Commit Graph

243 Commits (c9824432106175f00a2470c5ddaf217ce96a5c0d)

Author SHA1 Message Date
Heng Li c982443210 r854: improved the calculation of pa
and build pa filtering into BWA-MEM
2014-09-17 16:26:28 -04:00
Heng Li 825ae92e58 r849: the pa tag now gives a number
... which is the ratio of this hit to the best ALT hit.
2014-09-17 13:05:35 -04:00
Heng Li 6f37c14f26 r848: tag alignments with primary ALT 2014-09-16 18:52:49 -04:00
Heng Li 4b6eeb34c8 r830: optionally fixed chunk size 2014-09-15 23:42:24 -04:00
Heng Li 624687b072 r829: killed a harmless gcc warning 2014-09-15 23:33:22 -04:00
Heng Li b07587f806 r827: an alt hit as good as a pri hit as supp 2014-09-15 16:07:51 -04:00
Heng Li aee53f1334 r824: ALT mapping seems working 2014-09-15 00:29:05 -04:00
Heng Li 015ab3f6c3 r823: towards ALT support 2014-09-14 16:41:14 -04:00
Heng Li 8116bcc786 Merge branch 'dev' into alt 2014-09-14 15:40:52 -04:00
Heng Li 8d2b93156b r821: more relax on containing seeds 2014-09-12 10:35:49 -04:00
Heng Li 6739b713dd Merge branch 'hotfix-utgaln' into dev
Conflicts:
	main.c
2014-09-08 12:44:42 -04:00
Heng Li f4aedddee6 r819: bugfix - added too many sub-SMEMs 2014-09-08 11:32:48 -04:00
Heng Li ca61fe3ad5 code backup 2014-09-08 08:52:02 -04:00
Heng Li 1934f0cf24 code backup 2014-09-05 13:20:52 -04:00
Heng Li 35ac99b4f7 r815: optionally output ref fasta header
Also fixed a bug in reading .ann files
2014-08-29 10:51:23 -04:00
Heng Li b5cba257c1 r809: new strategy for the -a mode 2014-08-25 11:59:27 -04:00
Heng Li 7fd6a11569 r788: segfault when the last ref is "weird"
mem_patch_reg() did not check if two hits are on the same strand, which may
lead to an alignment bridging the forward-backward boundary.
2014-07-10 10:53:56 -04:00
Heng Li cffff4338f r787: use mem_seed_sw() also for non-PacBio reads
In the previous version, mem_seed_sw() is only used for PacBio reads to filter
bad seeds. For non-PacBio long queries, bwa-mem uses mem_chain2aln_short() for
a similar purpose. However, it turns out that mem_chain2aln_short() is not
effective given long near-tandem repeats. Bwa-mem still wastes a lot of time
of futile ref substring and extensions.

In this commit, mem_chain2aln_short() has been removed. mem_seed_sw() is used
if the query sequence is long enough (~700bp). For shorter reads, the results
should be almost identical to the previous version.
2014-07-10 10:30:22 -04:00
Heng Li e4752b321b Release bwa-0.7.9-r782 2014-05-19 09:08:07 -04:00
Heng Li f00cc94e1d r779: fixed a memory leak in SE 2014-05-16 00:06:34 -04:00
Heng Li a5ad0cff7f r778: reduced the number of alloc() calls a bit 2014-05-15 23:23:04 -04:00
Heng Li 061c63f36a r766: removed useless code 2014-05-13 13:09:29 -04:00
Heng Li 39a6cd5bb0 r762: cleanup for the new release; unfinished
It will take to make the documentation ready.
2014-05-11 15:15:44 -04:00
Heng Li cfe6996173 r760: removed commented code
It is slow and is not very effective. And I hate useless code.
2014-05-09 14:59:07 -04:00
Heng Li 43b498a37e r759: bugfix - frac_rep not working
Also added commented code for a 3rd round seeding. Not used.
2014-05-09 14:56:59 -04:00
Heng Li c9b33502f3 r758: fixed a typo
mostly negligible in practice
2014-05-07 15:07:29 -04:00
Heng Li ce3c198245 r749: max_hits tunable on CMD; default to 5 2014-05-04 10:17:03 -04:00
Heng Li f21d6498bc r748: reduced the default -m to 50 2014-05-02 16:49:19 -04:00
Heng Li e8f28cb529 r747: fixed a minor issue in the last (mis)commit 2014-05-02 16:17:50 -04:00
Heng Li 6db761e269 r746: tuned heuristic for GRCh38
Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
2014-05-02 16:06:27 -04:00
Heng Li fa20c71920 r742: further control the max bandwidth
I am looking at 6kb bandwidth...
2014-05-01 14:27:38 -04:00
Heng Li 4b2441069f r740: don't attempt merge if bandwidth too large
Sometimes the bandwidth can be >10k.
2014-05-01 11:01:52 -04:00
Heng Li c6c943f9d7 r738: output multi-map in the XA tag (SE only)
... PE support coming soon
2014-04-30 16:46:05 -04:00
Heng Li 88f89be60e r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG

This read has 5 chains, two of which are:

weight=80  26;26;0,4591439948(10:-3095894)  23;23;27,4591439957(10:-3095888)  31;31;70,4591439964(10:-3095873)
weight=50  45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801)  31;31;70,4591440090(10:-3095747)

Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-04-30 14:14:20 -04:00
Heng Li b603fed39c r733: bugfix - seed score unset when no -W 2014-04-29 14:58:53 -04:00
Heng Li dadd5d6281 r730: more permissive about merging overlapping 2014-04-28 10:01:54 -04:00
Heng Li 76bb49e01b r729: halved band width; doubled patch band width 2014-04-24 16:06:01 -04:00
Heng Li 6052d3015b r728: sorting the end in mem_sort_dedup_patch()
The older version does this, which is correct.
2014-04-24 15:44:59 -04:00
Heng Li df65893fb5 r727: extend seeds with SW 2014-04-24 14:28:40 -04:00
Heng Li b92bbb47e5 Merge branch '0.7.7-softclip' into layout
Conflicts:
	Makefile
	bwamem.h
	fastmap.c
	main.c
2014-04-24 12:24:49 -04:00
Heng Li 8c12ec4a4b r725: optionally disable hard clipping
as is reqested by the cancer group
2014-04-24 11:56:43 -04:00
Heng Li b93fca2b2e r723: merge adjacent hits 2014-04-16 16:38:50 -04:00
Heng Li 48847af2fc code backup 2014-04-16 12:00:13 -04:00
Heng Li 00a07f61bf r721: merge overlapping hits by default 2014-04-15 16:16:04 -04:00
Heng Li 45f24b4ae8 r720: improved overlap hit merging 2014-04-15 16:09:42 -04:00
Heng Li bdb7b000cd r719: more stringent overlap merge
Will consider to make it the default
2014-04-15 14:52:17 -04:00
Heng Li 4e22270eba r718: merge alnregs overlapping on both query/ref 2014-04-14 17:01:17 -04:00
Heng Li f02cd42679 dev-473: added a few assertions
to make sure the new change works as is expected
2014-04-10 21:03:13 -04:00
Heng Li 8638cfadc8 dev-472: get rid of bwa_fix_xref()
This function causes all kinds of problems when the reference genome consists
of many short reads/contigs/chromsomes. Some of the problems are nearly
unfixable at the point where bwa_fix_xref() gets called. This commit attempts
to fix the problem at the root. It disallows chains spanning multiple contigs
and never retrieves sequences bridging two adjacent contigs. Thus all the
chaining, extension, SW and global alignments are confined to on contig only.

This commit brings many changes. I have tested it on a couple examples
including Peter Field's PacBio example. It works well so far.
2014-04-10 20:54:27 -04:00
Heng Li 23e0e99ec0 dev-471: fixed a compiling error from last commit 2014-04-10 11:54:17 -04:00