Commit Graph

254 Commits (e4752b321bfdcffb0435ccaeee068c7f1c6a1f06)

Author SHA1 Message Date
Heng Li e4752b321b Release bwa-0.7.9-r782 2014-05-19 09:08:07 -04:00
Heng Li f00cc94e1d r779: fixed a memory leak in SE 2014-05-16 00:06:34 -04:00
Heng Li a5ad0cff7f r778: reduced the number of alloc() calls a bit 2014-05-15 23:23:04 -04:00
Heng Li 8d2986ece2 r770: fixed a compiling warning 2014-05-14 14:44:03 -04:00
Heng Li 061c63f36a r766: removed useless code 2014-05-13 13:09:29 -04:00
Heng Li 0168f39eeb r765: fixed a declaration error
Reported by Andreas Tile from Debian
2014-05-13 12:54:23 -04:00
Heng Li 08517ac09b r764: changed -c in "-x pacbio" to 500 2014-05-13 12:53:24 -04:00
Heng Li 39a6cd5bb0 r762: cleanup for the new release; unfinished
It will take to make the documentation ready.
2014-05-11 15:15:44 -04:00
Heng Li cfe6996173 r760: removed commented code
It is slow and is not very effective. And I hate useless code.
2014-05-09 14:59:07 -04:00
Heng Li 43b498a37e r759: bugfix - frac_rep not working
Also added commented code for a 3rd round seeding. Not used.
2014-05-09 14:56:59 -04:00
Heng Li c9b33502f3 r758: fixed a typo
mostly negligible in practice
2014-05-07 15:07:29 -04:00
Heng Li 6ac8dd5840 r754: added command msg for -h 2014-05-06 16:15:14 -04:00
Heng Li ce3c198245 r749: max_hits tunable on CMD; default to 5 2014-05-04 10:17:03 -04:00
Heng Li f21d6498bc r748: reduced the default -m to 50 2014-05-02 16:49:19 -04:00
Heng Li e8f28cb529 r747: fixed a minor issue in the last (mis)commit 2014-05-02 16:17:50 -04:00
Heng Li 6db761e269 r746: tuned heuristic for GRCh38
Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
2014-05-02 16:06:27 -04:00
Heng Li b7076848ab r744: int overflow given MB query 2014-05-01 15:30:36 -04:00
Heng Li fa20c71920 r742: further control the max bandwidth
I am looking at 6kb bandwidth...
2014-05-01 14:27:38 -04:00
Heng Li 7954e77a1b r741: fixed segfault in rare cases 2014-05-01 11:13:05 -04:00
Heng Li 4b2441069f r740: don't attempt merge if bandwidth too large
Sometimes the bandwidth can be >10k.
2014-05-01 11:01:52 -04:00
Heng Li 5aedc978d1 r739: output suboptimal hits in the PE mode
However, PE information is not used for suboptimal hits
2014-04-30 23:23:54 -04:00
Heng Li c6c943f9d7 r738: output multi-map in the XA tag (SE only)
... PE support coming soon
2014-04-30 16:46:05 -04:00
Heng Li d59d78838c r737: fixed an assertion when failed to convert sa
A bug pointed out by Mikkle Schubert
2014-04-30 14:55:44 -04:00
Heng Li 88f89be60e r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG

This read has 5 chains, two of which are:

weight=80  26;26;0,4591439948(10:-3095894)  23;23;27,4591439957(10:-3095888)  31;31;70,4591439964(10:-3095873)
weight=50  45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801)  31;31;70,4591440090(10:-3095747)

Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-04-30 14:14:20 -04:00
Heng Li 11698fc4e5 r735: fixed a bug caused by merge 2014-04-30 13:12:43 -04:00
Heng Li b603fed39c r733: bugfix - seed score unset when no -W 2014-04-29 14:58:53 -04:00
Heng Li 44754cd615 r731: separate layouter 2014-04-28 10:39:29 -04:00
Heng Li dadd5d6281 r730: more permissive about merging overlapping 2014-04-28 10:01:54 -04:00
Heng Li 76bb49e01b r729: halved band width; doubled patch band width 2014-04-24 16:06:01 -04:00
Heng Li 6052d3015b r728: sorting the end in mem_sort_dedup_patch()
The older version does this, which is correct.
2014-04-24 15:44:59 -04:00
Heng Li df65893fb5 r727: extend seeds with SW 2014-04-24 14:28:40 -04:00
Heng Li b92bbb47e5 Merge branch '0.7.7-softclip' into layout
Conflicts:
	Makefile
	bwamem.h
	fastmap.c
	main.c
2014-04-24 12:24:49 -04:00
Heng Li 8c12ec4a4b r725: optionally disable hard clipping
as is reqested by the cancer group
2014-04-24 11:56:43 -04:00
Heng Li b93fca2b2e r723: merge adjacent hits 2014-04-16 16:38:50 -04:00
Heng Li 48847af2fc code backup 2014-04-16 12:00:13 -04:00
Heng Li 00a07f61bf r721: merge overlapping hits by default 2014-04-15 16:16:04 -04:00
Heng Li 45f24b4ae8 r720: improved overlap hit merging 2014-04-15 16:09:42 -04:00
Heng Li bdb7b000cd r719: more stringent overlap merge
Will consider to make it the default
2014-04-15 14:52:17 -04:00
Heng Li 4e22270eba r718: merge alnregs overlapping on both query/ref 2014-04-14 17:01:17 -04:00
Heng Li 6d4a6debdc r716: changed -x pbread 2014-04-14 16:04:29 -04:00
Heng Li bbcabfe342 r707: change params for pacbio-to-pacbio 2014-04-10 21:53:52 -04:00
Heng Li 658f27eae4 Merge branch 'dev' into layout
Conflicts:
	main.c
2014-04-10 21:48:47 -04:00
Heng Li 6fda93502f r705: pairing performed on one chr only
Change of versioning: the revision number is acquired with:

  git rev-list --all --count

This counts the total number of commits across all branches.
2014-04-10 21:38:14 -04:00
Heng Li db4b171fa6 Merge branch 'dev' into layout
Conflicts:
	main.c
2014-04-10 21:09:47 -04:00
Heng Li 07182d9061 dev-475: -F outputs unit score, not raw score 2014-04-10 21:09:06 -04:00
Heng Li 7d25fe2de3 Merge branch 'dev' into layout
Conflicts:
	main.c
2014-04-10 21:07:16 -04:00
Heng Li e80bccc923 dev-474: fixed a typo 2014-04-10 21:04:02 -04:00
Heng Li f02cd42679 dev-473: added a few assertions
to make sure the new change works as is expected
2014-04-10 21:03:13 -04:00
Heng Li 8638cfadc8 dev-472: get rid of bwa_fix_xref()
This function causes all kinds of problems when the reference genome consists
of many short reads/contigs/chromsomes. Some of the problems are nearly
unfixable at the point where bwa_fix_xref() gets called. This commit attempts
to fix the problem at the root. It disallows chains spanning multiple contigs
and never retrieves sequences bridging two adjacent contigs. Thus all the
chaining, extension, SW and global alignments are confined to on contig only.

This commit brings many changes. I have tested it on a couple examples
including Peter Field's PacBio example. It works well so far.
2014-04-10 20:54:27 -04:00
Heng Li e2d0c996e9 layout-477: output unit score, not the raw score 2014-04-10 18:03:28 -04:00