Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG
This read has 5 chains, two of which are:
weight=80 26;26;0,4591439948(10:-3095894) 23;23;27,4591439957(10:-3095888) 31;31;70,4591439964(10:-3095873)
weight=50 45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801) 31;31;70,4591440090(10:-3095747)
Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
This function causes all kinds of problems when the reference genome consists
of many short reads/contigs/chromsomes. Some of the problems are nearly
unfixable at the point where bwa_fix_xref() gets called. This commit attempts
to fix the problem at the root. It disallows chains spanning multiple contigs
and never retrieves sequences bridging two adjacent contigs. Thus all the
chaining, extension, SW and global alignments are confined to on contig only.
This commit brings many changes. I have tested it on a couple examples
including Peter Field's PacBio example. It works well so far.
Peter Field has sent me an example caused by an alignment bridging three
adjacent chromosomes/contigs. Bwa-mem always aligns the query to the contig
covering the middle point of the alignment. In this example, it chooses the
middle contig, which should not be aligned. This leads to weird things failing
bwa_fix_xref2(), which cannot be fixed unless we build the contig boundaries
into the FM-index.
In the old code, bwa-mem halts when bwa_fix_xref2() fails. With this commit,
bwa-mem will give a warning instead of halting.
The recommended setting in the last commit is wrong. If we can extend a random
seed hit to the full length, we will force the read aligned through break
points, which is wrong. The new setting is better but it may lead to a small
fraction of fragmented alignments.
In addition, I added a filter on the minimum chain weight and tied
min_HSP_score to this filter. It doubles the mapping speed.
Global alignment does not allow contiguous insertions and deletions, but local
alignment and extension allow such CIGARs. The optimal global alignment may
have a lower score than extension, which actually happens often for PacBio
data. This commit disallows a CIGAR like 20M2D2I30M to fix this inconsistency.
Local alignment has not been changed.
Ksw uses two rounds of SSE2-SW to find the boundaries of an alignment. If the
second round gives a different score from the first round, it will fail. The
fix checks if this happens, though I have not dig into an example to understand
why this may happen in the first place.
I have seen a fosmid aligned to the same position but with two slightly
different CIGARs: 30000M and 29900M50D100M, possibly caused by tandem repeats.
0.7.5a will regard them as two distinct alignments and generates a very small
mapping quality. However, these two are essentially the same. Although there is
ambiguity in aligning the end of the fosmid, we should not penalize the entire
alignment with a small mapQ. This commit fixes this issue. More testing is
needed, though.
1. Check .sai versioning
2. Keep track of #ins and #del during backtrack
3. Use info above to get accurate aligned regions; don't call SW extension any more
4. Identify alignment crossing the for-rev boundary
5. Fixed a bug in printing the XA tag: ungapped alignments missing
The old method does not work when the alignment bridges three chr. This may
actually happen often. The new method does not work all the time, either, but
should be better than the old one. It is also simpler, arguably.
This leads to more aggressive pairing - more properly paired reads. I have
found a few cases where, for example, read1 is umambiguously mapped to chr20
while its 100bp mate has a perfect match to another chr but has 3 mismatches
and 1 deletion when it is paired with read1 on chr20. With longer reads, it
seems that the chr20 hit is correct, although it is not obvious how this
happened in evolution.
In this case, bwa_fix_xref() will return insane coordinates. The old version
did not check the return status and write wrong CIGAR. This bug only happen to
very short assembly contigs.
The bug only happens when there is a 1bp del and 1bp ins which are close to the
end and there are no other substitutions or indels. In this case, bwa mem gave
a wrong band width.
If one end has a low quality tail that happens to have a score-20 hit,
the pair won't be flagged as properly paired because bwa-mem thought it has
multiple hits. By filtering with -T, we won't have this problem.
When backtracking, bwa-short does not keep the detailed alignment or the exact
start and end positions. To find the boundary and the CIGAR, the old code does
a global alignment with a small end-gap penalty. It then deals with a lot of
special cases to derive the right position and CIGAR, which are actually not
always right. It is a mess.
As the new ksw.{c,h} does not support a different end-gap penalty, the old
strategy does not work. But we get something better. The new code finds the
boundaries with ksw_extend(). It is cleaner and gives more accurate CIGAR in
most cases.
stdaln.{c,h} was written ten years ago. Its local and SW extension code are
actually buggy (though that rarely happens and usually does not affect the
results too much). ksw.{c,h} is more concise, potentially faster, less buggy,
and richer in features.
Heng Li
Bradford Powell
John Marshall
Rob Davies