基于bwa,做一些优化,注释
 
 
 
 
 
 
Go to file
Heng Li 88f89be60e r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG

This read has 5 chains, two of which are:

weight=80  26;26;0,4591439948(10:-3095894)  23;23;27,4591439957(10:-3095888)  31;31;70,4591439964(10:-3095873)
weight=50  45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801)  31;31;70,4591440090(10:-3095747)

Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-04-30 14:14:20 -04:00
.gitignore Added Makefile.bak and bwamem-lite to .gitignore 2013-03-13 09:18:18 +00:00
COPYING Imported from my local bwa repository, the master repository. 2011-01-13 20:52:12 -05:00
ChangeLog Update to the latest modfication 0.5.9rc1-2. Update ChangeLog 2011-01-13 20:54:10 -05:00
Makefile r731: separate layouter 2014-04-28 10:39:29 -04:00
NEWS r455: release bwa-0.7.8 2014-03-31 15:27:23 -04:00
QSufSort.c removed a few unused variables 2013-02-23 13:26:50 -05:00
QSufSort.h move bwt_gen/* to the root directory 2011-10-20 11:56:24 -04:00
README.md r439: expose mem_opt_t::max_matesw 2014-02-19 13:10:33 -05:00
bamlite.c Removed more dependencies on utils.h 2013-05-03 11:38:48 +01:00
bamlite.h Removed more dependencies on utils.h 2013-05-03 11:38:48 +01:00
bntseq.c r713: a bug in retrieving ref seq on rev 2014-04-14 09:55:55 -04:00
bntseq.h dev-472: get rid of bwa_fix_xref() 2014-04-10 20:54:27 -04:00
bwa.1 r455: release bwa-0.7.8 2014-03-31 15:27:23 -04:00
bwa.c r723: merge adjacent hits 2014-04-16 16:38:50 -04:00
bwa.h dev-472: get rid of bwa_fix_xref() 2014-04-10 20:54:27 -04:00
bwamem.c r736: improved in low-complexity regions 2014-04-30 14:14:20 -04:00
bwamem.h r736: improved in low-complexity regions 2014-04-30 14:14:20 -04:00
bwamem_extra.c r723: merge adjacent hits 2014-04-16 16:38:50 -04:00
bwamem_pair.c Merge branch '0.7.7-softclip' into layout 2014-04-24 12:24:49 -04:00
bwape.c fix duplicate PG lines in bwape and bwase 2014-01-05 14:54:48 -05:00
bwase.c fix duplicate PG lines in bwape and bwase 2014-01-05 14:54:48 -05:00
bwase.h removed color-space support 2013-02-12 10:21:17 -05:00
bwaseqio.c Removed more dependencies on utils.h 2013-05-03 11:38:48 +01:00
bwt.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
bwt.h Fixed clang compiling warnings 2014-03-16 15:18:22 -04:00
bwt_gen.c Removed more dependencies on utils.h 2013-05-03 11:38:48 +01:00
bwt_lite.c Fixed clang compiling warnings 2014-03-16 15:18:22 -04:00
bwt_lite.h Fixed clang compiling warnings 2014-03-16 15:18:22 -04:00
bwtaln.c r397: multi changes/bugfixes to bwa-backtrack 2013-05-24 16:28:18 -04:00
bwtaln.h r397: multi changes/bugfixes to bwa-backtrack 2013-05-24 16:28:18 -04:00
bwtgap.c r397: multi changes/bugfixes to bwa-backtrack 2013-05-24 16:28:18 -04:00
bwtgap.h r397: multi changes/bugfixes to bwa-backtrack 2013-05-24 16:28:18 -04:00
bwtindex.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
bwtsw2.h r132: optionally copy FASTA/Q comment to SAM 2012-10-26 12:54:32 -04:00
bwtsw2_aux.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
bwtsw2_chain.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
bwtsw2_core.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
bwtsw2_main.c Ensure exit status of 1 if given invalid options or index files are not found. 2013-04-29 13:58:28 +01:00
bwtsw2_pair.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
example.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
fastmap.c r735: fixed a bug caused by merge 2014-04-30 13:12:43 -04:00
is.c Removed more dependencies on utils.h 2013-05-03 11:38:48 +01:00
kbtree.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
khash.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
kopen.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
kseq.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
ksort.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
kstring.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
kstring.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
ksw.c r727: extend seeds with SW 2014-04-24 14:28:40 -04:00
ksw.h dev-448: different ins/del penalties 2014-03-28 10:54:23 -04:00
kthread.c use kthread for multi-threading 2013-11-02 12:13:11 -04:00
kvec.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
main.c r736: improved in low-complexity regions 2014-04-30 14:14:20 -04:00
malloc_wrap.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
malloc_wrap.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
pemerge.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
qualfa2fq.pl Imported from my local bwa repository, the master repository. 2011-01-13 20:52:12 -05:00
utils.c Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
utils.h Reduce dependency on utils.h - new malloc wrapping scheme. 2013-05-02 15:12:01 +01:00
xa2multi.pl Bugfix: reverse (complement) sequence and phred string if alternative alignment has different orientation than primary alignment 2011-09-07 14:31:28 +02:00

README.md

###Getting started

git clone https://github.com/lh3/bwa.git
cd bwa; make
./bwa index ref.fa
./bwa mem ref.fa read-se.fq.gz | gzip -3 > aln-se.sam.gz
./bwa mem ref.fa read1.fq read2.fq | gzip -3 > aln-pe.sam.gz

###Introduction

BWA is a software package for mapping low-divergent sequences against a large reference genome, such as the human genome. It consists of three algorithms: BWA-backtrack, BWA-SW and BWA-MEM. The first algorithm is designed for Illumina sequence reads up to 100bp, while the rest two for longer sequences ranged from 70bp to 1Mbp. BWA-MEM and BWA-SW share similar features such as the support of long reads and chimeric alignment, but BWA-MEM, which is the latest, is generally recommended for high-quality queries as it is faster and more accurate. BWA-MEM also has better performance than BWA-backtrack for 70-100bp Illumina reads.

For all the algorithms, BWA first needs to construct the FM-index for the reference genome (the index command). Alignment algorithms are invoked with different sub-commands: aln/samse/sampe for BWA-backtrack, bwasw for BWA-SW and mem for the BWA-MEM algorithm.

###Availability

BWA is released under GPLv3. The latest souce code is freely available at github. Released packages can be downloaded at SourceForge. After you acquire the source code, simply use make to compile and copy the single executable bwa to the destination you want. The only dependency of BWA is zlib.

###Seeking helps

The detailed usage is described in the man page available together with the source code. You can use man ./bwa.1 to view the man page in a terminal. The HTML version of the man page can be found at the BWA website. If you have questions about BWA, you may sign up the mailing list and then send the questions to bio-bwa-help@sourceforge.net. You may also ask questions in forums such as BioStar and SEQanswers.

###Citing BWA

  • Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25, 1754-1760. [PMID: 19451168]. (if you use the BWA-backtrack algorithm)

  • Li H. and Durbin R. (2010) Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics, 26, 589-595. [PMID: 20080505]. (if you use the BWA-SW algorithm)

  • Li H. (2013) Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv:1303.3997v2 [q-bio.GN]. (if you use the BWA-MEM algorithm or the fastmap command, or want to cite the whole BWA package)

Please note that the last reference is a preprint hosted at arXiv.org. I do not have plan to submit it to a peer-reviewed journal in the near future.