Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG
This read has 5 chains, two of which are:
weight=80 26;26;0,4591439948(10:-3095894) 23;23;27,4591439957(10:-3095888) 31;31;70,4591439964(10:-3095873)
weight=50 45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801) 31;31;70,4591440090(10:-3095747)
Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
This function causes all kinds of problems when the reference genome consists
of many short reads/contigs/chromsomes. Some of the problems are nearly
unfixable at the point where bwa_fix_xref() gets called. This commit attempts
to fix the problem at the root. It disallows chains spanning multiple contigs
and never retrieves sequences bridging two adjacent contigs. Thus all the
chaining, extension, SW and global alignments are confined to on contig only.
This commit brings many changes. I have tested it on a couple examples
including Peter Field's PacBio example. It works well so far.
Peter Field has sent me an example caused by an alignment bridging three
adjacent chromosomes/contigs. Bwa-mem always aligns the query to the contig
covering the middle point of the alignment. In this example, it chooses the
middle contig, which should not be aligned. This leads to weird things failing
bwa_fix_xref2(), which cannot be fixed unless we build the contig boundaries
into the FM-index.
In the old code, bwa-mem halts when bwa_fix_xref2() fails. With this commit,
bwa-mem will give a warning instead of halting.
The recommended setting in the last commit is wrong. If we can extend a random
seed hit to the full length, we will force the read aligned through break
points, which is wrong. The new setting is better but it may lead to a small
fraction of fragmented alignments.
In addition, I added a filter on the minimum chain weight and tied
min_HSP_score to this filter. It doubles the mapping speed.
Global alignment does not allow contiguous insertions and deletions, but local
alignment and extension allow such CIGARs. The optimal global alignment may
have a lower score than extension, which actually happens often for PacBio
data. This commit disallows a CIGAR like 20M2D2I30M to fix this inconsistency.
Local alignment has not been changed.
Ksw uses two rounds of SSE2-SW to find the boundaries of an alignment. If the
second round gives a different score from the first round, it will fail. The
fix checks if this happens, though I have not dig into an example to understand
why this may happen in the first place.
I have seen a fosmid aligned to the same position but with two slightly
different CIGARs: 30000M and 29900M50D100M, possibly caused by tandem repeats.
0.7.5a will regard them as two distinct alignments and generates a very small
mapping quality. However, these two are essentially the same. Although there is
ambiguity in aligning the end of the fosmid, we should not penalize the entire
alignment with a small mapQ. This commit fixes this issue. More testing is
needed, though.
1. Check .sai versioning
2. Keep track of #ins and #del during backtrack
3. Use info above to get accurate aligned regions; don't call SW extension any more
4. Identify alignment crossing the for-rev boundary
5. Fixed a bug in printing the XA tag: ungapped alignments missing