2013-02-01 02:59:48 +08:00
|
|
|
#ifndef BWAMEM_H_
|
|
|
|
|
#define BWAMEM_H_
|
|
|
|
|
|
|
|
|
|
#include "bwt.h"
|
2013-02-08 02:13:43 +08:00
|
|
|
#include "bntseq.h"
|
2013-02-24 04:30:46 +08:00
|
|
|
#include "bwa.h"
|
2013-02-01 02:59:48 +08:00
|
|
|
|
2013-02-26 02:00:35 +08:00
|
|
|
#define MEM_MAPQ_COEF 30.0
|
2013-02-19 13:50:39 +08:00
|
|
|
#define MEM_MAPQ_MAX 60
|
2013-02-13 05:15:26 +08:00
|
|
|
|
2013-02-02 03:38:44 +08:00
|
|
|
struct __smem_i;
|
|
|
|
|
typedef struct __smem_i smem_i;
|
2013-02-01 02:59:48 +08:00
|
|
|
|
2013-02-19 05:33:06 +08:00
|
|
|
#define MEM_F_PE 0x2
|
|
|
|
|
#define MEM_F_NOPAIRING 0x4
|
2013-02-25 02:23:43 +08:00
|
|
|
#define MEM_F_ALL 0x8
|
2013-02-27 01:49:48 +08:00
|
|
|
#define MEM_F_NO_MULTI 0x10
|
2013-04-10 04:13:55 +08:00
|
|
|
#define MEM_F_NO_RESCUE 0x20
|
2014-04-09 04:29:36 +08:00
|
|
|
#define MEM_F_SELF_OVLP 0x40
|
|
|
|
|
#define MEM_F_ALN_REG 0x80
|
2014-08-29 22:51:23 +08:00
|
|
|
#define MEM_F_REF_HDR 0x100
|
2014-04-24 23:56:43 +08:00
|
|
|
#define MEM_F_SOFTCLIP 0x200
|
2013-02-19 05:33:06 +08:00
|
|
|
|
2013-02-01 02:59:48 +08:00
|
|
|
typedef struct {
|
2014-03-29 02:54:06 +08:00
|
|
|
int a, b; // match score and mismatch penalty
|
|
|
|
|
int o_del, e_del;
|
|
|
|
|
int o_ins, e_ins;
|
2013-02-28 10:13:39 +08:00
|
|
|
int pen_unpaired; // phred-scaled penalty for unpaired reads
|
2013-08-29 03:59:05 +08:00
|
|
|
int pen_clip5,pen_clip3;// clipping penalty. This score is not deducted from the DP score.
|
2013-02-26 00:56:02 +08:00
|
|
|
int w; // band width
|
2013-03-05 13:34:33 +08:00
|
|
|
int zdrop; // Z-dropoff
|
2013-02-28 10:13:39 +08:00
|
|
|
|
2014-08-25 23:59:27 +08:00
|
|
|
uint64_t max_mem_intv;
|
|
|
|
|
|
2013-03-06 11:49:38 +08:00
|
|
|
int T; // output score threshold; only affecting output
|
2013-02-26 00:56:02 +08:00
|
|
|
int flag; // see MEM_F_* macros
|
|
|
|
|
int min_seed_len; // minimum seed length
|
2014-04-05 05:01:04 +08:00
|
|
|
int min_chain_weight;
|
2014-04-09 09:45:49 +08:00
|
|
|
int max_chain_extend;
|
2013-02-26 00:56:02 +08:00
|
|
|
float split_factor; // split into a seed if MEM is longer than min_seed_len*split_factor
|
|
|
|
|
int split_width; // split into a seed if its occurence is smaller than this value
|
|
|
|
|
int max_occ; // skip a seed if its occurence is larger than this value
|
|
|
|
|
int max_chain_gap; // do not chain seed if it is max_chain_gap-bp away from the closest seed
|
|
|
|
|
int n_threads; // number of threads
|
|
|
|
|
int chunk_size; // process chunk_size-bp sequences in a batch
|
|
|
|
|
float mask_level; // regard a hit as redundant if the overlap with another better hit is over mask_level times the min length of the two hits
|
2014-04-09 09:45:49 +08:00
|
|
|
float drop_ratio; // drop a chain if its seed coverage is below drop_ratio times the seed coverage of a better chain overlapping with the small chain
|
2014-05-12 03:15:44 +08:00
|
|
|
float XA_drop_ratio; // when counting hits for the XA tag, ignore alignments with score < XA_drop_ratio * max_score; only effective for the XA tag
|
2013-09-09 23:36:50 +08:00
|
|
|
float mask_level_redun;
|
2013-09-07 00:31:47 +08:00
|
|
|
float mapQ_coef_len;
|
2014-09-18 04:26:28 +08:00
|
|
|
float min_pa_ratio;
|
2013-09-07 00:31:47 +08:00
|
|
|
int mapQ_coef_fac;
|
2013-02-26 00:56:02 +08:00
|
|
|
int max_ins; // when estimating insert size distribution, skip pairs with insert longer than this value
|
|
|
|
|
int max_matesw; // perform maximally max_matesw rounds of mate-SW for each end
|
2014-05-01 04:46:05 +08:00
|
|
|
int max_hits; // if there are max_hits or fewer, output them all
|
2013-02-26 00:56:02 +08:00
|
|
|
int8_t mat[25]; // scoring matrix; mat[0] == 0 if unset
|
2013-02-02 05:39:50 +08:00
|
|
|
} mem_opt_t;
|
2013-02-01 02:59:48 +08:00
|
|
|
|
2013-02-02 05:39:50 +08:00
|
|
|
typedef struct {
|
2013-02-25 02:09:29 +08:00
|
|
|
int64_t rb, re; // [rb,re): reference sequence in the alignment
|
|
|
|
|
int qb, qe; // [qb,qe): query sequence in the alignment
|
2014-04-11 08:54:27 +08:00
|
|
|
int rid; // reference seq ID
|
2013-03-16 09:26:37 +08:00
|
|
|
int score; // best local SW score
|
|
|
|
|
int truesc; // actual score corresponding to the aligned region; possibly smaller than $score
|
2013-02-25 02:09:29 +08:00
|
|
|
int sub; // 2nd best SW score
|
2014-09-18 04:26:28 +08:00
|
|
|
int alt_sc;
|
2013-02-25 02:09:29 +08:00
|
|
|
int csub; // SW score of a tandem hit
|
|
|
|
|
int sub_n; // approximate number of suboptimal hits
|
2013-03-05 06:29:07 +08:00
|
|
|
int w; // actual band width used in extension
|
2013-02-25 02:09:29 +08:00
|
|
|
int seedcov; // length of regions coverged by seeds
|
|
|
|
|
int secondary; // index of the parent hit shadowing the current hit; <0 if primary
|
r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG
This read has 5 chains, two of which are:
weight=80 26;26;0,4591439948(10:-3095894) 23;23;27,4591439957(10:-3095888) 31;31;70,4591439964(10:-3095873)
weight=50 45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801) 31;31;70,4591440090(10:-3095747)
Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-05-01 02:14:20 +08:00
|
|
|
int seedlen0; // length of the starting seed
|
2014-09-08 20:52:02 +08:00
|
|
|
int n_comp:30, is_alt:2; // number of sub-alignments chained together
|
2014-05-10 02:56:59 +08:00
|
|
|
float frac_rep;
|
2013-11-23 22:36:26 +08:00
|
|
|
uint64_t hash;
|
2013-02-07 02:59:32 +08:00
|
|
|
} mem_alnreg_t;
|
2013-02-01 04:55:22 +08:00
|
|
|
|
2013-02-28 11:28:29 +08:00
|
|
|
typedef struct { size_t n, m; mem_alnreg_t *a; } mem_alnreg_v;
|
|
|
|
|
|
2013-02-11 23:59:38 +08:00
|
|
|
typedef struct {
|
2013-04-27 00:31:18 +08:00
|
|
|
int low, high; // lower and upper bounds within which a read pair is considered to be properly paired
|
|
|
|
|
int failed; // non-zero if the orientation is not supported by sufficient data
|
|
|
|
|
double avg, std; // mean and stddev of the insert size distribution
|
2013-02-11 23:59:38 +08:00
|
|
|
} mem_pestat_t;
|
|
|
|
|
|
2013-02-28 11:28:29 +08:00
|
|
|
typedef struct { // This struct is only used for the convenience of API.
|
2013-03-12 09:25:17 +08:00
|
|
|
int64_t pos; // forward strand 5'-end mapping position
|
|
|
|
|
int rid; // reference sequence index in bntseq_t; <0 for unmapped
|
|
|
|
|
int flag; // extra flag
|
2014-09-17 06:52:49 +08:00
|
|
|
uint32_t is_rev:1, is_alt:1, mapq:8, NM:22; // is_rev: whether on the reverse strand; mapq: mapping quality; NM: edit distance
|
2013-03-02 00:14:51 +08:00
|
|
|
int n_cigar; // number of CIGAR operations
|
|
|
|
|
uint32_t *cigar; // CIGAR in the BAM encoding: opLen<<4|op; op to integer mapping: MIDSH=>01234
|
2014-05-01 04:46:05 +08:00
|
|
|
char *XA; // alternative mappings
|
2013-03-12 09:25:17 +08:00
|
|
|
|
2014-09-18 04:26:28 +08:00
|
|
|
int score, sub, alt_sc;
|
2013-02-28 11:28:29 +08:00
|
|
|
} mem_aln_t;
|
2013-02-08 02:13:43 +08:00
|
|
|
|
2013-02-01 02:59:48 +08:00
|
|
|
#ifdef __cplusplus
|
|
|
|
|
extern "C" {
|
|
|
|
|
#endif
|
|
|
|
|
|
2013-02-25 01:17:29 +08:00
|
|
|
smem_i *smem_itr_init(const bwt_t *bwt);
|
|
|
|
|
void smem_itr_destroy(smem_i *itr);
|
|
|
|
|
void smem_set_query(smem_i *itr, int len, const uint8_t *query);
|
2014-08-25 23:59:27 +08:00
|
|
|
void smem_config(smem_i *itr, int min_intv, int max_len, uint64_t max_intv);
|
2014-04-04 03:23:48 +08:00
|
|
|
const bwtintv_v *smem_next(smem_i *itr);
|
2013-02-01 02:59:48 +08:00
|
|
|
|
2013-02-25 01:17:29 +08:00
|
|
|
mem_opt_t *mem_opt_init(void);
|
|
|
|
|
void mem_fill_scmat(int a, int b, int8_t mat[25]);
|
2013-02-01 05:26:05 +08:00
|
|
|
|
2013-02-25 02:09:29 +08:00
|
|
|
/**
|
|
|
|
|
* Align a batch of sequences and generate the alignments in the SAM format
|
|
|
|
|
*
|
|
|
|
|
* This routine requires $seqs[i].{l_seq,seq,name} and write $seqs[i].sam.
|
|
|
|
|
* Note that $seqs[i].sam may consist of several SAM lines if the
|
|
|
|
|
* corresponding sequence has multiple primary hits.
|
|
|
|
|
*
|
|
|
|
|
* In the paired-end mode (i.e. MEM_F_PE is set in $opt->flag), query
|
|
|
|
|
* sequences must be interleaved: $n must be an even number and the 2i-th
|
|
|
|
|
* sequence and the (2i+1)-th sequence constitute a read pair. In this
|
|
|
|
|
* mode, there should be enough (typically >50) unique pairs for the
|
|
|
|
|
* routine to infer the orientation and insert size.
|
|
|
|
|
*
|
|
|
|
|
* @param opt alignment parameters
|
|
|
|
|
* @param bwt FM-index of the reference sequence
|
|
|
|
|
* @param bns Information of the reference
|
|
|
|
|
* @param pac 2-bit encoded reference
|
|
|
|
|
* @param n number of query sequences
|
|
|
|
|
* @param seqs query sequences; $seqs[i].seq/sam to be modified after the call
|
2013-04-27 00:31:18 +08:00
|
|
|
* @param pes0 insert-size info; if NULL, infer from data; if not NULL, it should be an array with 4 elements,
|
|
|
|
|
* corresponding to each FF, FR, RF and RR orientation. See mem_pestat() for more info.
|
2013-02-25 02:09:29 +08:00
|
|
|
*/
|
2013-11-23 22:36:26 +08:00
|
|
|
void mem_process_seqs(const mem_opt_t *opt, const bwt_t *bwt, const bntseq_t *bns, const uint8_t *pac, int64_t n_processed, int n, bseq1_t *seqs, const mem_pestat_t *pes0);
|
2013-02-25 02:09:29 +08:00
|
|
|
|
|
|
|
|
/**
|
|
|
|
|
* Find the aligned regions for one query sequence
|
|
|
|
|
*
|
|
|
|
|
* Note that this routine does not generate CIGAR. CIGAR should be
|
2013-03-02 00:47:51 +08:00
|
|
|
* generated later by mem_reg2aln() below.
|
2013-02-25 02:09:29 +08:00
|
|
|
*
|
|
|
|
|
* @param opt alignment parameters
|
|
|
|
|
* @param bwt FM-index of the reference sequence
|
|
|
|
|
* @param bns Information of the reference
|
|
|
|
|
* @param pac 2-bit encoded reference
|
|
|
|
|
* @param l_seq length of query sequence
|
2013-03-02 00:14:51 +08:00
|
|
|
* @param seq query sequence
|
2013-02-25 02:09:29 +08:00
|
|
|
*
|
|
|
|
|
* @return list of aligned regions.
|
|
|
|
|
*/
|
2013-03-02 00:14:51 +08:00
|
|
|
mem_alnreg_v mem_align1(const mem_opt_t *opt, const bwt_t *bwt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq);
|
2013-02-25 02:09:29 +08:00
|
|
|
|
2013-03-02 00:14:51 +08:00
|
|
|
/**
|
|
|
|
|
* Generate CIGAR and forward-strand position from alignment region
|
|
|
|
|
*
|
|
|
|
|
* @param opt alignment parameters
|
|
|
|
|
* @param bns Information of the reference
|
|
|
|
|
* @param pac 2-bit encoded reference
|
|
|
|
|
* @param l_seq length of query sequence
|
|
|
|
|
* @param seq query sequence
|
|
|
|
|
* @param ar one alignment region
|
|
|
|
|
*
|
|
|
|
|
* @return CIGAR, strand, mapping quality and forward-strand position
|
|
|
|
|
*/
|
|
|
|
|
mem_aln_t mem_reg2aln(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq, const mem_alnreg_t *ar);
|
2014-04-10 23:43:17 +08:00
|
|
|
mem_aln_t mem_reg2aln2(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq, const mem_alnreg_t *ar, const char *name);
|
2013-02-28 11:28:29 +08:00
|
|
|
|
2013-02-25 02:09:29 +08:00
|
|
|
/**
|
|
|
|
|
* Infer the insert size distribution from interleaved alignment regions
|
|
|
|
|
*
|
|
|
|
|
* This function can be called after mem_align1(), as long as paired-end
|
|
|
|
|
* reads are properly interleaved.
|
|
|
|
|
*
|
|
|
|
|
* @param opt alignment parameters
|
|
|
|
|
* @param l_pac length of concatenated reference sequence
|
|
|
|
|
* @param n number of query sequences; must be an even number
|
|
|
|
|
* @param regs region array of size $n; 2i-th and (2i+1)-th elements constitute a pair
|
|
|
|
|
* @param pes inferred insert size distribution (output)
|
|
|
|
|
*/
|
2013-02-25 01:17:29 +08:00
|
|
|
void mem_pestat(const mem_opt_t *opt, int64_t l_pac, int n, const mem_alnreg_v *regs, mem_pestat_t pes[4]);
|
2013-02-11 23:59:38 +08:00
|
|
|
|
2013-02-01 02:59:48 +08:00
|
|
|
#ifdef __cplusplus
|
|
|
|
|
}
|
|
|
|
|
#endif
|
|
|
|
|
|
|
|
|
|
#endif
|