.copyOfRange(reducedReadCounts, iii, iii + kmerLength));
|
||||
}
|
||||
|
||||
final byte[] kmer1 = Arrays.copyOfRange(sequence, iii, iii + KMER_LENGTH);
|
||||
final byte[] kmer2 = Arrays.copyOfRange(sequence, iii + 1, iii + 1 + KMER_LENGTH);
|
||||
|
||||
for( int kkk=0; kkk < countNumber; kkk++ ) {
|
||||
graph.addKmersToGraph(kmer1, kmer2, false, 1);
|
||||
}
|
||||
graph.addKmerPairFromSeqToGraph(sequence, iii, false, countNumber);
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
graph.cleanNonRefPaths();
|
||||
return graph;
|
||||
// always returns true now, but it's possible that we'd add reads and decide we don't like the graph in some way
|
||||
return true;
|
||||
}
|
||||
|
||||
/**
|
||||
* Add the kmers from the reference sequence to the DeBruijnGraph
|
||||
*
|
||||
* @param graph the graph to add the reference kmers to. Must be empty
|
||||
* @param refSequence the reference sequence from which we'll get our kmers
|
||||
* @return true if we succeeded in creating a good graph from the reference sequence, false otherwise
|
||||
*/
|
||||
protected boolean addReferenceKmersToGraph(final DeBruijnGraph graph, final byte[] refSequence) {
|
||||
if ( graph == null ) throw new IllegalArgumentException("graph cannot be null");
|
||||
if ( graph.vertexSet().size() != 0 ) throw new IllegalArgumentException("Reference sequences must be added before any other vertices, but got a graph with " + graph.vertexSet().size() + " vertices in it already: " + graph);
|
||||
if ( refSequence == null ) throw new IllegalArgumentException("refSequence cannot be null");
|
||||
|
||||
|
||||
final int kmerLength = graph.getKmerSize();
|
||||
if( refSequence.length < kmerLength + KMER_OVERLAP ) {
|
||||
// not enough reference sequence to build a kmer graph of this length, return null
|
||||
return false;
|
||||
}
|
||||
|
||||
final int kmersInSequence = refSequence.length - kmerLength + 1;
|
||||
for( int iii = 0; iii < kmersInSequence - 1; iii++ ) {
|
||||
graph.addKmerPairFromSeqToGraph(refSequence, iii, true, 1);
|
||||
}
|
||||
|
||||
// we expect that every kmer in the sequence is unique, so that the graph has exactly kmersInSequence vertices
|
||||
if ( graph.vertexSet().size() != kmersInSequence ) {
|
||||
if( debug ) logger.info("Cycle detected in reference graph for kmer = " + kmerLength + " ...skipping");
|
||||
return false;
|
||||
}
|
||||
|
||||
return true;
|
||||
}
|
||||
|
||||
protected void printGraphs(final List<SeqGraph> graphs) {
|
||||
|
|
|
|||
|
|
@ -126,30 +126,37 @@ public class DeBruijnGraph extends BaseGraph<DeBruijnVertex> {
|
|||
* @param kmer1 the source kmer for the edge
|
||||
* @param kmer2 the target kmer for the edge
|
||||
* @param isRef true if the added edge is a reference edge
|
||||
* @return will return false if trying to add a reference edge which creates a cycle in the assembly graph
|
||||
*/
|
||||
public boolean addKmersToGraph( final byte[] kmer1, final byte[] kmer2, final boolean isRef, final int multiplicity ) {
|
||||
public void addKmersToGraph( final byte[] kmer1, final byte[] kmer2, final boolean isRef, final int multiplicity ) {
|
||||
if( kmer1 == null ) { throw new IllegalArgumentException("Attempting to add a null kmer to the graph."); }
|
||||
if( kmer2 == null ) { throw new IllegalArgumentException("Attempting to add a null kmer to the graph."); }
|
||||
if( kmer1.length != kmer2.length ) { throw new IllegalArgumentException("Attempting to add a kmers to the graph with different lengths."); }
|
||||
|
||||
final int numVertexBefore = vertexSet().size();
|
||||
final DeBruijnVertex v1 = new DeBruijnVertex( kmer1 );
|
||||
addVertex(v1);
|
||||
final DeBruijnVertex v2 = new DeBruijnVertex( kmer2 );
|
||||
addVertex(v2);
|
||||
if( isRef && vertexSet().size() == numVertexBefore ) { return false; }
|
||||
final BaseEdge toAdd = new BaseEdge(isRef, multiplicity);
|
||||
|
||||
final BaseEdge targetEdge = getEdge(v1, v2);
|
||||
if ( targetEdge == null ) {
|
||||
addEdge(v1, v2, new BaseEdge( isRef, multiplicity ));
|
||||
} else {
|
||||
if( isRef ) {
|
||||
targetEdge.setIsRef( true );
|
||||
}
|
||||
targetEdge.setMultiplicity(targetEdge.getMultiplicity() + multiplicity);
|
||||
}
|
||||
return true;
|
||||
addVertices(v1, v2);
|
||||
addOrUpdateEdge(v1, v2, toAdd);
|
||||
}
|
||||
|
||||
/**
|
||||
* Higher-level interface to #addKmersToGraph that adds a pair of kmers from a larger sequence of bytes to this
|
||||
* graph. The kmers start at start (first) and start + 1 (second) have have length getKmerSize(). The
|
||||
* edge between them is added with isRef and multiplicity
|
||||
*
|
||||
* @param sequence a sequence of bases from which we want to extract a pair of kmers
|
||||
* @param start the start of the first kmer in sequence, must be between 0 and sequence.length - 2 - getKmerSize()
|
||||
* @param isRef should the edge between the two kmers be a reference edge?
|
||||
* @param multiplicity what's the multiplicity of the edge between these two kmers
|
||||
*/
|
||||
public void addKmerPairFromSeqToGraph( final byte[] sequence, final int start, final boolean isRef, final int multiplicity ) {
|
||||
if ( sequence == null ) throw new IllegalArgumentException("Sequence cannot be null");
|
||||
if ( start < 0 ) throw new IllegalArgumentException("start must be >= 0 but got " + start);
|
||||
if ( start + 1 + getKmerSize() > sequence.length ) throw new IllegalArgumentException("start " + start + " is too big given kmerSize " + getKmerSize() + " and sequence length " + sequence.length);
|
||||
final byte[] kmer1 = Arrays.copyOfRange(sequence, start, start + getKmerSize());
|
||||
final byte[] kmer2 = Arrays.copyOfRange(sequence, start + 1, start + 1 + getKmerSize());
|
||||
addKmersToGraph(kmer1, kmer2, isRef, multiplicity);
|
||||
}
|
||||
|
||||
/**
|
||||
|
|
|
|||
|
|
@ -72,8 +72,8 @@ public class DeBruijnAssemblerUnitTest extends BaseTest {
|
|||
public void testReferenceCycleGraph() {
|
||||
String refCycle = "ATCGAGGAGAGCGCCCCGAGATATATATATATATATTTGCGAGCGCGAGCGTTTTAAAAATTTTAGACGGAGAGATATATATATATGGGAGAGGGGATATATATATATCCCCCC";
|
||||
String noCycle = "ATCGAGGAGAGCGCCCCGAGATATTATTTGCGAGCGCGAGCGTTTTAAAAATTTTAGACGGAGAGATGGGAGAGGGGATATATAATATCCCCCC";
|
||||
final DeBruijnGraph g1 = new DeBruijnAssembler().createGraphFromSequences(new ArrayList<GATKSAMRecord>(), 10, new Haplotype(refCycle.getBytes(), true), false);
|
||||
final DeBruijnGraph g2 = new DeBruijnAssembler().createGraphFromSequences(new ArrayList<GATKSAMRecord>(), 10, new Haplotype(noCycle.getBytes(), true), false);
|
||||
final DeBruijnGraph g1 = new DeBruijnAssembler().createGraphFromSequences(new ArrayList<GATKSAMRecord>(), 10, new Haplotype(refCycle.getBytes(), true));
|
||||
final DeBruijnGraph g2 = new DeBruijnAssembler().createGraphFromSequences(new ArrayList<GATKSAMRecord>(), 10, new Haplotype(noCycle.getBytes(), true));
|
||||
|
||||
Assert.assertTrue(g1 == null, "Reference cycle graph should return null during creation.");
|
||||
Assert.assertTrue(g2 != null, "Reference non-cycle graph should not return null during creation.");
|
||||
|
|
|
|||
Loading…
Reference in New Issue