Commit Graph

688 Commits (76a15ea91ba19e8c0b8e3fe9ab00e84f96ae149a)

Author SHA1 Message Date
Heng Li b5415ba23d first integration; compiled, but NOT TESTED! 2014-08-07 11:59:37 -04:00
Heng Li 5e56bec0f4 don't process hard clipped SEQ
The full read sequence has to be present.
2014-08-07 10:36:28 -04:00
Heng Li 705aa53894 Released 0.7.10 2014-07-13 22:57:27 -04:00
Heng Li 7fd6a11569 r788: segfault when the last ref is "weird"
mem_patch_reg() did not check if two hits are on the same strand, which may
lead to an alignment bridging the forward-backward boundary.
2014-07-10 10:53:56 -04:00
Heng Li cffff4338f r787: use mem_seed_sw() also for non-PacBio reads
In the previous version, mem_seed_sw() is only used for PacBio reads to filter
bad seeds. For non-PacBio long queries, bwa-mem uses mem_chain2aln_short() for
a similar purpose. However, it turns out that mem_chain2aln_short() is not
effective given long near-tandem repeats. Bwa-mem still wastes a lot of time
of futile ref substring and extensions.

In this commit, mem_chain2aln_short() has been removed. mem_seed_sw() is used
if the query sequence is long enough (~700bp). For shorter reads, the results
should be almost identical to the previous version.
2014-07-10 10:30:22 -04:00
Heng Li 3efc33160c 0.7.9a-r786: fixed a segfault in a rare case
More likely to happen given a circular genome
2014-05-19 16:47:25 -04:00
Heng Li 031d3d83ce Wrong release number: 0.7.8 => 0.7.9 2014-05-19 09:49:26 -04:00
Heng Li be74dbc00c Release bwa-0.7.9-r783 2014-05-19 09:09:11 -04:00
Heng Li e4752b321b Release bwa-0.7.9-r782 2014-05-19 09:08:07 -04:00
Heng Li f00cc94e1d r779: fixed a memory leak in SE 2014-05-16 00:06:34 -04:00
Heng Li a5ad0cff7f r778: reduced the number of alloc() calls a bit 2014-05-15 23:23:04 -04:00
Heng Li 012d54fc49 Updated release notes 2014-05-15 11:48:28 -04:00
Heng Li 8d2986ece2 r770: fixed a compiling warning 2014-05-14 14:44:03 -04:00
Heng Li 8f3e7d573b fixed wrong FAQ links 2014-05-14 14:36:52 -04:00
Heng Li d67e923026 changed the heading format 2014-05-14 14:33:42 -04:00
Heng Li 1627f9dfae updated README 2014-05-14 14:32:09 -04:00
Heng Li 061c63f36a r766: removed useless code 2014-05-13 13:09:29 -04:00
Heng Li 0168f39eeb r765: fixed a declaration error
Reported by Andreas Tile from Debian
2014-05-13 12:54:23 -04:00
Heng Li 08517ac09b r764: changed -c in "-x pacbio" to 500 2014-05-13 12:53:24 -04:00
Heng Li a35a6c2580 updated maual page 2014-05-12 12:52:16 -04:00
Heng Li 39a6cd5bb0 r762: cleanup for the new release; unfinished
It will take to make the documentation ready.
2014-05-11 15:15:44 -04:00
Heng Li cfe6996173 r760: removed commented code
It is slow and is not very effective. And I hate useless code.
2014-05-09 14:59:07 -04:00
Heng Li 43b498a37e r759: bugfix - frac_rep not working
Also added commented code for a 3rd round seeding. Not used.
2014-05-09 14:56:59 -04:00
Heng Li c9b33502f3 r758: fixed a typo
mostly negligible in practice
2014-05-07 15:07:29 -04:00
Heng Li e56572e88f help on how to use bwa-helper.js 2014-05-06 17:11:17 -04:00
Heng Li 1ced2f386c more debugging info at -v5 2014-05-06 16:35:40 -04:00
Heng Li 4b951592fb download link of data used by genalt 2014-05-06 16:29:20 -04:00
Heng Li 6ac8dd5840 r754: added command msg for -h 2014-05-06 16:15:14 -04:00
Heng Li 81970e7687 more comments 2014-05-06 16:12:22 -04:00
Heng Li c50ee8c841 genalt is working 2014-05-06 16:02:40 -04:00
Heng Li 8d37726325 code backup 2014-05-06 11:57:02 -04:00
Heng Li 024195db62 code backup 2014-05-05 16:51:14 -04:00
Heng Li ce3c198245 r749: max_hits tunable on CMD; default to 5 2014-05-04 10:17:03 -04:00
Heng Li f21d6498bc r748: reduced the default -m to 50 2014-05-02 16:49:19 -04:00
Heng Li e8f28cb529 r747: fixed a minor issue in the last (mis)commit 2014-05-02 16:17:50 -04:00
Heng Li 6db761e269 r746: tuned heuristic for GRCh38
Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
2014-05-02 16:06:27 -04:00
Heng Li 8763e0ced7 Helpful scripts 2014-05-02 10:43:49 -04:00
Heng Li b7076848ab r744: int overflow given MB query 2014-05-01 15:30:36 -04:00
Heng Li fa20c71920 r742: further control the max bandwidth
I am looking at 6kb bandwidth...
2014-05-01 14:27:38 -04:00
Heng Li 7954e77a1b r741: fixed segfault in rare cases 2014-05-01 11:13:05 -04:00
Heng Li 4b2441069f r740: don't attempt merge if bandwidth too large
Sometimes the bandwidth can be >10k.
2014-05-01 11:01:52 -04:00
Heng Li 5aedc978d1 r739: output suboptimal hits in the PE mode
However, PE information is not used for suboptimal hits
2014-04-30 23:23:54 -04:00
Heng Li c6c943f9d7 r738: output multi-map in the XA tag (SE only)
... PE support coming soon
2014-04-30 16:46:05 -04:00
Heng Li d59d78838c r737: fixed an assertion when failed to convert sa
A bug pointed out by Mikkle Schubert
2014-04-30 14:55:44 -04:00
Heng Li 88f89be60e r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG

This read has 5 chains, two of which are:

weight=80  26;26;0,4591439948(10:-3095894)  23;23;27,4591439957(10:-3095888)  31;31;70,4591439964(10:-3095873)
weight=50  45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801)  31;31;70,4591440090(10:-3095747)

Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-04-30 14:14:20 -04:00
Heng Li 11698fc4e5 r735: fixed a bug caused by merge 2014-04-30 13:12:43 -04:00
Heng Li b603fed39c r733: bugfix - seed score unset when no -W 2014-04-29 14:58:53 -04:00
Heng Li 44754cd615 r731: separate layouter 2014-04-28 10:39:29 -04:00
Heng Li dadd5d6281 r730: more permissive about merging overlapping 2014-04-28 10:01:54 -04:00
Heng Li 76bb49e01b r729: halved band width; doubled patch band width 2014-04-24 16:06:01 -04:00