Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG
This read has 5 chains, two of which are:
weight=80 26;26;0,4591439948(10:-3095894) 23;23;27,4591439957(10:-3095888) 31;31;70,4591439964(10:-3095873)
weight=50 45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801) 31;31;70,4591440090(10:-3095747)
Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
1. the first cell in a row is not always right
2. prevent from H->H extension from H=0 cells
3. replaced the band narrowing heuristic with always correct one
This function causes all kinds of problems when the reference genome consists
of many short reads/contigs/chromsomes. Some of the problems are nearly
unfixable at the point where bwa_fix_xref() gets called. This commit attempts
to fix the problem at the root. It disallows chains spanning multiple contigs
and never retrieves sequences bridging two adjacent contigs. Thus all the
chaining, extension, SW and global alignments are confined to on contig only.
This commit brings many changes. I have tested it on a couple examples
including Peter Field's PacBio example. It works well so far.
Peter Field has sent me an example caused by an alignment bridging three
adjacent chromosomes/contigs. Bwa-mem always aligns the query to the contig
covering the middle point of the alignment. In this example, it chooses the
middle contig, which should not be aligned. This leads to weird things failing
bwa_fix_xref2(), which cannot be fixed unless we build the contig boundaries
into the FM-index.
In the old code, bwa-mem halts when bwa_fix_xref2() fails. With this commit,
bwa-mem will give a warning instead of halting.