Unidirectional alignments with mismatches now working. Significant refactoring will be required.

git-svn-id: file:///humgen/gsa-scr1/gsa-engineering/svn_contents/trunk@1686 348d0f76-0448-11de-a6fe-93d51630548a
This commit is contained in:
hanna 2009-09-22 19:05:10 +00:00
parent 22932042ea
commit 14477bb48e
5 changed files with 240 additions and 70 deletions

View File

@ -2,58 +2,20 @@ package org.broadinstitute.sting.alignment;
import net.sf.samtools.SAMRecord;
import java.io.File;
import java.util.List;
import org.broadinstitute.sting.alignment.bwa.*;
import org.broadinstitute.sting.alignment.bwa.bwt.BWT;
import org.broadinstitute.sting.alignment.bwa.bwt.SuffixArray;
import org.broadinstitute.sting.alignment.bwa.bwt.BWTReader;
import org.broadinstitute.sting.alignment.bwa.bwt.SuffixArrayReader;
/**
* Create perfect alignments from the read to the genome represented by the given BWT / suffix array.
*
* @author mhanna
* @version 0.1
*/
public class Aligner {
public interface Aligner {
/**
* BWT in the forward direction.
*/
private BWT forwardBWT;
/**
* Suffix array in the forward direction.
*/
private SuffixArray forwardSuffixArray;
/**
* BWT in the reverse direction.
*/
private BWT reverseBWT;
/**
* Suffix array in the reverse direction.
*/
private SuffixArray reverseSuffixArray;
public Aligner( File forwardBWTFile, File forwardSuffixArrayFile, File reverseBWTFile, File reverseSuffixArrayFile ) {
forwardBWT = new BWTReader(forwardBWTFile).read();
forwardSuffixArray = new SuffixArrayReader(forwardSuffixArrayFile).read();
reverseBWT = new BWTReader(reverseBWTFile).read();
reverseSuffixArray = new SuffixArrayReader(reverseSuffixArrayFile).read();
}
/**
* Align the read to the given reference.
* Align the read to the reference.
* @param read Read to align.
* @return A list of the alignments.
*/
public List<Alignment> align( SAMRecord read ) {
List<LowerBound> lowerBounds = LowerBound.create(read,reverseBWT);
return null;
}
public List<Alignment> align(SAMRecord read);
}

View File

@ -4,11 +4,18 @@ import org.broadinstitute.sting.utils.fasta.IndexedFastaSequenceFile;
import org.broadinstitute.sting.utils.StingException;
import org.broadinstitute.sting.alignment.bwa.bwt.SuffixArrayReader;
import org.broadinstitute.sting.alignment.bwa.bwt.*;
import org.broadinstitute.sting.alignment.Aligner;
import org.broadinstitute.sting.alignment.Alignment;
import java.io.File;
import java.io.FileNotFoundException;
import java.util.List;
import java.util.ArrayList;
import java.util.Iterator;
import net.sf.picard.reference.ReferenceSequence;
import net.sf.samtools.SAMRecord;
import net.sf.samtools.SAMFileReader;
/**
* A test harness to ensure that the perfect aligner works.
@ -16,7 +23,7 @@ import net.sf.picard.reference.ReferenceSequence;
* @author mhanna
* @version 0.1
*/
public class PerfectAlignerTestHarness {
public class AlignerTestHarness {
public static final String[] sampleReads = { "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGA",
"AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTAG",
"GCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGCGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCAGAT",
@ -32,21 +39,47 @@ public class PerfectAlignerTestHarness {
private static SuffixArray suffixArray;
public static void main( String argv[] ) throws FileNotFoundException {
if( argv.length != 3 ) {
System.out.println("PerfectAlignerTestHarness <fasta> <bwt> <sa>");
if( argv.length != 4 ) {
System.out.println("PerfectAlignerTestHarness <fasta> <bwt> <rbwt>");
System.exit(1);
}
File referenceFile = new File(argv[0]);
IndexedFastaSequenceFile reference = new IndexedFastaSequenceFile(referenceFile);
File bwtFile = new File(argv[1]);
BWTReader reader = new BWTReader(bwtFile);
bwt = reader.read();
File rbwtFile = new File(argv[2]);
File bamFile = new File(argv[3]);
File suffixArrayFile = null;
File suffixArrayFile = new File(argv[2]);
SuffixArrayReader suffixArrayReader = new SuffixArrayReader(suffixArrayFile);
suffixArray = suffixArrayReader.read();
align(referenceFile,bwtFile,rbwtFile,bamFile);
}
private static void align(File referenceFile, File bwtFile, File rbwtFile, File bamFile) throws FileNotFoundException {
BWT bwt = new BWTReader(bwtFile).read();
Aligner aligner = new BWAAligner(bwtFile,rbwtFile);
int count = 0;
SAMFileReader reader = new SAMFileReader(bamFile);
reader.setValidationStringency(SAMFileReader.ValidationStringency.SILENT);
for(SAMRecord read: reader) {
count++;
if( count > 15 ) break;
//if( count != 1 && count != 15 ) continue;
List<Alignment> alignments = aligner.align(read);
if(alignments.size() > 0 )
System.out.printf("%s: Aligned read to reference with %d mismatches.%n", read.getReadName(), alignments.get(0).getScore());
else
System.out.printf("%s: Failed to align read to reference.%n", read.getReadName());
}
}
private static void alignPerfect(File referenceFile, File bwtFile, File suffixArrayFile) throws FileNotFoundException
{
IndexedFastaSequenceFile reference = new IndexedFastaSequenceFile(referenceFile);
BWT bwt = new BWTReader(bwtFile).read();
SuffixArray suffixArray = new SuffixArrayReader(suffixArrayFile).read();
for( String read: sampleReads ) {
int alignmentStart = align(read);
@ -63,7 +96,7 @@ public class PerfectAlignerTestHarness {
}
}
public static int align( String read ) {
private static int align(String read) {
int lowerBound = 0, upperBound = bwt.length();
for( int i = read.length()-1; i >= 0; i-- ) {
Base base = Base.fromASCII((byte)read.charAt(i));
@ -75,4 +108,6 @@ public class PerfectAlignerTestHarness {
//System.out.printf("Read = %s; final bounds: (%d->%d); suffix array = %d%n",read,lowerBound,upperBound,alignmentStart);
return alignmentStart;
}
}

View File

@ -0,0 +1,126 @@
package org.broadinstitute.sting.alignment.bwa;
import org.broadinstitute.sting.alignment.bwa.bwt.BWT;
import org.broadinstitute.sting.alignment.bwa.bwt.BWTReader;
import org.broadinstitute.sting.alignment.bwa.bwt.Base;
import org.broadinstitute.sting.alignment.Alignment;
import org.broadinstitute.sting.alignment.Aligner;
import org.broadinstitute.sting.utils.BaseUtils;
import java.io.File;
import java.util.List;
import java.util.PriorityQueue;
import java.util.Collections;
import java.util.EnumSet;
import net.sf.samtools.SAMRecord;
import net.sf.picard.util.SequenceUtil;
/**
* Create imperfect alignments from the read to the genome represented by the given BWT / suffix array.
*
* @author mhanna
* @version 0.1
*/
public class BWAAligner implements Aligner {
/**
* BWT in the forward direction.
*/
private BWT forwardBWT;
/**
* BWT in the reverse direction.
*/
private BWT reverseBWT;
/**
* Maximum edit distance (-n option from original BWA).
*/
private static final int MAXIMUM_EDIT_DISTANCE = 4;
/**
* Maximum number of gap opens (-o option from original BWA).
*/
private static final int MAXIMUM_GAP_OPENS = 1;
/**
* Maximum number of gap extensions (-e option from original BWA).
*/
private static final int MAXIMUM_GAP_EXTENSIONS = -1;
/**
* Penalty for straight mismatches (-M option from original BWA).
*/
private static final int MISMATCH_PENALTY = 3;
/**
* Penalty for gap opens (-O option from original BWA).
*/
private static final int GAP_OPEN_PENALTY = 11;
/**
* Penalty for gap extensions (-E option from original BWA).
*/
private static final int GAP_EXTENSION_PENALTY = 4;
public BWAAligner( File forwardBWTFile, File reverseBWTFile ) {
forwardBWT = new BWTReader(forwardBWTFile).read();
reverseBWT = new BWTReader(reverseBWTFile).read();
}
public List<Alignment> align( SAMRecord read ) {
byte[] bases = read.getReadBases();
List<LowerBound> reverseLowerBounds = LowerBound.create(bases,reverseBWT);
// for( int i = 0; i < reverseLowerBounds.size(); i++ )
// System.out.printf("ReverseBWT: lb[%d] = %s%n",i,reverseLowerBounds.get(i));
PriorityQueue<BWAAlignment> alignments = new PriorityQueue<BWAAlignment>();
// Create a fictional initial alignment, with the position just off the end of the read, and the limits
// set as the entire BWT.
BWAAlignment initial = new BWAAlignment();
initial.position = read.getReadLength();
initial.loBound = 0;
initial.hiBound = forwardBWT.length();
initial.mismatches = 0;
alignments.add(initial);
while(!alignments.isEmpty()) {
BWAAlignment alignment = alignments.remove();
// Done with this particular alignment.
if(alignment.position == 0)
return Collections.<Alignment>singletonList(alignment);
//System.out.printf("Processing alignments; queue size = %d, alignment = %s, bound = %d%n", alignments.size(), alignment, lowerBounds.get(alignment.position-1).value);
// if z < D(i) then return {}
if( alignment.mismatches > reverseLowerBounds.get(alignment.position-1).value )
continue;
if( alignment.mismatches > MAXIMUM_EDIT_DISTANCE )
continue;
// For each base in { A, C, G, T }
for(Base base: EnumSet.allOf(Base.class)) {
// Create and initialize a new alignment, given that base as the candidate.
BWAAlignment newAlignment = new BWAAlignment();
newAlignment.position = alignment.position - 1;
newAlignment.loBound = forwardBWT.counts(base) + forwardBWT.occurrences(base,alignment.loBound-1) + 1;
newAlignment.hiBound = forwardBWT.counts(base) + forwardBWT.occurrences(base,alignment.hiBound);
newAlignment.mismatches = alignment.mismatches;
if( base.toASCII() != read.getReadBases()[newAlignment.position] )
newAlignment.mismatches++;
// If this alignment is valid, add it to the list.
if( newAlignment.loBound <= newAlignment.hiBound )
alignments.add(newAlignment);
}
}
return Collections.emptyList();
}
}

View File

@ -1,6 +1,8 @@
package org.broadinstitute.sting.alignment.bwa;
import org.broadinstitute.sting.alignment.Alignment;
import org.broadinstitute.sting.alignment.bwa.bwt.BWT;
import net.sf.samtools.SAMRecord;
/**
* An alignment object to be used incrementally as the BWA aligner
@ -10,6 +12,18 @@ import org.broadinstitute.sting.alignment.Alignment;
* @version 0.1
*/
public class BWAAlignment implements Alignment {
enum State { MATCH, INSERTION, DELETION }
/**
* Working variable. How many bases have been matched at this point.
*/
protected int position;
/**
* Working variable. How many mismatches have been encountered at this point.
*/
protected int mismatches;
/**
* Working variable. The lower bound of the alignment within the BWT.
*/
@ -21,16 +35,16 @@ public class BWAAlignment implements Alignment {
protected int hiBound;
/**
* Current score for this alignment.
* Indicates the current state of an alignment. Are we in an insertion? Deletion?
*/
protected int score;
protected State alignmentState;
/**
* Gets the BWA score of this alignment.
* @return BWA-style scores. 0 is best.
*/
public int getScore() {
return score;
return mismatches;
}
/**
@ -38,7 +52,16 @@ public class BWAAlignment implements Alignment {
* @param other Other alignment to which to compare.
* @return < 0 if this < other, == 0 if this == other, > 0 if this > other
*/
public int compareTo( Alignment other ) {
return Integer.valueOf(score).compareTo(other.getScore());
public int compareTo(Alignment other) {
// If the scores are equal, use the position to disambiguate order.
int scoreComparison = Integer.valueOf(getScore()).compareTo(other.getScore());
if( scoreComparison != 0 )
return scoreComparison;
else
return Integer.valueOf(position).compareTo(((BWAAlignment)other).position);
}
public String toString() {
return String.format("position = %d, mismatches = %d, loBound = %d, hiBound = %d, score = %d", position, mismatches, loBound, hiBound, getScore());
}
}

View File

@ -1,7 +1,5 @@
package org.broadinstitute.sting.alignment.bwa;
import net.sf.samtools.SAMRecord;
import java.util.List;
import java.util.ArrayList;
@ -16,6 +14,21 @@ import org.broadinstitute.sting.alignment.bwa.bwt.BWT;
* @version 0.1
*/
public class LowerBound {
/**
* Lower bound of the suffix array.
*/
public final int loIndex;
/**
* Upper bound of the suffix array.
*/
public final int hiIndex;
/**
* Width of the bwt from loIndex -> hiIndex, inclusive.
*/
public final int width;
/**
* The lower bound at the given point.
*/
@ -25,29 +38,40 @@ public class LowerBound {
* Create a new lower bound with the given value.
* @param value Value for the lower bound at this site.
*/
private LowerBound(int value) {
private LowerBound(int loIndex, int hiIndex, int value) {
this.loIndex = loIndex;
this.hiIndex = hiIndex;
this.width = hiIndex - loIndex + 1;
this.value = value;
}
/**
* Create a non-optimal bound according to the algorithm specified in Figure 3 of the BWA paper.
*/
public static List<LowerBound> create( SAMRecord read, BWT reverseBWT ) {
public static List<LowerBound> create( byte[] bases, BWT bwt ) {
List<LowerBound> bounds = new ArrayList<LowerBound>();
int loIndex = 0, hiIndex = reverseBWT.length(), mismatches = 0;
for( int i = 0; i < read.getReadBases().length; i++ ) {
Base base = Base.fromASCII(read.getReadBases()[i]);
loIndex = reverseBWT.counts(base) + reverseBWT.occurrences(base,loIndex-1) + 1;
hiIndex = reverseBWT.counts(base) + reverseBWT.occurrences(base,hiIndex);
int loIndex = 0, hiIndex = bwt.length(), mismatches = 0;
for( int i = bases.length-1; i >= 0; i-- ) {
Base base = Base.fromASCII(bases[i]);
loIndex = bwt.counts(base) + bwt.occurrences(base,loIndex-1) + 1;
hiIndex = bwt.counts(base) + bwt.occurrences(base,hiIndex);
if( loIndex > hiIndex ) {
loIndex = 0;
hiIndex = reverseBWT.length();
hiIndex = bwt.length();
mismatches++;
}
bounds.add(new LowerBound(mismatches));
bounds.add(0,new LowerBound(loIndex,hiIndex,mismatches));
}
return bounds;
}
/**
* Create a string representation of this bound.
* @return String version of this bound.
*/
public String toString() {
return String.format("LowerBound: w = %d, value = %d",width,value);
}
}