Commit Graph

258 Commits (482a47a57ed9aa203387d417f898efe57502f313)

Author SHA1 Message Date
Nils Homer 482a47a57e adding support for SAM/BAM output using htslib. Please turn on within
the Makefile.
2014-07-28 14:08:06 -04:00
Heng Li 3efc33160c 0.7.9a-r786: fixed a segfault in a rare case
More likely to happen given a circular genome
2014-05-19 16:47:25 -04:00
Heng Li 031d3d83ce Wrong release number: 0.7.8 => 0.7.9 2014-05-19 09:49:26 -04:00
Heng Li be74dbc00c Release bwa-0.7.9-r783 2014-05-19 09:09:11 -04:00
Heng Li e4752b321b Release bwa-0.7.9-r782 2014-05-19 09:08:07 -04:00
Heng Li f00cc94e1d r779: fixed a memory leak in SE 2014-05-16 00:06:34 -04:00
Heng Li a5ad0cff7f r778: reduced the number of alloc() calls a bit 2014-05-15 23:23:04 -04:00
Heng Li 8d2986ece2 r770: fixed a compiling warning 2014-05-14 14:44:03 -04:00
Heng Li 061c63f36a r766: removed useless code 2014-05-13 13:09:29 -04:00
Heng Li 0168f39eeb r765: fixed a declaration error
Reported by Andreas Tile from Debian
2014-05-13 12:54:23 -04:00
Heng Li 08517ac09b r764: changed -c in "-x pacbio" to 500 2014-05-13 12:53:24 -04:00
Heng Li 39a6cd5bb0 r762: cleanup for the new release; unfinished
It will take to make the documentation ready.
2014-05-11 15:15:44 -04:00
Heng Li cfe6996173 r760: removed commented code
It is slow and is not very effective. And I hate useless code.
2014-05-09 14:59:07 -04:00
Heng Li 43b498a37e r759: bugfix - frac_rep not working
Also added commented code for a 3rd round seeding. Not used.
2014-05-09 14:56:59 -04:00
Heng Li c9b33502f3 r758: fixed a typo
mostly negligible in practice
2014-05-07 15:07:29 -04:00
Heng Li 6ac8dd5840 r754: added command msg for -h 2014-05-06 16:15:14 -04:00
Heng Li ce3c198245 r749: max_hits tunable on CMD; default to 5 2014-05-04 10:17:03 -04:00
Heng Li f21d6498bc r748: reduced the default -m to 50 2014-05-02 16:49:19 -04:00
Heng Li e8f28cb529 r747: fixed a minor issue in the last (mis)commit 2014-05-02 16:17:50 -04:00
Heng Li 6db761e269 r746: tuned heuristic for GRCh38
Reduced -c to 500 by default. As a compensation, we choose up to 1000 positions
if a seed has 500 or more occurrences. In addition, a read with big portion
from such seeds will have lower mapping quality.
2014-05-02 16:06:27 -04:00
Heng Li b7076848ab r744: int overflow given MB query 2014-05-01 15:30:36 -04:00
Heng Li fa20c71920 r742: further control the max bandwidth
I am looking at 6kb bandwidth...
2014-05-01 14:27:38 -04:00
Heng Li 7954e77a1b r741: fixed segfault in rare cases 2014-05-01 11:13:05 -04:00
Heng Li 4b2441069f r740: don't attempt merge if bandwidth too large
Sometimes the bandwidth can be >10k.
2014-05-01 11:01:52 -04:00
Heng Li 5aedc978d1 r739: output suboptimal hits in the PE mode
However, PE information is not used for suboptimal hits
2014-04-30 23:23:54 -04:00
Heng Li c6c943f9d7 r738: output multi-map in the XA tag (SE only)
... PE support coming soon
2014-04-30 16:46:05 -04:00
Heng Li d59d78838c r737: fixed an assertion when failed to convert sa
A bug pointed out by Mikkle Schubert
2014-04-30 14:55:44 -04:00
Heng Li 88f89be60e r736: improved in low-complexity regions
Example: GGAGGGGAAGGGTGGGCTGGAGGGGACGGGTGGGCTGGAGGGGAAGGGTGTGCTGGAGGGAAAAGGTGGACTGGAGGGGAAGGGTGGGCTGGAGGGGAAGG

This read has 5 chains, two of which are:

weight=80  26;26;0,4591439948(10:-3095894)  23;23;27,4591439957(10:-3095888)  31;31;70,4591439964(10:-3095873)
weight=50  45;45;51,4591440017(10:-3095806) 50;50;51,4591440017(10:-3095801)  31;31;70,4591440090(10:-3095747)

Extension from the 26bp seed in the 1st chain gives an alignment [0,101) <=> [4591439948,4591440067), which
contains the 50bp seed in the second chain. However, if we extend the 50bp seed, it yields a better alignment
[0,101) <=> [4591439966,4591440067) with a different starting position. The 26bp seed is wrong. This commit
adds a heuristic to fix this issue.
2014-04-30 14:14:20 -04:00
Heng Li 11698fc4e5 r735: fixed a bug caused by merge 2014-04-30 13:12:43 -04:00
Heng Li b603fed39c r733: bugfix - seed score unset when no -W 2014-04-29 14:58:53 -04:00
Heng Li 44754cd615 r731: separate layouter 2014-04-28 10:39:29 -04:00
Heng Li dadd5d6281 r730: more permissive about merging overlapping 2014-04-28 10:01:54 -04:00
Heng Li 76bb49e01b r729: halved band width; doubled patch band width 2014-04-24 16:06:01 -04:00
Heng Li 6052d3015b r728: sorting the end in mem_sort_dedup_patch()
The older version does this, which is correct.
2014-04-24 15:44:59 -04:00
Heng Li df65893fb5 r727: extend seeds with SW 2014-04-24 14:28:40 -04:00
Heng Li b92bbb47e5 Merge branch '0.7.7-softclip' into layout
Conflicts:
	Makefile
	bwamem.h
	fastmap.c
	main.c
2014-04-24 12:24:49 -04:00
Heng Li 8c12ec4a4b r725: optionally disable hard clipping
as is reqested by the cancer group
2014-04-24 11:56:43 -04:00
Heng Li b93fca2b2e r723: merge adjacent hits 2014-04-16 16:38:50 -04:00
Heng Li 48847af2fc code backup 2014-04-16 12:00:13 -04:00
Heng Li 00a07f61bf r721: merge overlapping hits by default 2014-04-15 16:16:04 -04:00
Heng Li 45f24b4ae8 r720: improved overlap hit merging 2014-04-15 16:09:42 -04:00
Heng Li bdb7b000cd r719: more stringent overlap merge
Will consider to make it the default
2014-04-15 14:52:17 -04:00
Heng Li 4e22270eba r718: merge alnregs overlapping on both query/ref 2014-04-14 17:01:17 -04:00
Heng Li 6d4a6debdc r716: changed -x pbread 2014-04-14 16:04:29 -04:00
Heng Li bbcabfe342 r707: change params for pacbio-to-pacbio 2014-04-10 21:53:52 -04:00
Heng Li 658f27eae4 Merge branch 'dev' into layout
Conflicts:
	main.c
2014-04-10 21:48:47 -04:00
Heng Li 6fda93502f r705: pairing performed on one chr only
Change of versioning: the revision number is acquired with:

  git rev-list --all --count

This counts the total number of commits across all branches.
2014-04-10 21:38:14 -04:00
Heng Li db4b171fa6 Merge branch 'dev' into layout
Conflicts:
	main.c
2014-04-10 21:09:47 -04:00
Heng Li 07182d9061 dev-475: -F outputs unit score, not raw score 2014-04-10 21:09:06 -04:00
Heng Li 7d25fe2de3 Merge branch 'dev' into layout
Conflicts:
	main.c
2014-04-10 21:07:16 -04:00