Commit Graph

251 Commits (67c2d69218dcaae81b1d7c66a1b8d63dab0a5c5b)

Author SHA1 Message Date
Heng Li 76a365a95f r907: revert to -g.8 by default 2014-10-16 15:56:33 -04:00
Heng Li d8d8b230d1 r906: don't reduce non-ALT mapQ by default 2014-10-16 15:15:23 -04:00
Heng Li 2a18fa114f r895: increase the default max_XA_hits_alt to 200
Because there are >100 HLA haplotypes
2014-10-14 16:58:42 -04:00
Heng Li a03d01f944 r878: XA is given to the best alignment
Non-ALT hits may get ALT hits in the XA tag. This will simplify haplotype
assignment.
2014-09-30 13:50:51 -04:00
Heng Li dae4ca3ced r875: invalid SAM output for ALT hits 2014-09-26 15:29:08 -04:00
Heng Li 7426a750ec r868: use soft clip for ALT hits 2014-09-19 16:58:18 -04:00
Heng Li 9af36064e8 r867: fixed a few bugs; added ALT hits to XA 2014-09-19 16:50:21 -04:00
Heng Li a41afe4c97 These files were committed on a wrong branch 2014-09-18 10:49:35 -04:00
Heng Li c982443210 r854: improved the calculation of pa
and build pa filtering into BWA-MEM
2014-09-17 16:26:28 -04:00
Heng Li 825ae92e58 r849: the pa tag now gives a number
... which is the ratio of this hit to the best ALT hit.
2014-09-17 13:05:35 -04:00
Heng Li 6f37c14f26 r848: tag alignments with primary ALT 2014-09-16 18:52:49 -04:00
Heng Li 4b6eeb34c8 r830: optionally fixed chunk size 2014-09-15 23:42:24 -04:00
Heng Li 624687b072 r829: killed a harmless gcc warning 2014-09-15 23:33:22 -04:00
Heng Li b07587f806 r827: an alt hit as good as a pri hit as supp 2014-09-15 16:07:51 -04:00
Heng Li aee53f1334 r824: ALT mapping seems working 2014-09-15 00:29:05 -04:00
Heng Li 015ab3f6c3 r823: towards ALT support 2014-09-14 16:41:14 -04:00
Heng Li 8116bcc786 Merge branch 'dev' into alt 2014-09-14 15:40:52 -04:00
Heng Li 8d2b93156b r821: more relax on containing seeds 2014-09-12 10:35:49 -04:00
Heng Li 6739b713dd Merge branch 'hotfix-utgaln' into dev
Conflicts:
	main.c
2014-09-08 12:44:42 -04:00
Heng Li f4aedddee6 r819: bugfix - added too many sub-SMEMs 2014-09-08 11:32:48 -04:00
Heng Li ca61fe3ad5 code backup 2014-09-08 08:52:02 -04:00
Heng Li 1934f0cf24 code backup 2014-09-05 13:20:52 -04:00
Heng Li 35ac99b4f7 r815: optionally output ref fasta header
Also fixed a bug in reading .ann files
2014-08-29 10:51:23 -04:00
Heng Li b5cba257c1 r809: new strategy for the -a mode 2014-08-25 11:59:27 -04:00
Heng Li 7fd6a11569 r788: segfault when the last ref is "weird"
mem_patch_reg() did not check if two hits are on the same strand, which may
lead to an alignment bridging the forward-backward boundary.
2014-07-10 10:53:56 -04:00
Heng Li cffff4338f r787: use mem_seed_sw() also for non-PacBio reads
In the previous version, mem_seed_sw() is only used for PacBio reads to filter
bad seeds. For non-PacBio long queries, bwa-mem uses mem_chain2aln_short() for
a similar purpose. However, it turns out that mem_chain2aln_short() is not
effective given long near-tandem repeats. Bwa-mem still wastes a lot of time
of futile ref substring and extensions.

In this commit, mem_chain2aln_short() has been removed. mem_seed_sw() is used
if the query sequence is long enough (~700bp). For shorter reads, the results
should be almost identical to the previous version.
2014-07-10 10:30:22 -04:00
Heng Li e4752b321b Release bwa-0.7.9-r782 2014-05-19 09:08:07 -04:00
Heng Li f00cc94e1d r779: fixed a memory leak in SE 2014-05-16 00:06:34 -04:00
Heng Li a5ad0cff7f r778: reduced the number of alloc() calls a bit 2014-05-15 23:23:04 -04:00
Heng Li 061c63f36a r766: removed useless code 2014-05-13 13:09:29 -04:00
Heng Li 39a6cd5bb0 r762: cleanup for the new release; unfinished
It will take to make the documentation ready.
2014-05-11 15:15:44 -04:00
Heng Li cfe6996173 r760: removed commented code
It is slow and is not very effective. And I hate useless code.
2014-05-09 14:59:07 -04:00
Heng Li 43b498a37e r759: bugfix - frac_rep not working
Also added commented code for a 3rd round seeding. Not used.
2014-05-09 14:56:59 -04:00
Heng Li c9b33502f3 r758: fixed a typo
mostly negligible in practice
2014-05-07 15:07:29 -04:00
Heng Li ce3c198245 r749: max_hits tunable on CMD; default to 5 2014-05-04 10:17:03 -04:00
Heng Li f21d6498bc r748: reduced the default -m to 50 2014-05-02 16:49:19 -04:00
Heng Li e8f28cb529 r747: fixed a minor issue in the last (mis)commit 2014-05-02 16:17:50 -04:00
Heng Li 6db761e269 r746: tuned heuristic for GRCh38
Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
2014-05-02 16:06:27 -04:00
Heng Li fa20c71920 r742: further control the max bandwidth
I am looking at 6kb bandwidth...
2014-05-01 14:27:38 -04:00
Heng Li 4b2441069f r740: don't attempt merge if bandwidth too large
Sometimes the bandwidth can be >10k.
2014-05-01 11:01:52 -04:00
Heng Li c6c943f9d7 r738: output multi-map in the XA tag (SE only)
... PE support coming soon
2014-04-30 16:46:05 -04:00
Heng Li 88f89be60e r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG

This read has 5 chains, two of which are:

weight=80  26;26;0,4591439948(10:-3095894)  23;23;27,4591439957(10:-3095888)  31;31;70,4591439964(10:-3095873)
weight=50  45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801)  31;31;70,4591440090(10:-3095747)

Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-04-30 14:14:20 -04:00
Heng Li b603fed39c r733: bugfix - seed score unset when no -W 2014-04-29 14:58:53 -04:00
Heng Li dadd5d6281 r730: more permissive about merging overlapping 2014-04-28 10:01:54 -04:00
Heng Li 76bb49e01b r729: halved band width; doubled patch band width 2014-04-24 16:06:01 -04:00
Heng Li 6052d3015b r728: sorting the end in mem_sort_dedup_patch()
The older version does this, which is correct.
2014-04-24 15:44:59 -04:00
Heng Li df65893fb5 r727: extend seeds with SW 2014-04-24 14:28:40 -04:00
Heng Li b92bbb47e5 Merge branch '0.7.7-softclip' into layout
Conflicts:
	Makefile
	bwamem.h
	fastmap.c
	main.c
2014-04-24 12:24:49 -04:00
Heng Li 8c12ec4a4b r725: optionally disable hard clipping
as is reqested by the cancer group
2014-04-24 11:56:43 -04:00
Heng Li b93fca2b2e r723: merge adjacent hits 2014-04-16 16:38:50 -04:00