2010-04-20 07:00:08 +08:00
|
|
|
/*
|
2010-05-28 07:16:00 +08:00
|
|
|
* Copyright (c) 2010, The Broad Institute
|
2010-04-20 23:26:32 +08:00
|
|
|
*
|
2010-04-20 07:00:08 +08:00
|
|
|
* Permission is hereby granted, free of charge, to any person
|
|
|
|
|
* obtaining a copy of this software and associated documentation
|
2010-04-20 23:26:32 +08:00
|
|
|
* files (the "Software"), to deal in the Software without
|
2010-04-20 07:00:08 +08:00
|
|
|
* restriction, including without limitation the rights to use,
|
|
|
|
|
* copy, modify, merge, publish, distribute, sublicense, and/or sell
|
|
|
|
|
* copies of the Software, and to permit persons to whom the
|
|
|
|
|
* Software is furnished to do so, subject to the following
|
|
|
|
|
* conditions:
|
2010-04-20 23:26:32 +08:00
|
|
|
*
|
2010-04-20 07:00:08 +08:00
|
|
|
* The above copyright notice and this permission notice shall be
|
|
|
|
|
* included in all copies or substantial portions of the Software.
|
2010-04-20 23:26:32 +08:00
|
|
|
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
2010-04-20 07:00:08 +08:00
|
|
|
* EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
|
|
|
|
|
* OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
|
|
|
|
* NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
|
|
|
|
|
* HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
|
|
|
|
|
* WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
|
2010-05-28 07:16:00 +08:00
|
|
|
* FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
|
|
|
|
|
* OTHER DEALINGS IN THE SOFTWARE.
|
2010-04-20 07:00:08 +08:00
|
|
|
*/
|
|
|
|
|
|
2009-07-24 13:23:29 +08:00
|
|
|
package org.broadinstitute.sting.utils;
|
2009-03-24 13:36:37 +08:00
|
|
|
|
|
|
|
|
import net.sf.samtools.CigarElement;
|
|
|
|
|
import net.sf.samtools.CigarOperator;
|
|
|
|
|
import net.sf.samtools.Cigar;
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
import java.util.*;
|
|
|
|
|
|
|
|
|
|
import org.broadinstitute.sting.utils.collections.Pair;
|
|
|
|
|
import org.broadinstitute.sting.utils.exceptions.StingException;
|
2009-03-24 13:36:37 +08:00
|
|
|
|
|
|
|
|
/**
|
|
|
|
|
* Created by IntelliJ IDEA.
|
|
|
|
|
* User: asivache
|
|
|
|
|
* Date: Mar 23, 2009
|
|
|
|
|
* Time: 1:54:54 PM
|
|
|
|
|
* To change this template use File | Settings | File Templates.
|
|
|
|
|
*/
|
|
|
|
|
public class SWPairwiseAlignment {
|
|
|
|
|
private int alignment_offset; // offset of s2 w/respect to s1
|
|
|
|
|
private Cigar alignmentCigar;
|
|
|
|
|
|
2010-02-18 04:52:57 +08:00
|
|
|
private final double w_match;
|
|
|
|
|
private final double w_mismatch;
|
|
|
|
|
private final double w_open;
|
|
|
|
|
private final double w_extend;
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2009-03-24 13:36:37 +08:00
|
|
|
private static final int MSTATE = 0;
|
|
|
|
|
private static final int ISTATE = 1;
|
|
|
|
|
private static final int DSTATE = 2;
|
|
|
|
|
|
2011-04-01 08:11:04 +08:00
|
|
|
private static boolean cutoff = false;
|
2011-02-17 08:02:32 +08:00
|
|
|
|
|
|
|
|
double[] SW;
|
|
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
// private double [] best_gap_v ;
|
|
|
|
|
// private int [] gap_size_v ;
|
|
|
|
|
// private double [] best_gap_h ;
|
|
|
|
|
// private int [] gap_size_h ;
|
|
|
|
|
|
|
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
// private static double [][] sw = new double[500][500];
|
|
|
|
|
// private static int [][] btrack = new int[500][500];
|
|
|
|
|
|
2010-01-28 05:36:42 +08:00
|
|
|
// ************************************************************************
|
|
|
|
|
// **** IMPORTANT NOTE: ****
|
|
|
|
|
// **** This class assumes that all bytes come from UPPERCASED chars! ****
|
|
|
|
|
// ************************************************************************
|
|
|
|
|
public SWPairwiseAlignment(byte[] seq1, byte[] seq2, double match, double mismatch, double open, double extend ) {
|
2009-03-25 13:48:10 +08:00
|
|
|
w_match = match;
|
|
|
|
|
w_mismatch = mismatch;
|
|
|
|
|
w_open = open;
|
|
|
|
|
w_extend = extend;
|
2010-01-28 05:36:42 +08:00
|
|
|
align(seq1,seq2);
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
|
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2010-01-28 05:36:42 +08:00
|
|
|
public SWPairwiseAlignment(byte[] seq1, byte[] seq2) {
|
|
|
|
|
this(seq1,seq2,1.0,-1.0/3.0,-1.0-1.0/3.0,-1.0/3.0); // match=1, mismatch = -1/3, gap=-(1+k/3)
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
|
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2009-03-24 13:36:37 +08:00
|
|
|
public Cigar getCigar() { return alignmentCigar ; }
|
|
|
|
|
|
|
|
|
|
public int getAlignmentStart2wrt1() { return alignment_offset; }
|
|
|
|
|
|
2010-01-28 05:36:42 +08:00
|
|
|
public void align(final byte[] a, final byte[] b) {
|
2010-05-28 07:16:00 +08:00
|
|
|
final int n = a.length;
|
|
|
|
|
final int m = b.length;
|
2010-11-30 08:06:50 +08:00
|
|
|
double [] sw = new double[(n+1)*(m+1)];
|
2011-02-17 08:02:32 +08:00
|
|
|
SW = sw;
|
2010-11-30 08:06:50 +08:00
|
|
|
int [] btrack = new int[(n+1)*(m+1)];
|
2010-12-01 08:08:47 +08:00
|
|
|
|
|
|
|
|
// best_gap_v = new double[m+1];
|
|
|
|
|
// Arrays.fill(best_gap_v,-1.0e40);
|
|
|
|
|
// gap_size_v = new int[m+1];
|
|
|
|
|
// best_gap_h = new double[n+1];
|
|
|
|
|
// Arrays.fill(best_gap_h,-1.0e40);
|
|
|
|
|
// gap_size_h = new int[n+1];
|
|
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
calculateMatrix(a, b, sw, btrack);
|
|
|
|
|
calculateCigar(n, m, sw, btrack); // length of the segment (continuous matches, insertions or deletions)
|
|
|
|
|
}
|
|
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
private void calculateMatrix(final byte[] a, final byte[] b, double [] sw, int [] btrack ) {
|
|
|
|
|
final int n = a.length+1;
|
|
|
|
|
final int m = b.length+1;
|
2010-05-28 07:16:00 +08:00
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
//final double MATRIX_MIN_CUTOFF=-1e100; // never let matrix elements drop below this cutoff
|
|
|
|
|
final double MATRIX_MIN_CUTOFF; // never let matrix elements drop below this cutoff
|
|
|
|
|
if ( cutoff ) MATRIX_MIN_CUTOFF = 0.0;
|
|
|
|
|
else MATRIX_MIN_CUTOFF = -1e100;
|
|
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
double [] best_gap_v = new double[m+1];
|
|
|
|
|
Arrays.fill(best_gap_v,-1.0e40);
|
|
|
|
|
int [] gap_size_v = new int[m+1];
|
|
|
|
|
double [] best_gap_h = new double[n+1];
|
|
|
|
|
Arrays.fill(best_gap_h,-1.0e40);
|
|
|
|
|
int [] gap_size_h = new int[n+1];
|
|
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
// build smith-waterman matrix and keep backtrack info:
|
2010-11-30 08:06:50 +08:00
|
|
|
for ( int i = 1, row_offset_1 = 0 ; i < n ; i++ ) { // we do NOT update row_offset_1 here, see comment at the end of this outer loop
|
2010-05-28 07:16:00 +08:00
|
|
|
byte a_base = a[i-1]; // letter in a at the current pos
|
2010-11-30 08:06:50 +08:00
|
|
|
|
|
|
|
|
final int row_offset = row_offset_1 + m;
|
|
|
|
|
|
|
|
|
|
// On the entrance into the loop, row_offset_1 is the (linear) offset
|
|
|
|
|
// of the first element of row (i-1) and row_offset is the linear offset of the
|
|
|
|
|
// start of row i
|
|
|
|
|
|
|
|
|
|
for ( int j = 1, data_offset_1 = row_offset_1 ; j < m ; j++, data_offset_1++ ) {
|
|
|
|
|
|
|
|
|
|
// data_offset_1 is linearized offset of element [i-1][j-1]
|
|
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
final byte b_base = b[j-1]; // letter in b at the current pos
|
2010-11-30 08:06:50 +08:00
|
|
|
|
|
|
|
|
// in other words, step_diag = sw[i-1][j-1] + wd(a_base,b_base);
|
|
|
|
|
double step_diag = sw[data_offset_1] + wd(a_base,b_base);
|
2010-12-01 08:08:47 +08:00
|
|
|
|
|
|
|
|
// optimized "traversal" of all the matrix cells above the current one (i.e. traversing
|
|
|
|
|
// all 'step down' events that would end in the current cell. The optimized code
|
|
|
|
|
// does exactly the same thing as the commented out loop below. IMPORTANT:
|
|
|
|
|
// the optimization works ONLY for linear w(k)=wopen+(k-1)*wextend!!!!
|
|
|
|
|
|
|
|
|
|
// if a gap (length 1) was just opened above, this is the cost of arriving to the current cell:
|
|
|
|
|
double prev_gap = sw[data_offset_1+1]+w_open;
|
|
|
|
|
|
|
|
|
|
best_gap_v[j] += w_extend; // for the gaps that were already opened earlier, extending them by 1 costs w_extend
|
|
|
|
|
|
|
|
|
|
if ( prev_gap > best_gap_v[j] ) {
|
|
|
|
|
// opening a gap just before the current cell results in better score than extending by one
|
|
|
|
|
// the best previously opened gap. This will hold for ALL cells below: since any gap
|
|
|
|
|
// once opened always costs w_extend to extend by another base, we will always get a better score
|
|
|
|
|
// by arriving to any cell below from the gap we just opened (prev_gap) rather than from the previous best gap
|
|
|
|
|
best_gap_v[j] = prev_gap;
|
|
|
|
|
gap_size_v[j] = 1; // remember that the best step-down gap from above has length 1 (we just opened it)
|
|
|
|
|
} else {
|
|
|
|
|
// previous best gap is still the best, even after extension by another base, so we just record that extension:
|
|
|
|
|
gap_size_v[j]++;
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
final double step_down = best_gap_v[j] ;
|
|
|
|
|
final int kd = gap_size_v[j];
|
|
|
|
|
|
|
|
|
|
/*
|
2010-11-30 08:06:50 +08:00
|
|
|
for ( int k = 1, data_offset_k = data_offset_1+1 ; k < i ; k++, data_offset_k -= m ) {
|
|
|
|
|
// data_offset_k is linearized offset of element [i-k][j]
|
|
|
|
|
// in other words, trial = sw[i-k][j]+gap_penalty:
|
|
|
|
|
final double trial = sw[data_offset_k]+wk(k);
|
|
|
|
|
if ( step_down < trial ) {
|
|
|
|
|
step_down=trial;
|
2010-05-28 07:16:00 +08:00
|
|
|
kd = k;
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2010-12-01 08:08:47 +08:00
|
|
|
*/
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
// optimized "traversal" of all the matrix cells to the left of the current one (i.e. traversing
|
|
|
|
|
// all 'step right' events that would end in the current cell. The optimized code
|
|
|
|
|
// does exactly the same thing as the commented out loop below. IMPORTANT:
|
|
|
|
|
// the optimization works ONLY for linear w(k)=wopen+(k-1)*wextend!!!!
|
|
|
|
|
|
|
|
|
|
final int data_offset = row_offset + j; // linearized offset of element [i][j]
|
|
|
|
|
prev_gap = sw[data_offset-1]+w_open; // what would it cost us to open length 1 gap just to the left from current cell
|
|
|
|
|
best_gap_h[i] += w_extend; // previous best gap would cost us that much if extended by another base
|
|
|
|
|
|
|
|
|
|
if ( prev_gap > best_gap_h[i] ) {
|
|
|
|
|
// newly opened gap is better (score-wise) than any previous gap with the same row index i; since
|
|
|
|
|
// gap penalty is linear with k, this new gap location is going to remain better than any previous ones
|
|
|
|
|
best_gap_h[i] = prev_gap;
|
|
|
|
|
gap_size_h[i] = 1;
|
|
|
|
|
} else {
|
|
|
|
|
gap_size_h[i]++;
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
final double step_right = best_gap_h[i];
|
|
|
|
|
final int ki = gap_size_h[i];
|
|
|
|
|
|
|
|
|
|
/*
|
2010-11-30 08:06:50 +08:00
|
|
|
for ( int k = 1, data_offset = row_offset+j-1 ; k < j ; k++, data_offset-- ) {
|
|
|
|
|
// data_offset is linearized offset of element [i][j-k]
|
|
|
|
|
// in other words, step_right=sw[i][j-k]+gap_penalty;
|
|
|
|
|
final double trial = sw[data_offset]+wk(k);
|
|
|
|
|
if ( step_right < trial ) {
|
|
|
|
|
step_right=trial;
|
2010-05-28 07:16:00 +08:00
|
|
|
ki = k;
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
final int data_offset = row_offset + j; // linearized offset of element [i][j]
|
2010-12-01 08:08:47 +08:00
|
|
|
*/
|
|
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
if ( step_down > step_right ) {
|
|
|
|
|
if ( step_down > step_diag ) {
|
2011-02-17 08:02:32 +08:00
|
|
|
sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_down);
|
2010-12-01 08:08:47 +08:00
|
|
|
btrack[data_offset] = kd ; // positive=vertical
|
|
|
|
|
} else {
|
2011-02-17 08:02:32 +08:00
|
|
|
sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_diag);
|
2010-11-30 08:06:50 +08:00
|
|
|
btrack[data_offset] = 0; // 0 = diagonal
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
|
|
|
|
} else {
|
2010-12-01 08:08:47 +08:00
|
|
|
// step_down <= step_right
|
2010-05-28 07:16:00 +08:00
|
|
|
if ( step_right > step_diag ) {
|
2011-02-17 08:02:32 +08:00
|
|
|
sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_right);
|
2010-11-30 08:06:50 +08:00
|
|
|
btrack[data_offset] = -ki; // negative = horizontal
|
2009-03-25 13:48:10 +08:00
|
|
|
} else {
|
2011-02-17 08:02:32 +08:00
|
|
|
sw[data_offset] = Math.max(MATRIX_MIN_CUTOFF,step_diag);
|
2010-11-30 08:06:50 +08:00
|
|
|
btrack[data_offset] = 0; // 0 = diagonal
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
// sw[data_offset] = Math.max(0, Math.max(step_diag,Math.max(step_down,step_right)));
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2010-11-30 08:06:50 +08:00
|
|
|
|
|
|
|
|
// IMPORTANT, IMPORTANT, IMPORTANT:
|
|
|
|
|
// note that we update this (secondary) outer loop variable here,
|
|
|
|
|
// so that we DO NOT need to update it
|
|
|
|
|
// in the for() statement itself.
|
|
|
|
|
row_offset_1 = row_offset;
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2009-03-25 13:48:10 +08:00
|
|
|
// print(sw,a,b);
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
private void calculateCigar(int n, int m, double [] sw, int [] btrack) {
|
2010-05-28 07:16:00 +08:00
|
|
|
// p holds the position we start backtracking from; we will be assembling a cigar in the backwards order
|
|
|
|
|
//PrimitivePair.Int p = new PrimitivePair.Int();
|
|
|
|
|
int p1 = 0, p2 = 0;
|
2009-03-26 10:26:17 +08:00
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
double maxscore = 0.0;
|
|
|
|
|
int segment_length = 0; // length of the segment (continuous matches, insertions or deletions)
|
|
|
|
|
|
|
|
|
|
// look for largest score. we use >= combined with the traversal direction
|
|
|
|
|
// to ensure that if two scores are equal, the one closer to diagonal gets picked
|
2010-11-30 08:06:50 +08:00
|
|
|
for ( int i = 1, data_offset = m+1+m ; i < n+1 ; i++, data_offset += (m+1) ) {
|
|
|
|
|
// data_offset is the offset of [i][m]
|
|
|
|
|
if ( sw[data_offset] >= maxscore ) {
|
|
|
|
|
p1 = i; p2 = m ; maxscore = sw[data_offset];
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
for ( int j = 1, data_offset = n*(m+1)+1 ; j < m+1 ; j++, data_offset++ ) {
|
|
|
|
|
// data_offset is the offset of [n][j]
|
|
|
|
|
if ( sw[data_offset] > maxscore || sw[data_offset] == maxscore && Math.abs(n-j) < Math.abs(p1 - p2)) {
|
2010-05-28 07:16:00 +08:00
|
|
|
p1 = n;
|
|
|
|
|
p2 = j ;
|
2010-11-30 08:06:50 +08:00
|
|
|
// maxscore = sw[n][j];
|
|
|
|
|
maxscore = sw[data_offset];
|
2010-05-28 07:16:00 +08:00
|
|
|
segment_length = m - j ; // end of sequence 2 is overhanging; we will just record it as 'M' segment
|
|
|
|
|
}
|
|
|
|
|
}
|
2011-04-01 08:11:04 +08:00
|
|
|
// System.out.println(" Found max score="+maxscore+" at p1="+p1+ " p2="+p2);
|
2009-03-25 13:48:10 +08:00
|
|
|
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
// we will be placing all insertions and deletions into sequence b, so the states are named w/regard
|
2010-05-28 07:16:00 +08:00
|
|
|
// to that sequence
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
int state = MSTATE;
|
|
|
|
|
List<CigarElement> lce = new ArrayList<CigarElement>(5);
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-11-30 08:06:50 +08:00
|
|
|
int data_offset = p1*(m+1)+p2; // offset of element [p1][p2]
|
2011-02-17 08:02:32 +08:00
|
|
|
// System.out.println("Backtracking: starts at "+p1+":"+p2+" ("+sw[data_offset]+")");
|
2010-05-28 07:16:00 +08:00
|
|
|
do {
|
2010-11-30 08:06:50 +08:00
|
|
|
// int btr = btrack[p1][p2];
|
|
|
|
|
int btr = btrack[data_offset];
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
int new_state;
|
|
|
|
|
int step_length = 1;
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2011-04-01 08:11:04 +08:00
|
|
|
// System.out.print(" backtrack value: "+btr);
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
if ( btr > 0 ) {
|
|
|
|
|
new_state = DSTATE;
|
|
|
|
|
step_length = btr;
|
|
|
|
|
} else if ( btr < 0 ) {
|
|
|
|
|
new_state = ISTATE;
|
|
|
|
|
step_length = (-btr);
|
|
|
|
|
} else new_state = MSTATE; // and step_length =1, already set above
|
|
|
|
|
|
|
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
// move to next best location in the sw matrix:
|
|
|
|
|
switch( new_state ) {
|
2011-04-01 08:11:04 +08:00
|
|
|
case MSTATE: data_offset -= (m+2); p1--; p2--; break; // move back along the diag in th esw matrix
|
|
|
|
|
case ISTATE: data_offset -= step_length; p2 -= step_length; break; // move left
|
|
|
|
|
case DSTATE: data_offset -= (m+1)*step_length; p1 -= step_length; break; // move up
|
2010-05-28 07:16:00 +08:00
|
|
|
}
|
2011-04-01 08:11:04 +08:00
|
|
|
// System.out.println("; backtracked to p1="+p1+" p2="+p2);
|
2011-02-17 08:02:32 +08:00
|
|
|
/*
|
|
|
|
|
switch( new_state ) {
|
|
|
|
|
case MSTATE: System.out.println(" diag (match) to "+ sw[data_offset]); break; // equivalent to p1--; p2--
|
|
|
|
|
case ISTATE: System.out.println(" left (insertion, "+step_length+") to "+ sw[data_offset]); break; // equivalent to p2-=step_length;
|
|
|
|
|
case DSTATE: System.out.println(" up (deletion, "+step_length+") to "+ sw[data_offset]); break; // equivalent to p1 -= step_up
|
|
|
|
|
}
|
|
|
|
|
*/
|
2010-05-28 07:16:00 +08:00
|
|
|
// now let's see if the state actually changed:
|
|
|
|
|
if ( new_state == state ) segment_length+=step_length;
|
|
|
|
|
else {
|
2011-04-01 08:11:04 +08:00
|
|
|
// System.out.println(" emitting "+segment_length+makeElement(state,segment_length).getOperator().toString());
|
2010-05-28 07:16:00 +08:00
|
|
|
// state changed, lets emit previous segment, whatever it was (Insertion Deletion, or (Mis)Match).
|
|
|
|
|
lce.add(makeElement(state, segment_length));
|
|
|
|
|
segment_length = step_length;
|
|
|
|
|
state = new_state;
|
|
|
|
|
}
|
2010-11-30 08:06:50 +08:00
|
|
|
// next condition is equivalent to while ( sw[p1][p2] != 0 ) (with modified p1 and/or p2:
|
2011-02-17 08:02:32 +08:00
|
|
|
} while ( p1 > 0 && p2 > 0 );
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2011-04-01 08:11:04 +08:00
|
|
|
// post-process the last segment we are still keeping;
|
|
|
|
|
// NOTE: if reads "overhangs" the ref on the left (i.e. if p2>0) we are counting
|
|
|
|
|
// those extra bases sticking out of the ref into the first cigar element. For instance,
|
|
|
|
|
// if read length is 5 and alignment starts at offset -2 (i.e. read starts before the ref, and only
|
|
|
|
|
// last 3 bases of the read overlap with/align to the ref), the cigar will be still 5M (and not, e.g.
|
|
|
|
|
// 2I3M). The consumers need to check for the alignment offset and deal with it properly.
|
2010-05-28 07:16:00 +08:00
|
|
|
lce.add(makeElement(state, segment_length + p2));
|
2011-04-01 08:11:04 +08:00
|
|
|
alignment_offset = p1 - p2;
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
Collections.reverse(lce);
|
|
|
|
|
alignmentCigar = new Cigar(lce);
|
|
|
|
|
}
|
2009-03-25 13:48:10 +08:00
|
|
|
|
2010-05-28 07:16:00 +08:00
|
|
|
private CigarElement makeElement(int state, int segment_length) {
|
|
|
|
|
CigarOperator o = null;
|
|
|
|
|
switch(state) {
|
|
|
|
|
case MSTATE: o = CigarOperator.M; break;
|
|
|
|
|
case ISTATE: o = CigarOperator.I; break;
|
|
|
|
|
case DSTATE: o = CigarOperator.D; break;
|
|
|
|
|
}
|
|
|
|
|
return new CigarElement(segment_length,o);
|
2009-03-25 13:48:10 +08:00
|
|
|
}
|
2009-03-24 13:36:37 +08:00
|
|
|
|
2010-01-28 05:36:42 +08:00
|
|
|
private double wd(byte x, byte y) {
|
2010-02-18 04:52:57 +08:00
|
|
|
return (x == y ? w_match : w_mismatch);
|
2009-03-24 13:36:37 +08:00
|
|
|
}
|
|
|
|
|
|
2010-01-28 05:36:42 +08:00
|
|
|
private double wk(int k) {
|
2009-03-25 13:48:10 +08:00
|
|
|
return w_open+(k-1)*w_extend; // gap
|
2009-03-24 13:36:37 +08:00
|
|
|
}
|
|
|
|
|
|
|
|
|
|
private void print(int[][] s) {
|
|
|
|
|
for ( int i = 0 ; i < s.length ; i++) {
|
|
|
|
|
for ( int j = 0; j < s[i].length ; j++ ) {
|
|
|
|
|
System.out.printf(" %4d",s[i][j]);
|
|
|
|
|
}
|
|
|
|
|
System.out.println();
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
private void print(double[][] s) {
|
|
|
|
|
for ( int i = 0 ; i < s.length ; i++) {
|
|
|
|
|
for ( int j = 0; j < s[i].length ; j++ ) {
|
|
|
|
|
System.out.printf(" %4g",s[i][j]);
|
|
|
|
|
}
|
|
|
|
|
System.out.println();
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
private void print(int[][] s, String a, String b) {
|
|
|
|
|
|
|
|
|
|
System.out.print(" ");
|
|
|
|
|
for ( int j = 1 ; j < s[0].length ; j++) System.out.printf(" %4c",b.charAt(j-1)) ;
|
|
|
|
|
System.out.println();
|
|
|
|
|
|
|
|
|
|
for ( int i = 0 ; i < s.length ; i++) {
|
|
|
|
|
if ( i > 0 ) System.out.print(a.charAt(i-1));
|
|
|
|
|
else System.out.print(' ');
|
|
|
|
|
System.out.print(" ");
|
|
|
|
|
for ( int j = 0; j < s[i].length ; j++ ) {
|
|
|
|
|
System.out.printf(" %4d",s[i][j]);
|
|
|
|
|
}
|
|
|
|
|
System.out.println();
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
private void print(double[][] s, String a, String b) {
|
|
|
|
|
|
2009-06-05 23:36:10 +08:00
|
|
|
System.out.print("");
|
|
|
|
|
for ( int j = 1 ; j < s[0].length ; j++) System.out.printf(" %4c",b.charAt(j-1)) ;
|
2009-03-24 13:36:37 +08:00
|
|
|
System.out.println();
|
|
|
|
|
|
|
|
|
|
for ( int i = 0 ; i < s.length ; i++) {
|
|
|
|
|
if ( i > 0 ) System.out.print(a.charAt(i-1));
|
|
|
|
|
else System.out.print(' ');
|
|
|
|
|
System.out.print(" ");
|
|
|
|
|
for ( int j = 0; j < s[i].length ; j++ ) {
|
2009-06-05 23:36:10 +08:00
|
|
|
System.out.printf(" %2.1f",s[i][j]);
|
2009-03-24 13:36:37 +08:00
|
|
|
}
|
|
|
|
|
System.out.println();
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
private void print(double[] s, byte[] a, byte[] b) {
|
|
|
|
|
int n = a.length+1;
|
|
|
|
|
int m = b.length+1;
|
|
|
|
|
System.out.print(" ");
|
|
|
|
|
for ( int j = 1 ; j < m ; j++) System.out.printf(" %5c",(char)b[j-1]) ;
|
|
|
|
|
System.out.println();
|
|
|
|
|
|
|
|
|
|
for ( int i = 0, row_offset = 0 ; i < n ; i++, row_offset+=m) {
|
|
|
|
|
if ( i > 0 ) System.out.print((char)a[i-1]);
|
|
|
|
|
else System.out.print(' ');
|
|
|
|
|
System.out.print(" ");
|
|
|
|
|
for ( int j = 0; j < m ; j++ ) {
|
|
|
|
|
System.out.printf(" %5.1f",s[row_offset+j]);
|
|
|
|
|
}
|
|
|
|
|
System.out.println();
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
static void printAlignment(SWPairwiseAlignment a, byte[] ref, byte[] read) {
|
2011-05-09 21:51:00 +08:00
|
|
|
printAlignment(a,ref,read,100);
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
static void printAlignment(SWPairwiseAlignment a, byte[] ref, byte[] read, int width) {
|
2011-02-17 08:02:32 +08:00
|
|
|
StringBuilder bread = new StringBuilder();
|
|
|
|
|
StringBuilder bref = new StringBuilder();
|
|
|
|
|
StringBuilder match = new StringBuilder();
|
|
|
|
|
|
|
|
|
|
int i = 0;
|
|
|
|
|
int j = 0;
|
|
|
|
|
|
|
|
|
|
final int offset = a.getAlignmentStart2wrt1();
|
2011-04-01 08:11:04 +08:00
|
|
|
|
|
|
|
|
Cigar cigar = a.getCigar();
|
|
|
|
|
|
2011-05-09 21:51:00 +08:00
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
if ( offset < 0 ) {
|
|
|
|
|
for ( ; j < (-offset) ; j++ ) {
|
|
|
|
|
bread.append((char)read[j]);
|
|
|
|
|
bref.append(' ');
|
|
|
|
|
match.append(' ');
|
|
|
|
|
}
|
2011-04-01 08:11:04 +08:00
|
|
|
// at negative offsets, our cigar's first element carries overhanging bases
|
|
|
|
|
// that we have just printed above. Tweak the first element to
|
|
|
|
|
// exclude those bases. Here we create a new list of cigar elements, so the original
|
|
|
|
|
// list/original cigar are unchanged (they are unmodifiable anyway!)
|
|
|
|
|
|
|
|
|
|
List<CigarElement> tweaked = new ArrayList<CigarElement>();
|
|
|
|
|
tweaked.addAll(cigar.getCigarElements());
|
|
|
|
|
tweaked.set(0,new CigarElement(cigar.getCigarElement(0).getLength()+offset,
|
|
|
|
|
cigar.getCigarElement(0).getOperator()));
|
|
|
|
|
cigar = new Cigar(tweaked);
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
} else {
|
|
|
|
|
for ( ; i < a.getAlignmentStart2wrt1() ; i++ ) {
|
|
|
|
|
bref.append((char)ref[i]);
|
|
|
|
|
bread.append(' ');
|
|
|
|
|
match.append(' ');
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
2011-04-01 08:11:04 +08:00
|
|
|
for ( CigarElement e : cigar.getCigarElements() ) {
|
2011-02-17 08:02:32 +08:00
|
|
|
switch (e.getOperator()) {
|
|
|
|
|
case M :
|
2011-04-01 08:11:04 +08:00
|
|
|
for ( int z = 0 ; z < e.getLength() ; z++, i++, j++ ) {
|
|
|
|
|
bref.append((i<ref.length)?(char)ref[i]:' ');
|
|
|
|
|
bread.append((j < read.length)?(char)read[j]:' ');
|
|
|
|
|
match.append( ( i<ref.length && j < read.length ) ? (ref[i] == read[j] ? '.':'*' ) : ' ' );
|
2011-02-17 08:02:32 +08:00
|
|
|
}
|
|
|
|
|
break;
|
|
|
|
|
case I :
|
|
|
|
|
for ( int z = 0 ; z < e.getLength(); z++, j++ ) {
|
|
|
|
|
bref.append('-');
|
|
|
|
|
bread.append((char)read[j]);
|
|
|
|
|
match.append('I');
|
|
|
|
|
}
|
|
|
|
|
break;
|
|
|
|
|
case D:
|
|
|
|
|
for ( int z = 0 ; z < e.getLength(); z++ , i++ ) {
|
|
|
|
|
bref.append((char)ref[i]);
|
|
|
|
|
bread.append('-');
|
|
|
|
|
match.append('D');
|
|
|
|
|
}
|
|
|
|
|
break;
|
|
|
|
|
default:
|
|
|
|
|
throw new StingException("Unexpected Cigar element:" + e.getOperator());
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
for ( ; i < ref.length; i++ ) bref.append((char)ref[i]);
|
|
|
|
|
for ( ; j < read.length; j++ ) bread.append((char)read[j]);
|
|
|
|
|
|
2011-05-09 21:51:00 +08:00
|
|
|
int pos = 0 ;
|
|
|
|
|
int maxlength = Math.max(match.length(),Math.max(bread.length(),bref.length()));
|
|
|
|
|
while ( pos < maxlength ) {
|
|
|
|
|
print_cautiously(match,pos,width);
|
|
|
|
|
print_cautiously(bread,pos,width);
|
|
|
|
|
print_cautiously(bref,pos,width);
|
|
|
|
|
System.out.println();
|
|
|
|
|
pos += width;
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
/** String builder's substring is extremely stupid: instead of trimming and/or returning an empty
|
|
|
|
|
* string when one end/both ends of the interval are out of range, it crashes with an
|
|
|
|
|
* exception. This utility function simply prints the substring if the interval is within the index range
|
|
|
|
|
* or trims accordingly if it is not.
|
|
|
|
|
* @param s
|
|
|
|
|
* @param start
|
|
|
|
|
* @param width
|
|
|
|
|
*/
|
|
|
|
|
private static void print_cautiously(StringBuilder s, int start, int width) {
|
|
|
|
|
if ( start >= s.length() ) {
|
|
|
|
|
System.out.println();
|
|
|
|
|
return;
|
|
|
|
|
}
|
|
|
|
|
int end = Math.min(start+width,s.length());
|
|
|
|
|
System.out.println(s.substring(start,end));
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
}
|
|
|
|
|
|
|
|
|
|
// BELOW: main() method for testing; old implementations of the core methods are commented out below;
|
|
|
|
|
// uncomment everything through the end of the file if benchmarking of new vs old implementations is needed.
|
2010-12-01 08:08:47 +08:00
|
|
|
|
|
|
|
|
public static void main(String argv[]) {
|
2011-02-17 08:02:32 +08:00
|
|
|
// String ref="CACGAGCATATGTGTACATGAATTTGTATTGCACATGTGTTTAATGCGAACACGTGTCATGTGTATGTGTTCACATGCATGTGTGTCT";
|
|
|
|
|
// String read = "GCATATGTTTACATGAATTTGTATTGCACATGTGTTTAATGCGAACACGTGTCATGTGTGTGTTCACATGCATGTG";
|
|
|
|
|
|
|
|
|
|
String ref = null;
|
|
|
|
|
String read = null;
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
Map<String,List<String>> args = processArgs(argv);
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
List<String> l = args.get("SEQ");
|
|
|
|
|
args.remove("SEQ");
|
|
|
|
|
if ( l == null ) {
|
|
|
|
|
System.err.println("SEQ argument is missing. Two input sequences must be provided");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
if ( l.size() != 2 ) {
|
|
|
|
|
System.err.println("Two input sequences (SEQ arguments) must be provided. Found "+l.size()+" instead");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
ref = l.get(0);
|
|
|
|
|
read = l.get(1);
|
|
|
|
|
|
|
|
|
|
Double m = extractSingleDoubleArg("MATCH",args);
|
|
|
|
|
Double mm = extractSingleDoubleArg("MISMATCH",args);
|
|
|
|
|
Double open = extractSingleDoubleArg("OPEN",args);
|
|
|
|
|
Double ext = extractSingleDoubleArg("EXTEND",args);
|
|
|
|
|
|
|
|
|
|
Boolean reverse = extractSingleBooleanArg("REVERSE",args);
|
|
|
|
|
if ( reverse != null && reverse.booleanValue() == true ) {
|
|
|
|
|
ref = Utils.reverse(ref);
|
|
|
|
|
read = Utils.reverse(read);
|
2010-12-01 08:08:47 +08:00
|
|
|
}
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
Boolean print_mat = extractSingleBooleanArg("PRINT_MATRIX",args);
|
|
|
|
|
Boolean cut = extractSingleBooleanArg("CUTOFF",args);
|
|
|
|
|
if ( cut != null ) SWPairwiseAlignment.cutoff = cut;
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
if ( args.size() != 0 ) {
|
|
|
|
|
System.err.println("Unknown argument on the command line: "+args.keySet().iterator().next());
|
|
|
|
|
System.exit(1);
|
2010-12-01 08:08:47 +08:00
|
|
|
}
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
double w_match;
|
|
|
|
|
double w_mismatch;
|
|
|
|
|
double w_open;
|
|
|
|
|
double w_extend;
|
|
|
|
|
|
|
|
|
|
w_match = (m == null ? 30.0 : m.doubleValue());
|
|
|
|
|
w_mismatch = (mm == null ? -10.0 : mm.doubleValue());
|
|
|
|
|
w_open = (open == null ? -10.0 : open.doubleValue());
|
|
|
|
|
w_extend = (ext == null ? -2.0 : ext.doubleValue());
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
SWPairwiseAlignment a = new SWPairwiseAlignment(ref.getBytes(),read.getBytes(),w_match,w_mismatch,w_open,w_extend);
|
2010-12-01 08:08:47 +08:00
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
System.out.println("start="+a.getAlignmentStart2wrt1()+", cigar="+a.getCigar()+
|
|
|
|
|
" length1="+ref.length()+" length2="+read.length());
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
System.out.println();
|
|
|
|
|
printAlignment(a,ref.getBytes(),read.getBytes());
|
|
|
|
|
|
|
|
|
|
System.out.println();
|
|
|
|
|
if ( print_mat != null && print_mat == true ) {
|
|
|
|
|
a.print(a.SW,ref.getBytes(),read.getBytes());
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
static Pair<String,Integer> getArg(String prefix, String argv[], int i) {
|
|
|
|
|
String arg = null;
|
|
|
|
|
if ( argv[i].startsWith(prefix) ) {
|
|
|
|
|
arg = argv[i].substring(prefix.length());
|
|
|
|
|
if( arg.length() == 0 ) {
|
|
|
|
|
i++;
|
|
|
|
|
if ( i < argv.length ) arg = argv[i];
|
|
|
|
|
else {
|
|
|
|
|
System.err.println("No value found after " + prefix + " argument tag");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
i++;
|
|
|
|
|
}
|
|
|
|
|
return new Pair<String,Integer>(arg,i);
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
static Map<String,List<String>> processArgs(String argv[]) {
|
|
|
|
|
Map<String,List<String>> args = new HashMap<String,List<String>>();
|
|
|
|
|
|
|
|
|
|
for ( int i = 0; i < argv.length ; i++ ) {
|
|
|
|
|
String arg = argv[i];
|
|
|
|
|
int pos = arg.indexOf('=');
|
|
|
|
|
if ( pos < 0 ) {
|
|
|
|
|
System.err.println("Argument "+arg+" is not of the form <ARG>=<VAL>");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
String val = arg.substring(pos+1);
|
|
|
|
|
if ( val.length() == 0 ) {
|
|
|
|
|
// there was a space between '=' and the value
|
|
|
|
|
i++;
|
|
|
|
|
if ( i < argv.length ) val = argv[i];
|
|
|
|
|
else {
|
|
|
|
|
System.err.println("No value found after " + arg + " argument tag");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
arg = arg.substring(0,pos);
|
|
|
|
|
|
|
|
|
|
List<String> l = args.get(arg);
|
|
|
|
|
if ( l == null ) {
|
|
|
|
|
l = new ArrayList<String>();
|
|
|
|
|
args.put(arg,l);
|
|
|
|
|
}
|
|
|
|
|
l.add(val);
|
|
|
|
|
}
|
|
|
|
|
return args;
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
static Double extractSingleDoubleArg(String argname, Map<String,List<String>> args) {
|
|
|
|
|
List<String> l = args.get(argname);
|
|
|
|
|
args.remove(argname);
|
|
|
|
|
if ( l == null ) return null;
|
|
|
|
|
|
|
|
|
|
if ( l.size() > 1 ) {
|
|
|
|
|
System.err.println("Only one "+argname+" argument is allowed");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
double d=0;
|
|
|
|
|
try {
|
|
|
|
|
d = Double.parseDouble(l.get(0));
|
|
|
|
|
} catch ( NumberFormatException e) {
|
|
|
|
|
System.err.println("Can not parse value provided for "+argname+" argument ("+l.get(0)+")");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
System.out.println("Argument "+argname+" set to "+d);
|
|
|
|
|
return new Double(d);
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
static Boolean extractSingleBooleanArg(String argname, Map<String,List<String>> args) {
|
|
|
|
|
List<String> l = args.get(argname);
|
|
|
|
|
args.remove(argname);
|
|
|
|
|
if ( l == null ) return null;
|
|
|
|
|
|
|
|
|
|
if ( l.size() > 1 ) {
|
|
|
|
|
System.err.println("Only one "+argname+" argument is allowed");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
}
|
|
|
|
|
if ( l.get(0).equals("true") ) return new Boolean(true);
|
|
|
|
|
if ( l.get(0).equals("false") ) return new Boolean(false);
|
|
|
|
|
System.err.println("Can not parse value provided for "+argname+" argument ("+l.get(0)+"); true/false are allowed");
|
|
|
|
|
System.exit(1);
|
|
|
|
|
return null;
|
2010-12-01 08:08:47 +08:00
|
|
|
}
|
|
|
|
|
|
2011-02-17 08:02:32 +08:00
|
|
|
/* ##############################################
|
2010-12-01 08:08:47 +08:00
|
|
|
public SWPairwiseAlignment(byte[] seq1, byte[] seq2, double match, double mismatch, double open, double extend, boolean runOld ) {
|
|
|
|
|
w_match = match;
|
|
|
|
|
w_mismatch = mismatch;
|
|
|
|
|
w_open = open;
|
|
|
|
|
w_extend = extend;
|
|
|
|
|
if ( runOld ) align_old(seq1,seq2);
|
|
|
|
|
else align(seq1,seq2);
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
public SWPairwiseAlignment(byte[] seq1, byte[] seq2, boolean runOld) {
|
|
|
|
|
this(seq1,seq2,1.0,-1.0/3.0,-1.0-1.0/3.0,-1.0/3.0,runOld); // match=1, mismatch = -1/3, gap=-(1+k/3)
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
public void align_old(final byte[] a, final byte[] b) {
|
|
|
|
|
final int n = a.length;
|
|
|
|
|
final int m = b.length;
|
|
|
|
|
double [] sw = new double[(n+1)*(m+1)];
|
|
|
|
|
int [] btrack = new int[(n+1)*(m+1)];
|
|
|
|
|
calculateMatrix_old(a, b, sw, btrack);
|
|
|
|
|
calculateCigar(n, m, sw, btrack); // length of the segment (continuous matches, insertions or deletions)
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
private void calculateMatrix_old(final byte[] a, final byte[] b, double [] sw, int [] btrack ) {
|
|
|
|
|
final int n = a.length+1;
|
|
|
|
|
final int m = b.length+1;
|
|
|
|
|
|
|
|
|
|
// build smith-waterman matrix and keep backtrack info:
|
|
|
|
|
for ( int i = 1, row_offset_1 = 0 ; i < n ; i++ ) { // we do NOT update row_offset_1 here, see comment at the end of this outer loop
|
|
|
|
|
byte a_base = a[i-1]; // letter in a at the current pos
|
|
|
|
|
|
|
|
|
|
final int row_offset = row_offset_1 + m;
|
|
|
|
|
|
|
|
|
|
// On the entrance into the loop, row_offset_1 is the (linear) offset
|
|
|
|
|
// of the first element of row (i-1) and row_offset is the linear offset of the
|
|
|
|
|
// start of row i
|
|
|
|
|
|
|
|
|
|
for ( int j = 1, data_offset_1 = row_offset_1 ; j < m ; j++, data_offset_1++ ) {
|
|
|
|
|
|
|
|
|
|
// data_offset_1 is linearized offset of element [i-1][j-1]
|
|
|
|
|
|
|
|
|
|
final byte b_base = b[j-1]; // letter in b at the current pos
|
|
|
|
|
|
|
|
|
|
// in other words, step_diag = sw[i-1][j-1] + wd(a_base,b_base);
|
|
|
|
|
double step_diag = sw[data_offset_1] + wd(a_base,b_base);
|
|
|
|
|
int kd = 0;
|
|
|
|
|
|
|
|
|
|
double step_down = 0;
|
|
|
|
|
|
|
|
|
|
for ( int k = 1, data_offset_k = data_offset_1+1 ; k < i ; k++, data_offset_k -= m ) {
|
|
|
|
|
// data_offset_k is linearized offset of element [i-k][j]
|
|
|
|
|
// in other words, trial = sw[i-k][j]+gap_penalty:
|
|
|
|
|
final double trial = sw[data_offset_k]+wk(k);
|
|
|
|
|
if ( step_down < trial ) {
|
|
|
|
|
step_down=trial;
|
|
|
|
|
kd = k;
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
int ki = 0;
|
|
|
|
|
|
|
|
|
|
// optimized "traversal" of all the matrix cells to the left of the current one (i.e. traversing
|
|
|
|
|
// all 'step right' events that would end in the current cell. The optimized code
|
|
|
|
|
// does exactly the same thing as the commented out loop below. IMPORTANT:
|
|
|
|
|
// the optimization works ONLY for linear w(k)=wopen+(k-1)*wextend!!!!
|
|
|
|
|
|
|
|
|
|
double step_right = 0;
|
|
|
|
|
|
|
|
|
|
for ( int k = 1, data_offset = row_offset+j-1 ; k < j ; k++, data_offset-- ) {
|
|
|
|
|
// data_offset is linearized offset of element [i][j-k]
|
|
|
|
|
// in other words, step_right=sw[i][j-k]+gap_penalty;
|
|
|
|
|
final double trial = sw[data_offset]+wk(k);
|
|
|
|
|
if ( step_right < trial ) {
|
|
|
|
|
step_right=trial;
|
|
|
|
|
ki = k;
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
final int data_offset = row_offset + j; // linearized offset of element [i][j]
|
|
|
|
|
|
|
|
|
|
if ( step_down > step_right ) {
|
|
|
|
|
if ( step_down > step_diag ) {
|
|
|
|
|
sw[data_offset] = Math.max(0,step_down);
|
|
|
|
|
btrack[data_offset] = kd ; // positive=vertical
|
|
|
|
|
} else {
|
|
|
|
|
sw[data_offset] = Math.max(0,step_diag);
|
|
|
|
|
btrack[data_offset] = 0; // 0 = diagonal
|
|
|
|
|
}
|
|
|
|
|
} else {
|
|
|
|
|
// step_down <= step_right
|
|
|
|
|
if ( step_right > step_diag ) {
|
|
|
|
|
sw[data_offset] = Math.max(0,step_right);
|
|
|
|
|
btrack[data_offset] = -ki; // negative = horizontal
|
|
|
|
|
} else {
|
|
|
|
|
sw[data_offset] = Math.max(0,step_diag);
|
|
|
|
|
btrack[data_offset] = 0; // 0 = diagonal
|
|
|
|
|
}
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
// sw[data_offset] = Math.max(0, Math.max(step_diag,Math.max(step_down,step_right)));
|
|
|
|
|
}
|
|
|
|
|
|
|
|
|
|
// IMPORTANT, IMPORTANT, IMPORTANT:
|
|
|
|
|
// note that we update this (secondary) outer loop variable here,
|
|
|
|
|
// so that we DO NOT need to update it
|
|
|
|
|
// in the for() statement itself.
|
|
|
|
|
row_offset_1 = row_offset;
|
|
|
|
|
}
|
|
|
|
|
// print(sw,a,b);
|
|
|
|
|
}
|
|
|
|
|
#####################
|
|
|
|
|
END COMMENTED OUT SECTION
|
|
|
|
|
*/
|
|
|
|
|
|
2009-03-24 13:36:37 +08:00
|
|
|
}
|