From 0753e772930db830cb620b75947695890b3cbb5c Mon Sep 17 00:00:00 2001 From: zzh Date: Tue, 14 Jan 2025 14:34:09 +0800 Subject: [PATCH] Fast NGS sequence alignment tool based on bwa-mem. --- .vscode/launch.json | 80 + .vscode/settings.json | 51 + .vscode/tasks.json | 17 + COPYING | 674 +++++++ ChangeLog | 3864 ++++++++++++++++++++++++++++++++++++++ Makefile | 99 + NEWS.md | 1223 ++++++++++++ QSufSort.c | 402 ++++ QSufSort.h | 45 + README-alt.md | 178 ++ README.md | 11 + bamlite.c | 210 +++ bamlite.h | 114 ++ bntseq.c | 500 +++++ bntseq.h | 92 + bwa.1 | 871 +++++++++ bwa.c | 857 +++++++++ bwa.h | 125 ++ bwakit/README.md | 115 ++ bwakit/bwa-postalt.js | 524 ++++++ bwakit/run-HLA | 20 + bwakit/run-bwamem | 187 ++ bwakit/run-gen-ref | 39 + bwakit/typeHLA-selctg.js | 62 + bwakit/typeHLA.js | 496 +++++ bwakit/typeHLA.sh | 49 + bwamem.c | 1663 ++++++++++++++++ bwamem.h | 266 +++ bwamem_extra.c | 172 ++ bwamem_pair.c | 699 +++++++ bwape.c | 784 ++++++++ bwase.c | 606 ++++++ bwase.h | 29 + bwaseqio.c | 235 +++ bwashm.c | 414 ++++ bwt.c | 638 +++++++ bwt.h | 184 ++ bwt_gen.c | 1629 ++++++++++++++++ bwt_lite.c | 98 + bwt_lite.h | 29 + bwtaln.c | 321 ++++ bwtaln.h | 153 ++ bwtgap.c | 264 +++ bwtgap.h | 40 + bwtindex.c | 453 +++++ bwtsw2.h | 69 + bwtsw2_aux.c | 779 ++++++++ bwtsw2_chain.c | 112 ++ bwtsw2_core.c | 619 ++++++ bwtsw2_main.c | 89 + bwtsw2_pair.c | 274 +++ code_of_conduct.md | 30 + debug.c | 59 + debug.h | 28 + example.c | 60 + fastmap.c | 771 ++++++++ fmt_idx.c | 1313 +++++++++++++ fmt_idx.h | 121 ++ h.txt | 100 + is.c | 223 +++ kbtree.h | 388 ++++ khash.h | 614 ++++++ kopen.c | 374 ++++ kseq.h | 239 +++ ksort.h | 273 +++ kstring.c | 39 + kstring.h | 115 ++ ksw.c | 789 ++++++++ ksw.h | 117 ++ ksw_align_avx2.c | 75 + ksw_extend2_avx2.c | 826 ++++++++ ksw_extend2_avx2_u8.c | 430 +++++ kthread.c | 147 ++ kvec.h | 94 + main.c | 142 ++ malloc_wrap.c | 57 + malloc_wrap.h | 47 + maxk.c | 67 + neon_sse.h | 33 + pemerge.c | 293 +++ profiling.c | 130 ++ profiling.h | 104 + qualfa2fq.pl | 27 + rle.c | 191 ++ rle.h | 72 + rope.c | 318 ++++ rope.h | 58 + run.sh | 14 + scalar_sse.h | 119 ++ utils.c | 455 +++++ utils.h | 158 ++ xa2multi.pl | 25 + yarn.c | 398 ++++ yarn.h | 139 ++ 94 files changed, 31596 insertions(+) create mode 100644 .vscode/launch.json create mode 100644 .vscode/settings.json create mode 100644 .vscode/tasks.json create mode 100644 COPYING create mode 100644 ChangeLog create mode 100644 Makefile create mode 100644 NEWS.md create mode 100644 QSufSort.c create mode 100644 QSufSort.h create mode 100644 README-alt.md create mode 100644 README.md create mode 100644 bamlite.c create mode 100644 bamlite.h create mode 100644 bntseq.c create mode 100644 bntseq.h create mode 100644 bwa.1 create mode 100644 bwa.c create mode 100644 bwa.h create mode 100644 bwakit/README.md create mode 100644 bwakit/bwa-postalt.js create mode 100755 bwakit/run-HLA create mode 100755 bwakit/run-bwamem create mode 100755 bwakit/run-gen-ref create mode 100644 bwakit/typeHLA-selctg.js create mode 100644 bwakit/typeHLA.js create mode 100755 bwakit/typeHLA.sh create mode 100644 bwamem.c create mode 100644 bwamem.h create mode 100644 bwamem_extra.c create mode 100644 bwamem_pair.c create mode 100644 bwape.c create mode 100644 bwase.c create mode 100644 bwase.h create mode 100644 bwaseqio.c create mode 100644 bwashm.c create mode 100644 bwt.c create mode 100644 bwt.h create mode 100644 bwt_gen.c create mode 100644 bwt_lite.c create mode 100644 bwt_lite.h create mode 100644 bwtaln.c create mode 100644 bwtaln.h create mode 100644 bwtgap.c create mode 100644 bwtgap.h create mode 100644 bwtindex.c create mode 100644 bwtsw2.h create mode 100644 bwtsw2_aux.c create mode 100644 bwtsw2_chain.c create mode 100644 bwtsw2_core.c create mode 100644 bwtsw2_main.c create mode 100644 bwtsw2_pair.c create mode 100644 code_of_conduct.md create mode 100644 debug.c create mode 100644 debug.h create mode 100644 example.c create mode 100644 fastmap.c create mode 100644 fmt_idx.c create mode 100644 fmt_idx.h create mode 100644 h.txt create mode 100644 is.c create mode 100644 kbtree.h create mode 100644 khash.h create mode 100644 kopen.c create mode 100644 kseq.h create mode 100644 ksort.h create mode 100644 kstring.c create mode 100644 kstring.h create mode 100644 ksw.c create mode 100644 ksw.h create mode 100644 ksw_align_avx2.c create mode 100644 ksw_extend2_avx2.c create mode 100644 ksw_extend2_avx2_u8.c create mode 100644 kthread.c create mode 100644 kvec.h create mode 100644 main.c create mode 100644 malloc_wrap.c create mode 100644 malloc_wrap.h create mode 100644 maxk.c create mode 100644 neon_sse.h create mode 100644 pemerge.c create mode 100644 profiling.c create mode 100644 profiling.h create mode 100755 qualfa2fq.pl create mode 100644 rle.c create mode 100644 rle.h create mode 100644 rope.c create mode 100644 rope.h create mode 100755 run.sh create mode 100644 scalar_sse.h create mode 100644 utils.c create mode 100644 utils.h create mode 100755 xa2multi.pl create mode 100644 yarn.c create mode 100644 yarn.h diff --git a/.vscode/launch.json b/.vscode/launch.json new file mode 100644 index 0000000..0a30413 --- /dev/null +++ b/.vscode/launch.json @@ -0,0 +1,80 @@ +{ + // 使用 IntelliSense 了解相关属性。 + // 悬停以查看现有属性的描述。 + // 欲了解更多信息,请访问: https://go.microsoft.com/fwlink/?linkid=830387 + "version": "0.2.0", + "configurations": [ + { + "name": "bwa-mem", + "preLaunchTask": "Build", + "type": "cppdbg", + "request": "launch", + "program": "${workspaceRoot}/fastbwa", + "args": [ + "mem", + "-t", + "1", + "-M", + "-R", + "'@RG\\tID:normal\\tSM:normal\\tPL:illumina\\tLB:normal\\tPG:bwa'", + "~/data1/fmt_ref/human_g1k_v37_decoy.fasta", + "~/data/fastq/dataset/na12878_wes_144/1w_1.fq", + "~/data/fastq/dataset/na12878_wes_144/1w_2.fq", + "-o", + "/dev/null", + "-Z" + ], + "cwd": "${workspaceFolder}", // 当前工作路径:当前文件所在的工作空间 + }, + { + "name": "index", + "preLaunchTask": "Build", + "type": "cppdbg", + "request": "launch", + "program": "${workspaceRoot}/fastbwa", + "args": [ + "index", + "~/data/reference/human_g1k_v37_decoy.fasta" + ], + "cwd": "${workspaceFolder}", // 当前工作路径:当前文件所在的工作空间 + }, + { + "name": "buildkmer", + "preLaunchTask": "Build", + "type": "cppdbg", + "request": "launch", + "program": "${workspaceRoot}/fastbwa", + "args": [ + "buildkmer", + "~/data/reference/human_g1k_v37_decoy.fasta.256.64.fmt", + "~/data/reference/human_g1k_v37_decoy.fasta.kmer" + ], + "cwd": "${workspaceFolder}", // 当前工作路径:当前文件所在的工作空间 + }, + { + "name": "share mem", + "preLaunchTask": "Build", + "type": "cppdbg", + "request": "launch", + "program": "${workspaceRoot}/fastbwa", + "args": [ + "shm", + "-Z", + "~/data1/fmt_ref/human_g1k_v37_decoy.fasta" + ], + "cwd": "${workspaceFolder}", // 当前工作路径:当前文件所在的工作空间 + }, + { + "name": "pac to bref", + "preLaunchTask": "Build", + "type": "cppdbg", + "request": "launch", + "program": "${workspaceRoot}/fastbwa", + "args": [ + "pac2bref", + "~/data1/fmt_ref/human_g1k_v37_decoy.fasta" + ], + "cwd": "${workspaceFolder}", // 当前工作路径:当前文件所在的工作空间 + } + ] +} \ No newline at end of file diff --git a/.vscode/settings.json b/.vscode/settings.json new file mode 100644 index 0000000..834a9a0 --- /dev/null +++ b/.vscode/settings.json @@ -0,0 +1,51 @@ +{ + "files.associations": { + "random": "c", + "bwt.h": "c", + "bwa.h": "c", + "*.tcc": "c", + "functional": "c", + "string_view": "c", + "istream": "c", + "limits": "c", + "bit": "c", + "numeric": "c", + "typeinfo": "c", + "yarn.h": "c", + "malloc_wrap.h": "c", + "emmintrin.h": "c", + "bwamem.h": "c", + "utils.h": "c", + "stdio.h": "c", + "kvec.h": "c", + "string.h": "c", + "stdlib.h": "c", + "array": "c", + "initializer_list": "c", + "utility": "c", + "fmt_idx.h": "c", + "profiling.h": "c", + "neon_sse.h": "c", + "scalar_sse.h": "c", + "immintrin.h": "c", + "ksw.h": "c", + "debug.h": "c", + "type_traits": "c", + "cstdint": "c", + "bitset": "c", + "iterator": "c", + "memory": "c", + "__locale": "c", + "stdint.h": "c", + "bntseq.h": "c", + "inttypes.h": "c", + "ertindex.h": "c", + "ertseeding.h": "c", + "algorithm": "c", + "filesystem": "c", + "deque": "cpp", + "string": "cpp", + "unordered_map": "cpp", + "vector": "cpp" + } +} \ No newline at end of file diff --git a/.vscode/tasks.json b/.vscode/tasks.json new file mode 100644 index 0000000..f76ae19 --- /dev/null +++ b/.vscode/tasks.json @@ -0,0 +1,17 @@ +{ + // See https://go.microsoft.com/fwlink/?LinkId=733558 + // for the documentation about the tasks.json format + "version": "2.0.0", + "tasks": [ + { + "label": "Build", + "type": "shell", + "command": "make clean; make -j 16", + "problemMatcher": [], + "group": { + "kind": "build", + "isDefault": true + } + } + ] +} \ No newline at end of file diff --git a/COPYING b/COPYING new file mode 100644 index 0000000..94a9ed0 --- /dev/null +++ b/COPYING @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/ChangeLog b/ChangeLog new file mode 100644 index 0000000..403e61f --- /dev/null +++ b/ChangeLog @@ -0,0 +1,3864 @@ +------------------------------------------------------------------------ +r1605 | lh3 | 2010-12-29 20:20:20 -0500 (Wed, 29 Dec 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.9rc1-2 (r1605) + * fixed a typo/bug in bwasw + +------------------------------------------------------------------------ +r1587 | lh3 | 2010-12-21 18:48:30 -0500 (Tue, 21 Dec 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +a typo in the manual + +------------------------------------------------------------------------ +r1586 | lh3 | 2010-12-21 18:47:48 -0500 (Tue, 21 Dec 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/utils.c + M /branches/prog/bwa/utils.h + + * bwa-0.5.9rc1-1 (r1586) + * a few patches by John + +------------------------------------------------------------------------ +r1562 | lh3 | 2010-12-10 01:02:06 -0500 (Fri, 10 Dec 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + +documentation on specifying @RG + +------------------------------------------------------------------------ +r1561 | lh3 | 2010-12-10 00:45:40 -0500 (Fri, 10 Dec 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.5.9rc1 (r1561) + +------------------------------------------------------------------------ +r1560 | lh3 | 2010-12-10 00:29:08 -0500 (Fri, 10 Dec 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/main.c + + * fixed a small memory leak caused by the BAM reader + * fixed a memory violation, also in the BAM reader + +------------------------------------------------------------------------ +r1559 | lh3 | 2010-12-10 00:10:48 -0500 (Fri, 10 Dec 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/Makefile + +change Makefile gcc options + +------------------------------------------------------------------------ +r1558 | lh3 | 2010-12-10 00:09:22 -0500 (Fri, 10 Dec 2010) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.5.8-6 (r1557) + * added a little more comments to BWA-SW + * randomly choosing a mapping if there are more than one + +------------------------------------------------------------------------ +r1557 | lh3 | 2010-12-09 21:58:00 -0500 (Thu, 09 Dec 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_aux.c + +sometimes unmapped reads may not be printed... + +------------------------------------------------------------------------ +r1556 | lh3 | 2010-12-09 21:50:26 -0500 (Thu, 09 Dec 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_aux.c + +print unmapped reads + +------------------------------------------------------------------------ +r1555 | lh3 | 2010-12-09 21:17:20 -0500 (Thu, 09 Dec 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.5.8-5 (r1555) + * BAM input documentation + +------------------------------------------------------------------------ +r1544 | lh3 | 2010-11-23 11:01:41 -0500 (Tue, 23 Nov 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.5.8-4 (r1544) + * supporting adding RG tags and RG lines + +------------------------------------------------------------------------ +r1543 | lh3 | 2010-11-23 00:16:40 -0500 (Tue, 23 Nov 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.5.8-3 (r1543) + * fixed a memory leak + +------------------------------------------------------------------------ +r1542 | lh3 | 2010-11-22 23:50:56 -0500 (Mon, 22 Nov 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.5.8-2 (r1542) + * fixed a long existing bug in random placement of reads + +------------------------------------------------------------------------ +r1541 | lh3 | 2010-11-22 23:27:29 -0500 (Mon, 22 Nov 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + A /branches/prog/bwa/bamlite.c + A /branches/prog/bwa/bamlite.h + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + +preliminary BAM input support + +------------------------------------------------------------------------ +r1537 | lh3 | 2010-10-16 23:46:20 -0400 (Sat, 16 Oct 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwa.1 + +change version number and ChangeLog + +------------------------------------------------------------------------ +r1536 | lh3 | 2010-10-16 23:35:10 -0400 (Sat, 16 Oct 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + + * fixed a bug in the scoring matrix + * release bwa-0.5.8c (r1536) + +------------------------------------------------------------------------ +r1451 | lh3 | 2010-06-15 09:43:52 -0400 (Tue, 15 Jun 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +version change + +------------------------------------------------------------------------ +r1450 | lh3 | 2010-06-15 09:42:21 -0400 (Tue, 15 Jun 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + + * bwa-0.5.8b (r1450) + * fixed a bug in scoring matrix + +------------------------------------------------------------------------ +r1445 | lh3 | 2010-06-11 08:58:33 -0400 (Fri, 11 Jun 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + +fixed a serious bug + +------------------------------------------------------------------------ +r1442 | lh3 | 2010-06-08 10:22:14 -0400 (Tue, 08 Jun 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.5.8 (r1442) + +------------------------------------------------------------------------ +r1440 | lh3 | 2010-05-19 13:43:50 -0400 (Wed, 19 May 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-r1440 + * sorry, forget to remove a debugging line + +------------------------------------------------------------------------ +r1439 | lh3 | 2010-05-19 13:43:08 -0400 (Wed, 19 May 2010) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-r1439 + * fixed a bug in bwasw caused by a recent modification + * throwing insane insert size when estimating isize + +------------------------------------------------------------------------ +r1425 | lh3 | 2010-04-29 15:15:23 -0400 (Thu, 29 Apr 2010) | 10 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.5.7-7 (r1425) + * fixed a minor bug in bwasw command-line parsing + * When band-width is not large enough, bwasw may find two highly + overlapping but not completely overlapping alignments. The old + version will filter out one of them, which leads to false + negatives. The current outputs both. This solution is obviously not + ideal. The ideal one would be to increase the band-width and redo the + alignment. + + +------------------------------------------------------------------------ +r1399 | lh3 | 2010-04-16 09:20:49 -0400 (Fri, 16 Apr 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.5.7-6 (r1399) + * fixed a typo/bug (by Vaughn Iverson) + +------------------------------------------------------------------------ +r1329 | lh3 | 2010-03-19 23:32:46 -0400 (Fri, 19 Mar 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + +small correction + +------------------------------------------------------------------------ +r1328 | lh3 | 2010-03-19 23:28:44 -0400 (Fri, 19 Mar 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.5.7-4 (r1328) + * automatically adjust ap_prior based on alignment + +------------------------------------------------------------------------ +r1327 | lh3 | 2010-03-19 23:02:40 -0400 (Fri, 19 Mar 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.5.7-3 (r1327) + * evaluate hits obtained from SW alignment in a more proper way. + +------------------------------------------------------------------------ +r1320 | lh3 | 2010-03-17 15:13:22 -0400 (Wed, 17 Mar 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwape.c + +fixed a potential out-of-boundary error. Need more testing. + +------------------------------------------------------------------------ +r1319 | lh3 | 2010-03-14 22:44:46 -0400 (Sun, 14 Mar 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/bwape.c + +insert size is `weird' if the 3rd quatile larger than 100,000bp + +------------------------------------------------------------------------ +r1318 | lh3 | 2010-03-14 22:37:35 -0400 (Sun, 14 Mar 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.5.7-2 (r1318) + * in sampe, allow to disable insert size estimate + +------------------------------------------------------------------------ +r1317 | lh3 | 2010-03-14 22:14:14 -0400 (Sun, 14 Mar 2010) | 5 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/solid2fastq.pl + + * bwa-0.5.7-1 (r1317) + * fixed a potential bug in solid2fastq.pl + * fixed a bug in calculating mapping quality (by Rodrigo Goya) + * fixed a very rare bug (if ever occur) about pairing + +------------------------------------------------------------------------ +r1310 | lh3 | 2010-03-01 10:35:45 -0500 (Mon, 01 Mar 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.5.7 + +------------------------------------------------------------------------ +r1309 | lh3 | 2010-02-26 21:42:22 -0500 (Fri, 26 Feb 2010) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.5.6-2 (r1309) + * fixed an unfixed bug (by Carol Scott) + * fixed some tiny formatting + +------------------------------------------------------------------------ +r1305 | lh3 | 2010-02-25 13:47:58 -0500 (Thu, 25 Feb 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.5.6-1 (r1304) + * optionally write output to a file (by Tim Fennel) + +------------------------------------------------------------------------ +r1303 | lh3 | 2010-02-10 23:43:48 -0500 (Wed, 10 Feb 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + +Release bwa-0.5.6 + +------------------------------------------------------------------------ +r1302 | lh3 | 2010-02-10 11:11:49 -0500 (Wed, 10 Feb 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.5.5-10 (r1302) + * improve max insert size estimate (method suggested by Gerton Lunter) + +------------------------------------------------------------------------ +r1301 | lh3 | 2010-02-09 16:15:28 -0500 (Tue, 09 Feb 2010) | 5 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.5.5-9 (r1301) + * improve mapping quality calculation for abnomalous pairs + * fixed a bug in multiple hits + * SOLiD multiple hits should work now + +------------------------------------------------------------------------ +r1300 | lh3 | 2010-02-09 12:50:02 -0500 (Tue, 09 Feb 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.5.5-8 (r1300) + * output kurtosis + +------------------------------------------------------------------------ +r1299 | lh3 | 2010-02-09 12:33:34 -0500 (Tue, 09 Feb 2010) | 5 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.5.5-7 (r1299) + * calculate skewness in sampe + * increase min_len in SW to 20 + * perform more SW to fix discordant pairs + +------------------------------------------------------------------------ +r1298 | lh3 | 2010-02-08 12:40:31 -0500 (Mon, 08 Feb 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/cs2nt.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.5.5-6 (r1297) + * prepare to replace all 16-bit CIGAR (patches by Rodrigo Goya) + +------------------------------------------------------------------------ +r1297 | lh3 | 2010-02-05 22:26:11 -0500 (Fri, 05 Feb 2010) | 2 lines +Changed paths: + M /branches/prog/bwa/solid2fastq.pl + +the old fix seems not working! + +------------------------------------------------------------------------ +r1296 | lh3 | 2010-02-05 21:51:03 -0500 (Fri, 05 Feb 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.5.5-5 (r1296) + * fixed a minor issue that the lower bound of insert size is not correctly set. + +------------------------------------------------------------------------ +r1295 | lh3 | 2010-02-05 21:01:10 -0500 (Fri, 05 Feb 2010) | 5 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/main.c + + * bwa-0.5.5-4 (r1295) + * fixed a memory leak + * change the behaviour of -n (samse and sampe) + * change the default of -n + +------------------------------------------------------------------------ +r1294 | lh3 | 2010-02-05 17:24:06 -0500 (Fri, 05 Feb 2010) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.5.5-3 (r1294) + * improved multi-hit report + +------------------------------------------------------------------------ +r1293 | lh3 | 2010-02-05 12:57:38 -0500 (Fri, 05 Feb 2010) | 5 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/cs2nt.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/solid2fastq.pl + + * bwa-0.5.5-2 (r1293) + * bugfix: truncated quality string + * bugfix: quality -1 in solid->fastq conversion + * bugfix: color reads on the reverse strand is not complemented + +------------------------------------------------------------------------ +r1279 | lh3 | 2009-11-23 22:42:34 -0500 (Mon, 23 Nov 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/bwase.c + A /branches/prog/bwa/bwase.h + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.5-1 (r1279) + * incorporate changes from Matt Hanna for Java bindings. + +------------------------------------------------------------------------ +r1275 | lh3 | 2009-11-10 22:13:10 -0500 (Tue, 10 Nov 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + +update ChangeLog + +------------------------------------------------------------------------ +r1273 | lh3 | 2009-11-10 22:08:16 -0500 (Tue, 10 Nov 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + A /branches/prog/bwa/qualfa2fq.pl + +Release bwa-0.5.5 (r1273) + +------------------------------------------------------------------------ +r1272 | lh3 | 2009-11-10 22:02:50 -0500 (Tue, 10 Nov 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.5.4-3 (r1272) + * fixed another typo which may lead to incorrect single-end mapping quality + +------------------------------------------------------------------------ +r1271 | lh3 | 2009-11-10 21:59:47 -0500 (Tue, 10 Nov 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.5.4-2 (r1271) + * fixed a serious typo/bug which does not hurt if we allow one gap open + and work with <200bp reads, but causes segfault for long reads. + +------------------------------------------------------------------------ +r1270 | lh3 | 2009-11-09 23:12:42 -0500 (Mon, 09 Nov 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/cs2nt.c + M /branches/prog/bwa/main.c + + * bwa-0.5.4-1 (r1270) + * fixed a bug in color alignment + +------------------------------------------------------------------------ +r1245 | lh3 | 2009-10-09 07:42:52 -0400 (Fri, 09 Oct 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/main.c + +Release bwa-0.5.4 + +------------------------------------------------------------------------ +r1244 | lh3 | 2009-10-09 05:53:52 -0400 (Fri, 09 Oct 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + + * bwa-0.5.3-4 (r1244) + * output the clipped length in XC:i: tag + * skip mate alignment when stdaln is buggy + * fixed a bug in NM:i: tag + +------------------------------------------------------------------------ +r1243 | lh3 | 2009-10-07 08:15:04 -0400 (Wed, 07 Oct 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.5.3-3 (r1243) + * sampe: fixed a bug when a read sequence is identical its reverse complement. + +------------------------------------------------------------------------ +r1242 | lh3 | 2009-10-07 07:49:13 -0400 (Wed, 07 Oct 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.5.3-2 (r1242) + * sampe: optionall preload the full index into memory + * aln: change the default seed length to 32bp + +------------------------------------------------------------------------ +r1238 | lh3 | 2009-09-26 18:38:15 -0400 (Sat, 26 Sep 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/khash.h + +Improve portability of khash.h + +------------------------------------------------------------------------ +r1228 | lh3 | 2009-09-15 09:20:22 -0400 (Tue, 15 Sep 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/main.c + +fixed a typo + +------------------------------------------------------------------------ +r1227 | lh3 | 2009-09-15 09:19:35 -0400 (Tue, 15 Sep 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.5.3-1 (r1226) + * in dBWT-SW, optionall use hard clipping instead of soft clipping + +------------------------------------------------------------------------ +r1225 | lh3 | 2009-09-15 08:32:30 -0400 (Tue, 15 Sep 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + +Release bwa-0.5.3 (r1225) + +------------------------------------------------------------------------ +r1223 | lh3 | 2009-09-13 07:30:41 -0400 (Sun, 13 Sep 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.5.2 + +------------------------------------------------------------------------ +r1222 | lh3 | 2009-09-11 09:11:39 -0400 (Fri, 11 Sep 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.5.1-5 (r1222) + * fixed a typo. No real change + +------------------------------------------------------------------------ +r1221 | lh3 | 2009-09-11 09:09:44 -0400 (Fri, 11 Sep 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.5.1-4 (r1221) + * trim reads before alignment + +------------------------------------------------------------------------ +r1216 | lh3 | 2009-09-08 17:50:15 -0400 (Tue, 08 Sep 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.5.1-3 (r1216) + * fixed a bug about NM tags for gapped alignment + * print SAM header + +------------------------------------------------------------------------ +r1215 | lh3 | 2009-09-08 17:14:42 -0400 (Tue, 08 Sep 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.5.1-2 (r1215) + * fixed a bug when read lengths vary (by John Marshall) + +------------------------------------------------------------------------ +r1213 | lh3 | 2009-09-06 18:58:15 -0400 (Sun, 06 Sep 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.1-1 (r1213) + * change default -T to 30 + +------------------------------------------------------------------------ +r1209 | lh3 | 2009-09-02 06:06:02 -0400 (Wed, 02 Sep 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.5.1 + +------------------------------------------------------------------------ +r1208 | lh3 | 2009-09-02 05:56:33 -0400 (Wed, 02 Sep 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + + * ChangeLog + +------------------------------------------------------------------------ +r1206 | lh3 | 2009-08-30 18:27:30 -0400 (Sun, 30 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.0-6 (r1206) + * fixed two bugs caused by previous modification + +------------------------------------------------------------------------ +r1205 | lh3 | 2009-08-30 17:28:36 -0400 (Sun, 30 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.0-4 (r1205) + * reduce false coordinates and CIGAR when a query bridges two reference + sequences, although some very rare cases may fail bwa. + +------------------------------------------------------------------------ +r1204 | lh3 | 2009-08-30 06:06:16 -0400 (Sun, 30 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.5.0-3 (r1204) + * choose one repetitive hit to extend + +------------------------------------------------------------------------ +r1203 | lh3 | 2009-08-29 18:11:51 -0400 (Sat, 29 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.0-2 (r1203) + * dBWT-SW: change a parameter in calculating mapping quality + * fixed a bug in samse + +------------------------------------------------------------------------ +r1202 | lh3 | 2009-08-28 19:48:41 -0400 (Fri, 28 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.5.0-1 (r1202) + * change default band width to 50 + * improve mapping quality a bit + +------------------------------------------------------------------------ +r1200 | lh3 | 2009-08-20 06:21:24 -0400 (Thu, 20 Aug 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.5.0 (r1200) + +------------------------------------------------------------------------ +r1199 | lh3 | 2009-08-20 04:49:15 -0400 (Thu, 20 Aug 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwa.1 + +Updated ChangeLog and the manual + +------------------------------------------------------------------------ +r1198 | lh3 | 2009-08-19 11:09:15 -0400 (Wed, 19 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-36 (r1198) + * simplify duphits removal. The accuracy is changed a tiny bit, sometimes better, sometimes worse. + +------------------------------------------------------------------------ +r1197 | lh3 | 2009-08-19 08:15:05 -0400 (Wed, 19 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_aux.c + A /branches/prog/bwa/bwtsw2_chain.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-35 (r1197) + * further heuristic acceleration for long queries + +------------------------------------------------------------------------ +r1196 | lh3 | 2009-08-18 06:54:03 -0400 (Tue, 18 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-34 (r1196) + * updated the manual page + * output base quality if the input is fastq + +------------------------------------------------------------------------ +r1195 | lh3 | 2009-08-18 06:23:00 -0400 (Tue, 18 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/simple_dp.c + + * bwa-0.4.9-33 (r1191) + * fixed a bug in sampe/samse when gaps occur to the 5'-end in SW alignment + * in dbwtsw adjust -T and -c according to -a + +------------------------------------------------------------------------ +r1192 | lh3 | 2009-08-13 05:37:28 -0400 (Thu, 13 Aug 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update manual + +------------------------------------------------------------------------ +r1191 | lh3 | 2009-08-12 19:40:51 -0400 (Wed, 12 Aug 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwtsw2_main.c + +update documentation + +------------------------------------------------------------------------ +r1190 | lh3 | 2009-08-12 08:56:10 -0400 (Wed, 12 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-32 (r1190) + * only help messages are changed + +------------------------------------------------------------------------ +r1189 | lh3 | 2009-08-11 09:28:55 -0400 (Tue, 11 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-31 (r1189) + * in bwape/bwase, print CIGAR "*" if the read is unmapped + * improved the calculation of mapping quality + +------------------------------------------------------------------------ +r1181 | lh3 | 2009-08-03 12:09:41 -0400 (Mon, 03 Aug 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + +fflush() + +------------------------------------------------------------------------ +r1180 | lh3 | 2009-08-03 12:08:46 -0400 (Mon, 03 Aug 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-30 (r1180) + * fixed a memory problem + * multi-threading sometimes does not work... + +------------------------------------------------------------------------ +r1179 | lh3 | 2009-08-03 11:04:39 -0400 (Mon, 03 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-29 (r1179) + * preliminary mutli-threading support in dbwtsw + +------------------------------------------------------------------------ +r1178 | lh3 | 2009-08-03 09:14:54 -0400 (Mon, 03 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-28 (r1178) + * fixed a bug in printing repetitive hits + +------------------------------------------------------------------------ +r1177 | lh3 | 2009-08-03 05:03:42 -0400 (Mon, 03 Aug 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-27 (r1177) + * bwtsw2: fixed a hidden memory leak + +------------------------------------------------------------------------ +r1176 | lh3 | 2009-07-31 10:58:24 -0400 (Fri, 31 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-26 + * change the way mapping quality is calculated + +------------------------------------------------------------------------ +r1175 | lh3 | 2009-07-31 09:15:54 -0400 (Fri, 31 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-25 + * code clean up + * automatically adjust ->t and ->is_rev based on input + +------------------------------------------------------------------------ +r1174 | lh3 | 2009-07-30 08:50:25 -0400 (Thu, 30 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-24 + * fixed a bug in printing the hits + +------------------------------------------------------------------------ +r1173 | lh3 | 2009-07-29 18:32:43 -0400 (Wed, 29 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-23 + * allow to skip reverse alignment + * increase opt->t to 37 + +------------------------------------------------------------------------ +r1172 | lh3 | 2009-07-29 17:22:39 -0400 (Wed, 29 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-22 + * report if the hit is found in both directions + +------------------------------------------------------------------------ +r1171 | lh3 | 2009-07-29 17:12:02 -0400 (Wed, 29 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-21 + * dbwtsw: map to both forward and reverse BWT to reduce false alignment + +------------------------------------------------------------------------ +r1170 | lh3 | 2009-07-29 15:25:14 -0400 (Wed, 29 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + +save hits before cut_tail() + +------------------------------------------------------------------------ +r1169 | lh3 | 2009-07-29 08:06:01 -0400 (Wed, 29 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.4.9-19 + * use a global memory pool to reduce the CPU time spent on malloc/free(). + +------------------------------------------------------------------------ +r1168 | lh3 | 2009-07-29 06:13:29 -0400 (Wed, 29 Jul 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-18 + * reduce unnecessary extension to the 5'-end + * allow to use different interval size for the 2 rounds + * change default parameters + +------------------------------------------------------------------------ +r1167 | lh3 | 2009-07-28 19:06:17 -0400 (Tue, 28 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-17 + * dbwtsw: fixed THE memory leak. + +------------------------------------------------------------------------ +r1166 | lh3 | 2009-07-28 16:31:41 -0400 (Tue, 28 Jul 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + + * bwa-0.4.9-16 + * fixed a memory leak + * a small memory leak still occurs to bwtsw2_core(). I will work on that later. + * changed the default parameters + +------------------------------------------------------------------------ +r1165 | lh3 | 2009-07-28 10:15:40 -0400 (Tue, 28 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + + * bwa-0.4.9-15 + * generate CIGAR right before output. This saves unnecessary computation. + * this version may be buggy as I have not tested it. + +------------------------------------------------------------------------ +r1164 | lh3 | 2009-07-28 09:04:14 -0400 (Tue, 28 Jul 2009) | 11 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.4.9-14 + + * deplete unique hits in dbwtsw and postprocess them with standard sw + + * in principle, this stratgy should be faster and more accurate, but I + have not tested this point. I may switch back to the old method if + this does not work. + + * the code looks quite nasty now. it needs clean up... + + +------------------------------------------------------------------------ +r1163 | lh3 | 2009-07-27 17:41:10 -0400 (Mon, 27 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + +change a default parameter + +------------------------------------------------------------------------ +r1162 | lh3 | 2009-07-27 17:04:35 -0400 (Mon, 27 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-13 + * dbwtsw: switch between small and large Z-best + +------------------------------------------------------------------------ +r1161 | lh3 | 2009-07-27 12:17:41 -0400 (Mon, 27 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-12 + * changed the default -z to 100 + * heuristically speed up alignments for polyA reads + +------------------------------------------------------------------------ +r1160 | lh3 | 2009-07-27 07:50:57 -0400 (Mon, 27 Jul 2009) | 6 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-11 + + * dbwtsw potentially generates less false alignments, although in + practice, the modification brings no improvement. + + +------------------------------------------------------------------------ +r1159 | lh3 | 2009-07-27 04:37:02 -0400 (Mon, 27 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-10 + * disabled debugging code + * add "BAM_FMU" if both ends are unmapped + +------------------------------------------------------------------------ +r1158 | lh3 | 2009-07-24 09:36:52 -0400 (Fri, 24 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/main.c + +nothing, really + +------------------------------------------------------------------------ +r1157 | lh3 | 2009-07-24 09:05:44 -0400 (Fri, 24 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-9 + * bwtsw2: generate SAM output + +------------------------------------------------------------------------ +r1156 | lh3 | 2009-07-24 05:42:47 -0400 (Fri, 24 Jul 2009) | 6 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-8 + + * fixed a weird deadloop which only happens to icc -O3. Thanks John + Marshall for the fix. + + +------------------------------------------------------------------------ +r1155 | lh3 | 2009-07-24 05:28:40 -0400 (Fri, 24 Jul 2009) | 8 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-7 + + * fixed a typo in bwtsw2 alignment. Now score from the standard SW + seems to agree with score from bwtsw2, except that in reporting + alignments, bwtsw2 may report non-optimal segments. This is expected, + though. I will improve in future. + + +------------------------------------------------------------------------ +r1154 | lh3 | 2009-07-23 17:40:20 -0400 (Thu, 23 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * aln_left_core() seems to work properly + * aln_local_core() has a bug... AN EVER EXISTING BUG!!!!!!!!!!! + +------------------------------------------------------------------------ +r1153 | lh3 | 2009-07-23 17:06:09 -0400 (Thu, 23 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/stdaln.c + +removed debugging code... + +------------------------------------------------------------------------ +r1152 | lh3 | 2009-07-23 17:01:00 -0400 (Thu, 23 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/stdaln.c + + * radical changes failed... + * fixed a bug + +------------------------------------------------------------------------ +r1151 | lh3 | 2009-07-23 14:46:35 -0400 (Thu, 23 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/stdaln.c + +temporary changes. Will apply some radical changes to this file... + +------------------------------------------------------------------------ +r1150 | lh3 | 2009-07-23 10:09:56 -0400 (Thu, 23 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/stdaln.c + +fixed a long-existing bug in Smith-Waterman alignment + +------------------------------------------------------------------------ +r1149 | lh3 | 2009-07-23 08:50:52 -0400 (Thu, 23 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/simple_dp.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.4.9-6 + * unexplained inconsistency still occurs, but the results largely look reasonable. + +------------------------------------------------------------------------ +r1148 | lh3 | 2009-07-23 08:07:29 -0400 (Thu, 23 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/stdaln.c + +half DP + +------------------------------------------------------------------------ +r1147 | lh3 | 2009-07-22 08:03:06 -0400 (Wed, 22 Jul 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + +a bit code clean up + +------------------------------------------------------------------------ +r1145 | lh3 | 2009-07-21 15:52:05 -0400 (Tue, 21 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-5 + * fixed a bug in determining sub-optimal hits + * removed some debugging codes + +------------------------------------------------------------------------ +r1144 | lh3 | 2009-07-21 10:17:29 -0400 (Tue, 21 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-4 + * better cmd interface + * faster speed + +------------------------------------------------------------------------ +r1143 | lh3 | 2009-07-20 16:38:18 -0400 (Mon, 20 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + +bwtsw2 (dBWT-SW) is working apparently... + + +------------------------------------------------------------------------ +r1139 | lh3 | 2009-07-15 05:52:18 -0400 (Wed, 15 Jul 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.4.9-2 + * bwtsw2: change cut_tail() such that it is faster but more likely to + miss true hits + +------------------------------------------------------------------------ +r1138 | lh3 | 2009-07-15 05:18:42 -0400 (Wed, 15 Jul 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + A /branches/prog/bwa/bwt_lite.c + A /branches/prog/bwa/bwt_lite.h + A /branches/prog/bwa/bwtsw2.h + A /branches/prog/bwa/bwtsw2_aux.c + A /branches/prog/bwa/bwtsw2_core.c + A /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * bwa-0.4.9-1 + * added back bwtsw2 + +------------------------------------------------------------------------ +r1075 | lh3 | 2009-05-19 05:14:50 -0400 (Tue, 19 May 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + +Release bwa-0.4.9 + +------------------------------------------------------------------------ +r1073 | lh3 | 2009-05-18 17:13:19 -0400 (Mon, 18 May 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.4.8 + +------------------------------------------------------------------------ +r1069 | lh3 | 2009-05-14 09:54:54 -0400 (Thu, 14 May 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.4.7-2 + * change the default of "aln -R" to 30 + +------------------------------------------------------------------------ +r1068 | lh3 | 2009-05-14 09:27:55 -0400 (Thu, 14 May 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.4.7-1 + * search for suboptimal hits if the top hit is not so repetitive + +------------------------------------------------------------------------ +r1066 | lh3 | 2009-05-12 15:31:31 -0400 (Tue, 12 May 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + +Release bwa-0.4.7 + +------------------------------------------------------------------------ +r1065 | lh3 | 2009-05-12 15:20:40 -0400 (Tue, 12 May 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.6-9 + * fixed compiling errors on some Linux machines + +------------------------------------------------------------------------ +r1064 | lh3 | 2009-05-12 07:30:46 -0400 (Tue, 12 May 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.4.6-8 + * avoid compilation error on some systems. + +------------------------------------------------------------------------ +r1035 | lh3 | 2009-05-09 05:41:33 -0400 (Sat, 09 May 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.6-7 + * fixed an integer overflow caused by previous modifications + * made insert size estimation more robust + +------------------------------------------------------------------------ +r1008 | lh3 | 2009-04-29 05:41:58 -0400 (Wed, 29 Apr 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.6-5 + * fixed a integer overflow problem which may cause seg fault in very rare cases + * made XN tags more accurate + +------------------------------------------------------------------------ +r1005 | lh3 | 2009-04-27 07:37:23 -0400 (Mon, 27 Apr 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/simple_dp.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.4.6-4 + * heuristic rules to detect suboptimal alignment + * stdsw: support double-strand and protein alignment + +------------------------------------------------------------------------ +r1003 | lh3 | 2009-04-26 12:48:19 -0400 (Sun, 26 Apr 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/main.c + M /branches/prog/bwa/simple_dp.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.4.6-2 + * improve the functionality of stdsw + * allow to add a threshold on SW alignment. Hope this does not incur new bugs... + +------------------------------------------------------------------------ +r1002 | lh3 | 2009-04-22 03:56:15 -0400 (Wed, 22 Apr 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.4.6-1 + * output SM and AM tag + +------------------------------------------------------------------------ +r914 | lh3 | 2009-03-09 17:53:50 -0400 (Mon, 09 Mar 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.4.6 + +------------------------------------------------------------------------ +r913 | lh3 | 2009-03-09 17:23:24 -0400 (Mon, 09 Mar 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + A /branches/prog/bwa/solid2fastq.pl + + * added notes to bwa + * added a script to convert SOLiD reads + * updated documentations + +------------------------------------------------------------------------ +r912 | lh3 | 2009-03-09 16:57:05 -0400 (Mon, 09 Mar 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/kstring.c + M /branches/prog/bwa/main.c + +fixed a bug in kstring + +------------------------------------------------------------------------ +r881 | lh3 | 2009-03-02 15:36:06 -0500 (Mon, 02 Mar 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtmisc.c + M /branches/prog/bwa/main.c + + * bwa-0.4.5-7 + * fixed a bug in pac2cspac + +------------------------------------------------------------------------ +r880 | lh3 | 2009-03-01 16:34:08 -0500 (Sun, 01 Mar 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + +disable debugging + +------------------------------------------------------------------------ +r879 | lh3 | 2009-03-01 16:28:04 -0500 (Sun, 01 Mar 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/cs2nt.c + M /branches/prog/bwa/main.c + + * bwa-0.4.5-6 + * fixed problems with coordinates for color gapped alignment + +------------------------------------------------------------------------ +r878 | lh3 | 2009-03-01 13:43:09 -0500 (Sun, 01 Mar 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/cs2nt.c + M /branches/prog/bwa/main.c + + * bwa-0.4.5-5 + * added support for gapped color alignment + +------------------------------------------------------------------------ +r877 | lh3 | 2009-03-01 10:27:52 -0500 (Sun, 01 Mar 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/cs2nt.c + M /branches/prog/bwa/main.c + + * convert cs read to nt read (for ungapped alignment only) + +------------------------------------------------------------------------ +r860 | lh3 | 2009-02-27 08:58:39 -0500 (Fri, 27 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwase.c + A /branches/prog/bwa/cs2nt.c + +prepare to implement cs->nt conversion (have not yet...) + +------------------------------------------------------------------------ +r859 | lh3 | 2009-02-27 07:00:03 -0500 (Fri, 27 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/bwtmisc.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * bwa-0.4.5-3 + * generate color index from nucleotide fasta reference + +------------------------------------------------------------------------ +r857 | lh3 | 2009-02-26 10:22:58 -0500 (Thu, 26 Feb 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.4.5-2 + * improved mapping quality a bit if one end falls in a tandem repeat + but the mate is unique. + +------------------------------------------------------------------------ +r856 | lh3 | 2009-02-26 10:02:29 -0500 (Thu, 26 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.4.5-1 + * make bwa work for SOLiD reads + +------------------------------------------------------------------------ +r828 | lh3 | 2009-02-18 17:36:41 -0500 (Wed, 18 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.4.5 + +------------------------------------------------------------------------ +r827 | lh3 | 2009-02-18 16:48:48 -0500 (Wed, 18 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/main.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.4.4-6 + * fixed a bug in SW alignment when no residue matches + +------------------------------------------------------------------------ +r824 | lh3 | 2009-02-17 05:33:07 -0500 (Tue, 17 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.4.4-5 + * fixed that bounary bug + +------------------------------------------------------------------------ +r823 | lh3 | 2009-02-17 04:54:18 -0500 (Tue, 17 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwape.c + +just change some logging information + +------------------------------------------------------------------------ +r822 | lh3 | 2009-02-17 04:20:39 -0500 (Tue, 17 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update manual + +------------------------------------------------------------------------ +r821 | lh3 | 2009-02-17 04:11:14 -0500 (Tue, 17 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.4-4 + * fixed a bug on boundary check in pair_sw + +------------------------------------------------------------------------ +r820 | lh3 | 2009-02-16 17:43:37 -0500 (Mon, 16 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.4.4-3 + * allow to change mismatch penalty + +------------------------------------------------------------------------ +r819 | lh3 | 2009-02-16 17:40:28 -0500 (Mon, 16 Feb 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.4.4-2 + * remove timer + * allow to change default gapo and gape penalty at the command line + +------------------------------------------------------------------------ +r818 | lh3 | 2009-02-16 09:30:51 -0500 (Mon, 16 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update benchmark + +------------------------------------------------------------------------ +r817 | lh3 | 2009-02-16 08:44:40 -0500 (Mon, 16 Feb 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/kvec.h + M /branches/prog/bwa/main.c + + * bwa-0.4.4-1 + * automatically detect insert size + * use insert size in pairing. This may potentially improve accuracy (untested!) + +------------------------------------------------------------------------ +r814 | lh3 | 2009-02-15 11:10:23 -0500 (Sun, 15 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.4.4 + +------------------------------------------------------------------------ +r813 | lh3 | 2009-02-15 10:22:50 -0500 (Sun, 15 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.3-5 + * impose boundary check in refine_gapped + +------------------------------------------------------------------------ +r811 | lh3 | 2009-02-14 09:46:13 -0500 (Sat, 14 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.3-4 + * change MD tag to match the latest SAM specification + +------------------------------------------------------------------------ +r810 | lh3 | 2009-02-13 04:46:04 -0500 (Fri, 13 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + +update ChangeLog + +------------------------------------------------------------------------ +r799 | lh3 | 2009-02-05 12:01:17 -0500 (Thu, 05 Feb 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + +change MD tag to meet the latest SAM specification + +------------------------------------------------------------------------ +r796 | lh3 | 2009-02-05 08:35:13 -0500 (Thu, 05 Feb 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.3-2 + * fixed a bug on counting 'N' + +------------------------------------------------------------------------ +r795 | lh3 | 2009-02-05 07:41:27 -0500 (Thu, 05 Feb 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.4.3-1 + * fixed potential boundary problems + * update benchmark result + +------------------------------------------------------------------------ +r791 | lh3 | 2009-01-25 05:20:47 -0500 (Sun, 25 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update some numbers + +------------------------------------------------------------------------ +r790 | lh3 | 2009-01-24 15:13:03 -0500 (Sat, 24 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update benchmark + +------------------------------------------------------------------------ +r789 | lh3 | 2009-01-22 10:18:44 -0500 (Thu, 22 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtindex.c + +a warning message for index + +------------------------------------------------------------------------ +r788 | lh3 | 2009-01-22 09:54:06 -0500 (Thu, 22 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/main.c + +forget to change release number + +------------------------------------------------------------------------ +r786 | lh3 | 2009-01-22 06:27:39 -0500 (Thu, 22 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + +Release bwa-0.4.3 + +------------------------------------------------------------------------ +r785 | lh3 | 2009-01-22 06:27:16 -0500 (Thu, 22 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + +Release bwa-0.4.3 + +------------------------------------------------------------------------ +r784 | lh3 | 2009-01-22 06:19:59 -0500 (Thu, 22 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-10 + * update documentation + * fixed a bug on generating MD tags for SW alignment + +------------------------------------------------------------------------ +r782 | lh3 | 2009-01-19 12:08:38 -0500 (Mon, 19 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-9 + * fixed a bug in samse -n... + +------------------------------------------------------------------------ +r781 | lh3 | 2009-01-19 11:26:37 -0500 (Mon, 19 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-8 + * given -N, the previous version would stop if the top hit is a repeat. Now changed. + +------------------------------------------------------------------------ +r780 | lh3 | 2009-01-19 11:20:18 -0500 (Mon, 19 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-7 + * use a bit-wise flag to replace some member variables in the option struct + * allow to switch off the iterative strategy + +------------------------------------------------------------------------ +r779 | lh3 | 2009-01-19 10:45:57 -0500 (Mon, 19 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-6 + * allow to dump multiple hits from samse, in another format, though + +------------------------------------------------------------------------ +r778 | lh3 | 2009-01-19 06:24:29 -0500 (Mon, 19 Jan 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/kseq.h + A /branches/prog/bwa/kstring.c + A /branches/prog/bwa/kstring.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/simple_dp.c + + * bwa-0.4.2-5 + * update kseq.h to the latest version + * generate MD tag + * print mate coordinate if only one end is unmapped + +------------------------------------------------------------------------ +r775 | lh3 | 2009-01-18 05:40:35 -0500 (Sun, 18 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-4 + * fixed a bug for SAM format + +------------------------------------------------------------------------ +r774 | lh3 | 2009-01-17 13:48:52 -0500 (Sat, 17 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-3 + * change default fnr to 0.04 + * print max_diff for valid fnr + +------------------------------------------------------------------------ +r773 | lh3 | 2009-01-17 05:54:37 -0500 (Sat, 17 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.4.2-2 + * automatically choose max_diff + +------------------------------------------------------------------------ +r772 | lh3 | 2009-01-16 18:16:14 -0500 (Fri, 16 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.4.2-1 + * take N as a mismatch + +------------------------------------------------------------------------ +r768 | lh3 | 2009-01-09 11:57:23 -0500 (Fri, 09 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/main.c + +Release bwa-0.4.2 + +------------------------------------------------------------------------ +r759 | lh3 | 2009-01-07 09:55:43 -0500 (Wed, 07 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + +Release bwa-0.4.1 + +------------------------------------------------------------------------ +r758 | lh3 | 2009-01-07 05:36:06 -0500 (Wed, 07 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.4.0-2 + * make mate_sw fully working + +------------------------------------------------------------------------ +r757 | lh3 | 2009-01-06 18:04:29 -0500 (Tue, 06 Jan 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.4.0-1 + * do SW alignment for unmapped mate. It is working. + * I still need to do some extra work for SW alignment, but it is too late + and I am getting tired... I will do tomorrow. + +------------------------------------------------------------------------ +r755 | lh3 | 2009-01-06 10:23:29 -0500 (Tue, 06 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.4.0 + +------------------------------------------------------------------------ +r754 | lh3 | 2009-01-06 07:45:02 -0500 (Tue, 06 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/main.c + + * bwa-0.3.0-12 + * better lock + +------------------------------------------------------------------------ +r753 | lh3 | 2009-01-06 06:17:21 -0500 (Tue, 06 Jan 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-11 + * fixed a small memory leak in bwa_seq_close() + * fixed "uninitialized memory" from bwt_aln1_t + * multithreading for "aln" command + +------------------------------------------------------------------------ +r752 | lh3 | 2009-01-05 17:34:13 -0500 (Mon, 05 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + D /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwt_gen/bwt_gen.c + A /branches/prog/bwa/bwtmisc.c (from /branches/prog/bwa/pac2bwt.c:748) + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + D /branches/prog/bwa/pac2bwt.c + + * bwa-0.3.0-10 + * a little bit code clean up + +------------------------------------------------------------------------ +r751 | lh3 | 2009-01-05 17:19:04 -0500 (Mon, 05 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-9 + * use 64-bit integer to speed up Occ calculate, although just a little bit + +------------------------------------------------------------------------ +r750 | lh3 | 2009-01-05 16:44:26 -0500 (Mon, 05 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-8 + * a little bit code cleanup + +------------------------------------------------------------------------ +r749 | lh3 | 2009-01-05 16:37:28 -0500 (Mon, 05 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-7 + * accelerate Occ calculation + +------------------------------------------------------------------------ +r748 | lh3 | 2009-01-05 16:12:28 -0500 (Mon, 05 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + M /branches/prog/bwa/pac2bwt.c + + * bwa-0.3.0-6 + * put occ table along with bwt to save another cache miss + * this version is already faster than the previous and I can still improve it... + +------------------------------------------------------------------------ +r747 | lh3 | 2009-01-05 10:16:18 -0500 (Mon, 05 Jan 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-5 + * remove occ_major to save a cache miss; however, OCC_INTERVAL has to be + increased to keep the same memory. As a result, the speed is a little + slower in fact. + +------------------------------------------------------------------------ +r746 | lh3 | 2009-01-05 09:50:53 -0500 (Mon, 05 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-4 + * added back optimization codes (it is a pain...) + +------------------------------------------------------------------------ +r745 | lh3 | 2009-01-05 08:23:00 -0500 (Mon, 05 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-3 + * faster bit operations + +------------------------------------------------------------------------ +r744 | lh3 | 2009-01-05 05:58:46 -0500 (Mon, 05 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-2 + * removed optimization codes again... + * use a new method to count the bits + +------------------------------------------------------------------------ +r743 | lh3 | 2009-01-04 17:18:38 -0500 (Sun, 04 Jan 2009) | 5 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.3.0-1 + * added back the optimization codes + * added a new option to aln: max_entries, although this is disabled by default + * updated benchmark + +------------------------------------------------------------------------ +r742 | lh3 | 2009-01-04 07:56:12 -0500 (Sun, 04 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +add URL + +------------------------------------------------------------------------ +r740 | lh3 | 2009-01-04 07:39:43 -0500 (Sun, 04 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.3.0 + +------------------------------------------------------------------------ +r739 | lh3 | 2009-01-04 06:55:06 -0500 (Sun, 04 Jan 2009) | 2 lines +Changed paths: + A /branches/prog/bwa/COPYING + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/utils.c + M /branches/prog/bwa/utils.h + +added licensing information + +------------------------------------------------------------------------ +r738 | lh3 | 2009-01-04 06:18:25 -0500 (Sun, 04 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-31 + * better mapping quality + * update benchmark + +------------------------------------------------------------------------ +r737 | lh3 | 2009-01-03 16:00:58 -0500 (Sat, 03 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwa.1 + +update documentation + +------------------------------------------------------------------------ +r736 | lh3 | 2009-01-02 10:26:38 -0500 (Fri, 02 Jan 2009) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update documentation + +------------------------------------------------------------------------ +r735 | lh3 | 2009-01-02 07:10:20 -0500 (Fri, 02 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-30 + * reduce memory a little bit + * update documentation + +------------------------------------------------------------------------ +r734 | lh3 | 2009-01-01 13:45:45 -0500 (Thu, 01 Jan 2009) | 8 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-29 + * sampe: removed -O option; changed default -o to 100000 + * sampe: fixed a bug in calculating paired mapping quality + * aln: added an option to search for suboptimal hits even if the best is a repeat. + This option will make sampe MUCH SLOWER. + * sampe: set isize as zero if mapped to two different chr + * update manual (unfinished) + +------------------------------------------------------------------------ +r733 | lh3 | 2009-01-01 11:01:20 -0500 (Thu, 01 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-28 + * fixed a bug in calculating paired mapping quality + +------------------------------------------------------------------------ +r732 | lh3 | 2009-01-01 09:27:46 -0500 (Thu, 01 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + A /branches/prog/bwa/khash.h (from /branches/prog/sclib/khash/khash.h:675) + M /branches/prog/bwa/main.c + + * bwa-0.2.0-27 + * accelerate sampe by storing visited large intervals + +------------------------------------------------------------------------ +r731 | lh3 | 2009-01-01 06:51:21 -0500 (Thu, 01 Jan 2009) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-26 + * remove the optimation codes + +------------------------------------------------------------------------ +r730 | lh3 | 2009-01-01 06:48:59 -0500 (Thu, 01 Jan 2009) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-25 + * accelerate OCC calculation by ~7%. However, it seems not worth doing + this by complicate the codes. I will change back later. + +------------------------------------------------------------------------ +r729 | lh3 | 2008-12-31 16:43:56 -0500 (Wed, 31 Dec 2008) | 6 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-24 + * change command "sai2sam_pe" to "sampe" + * print usage for sampe command + * in sampe: change default max_occ to 1000 + * fixed a few compiling warnings in bntseq.c + +------------------------------------------------------------------------ +r728 | lh3 | 2008-12-27 07:14:59 -0500 (Sat, 27 Dec 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-22 + * mating information can be printed to SAM + +------------------------------------------------------------------------ +r727 | lh3 | 2008-12-26 18:10:59 -0500 (Fri, 26 Dec 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.2.0-21 + * implement pairing (still UNFINISHED) + * output all reads even if full of N + +------------------------------------------------------------------------ +r726 | lh3 | 2008-12-26 13:31:27 -0500 (Fri, 26 Dec 2008) | 5 lines +Changed paths: + M /branches/prog/bwa/Makefile + A /branches/prog/bwa/bwape.c + M /branches/prog/bwa/bwase.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * bwa-0.2.0-20 + * remove "-t" from aln cmd + * code clean up: move some functions in bwt2fmv.c to other source files + * added sai2sam_pe cmd: *UNFINISHED* + +------------------------------------------------------------------------ +r725 | lh3 | 2008-12-26 07:04:11 -0500 (Fri, 26 Dec 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + A /branches/prog/bwa/bwase.c + A /branches/prog/bwa/bwaseqio.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/kseq.h + A /branches/prog/bwa/ksort.h (from /branches/prog/sclib/ksort/ksort.h:712) + A /branches/prog/bwa/kvec.h (from /branches/prog/sclib/kvec/kvec.h:537) + M /branches/prog/bwa/main.c + + * bwa-0.2.0-19 + * considerable code cleanup; no actual changes + +------------------------------------------------------------------------ +r724 | lh3 | 2008-12-25 11:32:11 -0500 (Thu, 25 Dec 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.2.0-18 + * generate SAM output + +------------------------------------------------------------------------ +r723 | lh3 | 2008-12-25 10:48:31 -0500 (Thu, 25 Dec 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * bwa-0.2.0-17 + * remove bwtsw2 related codes + * separate searching for SA interval from generating alignments + +------------------------------------------------------------------------ +r722 | lh3 | 2008-12-25 08:57:13 -0500 (Thu, 25 Dec 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt2fmv.c + D /branches/prog/bwa/bwt_lite.c + D /branches/prog/bwa/bwt_lite.h + M /branches/prog/bwa/bwtgap.c + D /branches/prog/bwa/bwtsw2.h + D /branches/prog/bwa/bwtsw2_aux.c + D /branches/prog/bwa/bwtsw2_core.c + D /branches/prog/bwa/bwtsw2_main.c + D /branches/prog/bwa/khash.h + D /branches/prog/bwa/ksort.h + D /branches/prog/bwa/kvec.h + M /branches/prog/bwa/main.c + + * added interface to "aln -t" + * remove bwtsw2 related codes + +------------------------------------------------------------------------ +r666 | lh3 | 2008-11-18 18:34:29 -0500 (Tue, 18 Nov 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.2.0-16 + * allow to set max mismatches based on read length, but I do not know + whether this really works + +------------------------------------------------------------------------ +r665 | lh3 | 2008-11-18 08:34:03 -0500 (Tue, 18 Nov 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-15 + * fixed a bug in sequence parser. + +------------------------------------------------------------------------ +r612 | lh3 | 2008-10-28 06:50:53 -0400 (Tue, 28 Oct 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/utils.c + + * bwa-0.2.0-14 + * fixed a bug caused by the change of the FASTA/Q parser + +------------------------------------------------------------------------ +r611 | lh3 | 2008-10-28 06:24:56 -0400 (Tue, 28 Oct 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtsw2_core.c + A /branches/prog/bwa/kseq.h + D /branches/prog/bwa/seq.c + D /branches/prog/bwa/seq.h + M /branches/prog/bwa/simple_dp.c + M /branches/prog/bwa/utils.c + M /branches/prog/bwa/utils.h + +replace seq.* with kseq.h + +------------------------------------------------------------------------ +r610 | lh3 | 2008-10-27 13:00:04 -0400 (Mon, 27 Oct 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-13 + * make bwtsw2 output sub-optimal hits. not completed + +------------------------------------------------------------------------ +r609 | lh3 | 2008-10-24 16:52:00 -0400 (Fri, 24 Oct 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/kvec.h + +little... + +------------------------------------------------------------------------ +r532 | lh3 | 2008-09-19 05:28:45 -0400 (Fri, 19 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/khash.h + +improve interface of khash + +------------------------------------------------------------------------ +r531 | lh3 | 2008-09-18 06:52:59 -0400 (Thu, 18 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +improve minor things, which make bwtsw2 slower, but should miss less true hits + +------------------------------------------------------------------------ +r530 | lh3 | 2008-09-17 18:19:26 -0400 (Wed, 17 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + + * fixed a bug in calculating ->D + * enforce band-width checking + +------------------------------------------------------------------------ +r529 | lh3 | 2008-09-17 18:06:49 -0400 (Wed, 17 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +delete a line of code that is never visited + +------------------------------------------------------------------------ +r528 | lh3 | 2008-09-17 17:58:51 -0400 (Wed, 17 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +a bit code clean up + +------------------------------------------------------------------------ +r527 | lh3 | 2008-09-17 10:55:45 -0400 (Wed, 17 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-12 + * max-depth can be set, although it does not help the speed at all + +------------------------------------------------------------------------ +r526 | lh3 | 2008-09-16 17:59:36 -0400 (Tue, 16 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +cut_tail after remove duplicate + +------------------------------------------------------------------------ +r525 | lh3 | 2008-09-16 17:56:11 -0400 (Tue, 16 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/khash.h + M /branches/prog/bwa/main.c + + * bwa-0.2.0-11 + * improved cut_tail() + +------------------------------------------------------------------------ +r524 | lh3 | 2008-09-15 16:53:22 -0400 (Mon, 15 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-10 + * fixed a bug in cut_tail() + +------------------------------------------------------------------------ +r518 | lh3 | 2008-09-15 04:35:59 -0400 (Mon, 15 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +a bit code clean up + +------------------------------------------------------------------------ +r517 | lh3 | 2008-09-14 18:18:11 -0400 (Sun, 14 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +improve speed (<1%) + +------------------------------------------------------------------------ +r516 | lh3 | 2008-09-14 18:08:55 -0400 (Sun, 14 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + + * fixed two potential bugs, although I have not seen their effects + * improve speed a bit (<2%) + +------------------------------------------------------------------------ +r515 | lh3 | 2008-09-14 17:26:49 -0400 (Sun, 14 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + +nothing, really + +------------------------------------------------------------------------ +r514 | lh3 | 2008-09-14 17:10:13 -0400 (Sun, 14 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +disable X-drop, which has to be reimplemented in the current algorithm + +------------------------------------------------------------------------ +r513 | lh3 | 2008-09-14 16:49:42 -0400 (Sun, 14 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt_lite.c + M /branches/prog/bwa/bwt_lite.h + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + + * temporarily disable cut_tail() + * calculate SA in bwt_lite.c + * fixed a bug in reversing the sequence + +------------------------------------------------------------------------ +r512 | lh3 | 2008-09-13 17:35:40 -0400 (Sat, 13 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + A /branches/prog/bwa/ksort.h + +n-best method + +------------------------------------------------------------------------ +r507 | lh3 | 2008-09-13 09:06:54 -0400 (Sat, 13 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_core.c + +give correct result again + +------------------------------------------------------------------------ +r506 | lh3 | 2008-09-13 08:12:07 -0400 (Sat, 13 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +I think I know the reason. It needs more work... + +------------------------------------------------------------------------ +r505 | lh3 | 2008-09-13 06:20:43 -0400 (Sat, 13 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_core.c + +fixed another bug, but still have + +------------------------------------------------------------------------ +r504 | lh3 | 2008-09-12 18:13:37 -0400 (Fri, 12 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +fixed another bug + +------------------------------------------------------------------------ +r503 | lh3 | 2008-09-12 17:15:56 -0400 (Fri, 12 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/khash.h + + * do not segfault, but the result is WRONG! + * prepare to remove bsw2_connectivity_check() + +------------------------------------------------------------------------ +r502 | lh3 | 2008-09-12 15:52:41 -0400 (Fri, 12 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/kvec.h + +more revisions + +------------------------------------------------------------------------ +r501 | lh3 | 2008-09-11 18:06:15 -0400 (Thu, 11 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +further simply codes with kvec.h + +------------------------------------------------------------------------ +r500 | lh3 | 2008-09-11 17:42:15 -0400 (Thu, 11 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +part of revisions... have not finished + +------------------------------------------------------------------------ +r499 | lh3 | 2008-09-11 17:24:15 -0400 (Thu, 11 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/khash.h + A /branches/prog/bwa/kvec.h + +prepare for abrupt change + +------------------------------------------------------------------------ +r496 | lh3 | 2008-09-11 10:34:38 -0400 (Thu, 11 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +fixed a bug; now "bwtsw2 -d" is useless + +------------------------------------------------------------------------ +r495 | lh3 | 2008-09-11 09:22:03 -0400 (Thu, 11 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/simple_dp.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + +improve speed a little bit + +------------------------------------------------------------------------ +r494 | lh3 | 2008-09-11 08:28:08 -0400 (Thu, 11 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +remove debug codes + +------------------------------------------------------------------------ +r493 | lh3 | 2008-09-11 07:49:53 -0400 (Thu, 11 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + + * improve the speed a little bit (<5%) + * prepare to remove BSW_DEBUG + +------------------------------------------------------------------------ +r492 | lh3 | 2008-09-11 06:15:56 -0400 (Thu, 11 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-9 + * support reverse strand + * fixed a bug that causes missing hits + +------------------------------------------------------------------------ +r491 | lh3 | 2008-09-11 05:46:16 -0400 (Thu, 11 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-8 + * better progress report + +------------------------------------------------------------------------ +r490 | lh3 | 2008-09-10 17:04:49 -0400 (Wed, 10 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-7 + * avoid some missing hits + * add maximum depth + +------------------------------------------------------------------------ +r489 | lh3 | 2008-09-10 11:51:13 -0400 (Wed, 10 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-6 + * bwtsw2 works although on the forward strand only for now + * better progress information + +------------------------------------------------------------------------ +r488 | lh3 | 2008-09-10 10:21:53 -0400 (Wed, 10 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + + * implement memory pool + * avoid some rehashing + +------------------------------------------------------------------------ +r487 | lh3 | 2008-09-10 09:23:38 -0400 (Wed, 10 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_main.c + + * fixed a memory leak + * prepare to implement mempool + +------------------------------------------------------------------------ +r486 | lh3 | 2008-09-10 09:10:09 -0400 (Wed, 10 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/khash.h + + * add X-dropoff + * remove duplicated results + * switch to simple stack + +------------------------------------------------------------------------ +r485 | lh3 | 2008-09-10 06:31:20 -0400 (Wed, 10 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + + * check whether t-node has been visited + * prepare to remove two-level stack + +------------------------------------------------------------------------ +r484 | lh3 | 2008-09-10 05:00:57 -0400 (Wed, 10 Sep 2008) | 2 lines +Changed paths: + A /branches/prog/bwa/khash.h + +khash library + +------------------------------------------------------------------------ +r483 | lh3 | 2008-09-10 04:22:53 -0400 (Wed, 10 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +add inline + +------------------------------------------------------------------------ +r482 | lh3 | 2008-09-09 16:34:57 -0400 (Tue, 09 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + +improve speed + +------------------------------------------------------------------------ +r481 | lh3 | 2008-09-09 13:13:00 -0400 (Tue, 09 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtsw2_core.c + +Use a 128bit hash table to keep all (tk,tl,qk,ql). This is slow. Just +keep a copy in case I may need this in future. + + +------------------------------------------------------------------------ +r480 | lh3 | 2008-09-09 12:53:32 -0400 (Tue, 09 Sep 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_core.c + + * no principal modification + +------------------------------------------------------------------------ +r479 | lh3 | 2008-09-09 11:01:45 -0400 (Tue, 09 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2_core.c + + * fixed a bug which may cause duplicated matching + * accelerate the speed a bit, although using hash in avoiding duplications + slows the speed down in the end + +------------------------------------------------------------------------ +r474 | lh3 | 2008-09-03 17:22:57 -0400 (Wed, 03 Sep 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtsw2.h + M /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-5 + * indel seems to work on toy example + * add band + +------------------------------------------------------------------------ +r469 | lh3 | 2008-09-01 09:18:45 -0400 (Mon, 01 Sep 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt_lite.c + M /branches/prog/bwa/bwt_lite.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtsw2.h + A /branches/prog/bwa/bwtsw2_aux.c + M /branches/prog/bwa/bwtsw2_core.c + M /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/is.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + M /branches/prog/bwa/simple_dp.c + + * bwa-0.2.0-4 + * updated bwtsw2, which seems to work properly on toy examples + +------------------------------------------------------------------------ +r447 | lh3 | 2008-08-27 10:05:09 -0400 (Wed, 27 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-3 + * tune for longer gaps, but it does not really work with kilo-bp gaps... + +------------------------------------------------------------------------ +r446 | lh3 | 2008-08-26 13:30:41 -0400 (Tue, 26 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-2 + * changed the way to extend long deletions. Now use max_del_occ. + +------------------------------------------------------------------------ +r445 | lh3 | 2008-08-26 13:05:58 -0400 (Tue, 26 Aug 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt_lite.c + M /branches/prog/bwa/bwt_lite.h + +updated from bwtsw2_lite + +------------------------------------------------------------------------ +r436 | lh3 | 2008-08-23 12:28:44 -0400 (Sat, 23 Aug 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.h + A /branches/prog/bwa/bwt_lite.c + A /branches/prog/bwa/bwt_lite.h + A /branches/prog/bwa/bwtsw2.h + A /branches/prog/bwa/bwtsw2_core.c + A /branches/prog/bwa/bwtsw2_main.c + M /branches/prog/bwa/main.c + + * bwa-0.2.0-1 + * add bwt_lite: a light-weighted version of bwt (NOT TESTED!) + * add core codes for bwtsw2: NOT TESTED!!! + +------------------------------------------------------------------------ +r427 | lh3 | 2008-08-15 05:38:12 -0400 (Fri, 15 Aug 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + +Release bwa-0.2.0 + +------------------------------------------------------------------------ +r426 | lh3 | 2008-08-14 11:26:19 -0400 (Thu, 14 Aug 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + + * bwa-0.1.6-7 + * change default seed length to 31 + * add incomplete support to color sequences (not tested yet!) + +------------------------------------------------------------------------ +r425 | lh3 | 2008-08-14 06:23:11 -0400 (Thu, 14 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.1.6-6 + * change default seed length to 33bp + +------------------------------------------------------------------------ +r424 | lh3 | 2008-08-14 05:55:33 -0400 (Thu, 14 Aug 2008) | 6 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.6-5 + * fixed a bug that may miss true alignments. this bugs exists in most + early versions. + * fixed a bug that yields wrong coordinates for reads mapped on the forward + strands with gaps. + +------------------------------------------------------------------------ +r423 | lh3 | 2008-08-14 04:07:28 -0400 (Thu, 14 Aug 2008) | 2 lines +Changed paths: + D /branches/prog/bwa/Makefile.div + +useless + +------------------------------------------------------------------------ +r422 | lh3 | 2008-08-13 19:21:14 -0400 (Wed, 13 Aug 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.1.6-4 + * fixed one bug + * there is another one... + +------------------------------------------------------------------------ +r421 | lh3 | 2008-08-13 18:23:33 -0400 (Wed, 13 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/main.c + + * bwa-0.1.6-3 + * almost there, but not quite right + +------------------------------------------------------------------------ +r419 | lh3 | 2008-08-13 17:27:02 -0400 (Wed, 13 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/main.c + + * improve the seeding method + * prepare to load two BWTs into memory. A BIG change! + +------------------------------------------------------------------------ +r418 | lh3 | 2008-08-13 10:56:54 -0400 (Wed, 13 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/main.c + + * added seeding + * unfinished yet + +------------------------------------------------------------------------ +r413 | lh3 | 2008-08-08 11:48:35 -0400 (Fri, 08 Aug 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.1.6 + +------------------------------------------------------------------------ +r410 | lh3 | 2008-08-06 15:48:22 -0400 (Wed, 06 Aug 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/simple_dp.c + +sw: output alignment score + +------------------------------------------------------------------------ +r407 | lh3 | 2008-08-04 10:01:20 -0400 (Mon, 04 Aug 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + A /branches/prog/bwa/simple_dp.c + M /branches/prog/bwa/stdaln.c + M /branches/prog/bwa/stdaln.h + + * bwa-0.1.5-3 + * added a simple interface to SW/NW alignment + * stdaln-0.9.8 (see header for more details) + +------------------------------------------------------------------------ +r406 | lh3 | 2008-08-01 19:21:59 -0400 (Fri, 01 Aug 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + A /branches/prog/bwa/stdaln.c + A /branches/prog/bwa/stdaln.h + + * bwa-0.1.5-2 + * give accurate gap positions + +------------------------------------------------------------------------ +r405 | lh3 | 2008-08-01 19:06:19 -0400 (Fri, 01 Aug 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + +unfinished, but I am tired... + +------------------------------------------------------------------------ +r401 | lh3 | 2008-07-30 05:59:24 -0400 (Wed, 30 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/main.c + + * bwa-0.1.5-1 + * fixed a potential bug which may produce an alignment in N regions, + although extremely rare. + +------------------------------------------------------------------------ +r399 | lh3 | 2008-07-27 11:41:52 -0400 (Sun, 27 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.1.5 + +------------------------------------------------------------------------ +r398 | lh3 | 2008-07-25 12:14:47 -0400 (Fri, 25 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update documentation + +------------------------------------------------------------------------ +r397 | lh3 | 2008-07-25 09:58:56 -0400 (Fri, 25 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * + +------------------------------------------------------------------------ +r396 | lh3 | 2008-07-25 06:42:01 -0400 (Fri, 25 Jul 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.1.4-4 + * add timer for debugging + +------------------------------------------------------------------------ +r395 | lh3 | 2008-07-24 05:46:21 -0400 (Thu, 24 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.4-3 + * fixed a bug in the previous code + * this version gives identical result to bwa-0.1.4, just 10% faster + +------------------------------------------------------------------------ +r394 | lh3 | 2008-07-24 05:18:53 -0400 (Thu, 24 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/main.c + + * bwa-0.1.4-2 + * further improve the speed + * The result is slightly different from bwa-0.1.4 now. I need to check... + +------------------------------------------------------------------------ +r393 | lh3 | 2008-07-23 12:04:16 -0400 (Wed, 23 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt.c + +comments only + +------------------------------------------------------------------------ +r392 | lh3 | 2008-07-23 10:34:03 -0400 (Wed, 23 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + +further improve the speed in Occ functions + +------------------------------------------------------------------------ +r386 | lh3 | 2008-07-22 10:03:54 -0400 (Tue, 22 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/main.c + +Release bwa-0.1.4 + +------------------------------------------------------------------------ +r385 | lh3 | 2008-07-22 09:44:50 -0400 (Tue, 22 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwa.1 + +update documentation and ChangeLog + +------------------------------------------------------------------------ +r384 | lh3 | 2008-07-22 08:50:03 -0400 (Tue, 22 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.3-2 + * fixed the bug in the last modification + * now the alignment should be more clearly defined + +------------------------------------------------------------------------ +r383 | lh3 | 2008-07-21 18:32:21 -0400 (Mon, 21 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.3-1 + * this is a buggy verion! + * i will fix the bug tomorrow. It is late... + +------------------------------------------------------------------------ +r381 | lh3 | 2008-07-21 06:45:32 -0400 (Mon, 21 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.1.3 + +------------------------------------------------------------------------ +r380 | lh3 | 2008-07-21 06:07:43 -0400 (Mon, 21 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/main.c + + * bwa-0.1.2-3 + * improve the speed for gcc on Intel Mac OS X, but not really on icc on Linux + * aln: more command-line options + +------------------------------------------------------------------------ +r373 | lh3 | 2008-07-17 09:09:46 -0400 (Thu, 17 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + + * bwa-0.1.2-2 + * further improve the speed + * this version gives exactly the same result as bwa-0.1.2 + +------------------------------------------------------------------------ +r372 | lh3 | 2008-07-17 07:51:08 -0400 (Thu, 17 Jul 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/main.c + + * bwa-0.1.2-1 + * speed up by about 5% + +------------------------------------------------------------------------ +r370 | lh3 | 2008-07-17 05:12:00 -0400 (Thu, 17 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.1.2 + +------------------------------------------------------------------------ +r368 | lh3 | 2008-07-16 08:51:25 -0400 (Wed, 16 Jul 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + D /branches/prog/bwa/bwt1away.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + D /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.1-9 + * some code cleanup + * remove 1away and top2 + +------------------------------------------------------------------------ +r367 | lh3 | 2008-07-16 08:24:34 -0400 (Wed, 16 Jul 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/is.c + +Yuta Mori's implementation of IS algorithm. + +------------------------------------------------------------------------ +r365 | lh3 | 2008-07-16 06:58:04 -0400 (Wed, 16 Jul 2008) | 6 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/main.c + + * bwa-0.1.1-8 + * improve gapped alignment + * this version will miss more gapped alignments, but the speed is much faster + * prepare to remove top2 and 1away algorithms + * prepare to add SAIS algorithm for bwt construction + +------------------------------------------------------------------------ +r358 | lh3 | 2008-06-09 06:03:04 -0400 (Mon, 09 Jun 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.1-7 + * change END_SKIP from 3 to 5, but still gaps may be wrongly added + * change default '-g' from 5 to 3 + +------------------------------------------------------------------------ +r357 | lh3 | 2008-06-09 05:18:36 -0400 (Mon, 09 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.1-6 + * fix a bug in nested stack + +------------------------------------------------------------------------ +r356 | lh3 | 2008-06-08 18:43:13 -0400 (Sun, 08 Jun 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + A /branches/prog/bwa/bwtgap.h + M /branches/prog/bwa/main.c + + * bwa-0.1.1-5 + * replace heap with nested stacks + * there are still obvious bugs... + +------------------------------------------------------------------------ +r355 | lh3 | 2008-06-08 17:13:44 -0400 (Sun, 08 Jun 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * bwa-0.1.1-4 + * add interface to affine gap alignment + * there are obvious bugs and I will fix them later + +------------------------------------------------------------------------ +r354 | lh3 | 2008-06-08 15:39:05 -0400 (Sun, 08 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/main.c + + * bwa-0.1.1-3 + * affine gap seems to work, at least partially + +------------------------------------------------------------------------ +r353 | lh3 | 2008-06-08 09:27:18 -0400 (Sun, 08 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + A /branches/prog/bwa/bwtgap.c + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.1-2 + * initial gapped alignment. not work at the moment + +------------------------------------------------------------------------ +r352 | lh3 | 2008-06-06 04:37:34 -0400 (Fri, 06 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.1-1 + * ungap: remove a useless varible in top2_entry_t + +------------------------------------------------------------------------ +r348 | lh3 | 2008-06-03 09:04:12 -0400 (Tue, 03 Jun 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/ChangeLog + A /branches/prog/bwa/NEWS + M /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/main.c + +Release bwa-0.1.1 + +------------------------------------------------------------------------ +r347 | lh3 | 2008-06-03 05:45:08 -0400 (Tue, 03 Jun 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwa.1 + +update documentation + +------------------------------------------------------------------------ +r346 | lh3 | 2008-06-02 18:59:50 -0400 (Mon, 02 Jun 2008) | 5 lines +Changed paths: + A /branches/prog/bwa/ChangeLog + A /branches/prog/bwa/bwa.1 + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-11 + * improve approximating mapping qualities + * add documentation + * add ChangeLog + +------------------------------------------------------------------------ +r345 | lh3 | 2008-06-02 16:04:39 -0400 (Mon, 02 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-10 + * output a random position for repetitive reads + +------------------------------------------------------------------------ +r344 | lh3 | 2008-06-02 15:03:54 -0400 (Mon, 02 Jun 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/pac2bwt.c + + * bwa-0.1.0-9 + * fix memory leaks + * fix a potential bug in coverting to the real coordinate + +------------------------------------------------------------------------ +r343 | lh3 | 2008-06-02 13:44:51 -0400 (Mon, 02 Jun 2008) | 5 lines +Changed paths: + M /branches/prog/bwa/Makefile.div + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-8 + * fix a bug about strand + * update Makefile.div + * change top2b as the default method + +------------------------------------------------------------------------ +r342 | lh3 | 2008-06-02 11:23:26 -0400 (Mon, 02 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt1away.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-7 + * use bwt_2occ() and bwt_2occ4() in other functions + +------------------------------------------------------------------------ +r341 | lh3 | 2008-06-02 09:31:39 -0400 (Mon, 02 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-6 + * fix a bug for missing hits + +------------------------------------------------------------------------ +r340 | lh3 | 2008-06-02 09:10:18 -0400 (Mon, 02 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-5 + * accelerate comparisons in heap, a bit + +------------------------------------------------------------------------ +r339 | lh3 | 2008-06-02 08:41:31 -0400 (Mon, 02 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-4 + * avoid marginal repeated calculation in occ + +------------------------------------------------------------------------ +r338 | lh3 | 2008-06-02 06:46:51 -0400 (Mon, 02 Jun 2008) | 5 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-3 + * fix a bug caused by previours change + * fix a bug in heap + * order the heap by more criteria + +------------------------------------------------------------------------ +r337 | lh3 | 2008-06-01 19:11:15 -0400 (Sun, 01 Jun 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + + * bwa-0.1.0-2 + * also sort sa range in heapsort, in attempt to improve cache performance. + Unfortunately, it does not work well at all. + +------------------------------------------------------------------------ +r336 | lh3 | 2008-06-01 17:45:23 -0400 (Sun, 01 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/Makefile.div + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/main.c + + * 0.1.0-1 + * fix a bug in calculating the real coordinate + +------------------------------------------------------------------------ +r335 | lh3 | 2008-06-01 16:03:09 -0400 (Sun, 01 Jun 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + +nothing, really + +------------------------------------------------------------------------ +r334 | lh3 | 2008-06-01 15:59:13 -0400 (Sun, 01 Jun 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + A /branches/prog/bwa/Makefile.div + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/pac2bwt.c + +use IS algorithm by default + +------------------------------------------------------------------------ +r333 | lh3 | 2008-06-01 15:05:15 -0400 (Sun, 01 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/is.c + M /branches/prog/bwa/pac2bwt.c + + * a bit code clean up in is.c + * add IS algorithm for constructing BWT, albeit slower + +------------------------------------------------------------------------ +r332 | lh3 | 2008-06-01 13:23:08 -0400 (Sun, 01 Jun 2008) | 2 lines +Changed paths: + A /branches/prog/bwa/is.c + +IS linear-time algorithm for constructing SA/BWT + +------------------------------------------------------------------------ +r331 | lh3 | 2008-06-01 10:35:26 -0400 (Sun, 01 Jun 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bntseq.c + A /branches/prog/bwa/bwtindex.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * fix a bug in generating .pac + * index in one go + +------------------------------------------------------------------------ +r330 | lh3 | 2008-06-01 09:17:05 -0400 (Sun, 01 Jun 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwttop2.c + +real coordinates can be ouput + +------------------------------------------------------------------------ +r329 | lh3 | 2008-05-31 19:21:02 -0400 (Sat, 31 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwttop2.c + +add top2e which is similar to 1away + +------------------------------------------------------------------------ +r328 | lh3 | 2008-05-31 18:46:12 -0400 (Sat, 31 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwttop2.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * unified cmd-line interface for ungapped alignment + * add two alternatives to top2 algorithm + +------------------------------------------------------------------------ +r327 | lh3 | 2008-05-31 18:14:46 -0400 (Sat, 31 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + +add cmd-line interface to alntop2 + +------------------------------------------------------------------------ +r326 | lh3 | 2008-05-31 17:59:31 -0400 (Sat, 31 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt1away.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + A /branches/prog/bwa/bwttop2.c + +top2 algorithm seems to work. I need to change interface, though + +------------------------------------------------------------------------ +r325 | lh3 | 2008-05-31 15:11:49 -0400 (Sat, 31 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt1away.c + +change the variable in the structure + +------------------------------------------------------------------------ +r324 | lh3 | 2008-05-31 14:52:13 -0400 (Sat, 31 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt1away.c + +set a slightly better bound on the maximum allowed mismatches + +------------------------------------------------------------------------ +r323 | lh3 | 2008-05-30 18:40:21 -0400 (Fri, 30 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + + * output time statistics + +------------------------------------------------------------------------ +r322 | lh3 | 2008-05-30 17:58:25 -0400 (Fri, 30 May 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + A /branches/prog/bwa/bwt1away.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + + * presumably better way to make use of prefix. But for the moment I do + not know whether it is correct or not. + * a bit code clean up: separate alignment part + +------------------------------------------------------------------------ +r321 | lh3 | 2008-05-30 13:57:43 -0400 (Fri, 30 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt_gen/Makefile + M /branches/prog/bwa/bwt_gen/bwt_gen.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + M /branches/prog/bwa/pac2bwt.c + + * a bit code clean up + * put bwt_gen in bwa + +------------------------------------------------------------------------ +r320 | lh3 | 2008-05-30 11:40:11 -0400 (Fri, 30 May 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtio.c + + * improve cmd-line interface + * fix a bug in loading .sa + * change default sa interval to 32 + +------------------------------------------------------------------------ +r319 | lh3 | 2008-05-30 10:31:37 -0400 (Fri, 30 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwtaln.c + + * fix memory leak (I know that. Just a bit lazy) + * change to another method to do 1-away alignment + +------------------------------------------------------------------------ +r318 | lh3 | 2008-05-30 09:21:49 -0400 (Fri, 30 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + +best unique match is partially finished + +------------------------------------------------------------------------ +r317 | lh3 | 2008-05-30 06:33:28 -0400 (Fri, 30 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + +remove "ungapped" command and related codes + +------------------------------------------------------------------------ +r316 | lh3 | 2008-05-30 06:05:20 -0400 (Fri, 30 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + +change variable name thick to width + +------------------------------------------------------------------------ +r315 | lh3 | 2008-05-29 19:06:13 -0400 (Thu, 29 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + M /branches/prog/bwa/pac2bwt.c + +revised algorithm for ungapped alignment. the old one can still be used. + +------------------------------------------------------------------------ +r314 | lh3 | 2008-05-29 16:36:11 -0400 (Thu, 29 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwt_gen/bwt_gen.c + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/pac2bwt.c + + * make commands more independent, but ungapped does not work at the moment + +------------------------------------------------------------------------ +r313 | lh3 | 2008-05-29 15:56:14 -0400 (Thu, 29 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt_gen/bwt_gen.c + +little... + +------------------------------------------------------------------------ +r312 | lh3 | 2008-05-29 15:54:01 -0400 (Thu, 29 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt_gen/bwt_gen.c + M /branches/prog/bwa/bwt_gen/bwt_gen.h + + * add CopyRight information from the original codes + * do not dump .fmv files + +------------------------------------------------------------------------ +r311 | lh3 | 2008-05-29 15:44:36 -0400 (Thu, 29 May 2008) | 2 lines +Changed paths: + A /branches/prog/bwa/bwt_gen + A /branches/prog/bwa/bwt_gen/Makefile + A /branches/prog/bwa/bwt_gen/QSufSort.c + A /branches/prog/bwa/bwt_gen/QSufSort.h + A /branches/prog/bwa/bwt_gen/bwt_gen.c + A /branches/prog/bwa/bwt_gen/bwt_gen.h + +codes from BWT-SW, for building BWT from packed file + +------------------------------------------------------------------------ +r310 | lh3 | 2008-05-28 17:03:35 -0400 (Wed, 28 May 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * change OCC_INTERVAL to 0x40, which makes bwa twice as fast. + * write Occ file as ".occ" as it is using a different interval from + .fmv, the BWT-SW correspondance of .occ + +------------------------------------------------------------------------ +r309 | lh3 | 2008-05-28 11:39:37 -0400 (Wed, 28 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt2fmv.c + +fix a bug + +------------------------------------------------------------------------ +r308 | lh3 | 2008-05-28 09:56:16 -0400 (Wed, 28 May 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt2fmv.c + +add heuristics to improve the speed, but I have not tested whether the +results are correct or not. + + +------------------------------------------------------------------------ +r307 | lh3 | 2008-05-28 06:31:34 -0400 (Wed, 28 May 2008) | 5 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/bwtaln.c + M /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * make ungapped alignment basically works... + * but it is very slow in comparison to others... + * also I need to improve the interface... + * a lot of things to keep me busy today... + +------------------------------------------------------------------------ +r306 | lh3 | 2008-05-27 18:41:27 -0400 (Tue, 27 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwtaln.c + + * remove recursion + * fixed a bug in bwt_occ() + +------------------------------------------------------------------------ +r305 | lh3 | 2008-05-27 16:59:44 -0400 (Tue, 27 May 2008) | 5 lines +Changed paths: + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwtaln.c + + * bwa now tells whether a sequenced can be mapped with maximum allowed + mismatches. ONLY ungapped. + * this is a recursive version. I will remove recursion later. + + +------------------------------------------------------------------------ +r304 | lh3 | 2008-05-27 09:12:17 -0400 (Tue, 27 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + A /branches/prog/bwa/bwtaln.c + A /branches/prog/bwa/bwtaln.h + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + M /branches/prog/bwa/utils.c + + * load .sa and .fmv files + * exact alignment now works + +------------------------------------------------------------------------ +r303 | lh3 | 2008-05-27 06:33:38 -0400 (Tue, 27 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/utils.c + M /branches/prog/bwa/utils.h + +add xassert and fix a bug + +------------------------------------------------------------------------ +r302 | lh3 | 2008-05-27 06:23:20 -0400 (Tue, 27 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwtio.c + A /branches/prog/bwa/utils.c + A /branches/prog/bwa/utils.h + +improve error message and error handling + +------------------------------------------------------------------------ +r301 | lh3 | 2008-05-27 05:37:51 -0400 (Tue, 27 May 2008) | 4 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + A /branches/prog/bwa/bwtio.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + + * move I/O codes to bwtio.c + * SA can be dumped and interestingly, it is identical to BWTSW + * now, .fmv is still different from BWTSW + +------------------------------------------------------------------------ +r299 | lh3 | 2008-05-26 18:07:44 -0400 (Mon, 26 May 2008) | 2 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + +generate/retrieve SA and Occ + +------------------------------------------------------------------------ +r298 | lh3 | 2008-05-26 13:16:49 -0400 (Mon, 26 May 2008) | 3 lines +Changed paths: + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/bwt.c + M /branches/prog/bwa/bwt.h + M /branches/prog/bwa/bwt2fmv.c + + * retrieve occ value at any position + * move bwt_cal_occ() to bwt.c + +------------------------------------------------------------------------ +r297 | lh3 | 2008-05-25 17:43:58 -0400 (Sun, 25 May 2008) | 6 lines +Changed paths: + M /branches/prog/bwa/Makefile + A /branches/prog/bwa/bwt.c + A /branches/prog/bwa/bwt.h + A /branches/prog/bwa/bwt2fmv.c + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + M /branches/prog/bwa/pac2bwt.c + + * add bwt2fmv. It works to some extend. However, I do not understand + the purpose of some weird codes in BWT-SW. As a consequence, bwt2fmv + could generate a file almost identical, but not exactly identical, to + the .fmv file from BWT-SW. + + +------------------------------------------------------------------------ +r296 | lh3 | 2008-05-24 18:35:02 -0400 (Sat, 24 May 2008) | 5 lines +Changed paths: + M /branches/prog/bwa/Makefile + M /branches/prog/bwa/bntseq.c + M /branches/prog/bwa/bntseq.h + M /branches/prog/bwa/main.c + M /branches/prog/bwa/main.h + A /branches/prog/bwa/pac2bwt.c + +Burrows-Wheeler Transform now works. At least on one example, the +current code generates the same BWT as BWT-SW. Kind of magical, I would +say. :) + + +------------------------------------------------------------------------ +r295 | lh3 | 2008-05-24 11:25:31 -0400 (Sat, 24 May 2008) | 3 lines +Changed paths: + A /branches/prog/bwa/Makefile + M /branches/prog/bwa/bntseq.c + A /branches/prog/bwa/main.c + A /branches/prog/bwa/main.h + + * add Makefile and main.* + * improve interface to fa2bns, a bit + +------------------------------------------------------------------------ +r293 | lh3 | 2008-05-24 10:57:03 -0400 (Sat, 24 May 2008) | 3 lines +Changed paths: + A /branches/prog/bwa + A /branches/prog/bwa/bntseq.c + A /branches/prog/bwa/bntseq.h + A /branches/prog/bwa/seq.c + A /branches/prog/bwa/seq.h + + * Burrow-Wheeler Alignment + * initial codes + +------------------------------------------------------------------------ diff --git a/Makefile b/Makefile new file mode 100644 index 0000000..6b2a454 --- /dev/null +++ b/Makefile @@ -0,0 +1,99 @@ +CC= gcc +CFLAGS= -g -Wall -Wno-unused-function -mavx2 -O2 +WRAP_MALLOC=-DUSE_MALLOC_WRAPPERS + +SHOW_PERF= -DSHOW_PERF +SHOW_DATA_PERF= #-DSHOW_DATA_PERF +FILTER_FULL_MATCH= #-DFILTER_FULL_MATCH +USE_MT_READ= -DUSE_MT_READ + +AR= ar +DFLAGS= -DHAVE_PTHREAD $(WRAP_MALLOC) $(SHOW_PERF) $(SHOW_DATA_PERF) $(FILTER_FULL_MATCH) $(USE_MT_READ) -DUSE_AVX2 -DKSW_EQUAL +LOBJS= utils.o kthread.o kstring.o ksw.o bwt.o bntseq.o bwa.o bwamem.o bwamem_pair.o bwamem_extra.o malloc_wrap.o \ + QSufSort.o bwt_gen.o rope.o rle.o is.o bwtindex.o yarn.o +AOBJS= bwashm.o bwase.o bwaseqio.o bwtgap.o bwtaln.o bamlite.o \ + bwape.o kopen.o pemerge.o maxk.o ksw_align_avx2.o \ + bwtsw2_core.o bwtsw2_main.o bwtsw2_aux.o bwt_lite.o \ + bwtsw2_chain.o fastmap.o bwtsw2_pair.o profiling.o \ + fmt_idx.o ksw_extend2_avx2.o ksw_extend2_avx2_u8.o \ + debug.o +PROG= fastbwa +INCLUDES= +LIBS= -lm -lz -lpthread -ldl +SUBDIRS= . +JE_MALLOC=/home/zzh/work/jemalloc/lib/libjemalloc.a + +ifeq ($(shell uname -s),Linux) + LIBS += -lrt +endif + +.SUFFIXES:.c .o .cc + +.c.o: + $(CC) -c $(CFLAGS) $(DFLAGS) $(INCLUDES) $(CPPFLAGS) $< -o $@ + +all:$(PROG) + +#bwa:libbwa.a $(AOBJS) main.o +# $(CC) $(CFLAGS) $(LDFLAGS) $(AOBJS) main.o -o $@ -L. -lbwa $(LIBS) + +$(PROG):libbwa.a $(AOBJS) main.o + $(CC) $(CFLAGS) $(LDFLAGS) $(AOBJS) $(JE_MALLOC) main.o -o $@ -L. -lbwa $(LIBS) + +bwamem-lite:libbwa.a example.o + $(CC) $(CFLAGS) $(LDFLAGS) example.o -o $@ -L. -lbwa $(LIBS) + +libbwa.a:$(LOBJS) + $(AR) -csru $@ $(LOBJS) + +clean: + rm -f gmon.out *.o a.out $(PROG) *~ *.a + +depend: + ( LC_ALL=C ; export LC_ALL; makedepend -Y -- $(CFLAGS) $(DFLAGS) $(CPPFLAGS) -- *.c ) + +# DO NOT DELETE THIS LINE -- make depend depends on it. + +QSufSort.o: QSufSort.h +bamlite.o: bamlite.h malloc_wrap.h +bntseq.o: bntseq.h utils.h kseq.h malloc_wrap.h khash.h +bwa.o: bntseq.h bwa.h bwt.h ksw.h utils.h kstring.h malloc_wrap.h kvec.h +bwa.o: kseq.h +bwamem.o: kstring.h malloc_wrap.h bwamem.h bwt.h bntseq.h bwa.h ksw.h kvec.h +bwamem.o: ksort.h utils.h kbtree.h +bwamem_extra.o: bwa.h bntseq.h bwt.h bwamem.h kstring.h malloc_wrap.h +bwamem_pair.o: kstring.h malloc_wrap.h bwamem.h bwt.h bntseq.h bwa.h kvec.h +bwamem_pair.o: utils.h ksw.h +bwape.o: bwtaln.h bwt.h kvec.h malloc_wrap.h bntseq.h utils.h bwase.h bwa.h +bwape.o: ksw.h khash.h +bwase.o: bwase.h bntseq.h bwt.h bwtaln.h utils.h kstring.h malloc_wrap.h +bwase.o: bwa.h ksw.h +bwaseqio.o: bwtaln.h bwt.h utils.h bamlite.h malloc_wrap.h kseq.h +bwashm.o: bwa.h bntseq.h bwt.h +bwt.o: utils.h bwt.h kvec.h malloc_wrap.h +bwt_gen.o: QSufSort.h malloc_wrap.h +bwt_lite.o: bwt_lite.h malloc_wrap.h +bwtaln.o: bwtaln.h bwt.h bwtgap.h utils.h bwa.h bntseq.h malloc_wrap.h +bwtgap.o: bwtgap.h bwt.h bwtaln.h malloc_wrap.h +bwtindex.o: bntseq.h bwa.h bwt.h utils.h rle.h rope.h malloc_wrap.h +bwtsw2_aux.o: bntseq.h bwt_lite.h utils.h bwtsw2.h bwt.h kstring.h +bwtsw2_aux.o: malloc_wrap.h bwa.h ksw.h kseq.h ksort.h +bwtsw2_chain.o: bwtsw2.h bntseq.h bwt_lite.h bwt.h malloc_wrap.h ksort.h +bwtsw2_core.o: bwt_lite.h bwtsw2.h bntseq.h bwt.h kvec.h malloc_wrap.h +bwtsw2_core.o: khash.h ksort.h +bwtsw2_main.o: bwt.h bwtsw2.h bntseq.h bwt_lite.h utils.h bwa.h +bwtsw2_pair.o: utils.h bwt.h bntseq.h bwtsw2.h bwt_lite.h kstring.h +bwtsw2_pair.o: malloc_wrap.h ksw.h +example.o: bwamem.h bwt.h bntseq.h bwa.h kseq.h malloc_wrap.h +fastmap.o: bwa.h bntseq.h bwt.h bwamem.h kvec.h malloc_wrap.h utils.h kseq.h +is.o: malloc_wrap.h +kopen.o: malloc_wrap.h +kstring.o: kstring.h malloc_wrap.h +ksw.o: ksw.h neon_sse.h scalar_sse.h malloc_wrap.h +main.o: kstring.h malloc_wrap.h utils.h +malloc_wrap.o: malloc_wrap.h +maxk.o: bwa.h bntseq.h bwt.h bwamem.h kseq.h malloc_wrap.h +pemerge.o: ksw.h kseq.h malloc_wrap.h kstring.h bwa.h bntseq.h bwt.h utils.h +rle.o: rle.h +rope.o: rle.h rope.h +utils.o: utils.h ksort.h malloc_wrap.h kseq.h diff --git a/NEWS.md b/NEWS.md new file mode 100644 index 0000000..151e024 --- /dev/null +++ b/NEWS.md @@ -0,0 +1,1223 @@ +Release 0.7.17 (23 October 2017) +-------------------------------- + +This release adds option -q to preserve the mapping quality of split alignment +with a lower alignment score than the primary alignment. Option -5 +automatically applies -q as well. + +(0.7.17: 23 October 2017, r1188) + + + +Release 0.7.16 (30 July 2017) +----------------------------- + +This release added a couple of minor features and incorporated multiple pull +requests, including: + + * Added option -5, which is useful to some Hi-C pipelines. + + * Fixed an error with samtools sorting (#129). Updated download link for + GRCh38 (#123). Fixed README MarkDown formatting (#70). Addressed multiple + issues via a collected pull request #139 by @jmarshall. Avoid malformatted + SAM header when -R is used with TAB (#84). Output mate CIGAR (#138). + +(0.7.16: 30 July 2017, r1180) + + + +Release 0.7.15 (31 May 2016) +---------------------------- + +Fixed a long existing bug which potentially leads to underestimated insert size +upper bound. This bug should have little effect in practice. + +(0.7.15: 31 May 2016, r1140) + + + +Release 0.7.14 (4 May 2016) +--------------------------- + +In the ALT mapping mode, this release adds the "AH:*" header tag to SQ lines +corresponding to alternate haplotypes. + +(0.7.14: 4 May 2016, r1136) + + + +Release 0.7.13 (23 Feburary 2016) +--------------------------------- + +This release fixes a few minor bugs in the previous version and adds a few +minor features. All BWA algorithms should produce identical output to 0.7.12 +when there are no ALT contigs. + +Detailed changes: + + * Fixed a bug in "bwa-postalt.js". The old version may produce 0.5% of wrong + bases for reads mapped to the ALT contigs. + + * Fixed a potential bug in the multithreading mode. It may occur when mapping + is much faster than file reading, which should almost never happen in + practice. + + * Changed the download URL of GRCh38. + + * Removed the read overlap mode. It is not working well. + + * Added the ropebwt2 algorithm as an alternative to index large genomes. + Ropebwt2 is slower than the "bwtsw" algorithm, but it has a permissive + license. This allows us to create an Apache2-licensed BWA (in the "Apache2" + branch) for commercial users who are concerned with GPL. + +(0.7.13: 23 Feburary 2016, r1126) + + + +Release 0.7.12 (28 December 2014) +--------------------------------- + +This release fixed a bug in the pair-end mode when ALT contigs are present. It +leads to undercalling in regions overlapping ALT contigs. + +(0.7.12: 28 December 2014, r1039) + + + +Release 0.7.11 (23 December, 2014) +---------------------------------- + +A major change to BWA-MEM is the support of mapping to ALT contigs in addition +to the primary assembly. Part of the ALT mapping strategy is implemented in +BWA-MEM and the rest in a postprocessing script for now. Due to the extra +layer of complexity on generating the reference genome and on the two-step +mapping, we start to provide a wrapper script and precompiled binaries since +this release. The package may be more convenient to some specific use cases. +For general uses, the single BWA binary still works like the old way. + +Another major addition to BWA-MEM is HLA typing, which made possible with the +new ALT mapping strategy. Necessary data and programs are included in the +binary release. The wrapper script also optionally performs HLA typing when HLA +genes are included in the reference genome as additional ALT contigs. + +Other notable changes to BWA-MEM: + + * Added option `-b` to `bwa index`. This option tunes the batch size used in + the construction of BWT. It is advised to use large `-b` for huge reference + sequences such as the BLAST *nt* database. + + * Optimized for PacBio data. This includes a change to scoring based on a + study done by Aaron Quinlan and a heuristic speedup. Further speedup is + possible, but needs more careful investigation. + + * Dropped PacBio read-to-read alignment for now. BWA-MEM is good for finding + the best hit, but is not very sensitive to suboptimal hits. Option `-x pbread` + is still available, but hidden on the command line. This may be removed in + future releases. + + * Added a new pre-setting for Oxford Nanopore 2D reads. LAST is still a little + more sensitive on older bacterial data, but bwa-mem is as good on more + recent data and is times faster for mapping against mammalian genomes. + + * Added LAST-like seeding. This improves the accuracy for longer reads. + + * Added option `-H` to insert arbitrary header lines. + + * Smarter option `-p`. Given an interleaved FASTQ stream, old bwa-mem identifies + the 2i-th and (2i+1)-th reads as a read pair. The new verion identifies + adjacent reads with the same read name as a read pair. It is possible to mix + single-end and paired-end reads in one FASTQ. + + * Improved parallelization. Old bwa-mem waits for I/O. The new version puts + I/O on a separate thread. It performs mapping while reading FASTQ and + writing SAM. This saves significant wall-clock time when reading from + or writing to a slow Unix pipe. + +With the new release, the recommended way to map Illumina reads to GRCh38 is to +use the bwakit binary package: + + bwa.kit/run-gen-ref hs38DH + bwa.kit/bwa index hs38DH.fa + bwa.kit/run-bwamem -t8 -H -o out-prefix hs38DH.fa read1.fq.gz read2.fq.gz | sh + +Please check bwa.kit/README.md for details and command line options. + +(0.7.11: 23 December 2014, r1034) + + + +Release 0.7.10 (13 July, 2014) +------------------------------ + +Notable changes to BWA-MEM: + + * Fixed a segmentation fault due to an alignment bridging the forward-reverse + boundary. This is a bug. + + * Use the PacBio heuristic to map contigs to the reference genome. The old + heuristic evaluates the necessity of full extension for each chain. This may + not work in long low-complexity regions. The PacBio heuristic performs + SSE2-SW around each short seed. It works better. Note that the heuristic is + only applied to long query sequences. For Illumina reads, the output is + identical to the previous version. + +(0.7.10: 13 July 2014, r789) + + + +Release 0.7.9 (19 May, 2014) +---------------------------- + +This release brings several major changes to BWA-MEM. Notably, BWA-MEM now +formally supports PacBio read-to-reference alignment and experimentally supports +PacBio read-to-read alignment. BWA-MEM also runs faster at a minor cost of +accuracy. The speedup is more significant when GRCh38 is in use. More +specifically: + + * Support PacBio subread-to-reference alignment. Although older BWA-MEM works + with PacBio data in principle, the resultant alignments are frequently + fragmented. In this release, we fine tuned existing methods and introduced + new heuristics to improve PacBio alignment. These changes are not used by + default. Users need to add option "-x pacbio" to enable the feature. + + * Support PacBio subread-to-subread alignment (EXPERIMENTAL). This feature is + enabled with option "-x pbread". In this mode, the output only gives the + overlapping region between a pair of reads without detailed alignment. + + * Output alternative hits in the XA tag if there are not so many of them. This + is a BWA-backtrack feature. + + * Support mapping to ALT contigs in GRCh38 (EXPERIMENTAL). We provide a script + to postprocess hits in the XA tag to adjust the mapping quality and generate + new primary alignments to all overlapping ALT contigs. We would *NOT* + recommend this feature for production uses. + + * Improved alignments to many short reference sequences. Older BWA-MEM may + generate an alignment bridging two or more adjacent reference sequences. + Such alignments are split at a later step as postprocessing. This approach + is complex and does not always work. This release forbids these alignments + from the very beginning. BWA-MEM should not produce an alignment bridging + two or more reference sequences any more. + + * Reduced the maximum seed occurrence from 10000 to 500. Reduced the maximum + rounds of Smith-Waterman mate rescue from 100 to 50. Added a heuristic to + lower the mapping quality if a read contains seeds with excessive + occurrences. These changes make BWA-MEM faster at a minor cost of accuracy + in highly repetitive regions. + + * Added an option "-Y" to use soft clipping for supplementary alignments. + + * Bugfix: incomplete alignment extension in corner cases. + + * Bugfix: integer overflow when aligning long query sequences. + + * Bugfix: chain score is not computed correctly (almost no practical effect) + + * General code cleanup + + * Added FAQs to README + +Changes in BWA-backtrack: + + * Bugfix: a segmentation fault when an alignment stands out of the end of the + last chromosome. + +(0.7.9: 19 May 2014, r783) + + + +Release 0.7.8 (31 March, 2014) +------------------------------ + +Changes in BWA-MEM: + + * Bugfix: off-diagonal X-dropoff (option -d) not working as intended. + Short-read alignment is not affected. + + * Bugfix: unnecessarily large bandwidth used during global alignment, + which reduces the mapping speed by -5% for short reads. Results are not + affected. + + * Bugfix: when the matching score is not one, paired-end mapping quality is + inaccurate. + + * When the matching score (option -A) is changed, scale all score-related + options accordingly unless overridden by users. + + * Allow to specify different gap open (or extension) penalties for deletions + and insertions separately. + + * Allow to specify the insert size distribution. + + * Better and more detailed debugging information. + +With the default setting, 0.7.8 and 0.7.7 gave identical output on one million +100bp read pairs. + +(0.7.8: 31 March 2014, r455) + + + +Release 0.7.7 (25 Feburary, 2014) +--------------------------------- + +This release fixes incorrect MD tags in the BWA-MEM output. + +A note about short-read mapping to GRCh38. The new human reference genome +GRCh38 contains 60Mbp program generated alpha repeat arrays, some of which are +hard masked as they cannot be localized. These highly repetitive arrays make +BWA-MEM -50% slower. If you are concerned with the performance of BWA-MEM, you +may consider to use option "-c2000 -m50". On simulated data, this setting helps +the performance at a very minor cost on accuracy. I may consider to change the +default in future releases. + +(0.7.7: 25 Feburary 2014, r441) + + + +Release 0.7.6 (31 Januaray, 2014) +--------------------------------- + +Changes in BWA-MEM: + + * Changed the way mapping quality is estimated. The new method tends to give + the same alignment a higher mapping quality. On paired-end reads, the change + is minor as with pairing, the mapping quality is usually high. For short + single-end reads, the difference is considerable. + + * Improved load balance when many threads are spawned. However, bwa-mem is + still not very thread efficient, probably due to the frequent heap memory + allocation. Further improvement is a little difficult and may affect the + code stability. + + * Allow to use different clipping penalties for 5'- and 3'-ends. This helps + when we do not want to clip one end. + + * Print the @PG line, including the command line options. + + * Improved the band width estimate: a) fixed a bug causing the band + width extimated from extension not used in the final global alignment; b) + try doubled band width if the global alignment score is smaller. + Insufficient band width leads to wrong CIGAR and spurious mismatches/indels. + + * Added a new option -D to fine tune a heuristic on dropping suboptimal hits. + Reducing -D increases accuracy but decreases the mapping speed. If unsure, + leave it to the default. + + * Bugfix: for a repetitive single-end read, the reported hit is not randomly + distributed among equally best hits. + + * Bugfix: missing paired-end hits due to unsorted list of SE hits. + + * Bugfix: incorrect CIGAR caused by a defect in the global alignment. + + * Bugfix: incorrect CIGAR caused by failed SW rescue. + + * Bugfix: alignments largely mapped to the same position are regarded to be + distinct from each other, which leads to underestimated mapping quality. + + * Added the MD tag. + +There are no changes to BWA-backtrack in this release. However, it has a few +known issues yet to be fixed. If you prefer BWA-track, It is still advised to +use bwa-0.6.x. + +While I developed BWA-MEM, I also found a few issues with BWA-SW. It is now +possible to improve BWA-SW with the lessons learned from BWA-MEM. However, as +BWA-MEM is usually better, I will not improve BWA-SW until I find applications +where BWA-SW may excel. + +(0.7.6: 31 January 2014, r432) + + + +Release 0.7.5a (30 May, 2013) +----------------------------- + +Fixed a bug in BWA-backtrack which leads to off-by-one mapping errors in rare +cases. + +(0.7.5a: 30 May 2013, r405) + + + +Release 0.7.5 (29 May, 2013) +---------------------------- + +Changes in all components: + + * Improved error checking on memory allocation and file I/O. Patches provided + by Rob Davies. + + * Updated README. + + * Bugfix: return code is zero upon errors. + +Changes in BWA-MEM: + + * Changed the way a chimeric alignment is reported (conforming to the upcoming + SAM spec v1.5). With 0.7.5, if the read has a chimeric alignment, the paired + or the top hit uses soft clipping and is marked with neither 0x800 nor 0x100 + bits. All the other hits part of the chimeric alignment will use hard + clipping and be marked with 0x800 if option "-M" is not in use, or marked + with 0x100 otherwise. + + * Other hits part of a chimeric alignment are now reported in the SA tag, + conforming to the SAM spec v1.5. + + * Better method for resolving an alignment bridging two or more short + reference sequences. The current strategy maps the query to the reference + sequence that covers the middle point of the alignment. For most + applications, this change has no effects. + +Changes in BWA-backtrack: + + * Added a magic number to .sai files. This prevents samse/sampe from reading + corrupted .sai (e.g. a .sai file containing LSF log) or incompatible .sai + generated by a different version of bwa. + + * Bugfix: alignments in the XA:Z: tag were wrong. + + * Keep track of #ins and #del during backtracking. This simplifies the code + and reduces errors in rare corner cases. I should have done this in the + early days of bwa. + +In addition, if you use BWA-MEM or the fastmap command of BWA, please cite: + + - Li H. (2013) Aligning sequence reads, clone sequences and assembly contigs + with BWA-MEM. arXiv:1303.3997v2 [q-bio.GN]. + +Thank you. + +(0.7.5: 29 May 2013, r404) + + + +Release 0.7.4 (23 April, 2013) +------------------------------ + +This is a bugfix release. Most of bugs are considered to be minor which only +occur very rarely. + + * Bugfix: wrong CIGAR when a query sequence bridges three or more target + sequences. This only happens when aligning reads to short assembly contigs. + + * Bugfix: leading "D" operator in CIGAR. + + * Extend more seeds for better alignment around tandem repeats. This is also + a cause of the leading "D" operator in CIGAR. + + * Bugfix: SSE2-SSW may occasionally find incorrect query starting position + around tandem repeat. This will lead to a suboptimal CIGAR in BWA-MEM and + a wrong CIGAR in BWA. + + * Bugfix: clipping penalty does not work as is intended when there is a gap + towards the end of a read. + + * Fixed an issue caused by a bug in the libc from Mac/Darwin. In Darwin, + fread() is unable to read a data block longer than 2GB due to an integer + overflow bug in its implementation. + +Since version 0.7.4, BWA-MEM is considered to reach similar stability to +BWA-backtrack for short-read mapping. + +(0.7.4: 23 April, r385) + + + +Release 0.7.3a (15 March, 2013) +------------------------------- + +In 0.7.3, the wrong CIGAR bug was only fixed in one scenario, but not fixed +in another corner case. + +(0.7.3a: 15 March 2013, r367) + + + +Release 0.7.3 (15 March, 2013) +------------------------------ + +Changes to BWA-MEM: + + * Bugfix: pairing score is inaccurate when option -A does not take the default + value. This is a very minor issue even if it happens. + + * Bugfix: occasionally wrong CIGAR. This happens when in the alignment there + is a 1bp deletion and a 1bp insertion which are close to the end of the + reads, and there are no other substitutions or indels. BWA-MEM would not do + a gapped alignment due to the bug. + + * New feature: output other non-overlapping alignments in the XP tag such that + we can see the entire picture of alignment from one SAM line. XP gives the + position, CIGAR, NM and mapQ of each aligned subsequence of the query. + +BWA-MEM has been used to align -300Gbp 100-700bp SE/PE reads. SNP/indel calling +has also been evaluated on part of these data. BWA-MEM generally gives better +pre-filtered SNP calls than BWA. No significant issues have been observed since +0.7.2, though minor improvements or bugs (e.g. the bug fixed in this release) +are still possible. If you find potential issues, please send bug reports to + (free registration required). + +In addition, more detailed description of the BWA-MEM algorithm can be found at +. + +(0.7.3: 15 March 2013, r366) + + + +Release 0.7.2 (9 March, 2013) +----------------------------- + +Emergent bug fix: 0.7.0 and 0.7.1 give a wrong sign to TLEN. In addition, +flagging 'properly paired' also gets improved a little. + +(0.7.2: 9 March 2013, r351) + + + +Release 0.7.1 (8 March, 2013) +----------------------------- + +Changes to BWA-MEM: + + * Bugfix: rare segmentation fault caused by a partial hit to the end of the + last sequence. + + * Bugfix: occasional mis-pairing given an interleaved fastq. + + * Bugfix: wrong mate information when the mate is unmapped. SAM generated by + BWA-MEM can now be validated with Picard. + + * Improved the performance and accuracy for ultra-long query sequences. + Short-read alignment is not affected. + +Changes to other components: + + * In BWA-backtrack and BWA-SW, replaced the code for global alignment, + Smith-Waterman and SW extension. The performance and accuracy of the two + algorithms stay the same. + + * Added an experimental subcommand to merge overlapping paired ends. The + algorithm is very conservative: it may miss true overlaps but rarely makes + mistakes. + +An important note is that like BWA-SW, BWA-MEM may output multiple primary +alignments for a read, which may cause problems to some tools. For aligning +sequence reads, it is advised to use '-M' to flag extra hits as secondary. This +option is not the default because multiple primary alignments are theoretically +possible in sequence alignment. + +(0.7.1: 8 March 2013, r347) + + + +Beta Release 0.7.0 (28 Feburary, 2013) +-------------------------------------- + +This release comes with a new alignment algorithm, BWA-MEM, for 70bp-1Mbp query +sequences. BWA-MEM essentially seeds alignments with a variant of the fastmap +algorithm and extends seeds with banded affine-gap-penalty dynamic programming +(i.e. the Smith-Waterman-Gotoh algorithm). For typical Illumina 100bp reads or +longer low-divergence query sequences, BWA-MEM is about twice as fast as BWA +and BWA-SW and is more accurate. It also supports split alignments like BWA-SW +and may optionally output multiple hits like BWA. BWA-MEM does not guarantee +to find hits within a certain edit distance, but BWA is not efficient for such +task given longer reads anyway, and the edit-distance criterion is arguably +not as important in long-read alignment. + +In addition to the algorithmic improvements, BWA-MEM also implements a few +handy features in practical aspects: + + 1. BWA-MEM automatically switches between local and glocal (global wrt reads; + local wrt reference) alignment. It reports the end-to-end glocal alignment + if the glocal alignment is not much worse than the optimal local alignment. + Glocal alignment reduces reference bias. + + 2. BWA-MEM automatically infers pair orientation from a batch of single-end + alignments. It allows more than one orientations if there are sufficient + supporting reads. This feature has not been tested on reads from Illumina + jumping library yet. (EXPERIMENTAL) + + 3. BWA-MEM optionally takes one interleaved fastq for paired-end mapping. It + is possible to convert a name-sorted BAM to an interleaved fastq on the fly + and feed the data stream to BWA-MEM for mapping. + + 4. BWA-MEM optionally copies FASTA/Q comments to the final SAM output, which + helps to transfer individual read annotations to the output. + + 5. BWA-MEM supports more advanced piping. Users can now run: + (bwa mem ref.fa '20) CPU cores. + + * Check I/O error. + + * Increased the maximum barcode length to 63bp. + + * Automatically choose the indexing algorithm. + + * Bugfix: very rare segfault due to an uninitialized variable. The bug also + affects the placement of suboptimal alignments. The effect is very minor. + +This release involves quite a lot of tricky changes. Although it has been +tested on a few data sets, subtle bugs may be still hidden. It is *NOT* +recommended to use this release in a production pipeline. In future, however, +BWA-SW may be better when reads continue to go longer. I would encourage users +to try the 0.6 release. I would also like to hear the users' experience. Thank +you. + +(0.6.0: 12 November 2011, r85) + + + +Beta Release 0.5.9 (24 January, 2011) +------------------------------------- + +Notable changes: + + * Feature: barcode support via the '-B' option. + + * Feature: Illumina 1.3+ read format support via the '-I' option. + + * Bugfix: RG tags are not attached to unmapped reads. + + * Bugfix: very rare bwasw mismappings + + * Recommend options for PacBio reads in bwasw help message. + + +Also, since January 13, the BWA master repository has been moved to github: + + https://github.com/lh3/bwa + +The revision number has been reset. All recent changes will be first +committed to this repository. + +(0.5.9: 24 January 2011, r16) + + + +Beta Release Candidate 0.5.9rc1 (10 December, 2010) +--------------------------------------------------- + +Notable changes in bwasw: + + * Output unmapped reads. + + * For a repetitive read, choose a random hit instead of a fixed + one. This is not well tested. + +Notable changes in bwa-short: + + * Fixed a bug in the SW scoring system, which may lead to unexpected + gaps towards the end of a read. + + * Fixed a bug which invalidates the randomness of repetitive reads. + + * Fixed a rare memory leak. + + * Allowed to specify the read group at the command line. + + * Take name-grouped BAM files as input. + +Changes to this release are usually safe in that they do not interfere +with the key functionality. However, the release has only been tested on +small samples instead of on large-scale real data. If anything weird +happens, please report the bugs to the bio-bwa-help mailing list. + +(0.5.9rc1: 10 December 2010, r1561) + + + +Beta Release 0.5.8 (8 June, 2010) +--------------------------------- + +Notable changes in bwasw: + + * Fixed an issue of missing alignments. This should happen rarely and + only when the contig/read alignment is multi-part. Very rarely, bwasw + may still miss a segment in a multi-part alignment. This is difficult + to fix, although possible. + +Notable changes in bwa-short: + + * Discard the SW alignment when the best single-end alignment is much + better. Such a SW alignment may caused by structural variations and + forcing it to be aligned leads to false alignment. This fix has not + been tested thoroughly. It would be great to receive more users + feedbacks on this issue. + + * Fixed a typo/bug in sampe which leads to unnecessarily large memory + usage in some cases. + + * Further reduced the chance of reporting 'weird pairing'. + +(0.5.8: 8 June 2010, r1442) + + + +Beta Release 0.5.7 (1 March, 2010) +---------------------------------- + +This release only has an effect on paired-end data with fat insert-size +distribution. Users are still recommended to update as the new release +improves the robustness to poor data. + + * The fix for 'weird pairing' was not working in version 0.5.6, pointed + out by Carol Scott. It should work now. + + * Optionally output to a normal file rather than to stdout (by Tim + Fennel). + +(0.5.7: 1 March 2010, r1310) + + + +Beta Release 0.5.6 (10 Feburary, 2010) +-------------------------------------- + +Notable changes in bwa-short: + + * Report multiple hits in the SAM format at a new tag XA encoded as: + (chr,pos,CIGAR,NM;)*. By default, if a paired or single-end read has + 4 or fewer hits, they will all be reported; if a read in a anomalous + pair has 11 or fewer hits, all of them will be reported. + + * Perform Smith-Waterman alignment also for anomalous read pairs when + both ends have quality higher than 17. This reduces false positives + for some SV discovery algorithms. + + * Do not report "weird pairing" when the insert size distribution is + too fat or has a mean close to zero. + + * If a read is bridging two adjacent chromsomes, flag it as unmapped. + + * Fixed a small but long existing memory leak in paired-end mapping. + + * Multiple bug fixes in SOLiD mapping: a) quality "-1" can be correctly + parsed by solid2fastq.pl; b) truncated quality string is resolved; c) + SOLiD read mapped to the reverse strand is complemented. + + * Bwa now calculates skewness and kurtosis of the insert size + distribution. + + * Deploy a Bayesian method to estimate the maximum distance for a read + pair considered to be paired properly. The method is proposed by + Gerton Lunter, but bwa only implements a simplified version. + + * Export more functions for Java bindings, by Matt Hanna (See: + http://www.broadinstitute.org/gsa/wiki/index.php/Sting_BWA/C_bindings) + + * Abstract bwa CIGAR for further extension, by Rodrigo Goya. + +(0.5.6: 10 Feburary 2010, r1303) + + + +Beta Release 0.5.5 (10 November, 2009) +-------------------------------------- + +This is a bug fix release: + + * Fixed a serious bug/typo in aln which does not occur given short + reads, but will lead to segfault for >500bp reads. Of course, the aln + command is not recommended for reads longer than 200bp, but this is a + bug anyway. + + * Fixed a minor bug/typo which leads to incorrect single-end mapping + quality when one end is moved to meet the mate-pair requirement. + + * Fixed a bug in samse for mapping in the color space. This bug is + caused by quality filtration added since 0.5.1. + +(0.5.5: 10 November 2009, r1273) + + + +Beta Release 0.5.4 (9 October, 2009) +------------------------------------ + +Since this version, the default seed length used in the "aln" command is +changed to 32. + +Notable changes in bwa-short: + + * Added a new tag "XC:i" which gives the length of clipped reads. + + * In sampe, skip alignments in case of a bug in the Smith-Waterman + alignment module. + + * In sampe, fixed a bug in pairing when the read sequence is identical + to its reverse complement. + + * In sampe, optionally preload the entire FM-index into memory to + reduce disk operations. + +Notable changes in dBWT-SW/BWA-SW: + + * Changed name dBWT-SW to BWA-SW. + + * Optionally use "hard clipping" in the SAM output. + +(0.5.4: 9 October 2009, r1245) + + + +Beta Release 0.5.3 (15 September, 2009) +--------------------------------------- + +Fixed a critical bug in bwa-short: reads mapped to the reverse strand +are not complemented. + +(0.5.3: 15 September 2009, r1225) + + + +Beta Release 0.5.2 (13 September, 2009) +--------------------------------------- + +Notable changes in bwa-short: + + * Optionally trim reads before alignment. See the manual page on 'aln + -q' for detailed description. + + * Fixed a bug in calculating the NM tag for a gapped alignment. + + * Fixed a bug given a mixture of reads with some longer than the seed + length and some shorter. + + * Print SAM header. + +Notable changes in dBWT-SW: + + * Changed the default value of -T to 30. As a result, the accuracy is a + little higher for short reads at the cost of speed. + +(0.5.2: 13 September 2009, r1223) + + + +Beta Release 0.5.1 (2 September, 2009) +-------------------------------------- + +Notable changes in the short read alignment component: + + * Fixed a bug in samse: do not write mate coordinates. + +Notable changes in dBWT-SW: + + * Randomly choose one alignment if the read is a repetitive. + + * Fixed a flaw when a read is mapped across two adjacent reference + sequences. However, wrong alignment reports may still occur rarely in + this case. + + * Changed the default band width to 50. The speed is slower due to this + change. + + * Improved the mapping quality a little given long query sequences. + +(0.5.1: 2 September 2009, r1209) + + + +Beta Release 0.5.0 (20 August, 2009) +------------------------------------ + +This release implements a novel algorithm, dBWT-SW, specifically +designed for long reads. It is 10-50 times faster than SSAHA2, depending +on the characteristics of the input data, and achieves comparable +alignment accuracy while allowing chimera detection. In comparison to +BLAT, dBWT-SW is several times faster and much more accurate especially +when the error rate is high. Please read the manual page for more +information. + +The dBWT-SW algorithm is kind of developed for future sequencing +technologies which produce much longer reads with a little higher error +rate. It is still at its early development stage. Some features are +missing and it may be buggy although I have evaluated on several +simulated and real data sets. But following the "release early" +paradigm, I would like the users to try it first. + +Other notable changes in BWA are: + + * Fixed a rare bug in the Smith-Waterman alignment module. + + * Fixed a rare bug about the wrong alignment coordinate when a read is + poorly aligned. + + * Fixed a bug in generating the "mate-unmap" SAM tag when both ends in + a pair are unmapped. + +(0.5.0: 20 August 2009, r1200) + + + +Beta Release 0.4.9 (19 May, 2009) +--------------------------------- + +Interestingly, the integer overflow bug claimed to be fixed in 0.4.7 has +not in fact. Now I have fixed the bug. Sorry for this and thank Quan +Long for pointing out the bug (again). + +(0.4.9: 19 May 2009, r1075) + + + +Beta Release 0.4.8 (18 May, 2009) +--------------------------------- + +One change to "aln -R". Now by default, if there are no more than '-R' +equally best hits, bwa will search for suboptimal hits. This change +affects the ability in finding SNPs in segmental duplications. + +I have not tested this option thoroughly, but this simple change is less +likely to cause new bugs. Hope I am right. + +(0.4.8: 18 May 2009, r1073) + + + +Beta Release 0.4.7 (12 May, 2009) +--------------------------------- + +Notable changes: + + * Output SM (single-end mapping quality) and AM (smaller mapping + quality among the two ends) tag from sam output. + + * Improved the functionality of stdsw. + + * Made the XN tag more accurate. + + * Fixed a very rare segfault caused by integer overflow. + + * Improve the insert size estimation. + + * Fixed compiling errors for some Linux systems. + +(0.4.7: 12 May 2009, r1066) + + + +Beta Release 0.4.6 (9 March, 2009) +---------------------------------- + +This release improves the SOLiD support. First, a script for converting +SOLiD raw data is provided. This script is adapted from solid2fastq.pl +in the MAQ package. Second, a nucleotide reference file can be directly +used with 'bwa index'. Third, SOLiD paired-end support is +completed. Fourth, color-space reads will be converted to nucleotides +when SAM output is generated. Color errors are corrected in this +process. Please note that like MAQ, BWA cannot make use of the primer +base and the first color. + +In addition, the calculation of mapping quality is also improved a +little bit, although end-users may barely observe the difference. + +(0.4.6: 9 March 2009, r915) + + + +Beta Release 0.4.5 (18 Feburary, 2009) +-------------------------------------- + +Not much happened, but I think it would be good to let the users use the +latest version. + +Notable changes (Thank Bob Handsaker for catching the two bugs): + + * Improved bounary check. Previous version may still give incorrect + alignment coordinates in rare cases. + + * Fixed a bug in SW alignment when no residue matches. This only + affects the 'sampe' command. + + * Robustly estimate insert size without setting the maximum on the + command line. Since this release 'sampe -a' only has an effect if + there are not enough good pairs to infer the insert size + distribution. + + * Reduced false PE alignments a little bit by using the inferred insert + size distribution. This fix may be more important for long insert + size libraries. + +(0.4.5: 18 Feburary 2009, r829) + + + +Beta Release 0.4.4 (15 Feburary, 2009) +-------------------------------------- + +This is mainly a bug fix release. Notable changes are: + + * Imposed boundary check for extracting subsequence from the + genome. Previously this causes memory problem in rare cases. + + * Fixed a bug in failing to find whether an alignment overlapping with + N on the genome. + + * Changed MD tag to meet the latest SAM specification. + +(0.4.4: 15 Feburary 2009, r815) + + + +Beta Release 0.4.3 (22 January, 2009) +------------------------------------ + +Notable changes: + + * Treat an ambiguous base N as a mismatch. Previous versions will not + map reads containing any N. + + * Automatically choose the maximum allowed number of differences. This + is important when reads of different lengths are mixed together. + + * Print mate coordinate if only one end is unmapped. + + * Generate MD tag. This tag encodes the mismatching positions and the + reference bases at these positions. Deletions from the reference will + also be printed. + + * Optionally dump multiple hits from samse, in another concise format + rather than SAM. + + * Optionally disable iterative search. This is VERY SLOOOOW, though. + + * Fixed a bug in generate SAM. + +(0.4.3: 22 January 2009, r787) + + + +Beta Release 0.4.2 (9 January, 2009) +------------------------------------ + +Aaron Quinlan found a bug in the indexer: the bwa indexer segfaults if +there are no comment texts in the FASTA header. This is a critical +bug. Nothing else was changed. + +(0.4.2: 9 January 2009, r769) + + + +Beta Release 0.4.1 (7 January, 2009) +------------------------------------ + +I am sorry for the quick updates these days. I like to set a milestone +for BWA and this release seems to be. For paired end reads, BWA also +does Smith-Waterman alignment for an unmapped read whose mate can be +mapped confidently. With this strategy BWA achieves similar accuracy to +maq. Benchmark is also updated accordingly. + +(0.4.1: 7 January 2009, r760) + + + +Beta Release 0.4.0 (6 January, 2009) +------------------------------------ + +In comparison to the release two days ago, this release is mainly tuned +for performance with some tricks I learnt from Bowtie. However, as the +indexing format has also been changed, I have to increase the version +number to 0.4.0 to emphasize that *DATABASE MUST BE RE-INDEXED* with +'bwa index'. + + * Improved the speed by about 20%. + + * Added multi-threading to 'bwa aln'. + +(0.4.0: 6 January 2009, r756) + + + +Beta Release 0.3.0 (4 January, 2009) +------------------------------------ + + * Added paired-end support by separating SA calculation and alignment + output. + + * Added SAM output. + + * Added evaluation to the documentation. + +(0.3.0: 4 January 2009, r741) + + + +Beta Release 0.2.0 (15 Augusst, 2008) +------------------------------------- + + * Take the subsequence at the 5'-end as seed. Seeding strategy greatly + improves the speed for long reads, at the cost of missing a few true + hits that contain many differences in the seed. Seeding also increase + the memory by 800MB. + + * Fixed a bug which may miss some gapped alignments. Fixing the bug + also slows the speed a little. + +(0.2.0: 15 August 2008, r428) + + + +Beta Release 0.1.6 (08 Augusst, 2008) +------------------------------------- + + * Give accurate CIGAR string. + + * Add a simple interface to SW/NW alignment + +(0.1.6: 08 August 2008, r414) + + + +Beta Release 0.1.5 (27 July, 2008) +---------------------------------- + + * Improve the speed. This version is expected to give the same results. + +(0.1.5: 27 July 2008, r400) + + + +Beta Release 0.1.4 (22 July, 2008) +---------------------------------- + + * Fixed a bug which may cause missing gapped alignments. + + * More clearly define what alignments can be found by BWA (See + manual). Now BWA runs a little slower because it will visit more + potential gapped alignments. + + * A bit code clean up. + +(0.1.4: 22 July 2008, r387) + + + +Beta Release 0.1.3 (21 July, 2008) +---------------------------------- + +Improve the speed with some tricks on retrieving occurences. The results +should be exactly the same as that of 0.1.2. + +(0.1.3: 21 July 2008, r382) + + + +Beta Release 0.1.2 (17 July, 2008) +---------------------------------- + +Support gapped alignment. Codes for ungapped alignment has been removed. + +(0.1.2: 17 July 2008, r371) + + + +Beta Release 0.1.1 (03 June, 2008) +----------------------------------- + +This is the first release of BWA, Burrows-Wheeler Alignment tool. Please +read man page for more information about this software. + +(0.1.1: 03 June 2008, r349) diff --git a/QSufSort.c b/QSufSort.c new file mode 100644 index 0000000..36c5a51 --- /dev/null +++ b/QSufSort.c @@ -0,0 +1,402 @@ +/* QSufSort.c + + Original source from qsufsort.c + + Copyright 1999, N. Jesper Larsson, all rights reserved. + + This file contains an implementation of the algorithm presented in "Faster + Suffix Sorting" by N. Jesper Larsson (jesper@cs.lth.se) and Kunihiko + Sadakane (sada@is.s.u-tokyo.ac.jp). + + This software may be used freely for any purpose. However, when distributed, + the original source must be clearly stated, and, when the source code is + distributed, the copyright notice must be retained and any alterations in + the code must be clearly marked. No warranty is given regarding the quality + of this software. + + Modified by Wong Chi-Kwong, 2004 + + Changes summary: - Used long variable and function names + - Removed global variables + - Replace pointer references with array references + - Used insertion sort in place of selection sort and increased insertion sort threshold + - Reconstructing suffix array from inverse becomes an option + - Add handling where end-of-text symbol is not necessary < all characters + - Removed codes for supporting alphabet size > number of characters + + No warrenty is given regarding the quality of the modifications. + +*/ + + +#include +#include +#include +#include "QSufSort.h" + +#define min(value1, value2) ( ((value1) < (value2)) ? (value1) : (value2) ) +#define med3(a, b, c) ( ac ? b : a>c ? c : a)) +#define swap(a, b, t); t = a; a = b; b = t; + +// Static functions +static void QSufSortSortSplit(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t lowestPos, + const qsint_t highestPos, const qsint_t numSortedChar); +static qsint_t QSufSortChoosePivot(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t lowestPos, + const qsint_t highestPos, const qsint_t numSortedChar); +static void QSufSortInsertSortSplit(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t lowestPos, + const qsint_t highestPos, const qsint_t numSortedChar); +static void QSufSortBucketSort(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t numChar, const qsint_t alphabetSize); +static qsint_t QSufSortTransform(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t numChar, const qsint_t largestInputSymbol, + const qsint_t smallestInputSymbol, const qsint_t maxNewAlphabetSize, qsint_t *numSymbolAggregated); + +/* Makes suffix array p of x. x becomes inverse of p. p and x are both of size + n+1. Contents of x[0...n-1] are integers in the range l...k-1. Original + contents of x[n] is disregarded, the n-th symbol being regarded as + end-of-string smaller than all other symbols.*/ +void QSufSortSuffixSort(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t numChar, const qsint_t largestInputSymbol, + const qsint_t smallestInputSymbol, const int skipTransform) +{ + qsint_t i, j; + qsint_t s, negatedSortedGroupLength; + qsint_t numSymbolAggregated; + qsint_t numSortedPos = 1; + qsint_t newAlphabetSize; + + if (!skipTransform) { + /* bucketing possible*/ + newAlphabetSize = QSufSortTransform(V, I, numChar, largestInputSymbol, smallestInputSymbol, + numChar, &numSymbolAggregated); + QSufSortBucketSort(V, I, numChar, newAlphabetSize); + I[0] = -1; + V[numChar] = 0; + numSortedPos = numSymbolAggregated; + } + + while ((qsint_t)(I[0]) >= -(qsint_t)numChar) { + i = 0; + negatedSortedGroupLength = 0; + do { + s = I[i]; + if (s < 0) { + i -= s; /* skip over sorted group.*/ + negatedSortedGroupLength += s; + } else { + if (negatedSortedGroupLength) { + I[i+negatedSortedGroupLength] = negatedSortedGroupLength; /* combine preceding sorted groups */ + negatedSortedGroupLength = 0; + } + j = V[s] + 1; + QSufSortSortSplit(V, I, i, j - 1, numSortedPos); + i = j; + } + } while (i <= numChar); + if (negatedSortedGroupLength) { + /* array ends with a sorted group.*/ + I[i+negatedSortedGroupLength] = negatedSortedGroupLength; /* combine sorted groups at end of I.*/ + } + numSortedPos *= 2; /* double sorted-depth.*/ + } +} + +void QSufSortGenerateSaFromInverse(const qsint_t* V, qsint_t* __restrict I, const qsint_t numChar) +{ + qsint_t i; + for (i=0; i<=numChar; i++) + I[V[i]] = i + 1; +} + +/* Sorting routine called for each unsorted group. Sorts the array of integers + (suffix numbers) of length n starting at p. The algorithm is a ternary-split + quicksort taken from Bentley & McIlroy, "Engineering a Sort Function", + Software -- Practice and Experience 23(11), 1249-1265 (November 1993). This + function is based on Program 7.*/ +static void QSufSortSortSplit(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t lowestPos, + const qsint_t highestPos, const qsint_t numSortedChar) { + + qsint_t a, b, c, d; + qsint_t l, m; + qsint_t f, v, s, t; + qsint_t tmp; + qsint_t numItem; + + numItem = highestPos - lowestPos + 1; + + if (numItem <= INSERT_SORT_NUM_ITEM) { + QSufSortInsertSortSplit(V, I, lowestPos, highestPos, numSortedChar); + return; + } + + v = QSufSortChoosePivot(V, I, lowestPos, highestPos, numSortedChar); + + a = b = lowestPos; + c = d = highestPos; + + while (1) { + while (c >= b && (f = KEY(V, I, b, numSortedChar)) <= v) { + if (f == v) { + swap(I[a], I[b], tmp); + a++; + } + b++; + } + while (c >= b && (f = KEY(V, I, c, numSortedChar)) >= v) { + if (f == v) { + swap(I[c], I[d], tmp); + d--; + } + c--; + } + if (b > c) + break; + swap(I[b], I[c], tmp); + b++; + c--; + } + + s = a - lowestPos; + t = b - a; + s = min(s, t); + for (l = lowestPos, m = b - s; m < b; l++, m++) { + swap(I[l], I[m], tmp); + } + + s = d - c; + t = highestPos - d; + s = min(s, t); + for (l = b, m = highestPos - s + 1; m <= highestPos; l++, m++) { + swap(I[l], I[m], tmp); + } + + s = b - a; + t = d - c; + if (s > 0) + QSufSortSortSplit(V, I, lowestPos, lowestPos + s - 1, numSortedChar); + + // Update group number for equal portion + a = lowestPos + s; + b = highestPos - t; + if (a == b) { + // Sorted group + V[I[a]] = a; + I[a] = -1; + } else { + // Unsorted group + for (c=a; c<=b; c++) + V[I[c]] = b; + } + + if (t > 0) + QSufSortSortSplit(V, I, highestPos - t + 1, highestPos, numSortedChar); + +} + +/* Algorithm by Bentley & McIlroy.*/ +static qsint_t QSufSortChoosePivot(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t lowestPos, + const qsint_t highestPos, const qsint_t numSortedChar) { + + qsint_t m; + qsint_t keyl, keym, keyn; + qsint_t key1, key2, key3; + qsint_t s; + qsint_t numItem; + + numItem = highestPos - lowestPos + 1; + + m = lowestPos + numItem / 2; + + s = numItem / 8; + key1 = KEY(V, I, lowestPos, numSortedChar); + key2 = KEY(V, I, lowestPos+s, numSortedChar); + key3 = KEY(V, I, lowestPos+2*s, numSortedChar); + keyl = med3(key1, key2, key3); + key1 = KEY(V, I, m-s, numSortedChar); + key2 = KEY(V, I, m, numSortedChar); + key3 = KEY(V, I, m+s, numSortedChar); + keym = med3(key1, key2, key3); + key1 = KEY(V, I, highestPos-2*s, numSortedChar); + key2 = KEY(V, I, highestPos-s, numSortedChar); + key3 = KEY(V, I, highestPos, numSortedChar); + keyn = med3(key1, key2, key3); + + return med3(keyl, keym, keyn); + + +} + +/* Quadratic sorting method to use for small subarrays. */ +static void QSufSortInsertSortSplit(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t lowestPos, + const qsint_t highestPos, const qsint_t numSortedChar) +{ + qsint_t i, j; + qsint_t tmpKey, tmpPos; + qsint_t numItem; + qsint_t key[INSERT_SORT_NUM_ITEM], pos[INSERT_SORT_NUM_ITEM]; + qsint_t negativeSortedLength; + qsint_t groupNum; + + numItem = highestPos - lowestPos + 1; + + for (i=0; i0 && key[j-1] > tmpKey; j--) { + key[j] = key[j-1]; + pos[j] = pos[j-1]; + } + key[j] = tmpKey; + pos[j] = tmpPos; + } + + negativeSortedLength = -1; + + i = numItem - 1; + groupNum = highestPos; + while (i > 0) { + I[i+lowestPos] = pos[i]; + V[I[i+lowestPos]] = groupNum; + if (key[i-1] == key[i]) { + negativeSortedLength = 0; + } else { + if (negativeSortedLength < 0) + I[i+lowestPos] = negativeSortedLength; + groupNum = i + lowestPos - 1; + negativeSortedLength--; + } + i--; + } + + I[lowestPos] = pos[0]; + V[I[lowestPos]] = groupNum; + if (negativeSortedLength < 0) + I[lowestPos] = negativeSortedLength; +} + +/* Bucketsort for first iteration. + + Input: x[0...n-1] holds integers in the range 1...k-1, all of which appear + at least once. x[n] is 0. (This is the corresponding output of transform.) k + must be at most n+1. p is array of size n+1 whose contents are disregarded. + + Output: x is V and p is I after the initial sorting stage of the refined + suffix sorting algorithm.*/ + +static void QSufSortBucketSort(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t numChar, const qsint_t alphabetSize) +{ + qsint_t i, c; + qsint_t d; + qsint_t groupNum; + qsint_t currentIndex; + + // mark linked list empty + for (i=0; i0; i--) { + c = I[i-1]; + d = (qsint_t)(V[c]); + groupNum = currentIndex; + V[c] = groupNum; + if (d >= 0) { + I[currentIndex] = c; + while (d >= 0) { + c = d; + d = V[c]; + V[c] = groupNum; + currentIndex--; + I[currentIndex] = c; + } + } else { + // sorted group + I[currentIndex] = -1; + } + currentIndex--; + } +} + +/* Transforms the alphabet of x by attempting to aggregate several symbols into + one, while preserving the suffix order of x. The alphabet may also be + compacted, so that x on output comprises all integers of the new alphabet + with no skipped numbers. + + Input: x is an array of size n+1 whose first n elements are positive + integers in the range l...k-1. p is array of size n+1, used for temporary + storage. q controls aggregation and compaction by defining the maximum intue + for any symbol during transformation: q must be at least k-l; if q<=n, + compaction is guaranteed; if k-l>n, compaction is never done; if q is + INT_MAX, the maximum number of symbols are aggregated into one. + + Output: Returns an integer j in the range 1...q representing the size of the + new alphabet. If j<=n+1, the alphabet is compacted. The global variable r is + set to the number of old symbols grouped into one. Only x[n] is 0.*/ +static qsint_t QSufSortTransform(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t numChar, const qsint_t largestInputSymbol, + const qsint_t smallestInputSymbol, const qsint_t maxNewAlphabetSize, qsint_t *numSymbolAggregated) +{ + qsint_t c, i, j; + qsint_t a; // numSymbolAggregated + qsint_t mask; + qsint_t minSymbolInChunk = 0, maxSymbolInChunk = 0; + qsint_t newAlphabetSize; + qsint_t maxNumInputSymbol, maxNumBit, maxSymbol; + + maxNumInputSymbol = largestInputSymbol - smallestInputSymbol + 1; + + for (maxNumBit = 0, i = maxNumInputSymbol; i; i >>= 1) ++maxNumBit; + maxSymbol = QSINT_MAX >> maxNumBit; + + c = maxNumInputSymbol; + for (a = 0; a < numChar && maxSymbolInChunk <= maxSymbol && c <= maxNewAlphabetSize; a++) { + minSymbolInChunk = (minSymbolInChunk << maxNumBit) | (V[a] - smallestInputSymbol + 1); + maxSymbolInChunk = c; + c = (maxSymbolInChunk << maxNumBit) | maxNumInputSymbol; + } + + mask = (1 << (a-1) * maxNumBit) - 1; /* mask masks off top old symbol from chunk.*/ + V[numChar] = smallestInputSymbol - 1; /* emulate zero terminator.*/ + + /* bucketing possible, compact alphabet.*/ + for (i=0; i<=maxSymbolInChunk; i++) + I[i] = 0; /* zero transformation table.*/ + c = minSymbolInChunk; + for (i=a; i<=numChar; i++) { + I[c] = 1; /* mark used chunk symbol.*/ + c = ((c & mask) << maxNumBit) | (V[i] - smallestInputSymbol + 1); /* shift in next old symbol in chunk.*/ + } + for (i=1; i number of characters + + No warrenty is given regarding the quality of the modifications. + +*/ + +#ifndef __QSUFSORT_H__ +#define __QSUFSORT_H__ + +#include + +#define KEY(V, I, p, h) ( V[ I[p] + h ] ) +#define INSERT_SORT_NUM_ITEM 16 + +typedef int64_t qsint_t; +#define QSINT_MAX INT64_MAX + +void QSufSortSuffixSort(qsint_t* __restrict V, qsint_t* __restrict I, const qsint_t numChar, const qsint_t largestInputSymbol, + const qsint_t smallestInputSymbol, const int skipTransform); +void QSufSortGenerateSaFromInverse(const qsint_t *V, qsint_t* __restrict I, const qsint_t numChar); + + +#endif diff --git a/README-alt.md b/README-alt.md new file mode 100644 index 0000000..058ab7a --- /dev/null +++ b/README-alt.md @@ -0,0 +1,178 @@ +## For the Impatient + +```sh +# Download bwakit (or from manually) +wget -O- http://sourceforge.net/projects/bio-bwa/files/bwakit/bwakit-0.7.12_x64-linux.tar.bz2/download \ + | gzip -dc | tar xf - +# Generate the GRCh38+ALT+decoy+HLA and create the BWA index +bwa.kit/run-gen-ref hs38DH # download GRCh38 and write hs38DH.fa +bwa.kit/bwa index hs38DH.fa # create BWA index +# mapping +bwa.kit/run-bwamem -o out -H hs38DH.fa read1.fq read2.fq | sh # skip "|sh" to show command lines +``` + +This generates `out.aln.bam` as the final alignment, `out.hla.top` for best HLA +genotypes on each gene and `out.hla.all` for other possible HLA genotypes. +Please check out [bwa/bwakit/README.md][kithelp] for details. + +## Background + +GRCh38 consists of several components: chromosomal assembly, unlocalized contigs +(chromosome known but location unknown), unplaced contigs (chromosome unknown) +and ALT contigs (long clustered variations). The combination of the first three +components is called the *primary assembly*. It is recommended to use the +complete primary assembly for all analyses. Using ALT contigs in read mapping is +tricky. + +GRCh38 ALT contigs are totaled 109Mb in length, spanning 60Mbp of the primary +assembly. However, sequences that are highly diverged from the primary assembly +only contribute a few million bp. Most subsequences of ALT contigs are nearly +identical to the primary assembly. If we align sequence reads to GRCh38+ALT +blindly, we will get many additional reads with zero mapping quality and miss +variants on them. It is crucial to make mappers aware of ALTs. + +BWA-MEM is ALT-aware. It essentially computes mapping quality across the +non-redundant content of the primary assembly plus the ALT contigs and is free +of the problem above. + +## Methods + +### Sequence alignment + +As of now, ALT mapping is done in two separate steps: BWA-MEM mapping and +postprocessing. The `bwa.kit/run-bwamem` script performs the two steps when ALT +contigs are present. The following picture shows an example about how BWA-MEM +infers mapping quality and reports alignment after step 2: + +![](http://lh3lh3.users.sourceforge.net/images/alt-demo.png) + +#### Step 1: BWA-MEM mapping + +At this step, BWA-MEM reads the ALT contig names from "*idxbase*.alt", ignoring +the ALT-to-ref alignment, and labels a potential hit as *ALT* or *non-ALT*, +depending on whether the hit lands on an ALT contig or not. BWA-MEM then reports +alignments and assigns mapQ following these two rules: + +1. The mapQ of a non-ALT hit is computed across non-ALT hits only. The mapQ of + an ALT hit is computed across all hits. + +2. If there are no non-ALT hits, the best ALT hit is outputted as the primary + alignment. If there are both ALT and non-ALT hits, non-ALT hits will be + primary and ALT hits be supplementary (SAM flag 0x800). + +In theory, non-ALT alignments from step 1 should be identical to alignments +against the reference genome with ALT contigs. In practice, the two types of +alignments may differ in rare cases due to seeding heuristics. When an ALT hit +is significantly better than non-ALT hits, BWA-MEM may miss seeds on the +non-ALT hits. + +If we don't care about ALT hits, we may skip postprocessing (step 2). +Nonetheless, postprocessing is recommended as it improves mapQ and gives more +information about ALT hits. + +#### Step 2: Postprocessing + +Postprocessing is done with a separate script `bwa-postalt.js`. It reads all +potential hits reported in the XA tag, lifts ALT hits to the chromosomal +positions using the ALT-to-ref alignment, groups them based on overlaps between +their lifted positions, and then re-estimates mapQ across the best scoring hit +in each group. Being aware of the ALT-to-ref alignment, this script can greatly +improve mapQ of ALT hits and occasionally improve mapQ of non-ALT hits. It also +writes each hit overlapping the reported hit into a separate SAM line. This +enables variant calling on each ALT contig independent of others. + +### On the completeness of GRCh38+ALT + +While GRCh38 is much more complete than GRCh37, it is still missing some true +human sequences. To make sure every piece of sequence in the reference assembly +is correct, the [Genome Reference Consortium][grc] (GRC) require each ALT contig +to have enough support from multiple sources before considering to add it to the +reference assembly. This careful and sophisticated procedure has left out some +sequences, one of which is [this example][novel], a 10kb contig assembled from +CHM1 short reads and present also in NA12878. You can try [BLAT][blat] or +[BLAST][blast] to see where it maps. + +For a more complete reference genome, we compiled a new set of decoy sequences +from GenBank clones and the de novo assembly of 254 public [SGDP][sgdp] samples. +The sequences are included in `hs38DH-extra.fa` from the [BWA binary +package][res]. + +In addition to decoy, we also put multiple alleles of HLA genes in +`hs38DH-extra.fa`. These genomic sequences were acquired from [IMGT/HLA][hladb], +version 3.18.0 and are used to collect reads sequenced from these genes. + +### HLA typing + +HLA genes are known to be associated with many autoimmune diseases, infectious +diseases and drug responses. They are among the most important genes but are +rarely studied by WGS projects due to the high sequence divergence between +HLA genes and the reference genome in these regions. + +By including the HLA gene regions in the reference assembly as ALT contigs, we +are able to effectively identify reads coming from these genes. We also provide +a pipeline, which is included in the [BWA binary package][res], to type the +several classic HLA genes. The pipeline is conceptually simple. It de novo +assembles sequence reads mapped to each gene, aligns exon sequences of each +allele to the assembled contigs and then finds the pairs of alleles that best +explain the contigs. In practice, however, the completeness of IMGT/HLA and +copy-number changes related to these genes are not so straightforward to +resolve. HLA typing may not always be successful. Users may also consider to use +other programs for typing such as [Warren et al (2012)][hla4], [Liu et al +(2013)][hla2], [Bai et al (2014)][hla3] and [Dilthey et al (2014)][hla1], though +most of them are distributed under restrictive licenses. + +## Preliminary Evaluation + +To check whether GRCh38 is better than GRCh37, we mapped the CHM1 and NA12878 +unitigs to GRCh37 primary (hs37), GRCh38 primary (hs38) and GRCh38+ALT+decoy +(hs38DH), and called small variants from the alignment. CHM1 is haploid. +Ideally, heterozygous calls are false positives (FP). NA12878 is diploid. The +true positive (TP) heterozygous calls from NA12878 are approximately equal +to the difference between NA12878 and CHM1 heterozygous calls. A better assembly +should yield higher TP and lower FP. The following table shows the numbers for +these assemblies: + +|Assembly|hs37 |hs38 |hs38DH|CHM1_1.1| huref| +|:------:|------:|------:|------:|------:|------:| +|FP | 255706| 168068| 142516|307172 | 575634| +|TP |2142260|2163113|2150844|2167235|2137053| + +With this measurement, hs38 is clearly better than hs37. Genome hs38DH reduces +FP by ~25k but also reduces TP by ~12k. We manually inspected variants called +from hs38 only and found the majority of them are associated with excessive read +depth, clustered variants or weak alignment. We believe most hs38-only calls are +problematic. In addition, if we compare two NA12878 replicates from HiSeq X10 +with nearly identical library construction, the difference is ~140k, an order +of magnitude higher than the difference between hs38 and hs38DH. ALT contigs, +decoy and HLA genes in hs38DH improve variant calling and enable the analyses of +ALT contigs and HLA typing at little cost. + +## Problems and Future Development + +There are some uncertainties about ALT mappings - we are not sure whether they +help biological discovery and don't know the best way to analyze them. Without +clear demand from downstream analyses, it is very difficult to design the +optimal mapping strategy. The current BWA-MEM method is just a start. If it +turns out to be useful in research, we will probably rewrite bwa-postalt.js in C +for performance; if not, we may make changes. It is also possible that we might +make breakthrough on the representation of multiple genomes, in which case, we +can even get rid of ALT contigs for good. + + + +[res]: https://sourceforge.net/projects/bio-bwa/files/bwakit +[sb]: https://github.com/GregoryFaust/samblaster +[grc]: http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/ +[novel]: https://gist.github.com/lh3/9935148b71f04ba1a8cc +[blat]: https://genome.ucsc.edu/cgi-bin/hgBlat +[blast]: http://blast.st-va.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome +[sgdp]: http://www.simonsfoundation.org/life-sciences/simons-genome-diversity-project/ +[hladb]: http://www.ebi.ac.uk/ipd/imgt/hla/ +[grcdef]: http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/info/definitions.shtml +[hla1]: http://biorxiv.org/content/early/2014/07/08/006973 +[hlalink]: http://www.hladiseaseassociations.com +[hlatools]: https://www.biostars.org/p/93245/ +[hla2]: http://nar.oxfordjournals.org/content/41/14/e142.full.pdf+html +[hla3]: http://www.biomedcentral.com/1471-2164/15/325 +[hla4]: http://genomemedicine.com/content/4/12/95 +[kithelp]: https://github.com/lh3/bwa/tree/master/bwakit diff --git a/README.md b/README.md new file mode 100644 index 0000000..ba268a5 --- /dev/null +++ b/README.md @@ -0,0 +1,11 @@ +# FastBWA +Fast alignment tool based on bwa-mem + +# 1. Compile the source code +make -j 8 + +# 2. Build the FMT-Index +./fastbwa index reference.fasta + +# 3. Run sequence alignment with fastBWA +./fastbwa mem -t 64 -2 -M -R @RG\\tID:normal\\tSM:normal\\tPL:illumina\\tLB:normal\\tPG:fastbwa reference.fasta r1.fq.gz r2.fq.gz diff --git a/bamlite.c b/bamlite.c new file mode 100644 index 0000000..3704beb --- /dev/null +++ b/bamlite.c @@ -0,0 +1,210 @@ +#include +#include +#include +#include +#include +#include "bamlite.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +/********************* + * from bam_endian.c * + *********************/ + +static inline int bam_is_big_endian() +{ + long one= 1; + return !(*((char *)(&one))); +} +static inline uint16_t bam_swap_endian_2(uint16_t v) +{ + return (uint16_t)(((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8)); +} +static inline void *bam_swap_endian_2p(void *x) +{ + *(uint16_t*)x = bam_swap_endian_2(*(uint16_t*)x); + return x; +} +static inline uint32_t bam_swap_endian_4(uint32_t v) +{ + v = ((v & 0x0000FFFFU) << 16) | (v >> 16); + return ((v & 0x00FF00FFU) << 8) | ((v & 0xFF00FF00U) >> 8); +} +static inline void *bam_swap_endian_4p(void *x) +{ + *(uint32_t*)x = bam_swap_endian_4(*(uint32_t*)x); + return x; +} +static inline uint64_t bam_swap_endian_8(uint64_t v) +{ + v = ((v & 0x00000000FFFFFFFFLLU) << 32) | (v >> 32); + v = ((v & 0x0000FFFF0000FFFFLLU) << 16) | ((v & 0xFFFF0000FFFF0000LLU) >> 16); + return ((v & 0x00FF00FF00FF00FFLLU) << 8) | ((v & 0xFF00FF00FF00FF00LLU) >> 8); +} +static inline void *bam_swap_endian_8p(void *x) +{ + *(uint64_t*)x = bam_swap_endian_8(*(uint64_t*)x); + return x; +} + +/************** + * from bam.c * + **************/ + +int bam_is_be; + +bam_header_t *bam_header_init() +{ + bam_is_be = bam_is_big_endian(); + return (bam_header_t*)calloc(1, sizeof(bam_header_t)); +} + +void bam_header_destroy(bam_header_t *header) +{ + int32_t i; + if (header == 0) return; + if (header->target_name) { + for (i = 0; i < header->n_targets; ++i) + if (header->target_name[i]) free(header->target_name[i]); + if (header->target_len) free(header->target_len); + free(header->target_name); + } + if (header->text) free(header->text); + free(header); +} + +bam_header_t *bam_header_read(bamFile fp) +{ + bam_header_t *header; + char buf[4]; + int magic_len; + int32_t i = 1, name_len; + // read "BAM1" + magic_len = bam_read(fp, buf, 4); + if (magic_len != 4 || strncmp(buf, "BAM\001", 4) != 0) { + fprintf(stderr, "[bam_header_read] invalid BAM binary header (this is not a BAM file).\n"); + return NULL; + } + header = bam_header_init(); + // read plain text and the number of reference sequences + if (bam_read(fp, &header->l_text, 4) != 4) goto fail; + if (bam_is_be) bam_swap_endian_4p(&header->l_text); + header->text = (char*)calloc(header->l_text + 1, 1); + if (bam_read(fp, header->text, header->l_text) != header->l_text) goto fail; + if (bam_read(fp, &header->n_targets, 4) != 4) goto fail; + if (bam_is_be) bam_swap_endian_4p(&header->n_targets); + // read reference sequence names and lengths + header->target_name = (char**)calloc(header->n_targets, sizeof(char*)); + header->target_len = (uint32_t*)calloc(header->n_targets, 4); + for (i = 0; i != header->n_targets; ++i) { + if (bam_read(fp, &name_len, 4) != 4) goto fail; + if (bam_is_be) bam_swap_endian_4p(&name_len); + header->target_name[i] = (char*)calloc(name_len, 1); + if (bam_read(fp, header->target_name[i], name_len) != name_len) { + goto fail; + } + if (bam_read(fp, &header->target_len[i], 4) != 4) goto fail; + if (bam_is_be) bam_swap_endian_4p(&header->target_len[i]); + } + return header; + fail: + bam_header_destroy(header); + return NULL; +} + +static void swap_endian_data(const bam1_core_t *c, int data_len, uint8_t *data) +{ + uint8_t *s; + uint32_t i, *cigar = (uint32_t*)(data + c->l_qname); + s = data + c->n_cigar*4 + c->l_qname + c->l_qseq + (c->l_qseq + 1)/2; + for (i = 0; i < c->n_cigar; ++i) bam_swap_endian_4p(&cigar[i]); + while (s < data + data_len) { + uint8_t type; + s += 2; // skip key + type = toupper(*s); ++s; // skip type + if (type == 'C' || type == 'A') ++s; + else if (type == 'S') { bam_swap_endian_2p(s); s += 2; } + else if (type == 'I' || type == 'F') { bam_swap_endian_4p(s); s += 4; } + else if (type == 'D') { bam_swap_endian_8p(s); s += 8; } + else if (type == 'Z' || type == 'H') { while (*s) ++s; ++s; } + } +} + +int bam_read1(bamFile fp, bam1_t *b) +{ + bam1_core_t *c = &b->core; + int32_t block_len, ret, i; + uint32_t x[8]; + + if ((ret = bam_read(fp, &block_len, 4)) != 4) { + if (ret == 0) return -1; // normal end-of-file + else return -2; // truncated + } + if (bam_read(fp, x, sizeof(bam1_core_t)) != sizeof(bam1_core_t)) return -3; + if (bam_is_be) { + bam_swap_endian_4p(&block_len); + for (i = 0; i < 8; ++i) bam_swap_endian_4p(x + i); + } + c->tid = x[0]; c->pos = x[1]; + c->bin = x[2]>>16; c->qual = x[2]>>8&0xff; c->l_qname = x[2]&0xff; + c->flag = x[3]>>16; c->n_cigar = x[3]&0xffff; + c->l_qseq = x[4]; + c->mtid = x[5]; c->mpos = x[6]; c->isize = x[7]; + b->data_len = block_len - sizeof(bam1_core_t); + if (b->m_data < b->data_len) { + b->m_data = b->data_len; + kroundup32(b->m_data); + b->data = (uint8_t*)realloc(b->data, b->m_data); + } + if (bam_read(fp, b->data, b->data_len) != b->data_len) return -4; + b->l_aux = b->data_len - c->n_cigar * 4 - c->l_qname - c->l_qseq - (c->l_qseq+1)/2; + if (bam_is_be) swap_endian_data(c, b->data_len, b->data); + return 4 + block_len; +} + + +#ifdef USE_VERBOSE_ZLIB_WRAPPERS +// Versions of gzopen, gzread and gzclose that print up error messages + +gzFile bamlite_gzopen(const char *fn, const char *mode) { + gzFile fp; + if (strcmp(fn, "-") == 0) { + fp = gzdopen(fileno((strstr(mode, "r"))? stdin : stdout), mode); + if (!fp) { + fprintf(stderr, "Couldn't open %s : %s", + (strstr(mode, "r"))? "stdin" : "stdout", + strerror(errno)); + } + return fp; + } + if ((fp = gzopen(fn, mode)) == 0) { + fprintf(stderr, "Couldn't open %s : %s\n", fn, + errno ? strerror(errno) : "Out of memory"); + } + return fp; +} + +int bamlite_gzread(gzFile file, void *ptr, unsigned int len) { + int ret = gzread(file, ptr, len); + + if (ret < 0) { + int errnum = 0; + const char *msg = gzerror(file, &errnum); + fprintf(stderr, "gzread error: %s\n", + Z_ERRNO == errnum ? strerror(errno) : msg); + } + return ret; +} + +int bamlite_gzclose(gzFile file) { + int ret = gzclose(file); + if (Z_OK != ret) { + fprintf(stderr, "gzclose error: %s\n", + Z_ERRNO == ret ? strerror(errno) : zError(ret)); + } + + return ret; +} +#endif /* USE_VERBOSE_ZLIB_WRAPPERS */ diff --git a/bamlite.h b/bamlite.h new file mode 100644 index 0000000..efab7ac --- /dev/null +++ b/bamlite.h @@ -0,0 +1,114 @@ +#ifndef BAMLITE_H_ +#define BAMLITE_H_ + +#include +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#define USE_VERBOSE_ZLIB_WRAPPERS + +typedef gzFile bamFile; +#ifdef USE_VERBOSE_ZLIB_WRAPPERS +/* These print error messages on failure */ +# define bam_open(fn, mode) bamlite_gzopen(fn, mode) +# define bam_dopen(fd, mode) gzdopen(fd, mode) +# define bam_close(fp) bamlite_gzclose(fp) +# define bam_read(fp, buf, size) bamlite_gzread(fp, buf, size) +#else +# define bam_open(fn, mode) gzopen(fn, mode) +# define bam_dopen(fd, mode) gzdopen(fd, mode) +# define bam_close(fp) gzclose(fp) +# define bam_read(fp, buf, size) gzread(fp, buf, size) +#endif /* USE_VERBOSE_ZLIB_WRAPPERS */ + +typedef struct { + int32_t n_targets; + char **target_name; + uint32_t *target_len; + size_t l_text, n_text; + char *text; +} bam_header_t; + +#define BAM_FPAIRED 1 +#define BAM_FPROPER_PAIR 2 +#define BAM_FUNMAP 4 +#define BAM_FMUNMAP 8 +#define BAM_FREVERSE 16 +#define BAM_FMREVERSE 32 +#define BAM_FREAD1 64 +#define BAM_FREAD2 128 +#define BAM_FSECONDARY 256 +#define BAM_FQCFAIL 512 +#define BAM_FDUP 1024 + +#define BAM_CIGAR_SHIFT 4 +#define BAM_CIGAR_MASK ((1 << BAM_CIGAR_SHIFT) - 1) + +#define BAM_CMATCH 0 +#define BAM_CINS 1 +#define BAM_CDEL 2 +#define BAM_CREF_SKIP 3 +#define BAM_CSOFT_CLIP 4 +#define BAM_CHARD_CLIP 5 +#define BAM_CPAD 6 + +typedef struct { + int32_t tid; + int32_t pos; + uint32_t bin:16, qual:8, l_qname:8; + uint32_t flag:16, n_cigar:16; + int32_t l_qseq; + int32_t mtid; + int32_t mpos; + int32_t isize; +} bam1_core_t; + +typedef struct { + bam1_core_t core; + int l_aux, data_len, m_data; + uint8_t *data; +} bam1_t; + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +#define bam1_strand(b) (((b)->core.flag&BAM_FREVERSE) != 0) +#define bam1_mstrand(b) (((b)->core.flag&BAM_FMREVERSE) != 0) +#define bam1_cigar(b) ((uint32_t*)((b)->data + (b)->core.l_qname)) +#define bam1_qname(b) ((char*)((b)->data)) +#define bam1_seq(b) ((b)->data + (b)->core.n_cigar*4 + (b)->core.l_qname) +#define bam1_qual(b) ((b)->data + (b)->core.n_cigar*4 + (b)->core.l_qname + (((b)->core.l_qseq + 1)>>1)) +#define bam1_seqi(s, i) ((s)[(i)/2] >> 4*(1-(i)%2) & 0xf) +#define bam1_aux(b) ((b)->data + (b)->core.n_cigar*4 + (b)->core.l_qname + (b)->core.l_qseq + ((b)->core.l_qseq + 1)/2) + +#define bam_init1() ((bam1_t*)calloc(1, sizeof(bam1_t))) +#define bam_destroy1(b) do { \ + if (b) { free((b)->data); free(b); } \ + } while (0) + +extern int bam_is_be; + +#ifdef __cplusplus +extern "C" { +#endif + + bam_header_t *bam_header_init(void); + void bam_header_destroy(bam_header_t *header); + bam_header_t *bam_header_read(bamFile fp); + int bam_read1(bamFile fp, bam1_t *b); + +#ifdef USE_VERBOSE_ZLIB_WRAPPERS + gzFile bamlite_gzopen(const char *fn, const char *mode); + int bamlite_gzread(gzFile file, void *ptr, unsigned int len); + int bamlite_gzclose(gzFile file); +#endif /* USE_VERBOSE_ZLIB_WRAPPERS */ + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bntseq.c b/bntseq.c new file mode 100644 index 0000000..b2163e9 --- /dev/null +++ b/bntseq.c @@ -0,0 +1,500 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include +#include +#include +#include +#include "bntseq.h" +#include "utils.h" + +#include "kseq.h" +KSEQ_DECLARE(gzFile) + +#include "khash.h" +KHASH_MAP_INIT_STR(str, int) + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +unsigned char nst_nt4_table[256] = { + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 5 /*'-'*/, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4 +}; + +void bns_dump(const bntseq_t *bns, const char *prefix) +{ + char str[1024]; + FILE *fp; + int i; + { // dump .ann + strcpy(str, prefix); strcat(str, ".ann"); + fp = xopen(str, "w"); + err_fprintf(fp, "%lld %d %u\n", (long long)bns->l_pac, bns->n_seqs, bns->seed); + for (i = 0; i != bns->n_seqs; ++i) { + bntann1_t *p = bns->anns + i; + err_fprintf(fp, "%d %s", p->gi, p->name); + if (p->anno[0]) err_fprintf(fp, " %s\n", p->anno); + else err_fprintf(fp, "\n"); + err_fprintf(fp, "%lld %d %d\n", (long long)p->offset, p->len, p->n_ambs); + } + err_fflush(fp); + err_fclose(fp); + } + { // dump .amb + strcpy(str, prefix); strcat(str, ".amb"); + fp = xopen(str, "w"); + err_fprintf(fp, "%lld %d %u\n", (long long)bns->l_pac, bns->n_seqs, bns->n_holes); + for (i = 0; i != bns->n_holes; ++i) { + bntamb1_t *p = bns->ambs + i; + err_fprintf(fp, "%lld %d %c\n", (long long)p->offset, p->len, p->amb); + } + err_fflush(fp); + err_fclose(fp); + } +} + +bntseq_t *bns_restore_core(const char *ann_filename, const char* amb_filename, const char* pac_filename) +{ + char str[8192]; + FILE *fp; + const char *fname; + bntseq_t *bns; + long long xx; + int i; + int scanres; + bns = (bntseq_t*)calloc(1, sizeof(bntseq_t)); + { // read .ann + fp = xopen(fname = ann_filename, "r"); + scanres = fscanf(fp, "%lld%d%u", &xx, &bns->n_seqs, &bns->seed); + if (scanres != 3) goto badread; + bns->l_pac = xx; + bns->anns = (bntann1_t*)calloc(bns->n_seqs, sizeof(bntann1_t)); + for (i = 0; i < bns->n_seqs; ++i) { + bntann1_t *p = bns->anns + i; + char *q = str; + int c; + // read gi and sequence name + scanres = fscanf(fp, "%u%s", &p->gi, str); + if (scanres != 2) goto badread; + p->name = strdup(str); + // read fasta comments + while (q - str < sizeof(str) - 1 && (c = fgetc(fp)) != '\n' && c != EOF) *q++ = c; + while (c != '\n' && c != EOF) c = fgetc(fp); + if (c == EOF) { + scanres = EOF; + goto badread; + } + *q = 0; + if (q - str > 1 && strcmp(str, " (null)") != 0) p->anno = strdup(str + 1); // skip leading space + else p->anno = strdup(""); + // read the rest + scanres = fscanf(fp, "%lld%d%d", &xx, &p->len, &p->n_ambs); + if (scanres != 3) goto badread; + p->offset = xx; + } + err_fclose(fp); + } + { // read .amb + int64_t l_pac; + int32_t n_seqs; + fp = xopen(fname = amb_filename, "r"); + scanres = fscanf(fp, "%lld%d%d", &xx, &n_seqs, &bns->n_holes); + if (scanres != 3) goto badread; + l_pac = xx; + xassert(l_pac == bns->l_pac && n_seqs == bns->n_seqs, "inconsistent .ann and .amb files."); + bns->ambs = bns->n_holes? (bntamb1_t*)calloc(bns->n_holes, sizeof(bntamb1_t)) : 0; + for (i = 0; i < bns->n_holes; ++i) { + bntamb1_t *p = bns->ambs + i; + scanres = fscanf(fp, "%lld%d%s", &xx, &p->len, str); + if (scanres != 3) goto badread; + p->offset = xx; + p->amb = str[0]; + } + err_fclose(fp); + } + { // open .pac + bns->fp_pac = xopen(pac_filename, "rb"); + } + return bns; + + badread: + if (EOF == scanres) { + err_fatal(__func__, "Error reading %s : %s\n", fname, ferror(fp) ? strerror(errno) : "Unexpected end of file"); + } + err_fatal(__func__, "Parse error reading %s\n", fname); +} + +bntseq_t *bns_restore(const char *prefix) +{ + char ann_filename[1024], amb_filename[1024], pac_filename[1024], alt_filename[1024]; + FILE *fp; + bntseq_t *bns; + strcat(strcpy(ann_filename, prefix), ".ann"); + strcat(strcpy(amb_filename, prefix), ".amb"); + strcat(strcpy(pac_filename, prefix), ".pac"); + bns = bns_restore_core(ann_filename, amb_filename, pac_filename); + if (bns == 0) return 0; + if ((fp = fopen(strcat(strcpy(alt_filename, prefix), ".alt"), "r")) != 0) { // read .alt file if present + char str[1024]; + khash_t(str) *h; + int c, i, absent; + khint_t k; + h = kh_init(str); + for (i = 0; i < bns->n_seqs; ++i) { + k = kh_put(str, h, bns->anns[i].name, &absent); + kh_val(h, k) = i; + } + i = 0; + while ((c = fgetc(fp)) != EOF) { + if (c == '\t' || c == '\n' || c == '\r') { + str[i] = 0; + if (str[0] != '@') { + k = kh_get(str, h, str); + if (k != kh_end(h)) + bns->anns[kh_val(h, k)].is_alt = 1; + } + while (c != '\n' && c != EOF) c = fgetc(fp); + i = 0; + } else { + if (i >= 1022) { + fprintf(stderr, "[E::%s] sequence name longer than 1023 characters. Abort!\n", __func__); + exit(1); + } + str[i++] = c; + } + } + kh_destroy(str, h); + fclose(fp); + } + return bns; +} + +void bns_destroy(bntseq_t *bns) +{ + if (bns == 0) return; + else { + int i; + if (bns->fp_pac) err_fclose(bns->fp_pac); + free(bns->ambs); + for (i = 0; i < bns->n_seqs; ++i) { + free(bns->anns[i].name); + free(bns->anns[i].anno); + } + free(bns->anns); + free(bns); + } +} + +#define _set_pac(pac, l, c) ((pac)[(l)>>2] |= (c)<<((~(l)&3)<<1)) +#define _get_pac(pac, l) ((pac)[(l)>>2]>>((~(l)&3)<<1)&3) + +static uint8_t *add1(const kseq_t *seq, bntseq_t *bns, uint8_t *pac, int64_t *m_pac, int *m_seqs, int *m_holes, bntamb1_t **q) +{ + bntann1_t *p; // ,contig + int i, lasts; + if (bns->n_seqs == *m_seqs) { // ,,n_seqscontig() + *m_seqs <<= 1; + bns->anns = (bntann1_t*)realloc(bns->anns, *m_seqs * sizeof(bntann1_t)); + } + p = bns->anns + bns->n_seqs; // pcontig + p->name = strdup((char*)seq->name.s); // contig,1,2,3... X,Y + p->anno = seq->comment.l > 0? strdup((char*)seq->comment.s) : strdup("(null)"); // , + p->gi = 0; p->len = seq->seq.l; // contig + p->offset = (bns->n_seqs == 0)? 0 : (p-1)->offset + (p-1)->len; // offsetcontig + p->n_ambs = 0; // + for (i = lasts = 0; i < seq->seq.l; ++i) { // contig + int c = nst_nt4_table[(int)seq->seq.s[i]]; // + if (c >= 4) { // N + if (lasts == seq->seq.s[i]) { // contiguous N + ++(*q)->len; // +1 + } else { // + if (bns->n_holes == *m_holes) { // , + (*m_holes) <<= 1; + bns->ambs = (bntamb1_t*)realloc(bns->ambs, (*m_holes) * sizeof(bntamb1_t)); + } + *q = bns->ambs + bns->n_holes; + (*q)->len = 1; + (*q)->offset = p->offset + i; // + (*q)->amb = seq->seq.s[i]; + ++p->n_ambs; // contig + ++bns->n_holes; // + } + } + lasts = seq->seq.s[i]; // , + { // fill buffer + if (c >= 4) c = lrand48()&3; // ,ATGC + if (bns->l_pac == *m_pac) { // double the pac size + *m_pac <<= 1; + pac = realloc(pac, *m_pac/4); + memset(pac + bns->l_pac/4, 0, (*m_pac - bns->l_pac)/4); + } + _set_pac(pac, bns->l_pac, c); + ++bns->l_pac; + } + } + ++bns->n_seqs; + return pac; +} + +int64_t bns_fasta2bntseq(gzFile fp_fa, const char *prefix, int for_only) +{ + extern void seq_reverse(int len, ubyte_t *seq, int is_comp); // in bwaseqio.c + kseq_t *seq; + char name[1024]; + bntseq_t *bns; + uint8_t *pac = 0; + int32_t m_seqs, m_holes; + int64_t ret = -1, m_pac, l; + bntamb1_t *q; + FILE *fp; + + // initialization + seq = kseq_init(fp_fa); + bns = (bntseq_t*)calloc(1, sizeof(bntseq_t)); + bns->seed = 11; // fixed seed for random generator + srand48(bns->seed); + m_seqs = m_holes = 8; m_pac = 0x10000; + bns->anns = (bntann1_t*)calloc(m_seqs, sizeof(bntann1_t)); + bns->ambs = (bntamb1_t*)calloc(m_holes, sizeof(bntamb1_t)); + pac = calloc(m_pac/4, 1); + q = bns->ambs; + strcpy(name, prefix); strcat(name, ".pac"); + fp = xopen(name, "wb"); + // read sequences + while (kseq_read(seq) >= 0) pac = add1(seq, bns, pac, &m_pac, &m_seqs, &m_holes, &q); + if (!for_only) { // add the reverse complemented sequence + int64_t ll_pac = (bns->l_pac * 2 + 3) / 4 * 4; + if (ll_pac > m_pac) pac = realloc(pac, ll_pac/4); + memset(pac + (bns->l_pac+3)/4, 0, (ll_pac - (bns->l_pac+3)/4*4) / 4); + for (l = bns->l_pac - 1; l >= 0; --l, ++bns->l_pac) + _set_pac(pac, bns->l_pac, 3-_get_pac(pac, l)); + } + ret = bns->l_pac; + { // finalize .pac file + ubyte_t ct; + err_fwrite(pac, 1, (bns->l_pac>>2) + ((bns->l_pac&3) == 0? 0 : 1), fp); + // the following codes make the pac file size always (l_pac/4+1+1) + if (bns->l_pac % 4 == 0) { + ct = 0; + err_fwrite(&ct, 1, 1, fp); + } + ct = bns->l_pac % 4; + err_fwrite(&ct, 1, 1, fp); + // close .pac file + err_fflush(fp); + err_fclose(fp); + } + bns_dump(bns, prefix); + bns_destroy(bns); + kseq_destroy(seq); + free(pac); + return ret; +} + +int bwa_fa2pac(int argc, char *argv[]) +{ + int c, for_only = 0; + gzFile fp; + while ((c = getopt(argc, argv, "f")) >= 0) { + switch (c) { + case 'f': for_only = 1; break; + } + } + if (argc == optind) { + fprintf(stderr, "Usage: fastbwa fa2pac [-f] []\n"); + return 1; + } + fp = xzopen(argv[optind], "r"); + bns_fasta2bntseq(fp, (optind+1 < argc)? argv[optind+1] : argv[optind], for_only); + err_gzclose(fp); + return 0; +} + +int bns_pos2rid(const bntseq_t *bns, int64_t pos_f) +{ + int left, mid, right; + if (pos_f >= bns->l_pac) return -1; + left = 0; mid = 0; right = bns->n_seqs; + while (left < right) { // binary search + mid = (left + right) >> 1; + if (pos_f >= bns->anns[mid].offset) { + if (mid == bns->n_seqs - 1) break; + if (pos_f < bns->anns[mid+1].offset) break; // bracketed + left = mid + 1; + } else right = mid; + } + return mid; +} + +int bns_intv2rid(const bntseq_t *bns, int64_t rb, int64_t re) +{ + int is_rev, rid_b, rid_e; + if (rb < bns->l_pac && re > bns->l_pac) return -2; + assert(rb <= re); + rid_b = bns_pos2rid(bns, bns_depos(bns, rb, &is_rev)); + rid_e = rb < re? bns_pos2rid(bns, bns_depos(bns, re - 1, &is_rev)) : rid_b; + return rid_b == rid_e? rid_b : -1; +} + +int bns_cnt_ambi(const bntseq_t *bns, int64_t pos_f, int len, int *ref_id) +{ + int left, mid, right, nn; + if (ref_id) *ref_id = bns_pos2rid(bns, pos_f); + left = 0; right = bns->n_holes; nn = 0; + while (left < right) { + mid = (left + right) >> 1; + if (pos_f >= bns->ambs[mid].offset + bns->ambs[mid].len) left = mid + 1; + else if (pos_f + len <= bns->ambs[mid].offset) right = mid; + else { // overlap + if (pos_f >= bns->ambs[mid].offset) { + nn += bns->ambs[mid].offset + bns->ambs[mid].len < pos_f + len? + bns->ambs[mid].offset + bns->ambs[mid].len - pos_f : len; + } else { + nn += bns->ambs[mid].offset + bns->ambs[mid].len < pos_f + len? + bns->ambs[mid].len : len - (bns->ambs[mid].offset - pos_f); + } + break; + } + } + return nn; +} + +uint8_t *bns_get_seq(int64_t l_pac, const uint8_t *pac, int64_t beg, int64_t end, int64_t *len) +{ + uint8_t *seq = 0; + if (end < beg) end ^= beg, beg ^= end, end ^= beg; // if end is smaller, swap + if (end > l_pac<<1) end = l_pac<<1; + if (beg < 0) beg = 0; + if (beg >= l_pac || end <= l_pac) { + int64_t k, l = 0; + *len = end - beg; + seq = malloc(end - beg); + if (beg >= l_pac) { // reverse strand + int64_t beg_f = (l_pac<<1) - 1 - end; + int64_t end_f = (l_pac<<1) - 1 - beg; + for (k = end_f; k > beg_f; --k) + seq[l++] = 3 - _get_pac(pac, k); + } else { // forward strand + for (k = beg; k < end; ++k) + seq[l++] = _get_pac(pac, k); + } + } else *len = 0; // if bridging the forward-reverse boundary, return nothing + return seq; +} + +void bns_get_seq_no_alloc(int64_t l_pac, const uint8_t *pac, int64_t beg, int64_t end, int64_t *len, size_t *m_seq, uint8_t **seqp) +{ + if (end < beg) end ^= beg, beg ^= end, end ^= beg; // if end is smaller, swap + if (end > l_pac<<1) end = l_pac<<1; + if (beg < 0) beg = 0; + if (beg >= l_pac || end <= l_pac) { + int64_t k, l = 0; + *len = end - beg; + if (*len > *m_seq) { + *m_seq = *len; + *seqp = realloc(*seqp, end - beg); + } + if (beg >= l_pac) { // reverse strand + int64_t beg_f = (l_pac<<1) - 1 - end; + int64_t end_f = (l_pac<<1) - 1 - beg; + for (k = end_f; k > beg_f; --k) + (*seqp)[l++] = 3 - _get_pac(pac, k); + } else { // forward strand + for (k = beg; k < end; ++k) + (*seqp)[l++] = _get_pac(pac, k); + } + } else *len = 0; // if bridging the forward-reverse boundary, return nothing +} + +uint8_t *bns_fetch_seq(const bntseq_t *bns, const uint8_t *pac, int64_t *beg, int64_t mid, int64_t *end, int *rid) +{ + int64_t far_beg, far_end, len; + int is_rev; + uint8_t *seq; + + if (*end < *beg) *end ^= *beg, *beg ^= *end, *end ^= *beg; // if end is smaller, swap + assert(*beg <= mid && mid < *end); + *rid = bns_pos2rid(bns, bns_depos(bns, mid, &is_rev)); + far_beg = bns->anns[*rid].offset; + far_end = far_beg + bns->anns[*rid].len; + if (is_rev) { // flip to the reverse strand + int64_t tmp = far_beg; + far_beg = (bns->l_pac<<1) - far_end; + far_end = (bns->l_pac<<1) - tmp; + } + *beg = *beg > far_beg? *beg : far_beg; + *end = *end < far_end? *end : far_end; + seq = bns_get_seq(bns->l_pac, pac, *beg, *end, &len); + if (seq == 0 || *end - *beg != len) { + fprintf(stderr, "[E::%s] begin=%ld, mid=%ld, end=%ld, len=%ld, seq=%p, rid=%d, far_beg=%ld, far_end=%ld\n", + __func__, (long)*beg, (long)mid, (long)*end, (long)len, seq, *rid, (long)far_beg, (long)far_end); + } + assert(seq && *end - *beg == len); // assertion failure should never happen + return seq; +} + +void bns_fetch_seq_no_alloc(const bntseq_t *bns, const uint8_t *pac, int64_t *beg, int64_t mid, int64_t *end, int *rid, size_t *m_seq, uint8_t **seqp) +{ + int64_t far_beg, far_end, len; + int is_rev; + + if (*end < *beg) *end ^= *beg, *beg ^= *end, *end ^= *beg; // if end is smaller, swap + assert(*beg <= mid && mid < *end); + *rid = bns_pos2rid(bns, bns_depos(bns, mid, &is_rev)); + far_beg = bns->anns[*rid].offset; + far_end = far_beg + bns->anns[*rid].len; + if (is_rev) { // flip to the reverse strand + int64_t tmp = far_beg; + far_beg = (bns->l_pac<<1) - far_end; + far_end = (bns->l_pac<<1) - tmp; + } + *beg = *beg > far_beg? *beg : far_beg; + *end = *end < far_end? *end : far_end; + bns_get_seq_no_alloc(bns->l_pac, pac, *beg, *end, &len, m_seq, seqp); + if (*seqp == 0 || *end - *beg != len) { + fprintf(stderr, "[E::%s] begin=%ld, mid=%ld, end=%ld, len=%ld, seq=%p, rid=%d, far_beg=%ld, far_end=%ld\n", + __func__, (long)*beg, (long)mid, (long)*end, (long)len, *seqp, *rid, (long)far_beg, (long)far_end); + } + assert(*seqp && *end - *beg == len); // assertion failure should never happen +} diff --git a/bntseq.h b/bntseq.h new file mode 100644 index 0000000..7ea0286 --- /dev/null +++ b/bntseq.h @@ -0,0 +1,92 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +#ifndef BWT_BNTSEQ_H +#define BWT_BNTSEQ_H + +#include +#include +#include +#include + +#ifndef BWA_UBYTE +#define BWA_UBYTE +typedef uint8_t ubyte_t; +#endif + +typedef struct { + int64_t offset; + int32_t len; + int32_t n_ambs; + uint32_t gi; + int32_t is_alt; + char *name, *anno; +} bntann1_t; + +typedef struct { + int64_t offset; + int32_t len; + char amb; +} bntamb1_t; + +typedef struct { + int64_t l_pac; + int32_t n_seqs; + uint32_t seed; + bntann1_t *anns; // n_seqs elements + int32_t n_holes; + bntamb1_t *ambs; // n_holes elements AGCT + FILE *fp_pac; +} bntseq_t; + +extern unsigned char nst_nt4_table[256]; + +#ifdef __cplusplus +extern "C" { +#endif + + void bns_dump(const bntseq_t *bns, const char *prefix); + bntseq_t *bns_restore(const char *prefix); + bntseq_t *bns_restore_core(const char *ann_filename, const char* amb_filename, const char* pac_filename); + void bns_destroy(bntseq_t *bns); + int64_t bns_fasta2bntseq(gzFile fp_fa, const char *prefix, int for_only); + int bns_pos2rid(const bntseq_t *bns, int64_t pos_f); + int bns_cnt_ambi(const bntseq_t *bns, int64_t pos_f, int len, int *ref_id); + uint8_t *bns_get_seq(int64_t l_pac, const uint8_t *pac, int64_t beg, int64_t end, int64_t *len); + uint8_t *bns_fetch_seq(const bntseq_t *bns, const uint8_t *pac, int64_t *beg, int64_t mid, int64_t *end, int *rid); + int bns_intv2rid(const bntseq_t *bns, int64_t rb, int64_t re); + void bns_fetch_seq_no_alloc(const bntseq_t *bns, const uint8_t *pac, int64_t *beg, int64_t mid, int64_t *end, int *rid, size_t *m_seq, uint8_t **seqp); +#ifdef __cplusplus +} +#endif + +static inline int64_t bns_depos(const bntseq_t *bns, int64_t pos, int *is_rev) +{ + return (*is_rev = (pos >= bns->l_pac))? (bns->l_pac<<1) - 1 - pos : pos; +} + +#endif diff --git a/bwa.1 b/bwa.1 new file mode 100644 index 0000000..eefb235 --- /dev/null +++ b/bwa.1 @@ -0,0 +1,871 @@ +.TH bwa 1 "23 October 2017" "bwa-0.7.17-r1188" "Bioinformatics tools" +.SH NAME +.PP +bwa - Burrows-Wheeler Alignment Tool +.SH SYNOPSIS +.PP +bwa index ref.fa +.PP +bwa mem ref.fa reads.fq > aln-se.sam +.PP +bwa mem ref.fa read1.fq read2.fq > aln-pe.sam +.PP +bwa aln ref.fa short_read.fq > aln_sa.sai +.PP +bwa samse ref.fa aln_sa.sai short_read.fq > aln-se.sam +.PP +bwa sampe ref.fa aln_sa1.sai aln_sa2.sai read1.fq read2.fq > aln-pe.sam +.PP +bwa bwasw ref.fa long_read.fq > aln.sam + +.SH DESCRIPTION +.PP +BWA is a software package for mapping low-divergent sequences against a large +reference genome, such as the human genome. It consists of three algorithms: +BWA-backtrack, BWA-SW and BWA-MEM. The first algorithm is designed for Illumina +sequence reads up to 100bp, while the rest two for longer sequences ranged from +70bp to 1Mbp. BWA-MEM and BWA-SW share similar features such as long-read +support and split alignment, but BWA-MEM, which is the latest, is generally +recommended for high-quality queries as it is faster and more accurate. +BWA-MEM also has better performance than BWA-backtrack for 70-100bp Illumina +reads. + +For all the algorithms, BWA first needs to construct the FM-index for +the reference genome (the +.B index +command). Alignment algorithms are invoked with different sub-commands: +.BR aln / samse / sampe +for BWA-backtrack, +.B bwasw +for BWA-SW and +.B mem +for the BWA-MEM algorithm. + +.SH COMMANDS AND OPTIONS +.TP +.B index +.B bwa index +.RB [ -p +.IR prefix ] +.RB [ -a +.IR algoType ] +.I db.fa + +Index database sequences in the FASTA format. + +.B OPTIONS: +.RS +.TP 10 +.BI -p \ STR +Prefix of the output database [same as db filename] +.TP +.BI -a \ STR +Algorithm for constructing BWT index. BWA implements three algorithms for BWT +construction: +.BR is , +.B bwtsw +and +.BR rb2 . +The first algorithm is a little faster for small database but requires large +RAM and does not work for databases with total length longer than 2GB. The +second algorithm is adapted from the BWT-SW source code. It in theory works +with database with trillions of bases. When this option is not specified, the +appropriate algorithm will be chosen automatically. +.RE + +.TP +.B mem +.B bwa mem +.RB [ -aCHjMpP ] +.RB [ -t +.IR nThreads ] +.RB [ -k +.IR minSeedLen ] +.RB [ -w +.IR bandWidth ] +.RB [ -d +.IR zDropoff ] +.RB [ -r +.IR seedSplitRatio ] +.RB [ -c +.IR maxOcc ] +.RB [ -D +.IR chainShadow ] +.RB [ -m +.IR maxMateSW ] +.RB [ -W +.IR minSeedMatch ] +.RB [ -A +.IR matchScore ] +.RB [ -B +.IR mmPenalty ] +.RB [ -O +.IR gapOpenPen ] +.RB [ -E +.IR gapExtPen ] +.RB [ -L +.IR clipPen ] +.RB [ -U +.IR unpairPen ] +.RB [ -x +.IR readType ] +.RB [ -R +.IR RGline ] +.RB [ -H +.IR HDlines ] +.RB [ -v +.IR verboseLevel ] +.I db.prefix +.I reads.fq +.RI [ mates.fq ] + +Align 70bp-1Mbp query sequences with the BWA-MEM algorithm. Briefly, the +algorithm works by seeding alignments with maximal exact matches (MEMs) and +then extending seeds with the affine-gap Smith-Waterman algorithm (SW). + +If +.I mates.fq +file is absent and option +.B -p +is not set, this command regards input reads are single-end. If +.I mates.fq +is present, this command assumes the +.IR i -th +read in +.I reads.fq +and the +.IR i -th +read in +.I mates.fq +constitute a read pair. If +.B -p +is used, the command assumes the +.RI 2 i -th +and the +.RI (2 i +1)-th +read in +.I reads.fq +constitute a read pair (such input file is said to be interleaved). In this case, +.I mates.fq +is ignored. In the paired-end mode, the +.B mem +command will infer the read orientation and the insert size distribution from a +batch of reads. + +The BWA-MEM algorithm performs local alignment. It may produce multiple primary +alignments for different part of a query sequence. This is a crucial feature +for long sequences. However, some tools may not work with split alignments. +One may consider to use option +.B -M +to flag shorter split hits as secondary. + +.RS +.TP 10 +.B ALGORITHM OPTIONS: +.TP +.BI -t \ INT +Number of threads [1] +.TP +.BI -k \ INT +Minimum seed length. Matches shorter than +.I INT +will be missed. The alignment speed is usually insensitive to this value unless +it significantly deviates from 20. [19] +.TP +.BI -w \ INT +Band width. Essentially, gaps longer than +.I INT +will not be found. Note that the maximum gap length is also affected by the +scoring matrix and the hit length, not solely determined by this option. [100] +.TP +.BI -d \ INT +Off-diagonal X-dropoff (Z-dropoff). Stop extension when the difference between +the best and the current extension score is above +.RI | i - j |* A + INT , +where +.I i +and +.I j +are the current positions of the query and reference, respectively, and +.I A +is the matching score. Z-dropoff is similar to BLAST's X-dropoff except that it +doesn't penalize gaps in one of the sequences in the alignment. Z-dropoff not +only avoids unnecessary extension, but also reduces poor alignments inside a +long good alignment. [100] +.TP +.BI -r \ FLOAT +Trigger re-seeding for a MEM longer than +.IR minSeedLen * FLOAT . +This is a key heuristic parameter for tuning the performance. Larger value +yields fewer seeds, which leads to faster alignment speed but lower accuracy. [1.5] +.TP +.BI -c \ INT +Discard a MEM if it has more than +.I INT +occurence in the genome. This is an insensitive parameter. [500] +.TP +.BI -D \ FLOAT +Drop chains shorter than +.I FLOAT +fraction of the longest overlapping chain [0.5] +.TP +.BI -m \ INT +Perform at most +.I INT +rounds of mate-SW [50] +.TP +.BI -W \ INT +Drop a chain if the number of bases in seeds is smaller than +.IR INT . +This option is primarily used for longer contigs/reads. When positive, it also +affects seed filtering. [0] +.TP +.B -P +In the paired-end mode, perform SW to rescue missing hits only but do not try to find +hits that fit a proper pair. + +.TP +.B SCORING OPTIONS: +.TP +.BI -A \ INT +Matching score. [1] +.TP +.BI -B \ INT +Mismatch penalty. The sequence error rate is approximately: {.75 * exp[-log(4) * B/A]}. [4] +.TP +.BI -O \ INT[,INT] +Gap open penalty. If two numbers are specified, the first is the penalty of +openning a deletion and the second for openning an insertion. [6] +.TP +.BI -E \ INT[,INT] +Gap extension penalty. If two numbers are specified, the first is the penalty +of extending a deletion and second for extending an insertion. A gap of length +k costs O + k*E (i.e. +.B -O +is for opening a zero-length gap). [1] +.TP +.BI -L \ INT[,INT] +Clipping penalty. When performing SW extension, BWA-MEM keeps track of the best +score reaching the end of query. If this score is larger than the best SW score +minus the clipping penalty, clipping will not be applied. Note that in this +case, the SAM AS tag reports the best SW score; clipping penalty is not +deduced. If two numbers are provided, the first is for 5'-end clipping and +second for 3'-end clipping. [5] +.TP +.BI -U \ INT +Penalty for an unpaired read pair. BWA-MEM scores an unpaired read pair as +.RI scoreRead1+scoreRead2- INT +and scores a paired as scoreRead1+scoreRead2-insertPenalty. It compares these +two scores to determine whether we should force pairing. A larger value leads to +more aggressive read pair. [17] +.TP +.BI -x \ STR +Read type. Changes multiple parameters unless overriden [null] +.RS +.TP 10 +.BR pacbio : +.B -k17 -W40 -r10 -A1 -B1 -O1 -E1 -L0 +(PacBio reads to ref) +.TP +.BR ont2d : +.B -k14 -W20 -r10 -A1 -B1 -O1 -E1 -L0 +(Oxford Nanopore 2D-reads to ref) +.TP +.BR intractg : +.B -B9 -O16 -L5 +(intra-species contigs to ref) +.RE +.TP +.B INPUT/OUTPUT OPTIONS: +.TP +.B -p +Smart pairing. If two adjacent reads have the same name, they are considered +to form a read pair. This way, paired-end and single-end reads can be mixed +in a single FASTA/Q stream. +.TP +.BI -R \ STR +Complete read group header line. '\\t' can be used in +.I STR +and will be converted to a TAB in the output SAM. The read group ID will be +attached to every read in the output. An example is '@RG\\tID:foo\\tSM:bar'. +[null] +.TP +.BI -H \ ARG +If ARG starts with @, it is interpreted as a string and gets inserted into the +output SAM header; otherwise, ARG is interpreted as a file with all lines +starting with @ in the file inserted into the SAM header. [null] +.TP +.BI -o \ FILE +Write the output SAM file to +.IR FILE . +For compatibility with other BWA commands, this option may also be given as +.B -f +.IR FILE . +[standard ouptut] +.TP +.B -q + Don't reduce the mapping quality of split alignment of lower alignment score. +.TP +.B -5 +For split alignment, mark the segment with the smallest coordinate as the +primary. It automatically applies option +.B -q +as well. This option may help some Hi-C pipelines. By default, BWA-MEM marks +highest scoring segment as primary. +.TP +.B -K \ INT +Process +.I INT +input bases in each batch regardless of the number of threads in use +.RI [10000000* nThreads ]. +By default, the batch size is proportional to the number of threads in use. +Because the inferred insert size distribution slightly depends on the batch +size, using different number of threads may produce different output. +Specifying this option helps reproducibility. +.TP +.BI -T \ INT +Don't output alignment with score lower than +.IR INT . +This option affects output and occasionally SAM flag 2. [30] +.TP +.BI -j +Treat ALT contigs as part of the primary assembly (i.e. ignore the +.I db.prefix.alt +file). +.TP +.BI -h \ INT[,INT2] +If a query has not more than +.I INT +hits with score higher than 80% of the best hit, output them all in the XA tag. +If +.I INT2 +is specified, BWA-MEM outputs up to +.I INT2 +hits if the list contains a hit to an ALT contig. [5,200] +.TP +.B -a +Output all found alignments for single-end or unpaired paired-end reads. These +alignments will be flagged as secondary alignments. +.TP +.B -C +Append FASTA/Q comment to SAM output. This option can be used to +transfer read meta information (e.g. barcode) to the SAM output. Note that the +FASTA/Q comment (the string after a space in the header line) must conform the SAM +spec (e.g. BC:Z:CGTAC). Malformated comments lead to incorrect SAM output. +.TP +.B -Y +Use soft clipping CIGAR operation for supplementary alignments. By default, BWA-MEM +uses soft clipping for the primary alignment and hard clipping for +supplementary alignments. +.TP +.B -M +Mark shorter split hits as secondary (for Picard compatibility). +.TP +.BI -v \ INT +Control the verbosity level of the output. This option has not been fully +supported throughout BWA. Ideally, a value 0 for disabling all the output to +stderr; 1 for outputting errors only; 2 for warnings and errors; 3 for +all normal messages; 4 or higher for debugging. When this option takes value +4, the output is not SAM. [3] +.TP +.BI -I \ FLOAT[,FLOAT[,INT[,INT]]] +Specify the mean, standard deviation (10% of the mean if absent), max (4 sigma +from the mean if absent) and min (4 sigma if absent) of the insert size +distribution. Only applicable to the FR orientation. By default, BWA-MEM infers +these numbers and the pair orientations given enough reads. [inferred] + +.RE + +.TP +.B aln +bwa aln [-n maxDiff] [-o maxGapO] [-e maxGapE] [-d nDelTail] [-i +nIndelEnd] [-k maxSeedDiff] [-l seedLen] [-t nThrds] [-cRN] [-M misMsc] +[-O gapOsc] [-E gapEsc] [-q trimQual] > + + +Find the SA coordinates of the input reads. Maximum +.I maxSeedDiff +differences are allowed in the first +.I seedLen +subsequence and maximum +.I maxDiff +differences are allowed in the whole sequence. + +.B OPTIONS: +.RS +.TP 10 +.BI -n \ NUM +Maximum edit distance if the value is INT, or the fraction of missing +alignments given 2% uniform base error rate if FLOAT. In the latter +case, the maximum edit distance is automatically chosen for different +read lengths. [0.04] +.TP +.BI -o \ INT +Maximum number of gap opens [1] +.TP +.BI -e \ INT +Maximum number of gap extensions, -1 for k-difference mode (disallowing +long gaps) [-1] +.TP +.BI -d \ INT +Disallow a long deletion within INT bp towards the 3'-end [16] +.TP +.BI -i \ INT +Disallow an indel within INT bp towards the ends [5] +.TP +.BI -l \ INT +Take the first INT subsequence as seed. If INT is larger than the query +sequence, seeding will be disabled. For long reads, this option is +typically ranged from 25 to 35 for `-k 2'. [inf] +.TP +.BI -k \ INT +Maximum edit distance in the seed [2] +.TP +.BI -t \ INT +Number of threads (multi-threading mode) [1] +.TP +.BI -M \ INT +Mismatch penalty. BWA will not search for suboptimal hits with a score +lower than (bestScore-misMsc). [3] +.TP +.BI -O \ INT +Gap open penalty [11] +.TP +.BI -E \ INT +Gap extension penalty [4] +.TP +.BI -R \ INT +Proceed with suboptimal alignments if there are no more than INT equally +best hits. This option only affects paired-end mapping. Increasing this +threshold helps to improve the pairing accuracy at the cost of speed, +especially for short reads (~32bp). +.TP +.B -c +Reverse query but not complement it, which is required for alignment in +the color space. (Disabled since 0.6.x) +.TP +.B -N +Disable iterative search. All hits with no more than +.I maxDiff +differences will be found. This mode is much slower than the default. +.TP +.BI -q \ INT +Parameter for read trimming. BWA trims a read down to +argmax_x{\\sum_{i=x+1}^l(INT-q_i)} if q_l 1.sai + bwa aln ref.fa -b2 reads.bam > 2.sai + bwa sampe ref.fa 1.sai 2.sai reads.bam reads.bam > aln.sam +.TP +.B -0 +When +.B -b +is specified, only use single-end reads in mapping. +.TP +.B -1 +When +.B -b +is specified, only use the first read in a read pair in mapping (skip +single-end reads and the second reads). +.TP +.B -2 +When +.B -b +is specified, only use the second read in a read pair in mapping. +.B +.RE + +.TP +.B samse +bwa samse [-n maxOcc] > + +Generate alignments in the SAM format given single-end reads. Repetitive +hits will be randomly chosen. + +.B OPTIONS: +.RS +.TP 10 +.BI -n \ INT +Maximum number of alignments to output in the XA tag for reads paired +properly. If a read has more than INT hits, the XA tag will not be +written. [3] +.TP +.BI -r \ STR +Specify the read group in a format like `@RG\\tID:foo\\tSM:bar'. [null] +.RE + +.TP +.B sampe +bwa sampe [-a maxInsSize] [-o maxOcc] [-n maxHitPaired] [-N maxHitDis] +[-P] > + +Generate alignments in the SAM format given paired-end reads. Repetitive +read pairs will be placed randomly. + +.B OPTIONS: +.RS +.TP 8 +.BI -a \ INT +Maximum insert size for a read pair to be considered being mapped +properly. Since 0.4.5, this option is only used when there are not +enough good alignment to infer the distribution of insert sizes. [500] +.TP +.BI -o \ INT +Maximum occurrences of a read for pairing. A read with more occurrneces +will be treated as a single-end read. Reducing this parameter helps +faster pairing. [100000] +.TP +.B -P +Load the entire FM-index into memory to reduce disk operations +(base-space reads only). With this option, at least 1.25N bytes of +memory are required, where N is the length of the genome. +.TP +.BI -n \ INT +Maximum number of alignments to output in the XA tag for reads paired +properly. If a read has more than INT hits, the XA tag will not be +written. [3] +.TP +.BI -N \ INT +Maximum number of alignments to output in the XA tag for disconcordant +read pairs (excluding singletons). If a read has more than INT hits, the +XA tag will not be written. [10] +.TP +.BI -r \ STR +Specify the read group in a format like `@RG\\tID:foo\\tSM:bar'. [null] +.RE + +.TP +.B bwasw +bwa bwasw [-a matchScore] [-b mmPen] [-q gapOpenPen] [-r gapExtPen] [-t +nThreads] [-w bandWidth] [-T thres] [-s hspIntv] [-z zBest] [-N +nHspRev] [-c thresCoef] [mate.fq] + +Align query sequences in the +.I in.fq +file. When +.I mate.fq +is present, perform paired-end alignment. The paired-end mode only works +for reads Illumina short-insert libraries. In the paired-end mode, BWA-SW +may still output split alignments but they are all marked as not properly +paired; the mate positions will not be written if the mate has multiple +local hits. + +.B OPTIONS: +.RS +.TP 10 +.BI -a \ INT +Score of a match [1] +.TP +.BI -b \ INT +Mismatch penalty [3] +.TP +.BI -q \ INT +Gap open penalty [5] +.TP +.BI -r \ INT +Gap extension penalty. The penalty for a contiguous gap of size k is +q+k*r. [2] +.TP +.BI -t \ INT +Number of threads in the multi-threading mode [1] +.TP +.BI -w \ INT +Band width in the banded alignment [33] +.TP +.BI -T \ INT +Minimum score threshold divided by a [37] +.TP +.BI -c \ FLOAT +Coefficient for threshold adjustment according to query length. Given an +l-long query, the threshold for a hit to be retained is +a*max{T,c*log(l)}. [5.5] +.TP +.BI -z \ INT +Z-best heuristics. Higher -z increases accuracy at the cost of speed. [1] +.TP +.BI -s \ INT +Maximum SA interval size for initiating a seed. Higher -s increases +accuracy at the cost of speed. [3] +.TP +.BI -N \ INT +Minimum number of seeds supporting the resultant alignment to skip +reverse alignment. [5] +.RE + +.SH SAM ALIGNMENT FORMAT +.PP +The output of the +.B `aln' +command is binary and designed for BWA use only. BWA outputs the final +alignment in the SAM (Sequence Alignment/Map) format. Each line consists +of: + +.TS +center box; +cb | cb | cb +n | l | l . +Col Field Description +_ +1 QNAME Query (pair) NAME +2 FLAG bitwise FLAG +3 RNAME Reference sequence NAME +4 POS 1-based leftmost POSition/coordinate of clipped sequence +5 MAPQ MAPping Quality (Phred-scaled) +6 CIAGR extended CIGAR string +7 MRNM Mate Reference sequence NaMe (`=' if same as RNAME) +8 MPOS 1-based Mate POSistion +9 ISIZE Inferred insert SIZE +10 SEQ query SEQuence on the same strand as the reference +11 QUAL query QUALity (ASCII-33 gives the Phred base quality) +12 OPT variable OPTional fields in the format TAG:VTYPE:VALUE +.TE + +.PP +Each bit in the FLAG field is defined as: + +.TS +center box; +cb | cb | cb +c | l | l . +Chr Flag Description +_ +p 0x0001 the read is paired in sequencing +P 0x0002 the read is mapped in a proper pair +u 0x0004 the query sequence itself is unmapped +U 0x0008 the mate is unmapped +r 0x0010 strand of the query (1 for reverse) +R 0x0020 strand of the mate +1 0x0040 the read is the first read in a pair +2 0x0080 the read is the second read in a pair +s 0x0100 the alignment is not primary +f 0x0200 QC failure +d 0x0400 optical or PCR duplicate +S 0x0800 supplementary alignment +.TE + +.PP +The Please check for the format +specification and the tools for post-processing the alignment. + +BWA generates the following optional fields. Tags starting with `X' are +specific to BWA. + +.TS +center box; +cb | cb +cB | l . +Tag Meaning +_ +NM Edit distance +MD Mismatching positions/bases +AS Alignment score +BC Barcode sequence +SA Supplementary alignments +_ +X0 Number of best hits +X1 Number of suboptimal hits found by BWA +XN Number of ambiguous bases in the referenece +XM Number of mismatches in the alignment +XO Number of gap opens +XG Number of gap extentions +XT Type: Unique/Repeat/N/Mate-sw +XA Alternative hits; format: /(chr,pos,CIGAR,NM;)*/ +_ +XS Suboptimal alignment score +XF Support from forward/reverse alignment +XE Number of supporting seeds +.TE + +.PP +Note that XO and XG are generated by BWT search while the CIGAR string +by Smith-Waterman alignment. These two tags may be inconsistent with the +CIGAR string. This is not a bug. + +.SH NOTES ON SHORT-READ ALIGNMENT +.SS Alignment Accuracy +.PP +When seeding is disabled, BWA guarantees to find an alignment +containing maximum +.I maxDiff +differences including +.I maxGapO +gap opens which do not occur within +.I nIndelEnd +bp towards either end of the query. Longer gaps may be found if +.I maxGapE +is positive, but it is not guaranteed to find all hits. When seeding is +enabled, BWA further requires that the first +.I seedLen +subsequence contains no more than +.I maxSeedDiff +differences. +.PP +When gapped alignment is disabled, BWA is expected to generate the same +alignment as Eland version 1, the Illumina alignment program. However, as BWA +change `N' in the database sequence to random nucleotides, hits to these +random sequences will also be counted. As a consequence, BWA may mark a +unique hit as a repeat, if the random sequences happen to be identical +to the sequences which should be unqiue in the database. +.PP +By default, if the best hit is not highly repetitive (controlled by -R), BWA +also finds all hits contains one more mismatch; otherwise, BWA finds all +equally best hits only. Base quality is NOT considered in evaluating +hits. In the paired-end mode, BWA pairs all hits it found. It further +performs Smith-Waterman alignment for unmapped reads to rescue reads with a +high erro rate, and for high-quality anomalous pairs to fix potential alignment +errors. + +.SS Estimating Insert Size Distribution +.PP +BWA estimates the insert size distribution per 256*1024 read pairs. It +first collects pairs of reads with both ends mapped with a single-end +quality 20 or higher and then calculates median (Q2), lower and higher +quartile (Q1 and Q3). It estimates the mean and the variance of the +insert size distribution from pairs whose insert sizes are within +interval [Q1-2(Q3-Q1), Q3+2(Q3-Q1)]. The maximum distance x for a pair +considered to be properly paired (SAM flag 0x2) is calculated by solving +equation Phi((x-mu)/sigma)=x/L*p0, where mu is the mean, sigma is the +standard error of the insert size distribution, L is the length of the +genome, p0 is prior of anomalous pair and Phi() is the standard +cumulative distribution function. For mapping Illumina short-insert +reads to the human genome, x is about 6-7 sigma away from the +mean. Quartiles, mean, variance and x will be printed to the standard +error output. + +.SS Memory Requirement +.PP +With bwtsw algorithm, 5GB memory is required for indexing the complete +human genome sequences. For short reads, the +.B aln +command uses ~3.2GB memory and the +.B sampe +command uses ~5.4GB. + +.SS Speed +.PP +Indexing the human genome sequences takes 3 hours with bwtsw +algorithm. Indexing smaller genomes with IS algorithms is +faster, but requires more memory. +.PP +The speed of alignment is largely determined by the error rate of the query +sequences (r). Firstly, BWA runs much faster for near perfect hits than +for hits with many differences, and it stops searching for a hit with +l+2 differences if a l-difference hit is found. This means BWA will be +very slow if r is high because in this case BWA has to visit hits with +many differences and looking for these hits is expensive. Secondly, the +alignment algorithm behind makes the speed sensitive to [k log(N)/m], +where k is the maximum allowed differences, N the size of database and m +the length of a query. In practice, we choose k w.r.t. r and therefore r +is the leading factor. I would not recommend to use BWA on data with +r>0.02. +.PP +Pairing is slower for shorter reads. This is mainly because shorter +reads have more spurious hits and converting SA coordinates to +chromosomal coordinates are very costly. + +.SH CHANGES IN BWA-0.6 +.PP +Since version 0.6, BWA has been able to work with a reference genome longer than 4GB. +This feature makes it possible to integrate the forward and reverse complemented +genome in one FM-index, which speeds up both BWA-short and BWA-SW. As a tradeoff, +BWA uses more memory because it has to keep all positions and ranks in 64-bit +integers, twice larger than 32-bit integers used in the previous versions. + +The latest BWA-SW also works for paired-end reads longer than 100bp. In +comparison to BWA-short, BWA-SW tends to be more accurate for highly unique +reads and more robust to relative long INDELs and structural variants. +Nonetheless, BWA-short usually has higher power to distinguish the optimal hit +from many suboptimal hits. The choice of the mapping algorithm may depend on +the application. + +.SH SEE ALSO +BWA website , Samtools website + + +.SH AUTHOR +Heng Li at the Sanger Institute wrote the key source codes and +integrated the following codes for BWT construction: bwtsw +, implemented by Chi-Kwong Wong at +the University of Hong Kong and IS + originally proposed by Nong Ge + at the Sun Yat-Sen University and +implemented by Yuta Mori. + +.SH LICENSE AND CITATION +.PP +The full BWA package is distributed under GPLv3 as it uses source codes +from BWT-SW which is covered by GPL. Sorting, hash table, BWT and IS +libraries are distributed under the MIT license. +.PP +If you use the BWA-backtrack algorithm, please cite the following +paper: +.PP +Li H. and Durbin R. (2009) Fast and accurate short read alignment with +Burrows-Wheeler transform. Bioinformatics, 25, 1754-1760. [PMID: 19451168] +.PP +If you use the BWA-SW algorithm, please cite: +.PP +Li H. and Durbin R. (2010) Fast and accurate long-read alignment with +Burrows-Wheeler transform. Bioinformatics, 26, 589-595. [PMID: 20080505] +.PP +If you use BWA-MEM or the fastmap component of BWA, please cite: +.PP +Li H. (2013) Aligning sequence reads, clone sequences and assembly contigs with +BWA-MEM. arXiv:1303.3997v1 [q-bio.GN]. +.PP +It is likely that the BWA-MEM manuscript will not appear in a peer-reviewed +journal. + +.SH HISTORY +BWA is largely influenced by BWT-SW. It uses source codes from BWT-SW +and mimics its binary file formats; BWA-SW resembles BWT-SW in several +ways. The initial idea about BWT-based alignment also came from the +group who developed BWT-SW. At the same time, BWA is different enough +from BWT-SW. The short-read alignment algorithm bears no similarity to +Smith-Waterman algorithm any more. While BWA-SW learns from BWT-SW, it +introduces heuristics that can hardly be applied to the original +algorithm. In all, BWA does not guarantee to find all local hits as what +BWT-SW is designed to do, but it is much faster than BWT-SW on both +short and long query sequences. + +I started to write the first piece of codes on 24 May 2008 and got the +initial stable version on 02 June 2008. During this period, I was +acquainted that Professor Tak-Wah Lam, the first author of BWT-SW paper, +was collaborating with Beijing Genomics Institute on SOAP2, the successor +to SOAP (Short Oligonucleotide Analysis Package). SOAP2 has come out in +November 2008. According to the SourceForge download page, the third +BWT-based short read aligner, bowtie, was first released in August +2008. At the time of writing this manual, at least three more BWT-based +short-read aligners are being implemented. + +The BWA-SW algorithm is a new component of BWA. It was conceived in +November 2008 and implemented ten months later. + +The BWA-MEM algorithm is based on an algorithm finding super-maximal exact +matches (SMEMs), which was first published with the fermi assembler paper +in 2012. I first implemented the basic SMEM algorithm in the +.B fastmap +command for an experiment and then extended the basic algorithm and added the +extension part in Feburary 2013 to make BWA-MEM a fully featured mapper. + diff --git a/bwa.c b/bwa.c new file mode 100644 index 0000000..c7647b6 --- /dev/null +++ b/bwa.c @@ -0,0 +1,857 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include +#include +#include +#include +#include +#include "bntseq.h" +#include "bwa.h" +#include "ksw.h" +#include "utils.h" +#include "kstring.h" +#include "kvec.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +int bwa_verbose = 3; +int bwa_dbg = 0; +char bwa_rg_id[256]; +char *bwa_pg; + +/************************ + * Batch FASTA/Q reader * + ************************/ + +#include "kseq.h" +KSEQ_DECLARE(gzFile) + +static inline void trim_readno(kstring_t *s) +{ + if (s->l > 2 && s->s[s->l-2] == '/' && isdigit(s->s[s->l-1])) + s->l -= 2, s->s[s->l] = 0; +} + +static inline void dupkstring(const kstring_t *str, int dupempty, char **dstp, int *sm) +{ + if (!dupempty && str->l == 0) { + if (*dstp) free(*dstp); + *dstp = 0; *sm = 0; + } else if (*dstp == 0 || *sm < str->l) { + *sm = str->l; + *dstp = realloc(*dstp, str->l + 1); + } + + char *s = *dstp; + if (!s) return; + + memcpy(s, str->s, str->l); + s[str->l] = '\0'; +} + +static inline void kseq2bseq1(const kseq_t *ks, bseq1_t *s, int copy_comment) +{ // TODO: it would be better to allocate one chunk of memory, but probably it does not matter in practice + dupkstring(&ks->name, 1, &s->name, &s->m_name); + if (copy_comment) dupkstring(&ks->comment, 0, &s->comment, &s->m_comment); + dupkstring(&ks->seq, 1, &s->seq, &s->m_seq); + dupkstring(&ks->qual, 0, &s->qual, &s->m_qual); + s->l_seq = ks->seq.l; +} + +typedef struct { + kseq_t *ks; + bseq1_t *seq; + int start_pos; + int n_bound; + int copy_comment; + int ret_n; + int ret_size; + int ret_status; + int chunk_size; +} read_data_t; + +static void *thread_bseq_read(void *data) { + read_data_t *d = (read_data_t*) data; + kseq_t *ks = d->ks; + bseq1_t *seqs = d->seq; + int copy_comment = d->copy_comment; + int chunk_size = d->chunk_size; + int cur_n = 0, cur_pos = d->start_pos, size = 0; + int ret_status = 1; + + //pthread_t thread_id = pthread_self(); + //fprintf(stderr, "Thread ID: %lu\n", thread_id); + PROF_START(parse); + while (cur_n < d->n_bound && (ret_status = kseq_read(ks)) >= 0) { + + trim_readno(&ks->name); + kseq2bseq1(ks, seqs + cur_pos, copy_comment); + seqs[cur_pos].id = cur_pos; + size += seqs[cur_pos].l_seq; + cur_pos += 2; cur_n += 1; + + if (size >= chunk_size) break; + } + PROF_END(gprof[G_parse_seq], parse); + d->ret_n = cur_n; d->ret_size = size; d->ret_status = ret_status; + return 0; +} + +#define READ_ONE_SEQ(ksin) \ + trim_readno(&(ksin)->name); \ + kseq2bseq1(ksin, &seqs[n], copy_comment); \ + seqs[n].id = n; \ + size += seqs[n++].l_seq; + +// multi thread reading input seqs +void bseq_read_pe_mt(int chunk_size, int *n_, void *ks1_, void *ks2_, int copy_comment, int64_t *size_, int *m_, bseq1_t **seqs_ptr) +{ + kseq_t *ks = (kseq_t *)ks1_, *ks2 = (kseq_t *)ks2_; + int size = 0, m = *m_, n = 0; + bseq1_t *seqs = *seqs_ptr; + read_data_t d[2]; + pthread_t tid[2]; + const int chunk_size_narrow = 4 * 1024 * 1024; + const int init_n_reads = 20; + if (m == 0) { // , + seqs = calloc(init_n_reads, sizeof(bseq1_t)); // 20reads,readschunk sizereads +#if 1 + int ks1_ret = 0, ks2_ret = 0; + int i = init_n_reads >> 1; + while (i-- > 0) { + ks1_ret = kseq_read(ks); + if (ks1_ret < 0) break; + ks2_ret = kseq_read(ks2); + if (ks2_ret < 0) { + fprintf(stderr, "[W::%s] the 2nd file has fewer sequences.\n", __func__); + break; + } + READ_ONE_SEQ(ks); + READ_ONE_SEQ(ks2); + } + if (ks1_ret < 0 || ks2_ret < 0) { + if (size == 0 && kseq_read(ks2) >= 0) { // test if the 2nd file is finished + fprintf(stderr, "[W::%s] the 1st file has fewer sequences.\n", __func__); + } + *n_ = n; *seqs_ptr = seqs; *size_ = size; *m_ = n; + return; + } + m = (chunk_size + size / init_n_reads - 1) / (size / init_n_reads); +#else + m = 50000; +#endif + seqs = realloc(seqs, m * sizeof(bseq1_t)); + memset(seqs + n, 0, sizeof(bseq1_t) * (m - n)); + } + + d[0].copy_comment = copy_comment; d[1].copy_comment = copy_comment; + d[0].ks = ks ; d[0].seq = &seqs[0]; d[0].n_bound = (m >> 1) - (n>>1); d[0].start_pos = n; + d[1].ks = ks2; d[1].seq = &seqs[0]; d[1].n_bound = (m >> 1) - (n>>1); d[1].start_pos = n+1; + d[0].chunk_size = d[1].chunk_size = (chunk_size - chunk_size_narrow - size) >> 1; + + pthread_create(&tid[0], 0, thread_bseq_read, &d[0]); + pthread_create(&tid[1], 0, thread_bseq_read, &d[1]); + pthread_join(tid[0], 0); pthread_join(tid[1], 0); + + size += d[0].ret_size + d[1].ret_size; + + // reads + if (d[0].ret_n < d[1].ret_n) + { + int num_to_read = d[1].ret_n - d[0].ret_n; + int offset = n + d[0].ret_n * 2; + while (num_to_read-- > 0 && kseq_read(ks) >= 0) { + trim_readno(&ks->name); + kseq2bseq1(ks, &seqs[offset], copy_comment); + seqs[offset].id = offset; + size += seqs[offset].l_seq; + offset += 2; + } + d[0].ret_n = d[1].ret_n; + } + else if (d[1].ret_n < d[0].ret_n) + { + int num_to_read = d[0].ret_n - d[1].ret_n; + int offset = n + 1 + d[1].ret_n * 2; + while (num_to_read-- > 0 && kseq_read(ks2) >= 0) { + trim_readno(&ks2->name); + kseq2bseq1(ks2, &seqs[offset], copy_comment); + seqs[offset].id = offset; + size += seqs[offset].l_seq; + offset += 2; + } + d[1].ret_n = d[0].ret_n; + } + + n += d[0].ret_n + d[1].ret_n; + + if (size == 0 && kseq_read(ks2) >= 0) { // test if the 2nd file is finished + fprintf(stderr, "[W::%s] the 1st file has fewer sequences.\n", __func__); + } else if (size < chunk_size && d[0].ret_status > 0 && d[1].ret_status > 0) { + while (kseq_read(ks) >= 0) { + if (kseq_read(ks2) < 0) { // the 2nd file has fewer reads + fprintf(stderr, "[W::%s] the 2nd file has fewer sequences.\n", __func__); + break; + } + if (n >= m) { + m = m? m<<1 : 256; + seqs = realloc(seqs, m * sizeof(bseq1_t)); + memset(seqs + n, 0, (m-n) * sizeof(bseq1_t)); + } + READ_ONE_SEQ(ks); + READ_ONE_SEQ(ks2); + if (size >= chunk_size && (n&1) == 0) break; + } + if (size == 0) { // test if the 2nd file is finished + if (kseq_read(ks2) >= 0) fprintf(stderr, "[W::%s] the 1st file has fewer sequences.\n", __func__); + } + } + *n_ = n; *size_ = size; + if (m > *m_) *m_ = m; + *seqs_ptr = seqs; +} + +void bseq_read(int chunk_size, int *n_, void *ks1_, void *ks2_, int copy_comment, int64_t *size_, int *m_, bseq1_t **seqs_ptr) +{ +#ifdef USE_MT_READ + if (ks2_) return bseq_read_pe_mt(chunk_size, n_, ks1_, ks2_, copy_comment, size_, m_, seqs_ptr); +#endif + kseq_t *ks = (kseq_t*)ks1_, *ks2 = (kseq_t*)ks2_; + int size = 0, m, n; + bseq1_t *seqs = *seqs_ptr; + n = 0; m = *m_; + while (kseq_read(ks) >= 0) { + if (ks2 && kseq_read(ks2) < 0) { // the 2nd file has fewer reads + fprintf(stderr, "[W::%s] the 2nd file has fewer sequences.\n", __func__); + break; + } + PROF_START(parse); + if (n >= m) { + m = m? m<<1 : 256; + seqs = realloc(seqs, m * sizeof(bseq1_t)); + memset(seqs + n, 0, (m-n) * sizeof(bseq1_t)); + } + READ_ONE_SEQ(ks); + if (ks2) { + READ_ONE_SEQ(ks2); + } + PROF_END(gprof[G_parse_seq], parse); + if (size >= chunk_size && (n&1) == 0) break; + } + + if (size == 0) { // test if the 2nd file is finished + if (ks2 && kseq_read(ks2) >= 0) + fprintf(stderr, "[W::%s] the 1st file has fewer sequences.\n", __func__); + } + *n_ = n; *size_ = size; + if (m > *m_) *m_ = m; + *seqs_ptr = seqs; +} + +void bseq_classify(int n, bseq1_t *seqs, int m[2], bseq1_t *sep[2]) +{ + int i, has_last; + kvec_t(bseq1_t) a[2] = {{0,0,0}, {0,0,0}}; + for (i = 1, has_last = 1; i < n; ++i) { + if (has_last) { + if (strcmp(seqs[i].name, seqs[i-1].name) == 0) { + kv_push(bseq1_t, a[1], seqs[i-1]); + kv_push(bseq1_t, a[1], seqs[i]); + has_last = 0; + } else kv_push(bseq1_t, a[0], seqs[i-1]); + } else has_last = 1; + } + if (has_last) kv_push(bseq1_t, a[0], seqs[i-1]); + sep[0] = a[0].a, m[0] = a[0].n; + sep[1] = a[1].a, m[1] = a[1].n; +} + +/***************** + * CIGAR related * + *****************/ + +void bwa_fill_scmat(int a, int b, int8_t mat[25]) +{ + int i, j, k; + for (i = k = 0; i < 4; ++i) { + for (j = 0; j < 4; ++j) + mat[k++] = i == j? a : -b; + mat[k++] = -1; // ambiguous base + } + for (j = 0; j < 5; ++j) mat[k++] = -1; +} + +// Generate CIGAR when the alignment end points are known +uint32_t *bwa_gen_cigar2(const int8_t mat[25], int o_del, int e_del, int o_ins, int e_ins, int w_, int64_t l_pac, const uint8_t *pac, int l_query, uint8_t *query, int64_t rb, int64_t re, int *score, int *n_cigar, int *NM) +{ + uint32_t *cigar = 0; + uint8_t tmp, *rseq; + int i; + int64_t rlen; + kstring_t str; + const char *int2base; + + if (n_cigar) *n_cigar = 0; + if (NM) *NM = -1; + if (l_query <= 0 || rb >= re || (rb < l_pac && re > l_pac)) return 0; // reject if negative length or bridging the forward and reverse strand + rseq = bns_get_seq(l_pac, pac, rb, re, &rlen); + if (re - rb != rlen) goto ret_gen_cigar; // possible if out of range + if (rb >= l_pac) { // then reverse both query and rseq; this is to ensure indels to be placed at the leftmost position + for (i = 0; i < l_query>>1; ++i) + tmp = query[i], query[i] = query[l_query - 1 - i], query[l_query - 1 - i] = tmp; + for (i = 0; i < rlen>>1; ++i) + tmp = rseq[i], rseq[i] = rseq[rlen - 1 - i], rseq[rlen - 1 - i] = tmp; + } + if (l_query == re - rb && w_ == 0) { // no gap; no need to do DP + // UPDATE: we come to this block now... FIXME: due to an issue in mem_reg2aln(), we never come to this block. This does not affect accuracy, but it hurts performance. + if (n_cigar) { + cigar = malloc(4); + cigar[0] = l_query<<4 | 0; + *n_cigar = 1; + } + for (i = 0, *score = 0; i < l_query; ++i) + *score += mat[rseq[i]*5 + query[i]]; + } else { + int w, max_gap, max_ins, max_del, min_w; + // set the band-width + max_ins = (int)((double)(((l_query+1)>>1) * mat[0] - o_ins) / e_ins + 1.); + max_del = (int)((double)(((l_query+1)>>1) * mat[0] - o_del) / e_del + 1.); + max_gap = max_ins > max_del? max_ins : max_del; + max_gap = max_gap > 1? max_gap : 1; + w = (max_gap + abs((int)rlen - l_query) + 1) >> 1; + w = w < w_? w : w_; + min_w = abs((int)rlen - l_query) + 3; + w = w > min_w? w : min_w; + // NW alignment + if (bwa_verbose >= 4) { + printf("* Global bandwidth: %d\n", w); + printf("* Global ref: "); for (i = 0; i < rlen; ++i) putchar("ACGTN"[(int)rseq[i]]); putchar('\n'); + printf("* Global query: "); for (i = 0; i < l_query; ++i) putchar("ACGTN"[(int)query[i]]); putchar('\n'); + } + *score = ksw_global2(l_query, query, rlen, rseq, 5, mat, o_del, e_del, o_ins, e_ins, w, n_cigar, &cigar); + } + if (NM && n_cigar) {// compute NM and MD + int k, x, y, u, n_mm = 0, n_gap = 0; + str.l = str.m = *n_cigar * 4; str.s = (char*)cigar; // append MD to CIGAR + int2base = rb < l_pac? "ACGTN" : "TGCAN"; + for (k = 0, x = y = u = 0; k < *n_cigar; ++k) { + int op, len; + cigar = (uint32_t*)str.s; + op = cigar[k]&0xf, len = cigar[k]>>4; + if (op == 0) { // match + for (i = 0; i < len; ++i) { + if (query[x + i] != rseq[y + i]) { + kputw(u, &str); + kputc(int2base[rseq[y+i]], &str); + ++n_mm; u = 0; + } else ++u; + } + x += len; y += len; + } else if (op == 2) { // deletion + if (k > 0 && k < *n_cigar - 1) { // don't do the following if D is the first or the last CIGAR + kputw(u, &str); kputc('^', &str); + for (i = 0; i < len; ++i) + kputc(int2base[rseq[y+i]], &str); + u = 0; n_gap += len; + } + y += len; + } else if (op == 1) x += len, n_gap += len; // insertion + } + kputw(u, &str); kputc(0, &str); + *NM = n_mm + n_gap; + cigar = (uint32_t*)str.s; + } + if (rb >= l_pac) // reverse back query + for (i = 0; i < l_query>>1; ++i) + tmp = query[i], query[i] = query[l_query - 1 - i], query[l_query - 1 - i] = tmp; + +ret_gen_cigar: + free(rseq); + return cigar; +} + +uint32_t *bwa_gen_cigar(const int8_t mat[25], int q, int r, int w_, int64_t l_pac, const uint8_t *pac, int l_query, uint8_t *query, int64_t rb, int64_t re, int *score, int *n_cigar, int *NM) +{ + return bwa_gen_cigar2(mat, q, r, q, r, w_, l_pac, pac, l_query, query, rb, re, score, n_cigar, NM); +} + +/********************* + * Full index reader * + *********************/ + +char *bwa_idx_infer_prefix(const char *hint) +{ + char *prefix; + int l_hint; + FILE *fp; + l_hint = strlen(hint); + prefix = malloc(l_hint + 3 + 4 + 1 + 10); + strcpy(prefix, hint); + //strcpy(prefix + l_hint, ".64.bwt"); + strcpy(prefix + l_hint, ".ne.bwt"); + if ((fp = fopen(prefix, "rb")) != 0) { + fclose(fp); + prefix[l_hint + 3] = 0; + return prefix; + } else { + strcpy(prefix + l_hint, ".bwt"); + if ((fp = fopen(prefix, "rb")) == 0) { + free(prefix); + return 0; + } else { + fclose(fp); + prefix[l_hint] = 0; + return prefix; + } + } +} + +bwt_t *bwa_idx_load_bwt(const char *hint) +{ + char *tmp, *prefix; + bwt_t *bwt; + prefix = bwa_idx_infer_prefix(hint); + if (prefix == 0) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] fail to locate the index files\n", __func__); + return 0; + } + tmp = calloc(strlen(prefix) + 5, 1); + strcat(strcpy(tmp, prefix), ".bwt"); // FM-index + bwt = bwt_restore_bwt(tmp); + //strcat(strcpy(tmp, prefix), ".33.4.sa"); // partial suffix array (SA) + strcat(strcpy(tmp, prefix), ".sa"); // partial suffix array (SA) + bwt_restore_sa(tmp, bwt); + free(tmp); free(prefix); + return bwt; +} + +FMTIndex *bwa_idx_load_fmt(const char *hint) +{ + char *fmt_idx_fn, *kmer_idx_fn, *sa_fn; + // char *kmer_bit_fn; + FMTIndex *fmt; + char suffix[32]; + int l_hint = strlen(hint); + fmt_idx_fn = malloc(l_hint + 32); + kmer_idx_fn = malloc(l_hint + 32); + //kmer_bit_fn = malloc(l_hint + 32); + sa_fn = malloc(l_hint + 32); +// sprintf(suffix, ".256.%d.fmt", FMT_MID_INTERVAL); + sprintf(suffix, ".fmt"); + strcpy(fmt_idx_fn, hint); + strcpy(fmt_idx_fn + l_hint, suffix); +// sprintf(suffix, ".%d.kmer", HASH_KMER_LEN); + sprintf(suffix, ".kmer"); + strcpy(kmer_idx_fn, hint); + strcpy(kmer_idx_fn + l_hint, suffix); + + if (access(fmt_idx_fn, F_OK) != 0 || access(kmer_idx_fn, F_OK) != 0) + { + if (bwa_verbose >= 1) + fprintf(stderr, "[E::%s] fail to locate the index files\n", __func__); + return 0; + } + fmt = fmt_restore_fmt(fmt_idx_fn); + // fprintf(stderr, "%s\n", kmer_idx_fn); + fmt->kmer_hash = fmt_restore_kmer_idx(kmer_idx_fn); + + strcpy(sa_fn, hint); +// sprintf(suffix, ".33.%d.sa", SA_INTV); + sprintf(suffix, ".bytesa"); + strcpy(sa_fn + l_hint, suffix); // partial suffix array (SA) + fmt_restore_sa(sa_fn, fmt); + + free(fmt_idx_fn); + free(kmer_idx_fn); + free(sa_fn); + + return fmt; +} + +bwaidx_t *bwa_idx_load_from_disk(const char *hint, int which) +{ + bwaidx_t *idx; + char *prefix; + prefix = bwa_idx_infer_prefix(hint); + if (prefix == 0) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] fail to locate the index files\n", __func__); + return 0; + } + idx = calloc(1, sizeof(bwaidx_t)); + + + if (which & BWA_IDX_FMT) idx->fmt = bwa_idx_load_fmt(hint); + if (which & BWA_IDX_BWT) + { + idx->bwt = bwa_idx_load_bwt(hint); + if (which & BWA_IDX_FMT) + idx->bwt->kmer_hash = idx->fmt->kmer_hash; + } + + if (which & BWA_IDX_BNS) + { + int i, c; + idx->bns = bns_restore(prefix); + for (i = c = 0; i < idx->bns->n_seqs; ++i) + if (idx->bns->anns[i].is_alt) ++c; + if (bwa_verbose >= 3) + fprintf(stderr, "[M::%s] read %d ALT contigs\n", __func__, c); + if (which & BWA_IDX_PAC) { + idx->pac = calloc(idx->bns->l_pac/4+1, 1); + err_fread_noeof(idx->pac, 1, idx->bns->l_pac/4+1, idx->bns->fp_pac); // concatenated 2-bit encoded sequence + err_fclose(idx->bns->fp_pac); + idx->bns->fp_pac = 0; + // fmtpac + if (which & BWA_IDX_FMT) { + idx->fmt->l_pac = idx->bns->l_pac; + idx->fmt->pac = idx->pac; + } + } + } + free(prefix); + return idx; +} + +bwaidx_t *bwa_idx_load(const char *hint, int which) +{ + return bwa_idx_load_from_disk(hint, which); +} + +void bwa_idx_destroy(bwaidx_t *idx) +{ + if (idx == 0) return; + if (idx->mem == 0) { + if (idx->bwt) bwt_destroy(idx->bwt); + if (idx->bns) bns_destroy(idx->bns); + if (idx->pac) free(idx->pac); + } else { + free(idx->bwt); free(idx->bns->anns); free(idx->bns); + if (!idx->is_shm) free(idx->mem); + } + free(idx); +} + +int bwa_mem2idx(int64_t l_mem, uint8_t *mem, bwaidx_t *idx) +{ + int64_t k = 0, x; + int i; + + // generate idx->bwt + x = sizeof(bwt_t); idx->bwt = malloc(x); memcpy(idx->bwt, mem + k, x); k += x; + x = idx->bwt->bwt_size * 4; idx->bwt->bwt = (uint32_t*)(mem + k); k += x; + x = idx->bwt->n_sa * sizeof(bwtint_t); idx->bwt->sa = (bwtint_t*)(mem + k); k += x; + + // generate idx->bns and idx->pac + x = sizeof(bntseq_t); idx->bns = malloc(x); memcpy(idx->bns, mem + k, x); k += x; + x = idx->bns->n_holes * sizeof(bntamb1_t); idx->bns->ambs = (bntamb1_t*)(mem + k); k += x; + x = idx->bns->n_seqs * sizeof(bntann1_t); idx->bns->anns = malloc(x); memcpy(idx->bns->anns, mem + k, x); k += x; + for (i = 0; i < idx->bns->n_seqs; ++i) { + idx->bns->anns[i].name = (char*)(mem + k); k += strlen(idx->bns->anns[i].name) + 1; + idx->bns->anns[i].anno = (char*)(mem + k); k += strlen(idx->bns->anns[i].anno) + 1; + } + idx->pac = (uint8_t*)(mem + k); k += idx->bns->l_pac/4+1; + assert(k == l_mem); + + idx->l_mem = k; idx->mem = mem; + return 0; +} + +static void mem_to_bnspac(bwaidx_t *idx, uint8_t **mem_, int64_t *k_) +{ + int i; + int64_t x, k = *k_; + uint8_t *mem = *mem_; + // generate idx->bns and idx->pac + x = sizeof(bntseq_t); idx->bns = malloc(x); memcpy(idx->bns, mem + k, x); k += x; + x = idx->bns->n_holes * sizeof(bntamb1_t); idx->bns->ambs = (bntamb1_t*)(mem + k); k += x; + x = idx->bns->n_seqs * sizeof(bntann1_t); idx->bns->anns = malloc(x); memcpy(idx->bns->anns, mem + k, x); k += x; + for (i = 0; i < idx->bns->n_seqs; ++i) { + idx->bns->anns[i].name = (char*)(mem + k); k += strlen(idx->bns->anns[i].name) + 1; + idx->bns->anns[i].anno = (char*)(mem + k); k += strlen(idx->bns->anns[i].anno) + 1; + } + idx->pac = (uint8_t*)(mem + k); k += idx->bns->l_pac/4+1; + *k_ = k; + *mem_ = mem; +} + +int bwa_mem2fmtidx(int64_t l_mem, uint8_t *mem, bwaidx_t *idx) +{ + int64_t k = 0, x; + // generate idx->fmt + x = sizeof(FMTIndex); idx->fmt = malloc(x); memcpy(idx->fmt, mem + k, x); k += x; + x = idx->fmt->bwt_size * 4; idx->fmt->bwt = (uint32_t*)(mem + k); k += x; + x = SA_BYTES(idx->fmt->n_sa); idx->fmt->sa = (uint8_t*)(mem + k); k += x; + // kmer hash + x = (1 << (10 << 1)) * sizeof(KmerEntryArr); + idx->fmt->kmer_hash.ke10 = (KmerEntryArr*)(mem + k); k += x; + x = (1 << (11 << 1)) * sizeof(KmerEntry); + idx->fmt->kmer_hash.ke11 = (KmerEntry*)(mem + k); k += x; + x = (1 << (12 << 1)) * sizeof(KmerEntry); + idx->fmt->kmer_hash.ke12 = (KmerEntry*)(mem + k); k += x; +#if HASH_KMER_LEN > 12 + x = (1 << (13 << 1)) * sizeof(KmerEntry); + idx->fmt->kmer_hash.ke13 = (KmerEntry*)(mem + k); k += x; +#endif +#if HASH_KMER_LEN > 13 + x = (1 << (14 << 1)) * sizeof(KmerEntry); + idx->fmt->kmer_hash.ke14 = (KmerEntry*)(mem + k); k += x; +#endif + + // generate idx->bns and idx->pac + mem_to_bnspac(idx, &mem, &k); + assert(k == l_mem); + idx->l_mem = k; idx->mem = mem; + idx->fmt->pac = idx->pac; + return 0; +} + +static void move_bns_to_mem(bwaidx_t *idx, uint8_t **mem_, int64_t *k_) +{ + int i; + int64_t x, tmp, k=*k_; + uint8_t *mem = *mem_; + // copy idx->bns + tmp = idx->bns->n_seqs * sizeof(bntann1_t) + idx->bns->n_holes * sizeof(bntamb1_t); + for (i = 0; i < idx->bns->n_seqs; ++i) // compute the size of heap-allocated memory + tmp += strlen(idx->bns->anns[i].name) + strlen(idx->bns->anns[i].anno) + 2; + mem = realloc(mem, k + sizeof(bntseq_t) + tmp); + x = sizeof(bntseq_t); memcpy(mem + k, idx->bns, x); k += x; + x = idx->bns->n_holes * sizeof(bntamb1_t); memcpy(mem + k, idx->bns->ambs, x); k += x; + free(idx->bns->ambs); + x = idx->bns->n_seqs * sizeof(bntann1_t); memcpy(mem + k, idx->bns->anns, x); k += x; + for (i = 0; i < idx->bns->n_seqs; ++i) { + x = strlen(idx->bns->anns[i].name) + 1; memcpy(mem + k, idx->bns->anns[i].name, x); k += x; + x = strlen(idx->bns->anns[i].anno) + 1; memcpy(mem + k, idx->bns->anns[i].anno, x); k += x; + free(idx->bns->anns[i].name); free(idx->bns->anns[i].anno); + } + free(idx->bns->anns); + *k_ = k; + *mem_ = mem; +} + +static void move_pac_to_mem(bwaidx_t *idx, uint8_t **mem_, int64_t *k_) +{ + int64_t x, k = *k_; + uint8_t *mem = *mem_; + // copy idx->pac + x = idx->bns->l_pac/4+1; + mem = realloc(mem, k + x); + memcpy(mem + k, idx->pac, x); k += x; + free(idx->bns); idx->bns = 0; + free(idx->pac); idx->pac = 0; + *k_ = k; + *mem_ = mem; +} + +int bwa_fmtidx2mem(bwaidx_t *idx) +{ + int64_t k, x; + uint8_t *mem; + + // copy idx->fmt + x = idx->fmt->bwt_size * 4; + mem = realloc(idx->fmt->bwt, sizeof(FMTIndex) + x); idx->fmt->bwt = 0; + memmove(mem + sizeof(FMTIndex), mem, x); + memcpy(mem, idx->fmt, sizeof(FMTIndex)); k = sizeof(FMTIndex) + x; + x = SA_BYTES(idx->fmt->n_sa); mem = realloc(mem, k + x); memcpy(mem + k, idx->fmt->sa, x); k += x; + // kmer hash + x = (1 << (10 << 1)) * sizeof(KmerEntryArr); + mem = realloc(mem, k + x); memcpy(mem + k, idx->fmt->kmer_hash.ke10, x); k += x; + x = (1 << (11 << 1)) * sizeof(KmerEntry); + mem = realloc(mem, k + x); memcpy(mem + k, idx->fmt->kmer_hash.ke11, x); k += x; + x = (1 << (12 << 1)) * sizeof(KmerEntry); + mem = realloc(mem, k + x); memcpy(mem + k, idx->fmt->kmer_hash.ke12, x); k += x; +#if HASH_KMER_LEN > 12 + x = (1 << (13 << 1)) * sizeof(KmerEntry); + mem = realloc(mem, k + x); memcpy(mem + k, idx->fmt->kmer_hash.ke13, x); k += x; +#endif +#if HASH_KMER_LEN > 13 + x = (1 << (14 << 1)) * sizeof(KmerEntry); + mem = realloc(mem, k + x); memcpy(mem + k, idx->fmt->kmer_hash.ke14, x); k += x; +#endif + free(idx->fmt->kmer_hash.ke10); + free(idx->fmt->kmer_hash.ke11); + free(idx->fmt->kmer_hash.ke12); + free(idx->fmt->kmer_hash.ke13); + free(idx->fmt->kmer_hash.ke14); + free(idx->fmt->sa); + free(idx->fmt); idx->fmt = 0; + + // copy idx->bns + move_bns_to_mem(idx, &mem, &k); + // copy idx->pac + move_pac_to_mem(idx, &mem, &k); + + return bwa_mem2fmtidx(k, mem, idx); +} + +int bwa_idx2mem(bwaidx_t *idx) +{ + int i; + int64_t k, x, tmp; + uint8_t *mem; + + // copy idx->bwt + + x = idx->bwt->bwt_size * 4; + mem = realloc(idx->bwt->bwt, sizeof(bwt_t) + x); idx->bwt->bwt = 0; + memmove(mem + sizeof(bwt_t), mem, x); + memcpy(mem, idx->bwt, sizeof(bwt_t)); k = sizeof(bwt_t) + x; + x = idx->bwt->n_sa * sizeof(bwtint_t); mem = realloc(mem, k + x); memcpy(mem + k, idx->bwt->sa, x); k += x; + free(idx->bwt->sa); + free(idx->bwt); idx->bwt = 0; + + + // copy idx->bns + tmp = idx->bns->n_seqs * sizeof(bntann1_t) + idx->bns->n_holes * sizeof(bntamb1_t); + for (i = 0; i < idx->bns->n_seqs; ++i) // compute the size of heap-allocated memory + tmp += strlen(idx->bns->anns[i].name) + strlen(idx->bns->anns[i].anno) + 2; + mem = realloc(mem, k + sizeof(bntseq_t) + tmp); + x = sizeof(bntseq_t); memcpy(mem + k, idx->bns, x); k += x; + x = idx->bns->n_holes * sizeof(bntamb1_t); memcpy(mem + k, idx->bns->ambs, x); k += x; + free(idx->bns->ambs); + x = idx->bns->n_seqs * sizeof(bntann1_t); memcpy(mem + k, idx->bns->anns, x); k += x; + for (i = 0; i < idx->bns->n_seqs; ++i) { + x = strlen(idx->bns->anns[i].name) + 1; memcpy(mem + k, idx->bns->anns[i].name, x); k += x; + x = strlen(idx->bns->anns[i].anno) + 1; memcpy(mem + k, idx->bns->anns[i].anno, x); k += x; + free(idx->bns->anns[i].name); free(idx->bns->anns[i].anno); + } + free(idx->bns->anns); + + // copy idx->pac + x = idx->bns->l_pac/4+1; + mem = realloc(mem, k + x); + memcpy(mem + k, idx->pac, x); k += x; + free(idx->bns); idx->bns = 0; + free(idx->pac); idx->pac = 0; + + return bwa_mem2idx(k, mem, idx); +} + +/*********************** + * SAM header routines * + ***********************/ + +void bwa_print_sam_hdr(const bntseq_t *bns, const char *hdr_line) +{ + int i, n_HD = 0, n_SQ = 0; + extern char *bwa_pg; + + if (hdr_line) { + // check for HD line + const char *p = hdr_line; + if ((p = strstr(p, "@HD")) != 0) { + ++n_HD; + } + // check for SQ lines + p = hdr_line; + while ((p = strstr(p, "@SQ\t")) != 0) { + if (p == hdr_line || *(p-1) == '\n') ++n_SQ; + p += 4; + } + } + if (n_SQ == 0) { + for (i = 0; i < bns->n_seqs; ++i) { + err_printf("@SQ\tSN:%s\tLN:%d", bns->anns[i].name, bns->anns[i].len); + if (bns->anns[i].is_alt) err_printf("\tAH:*\n"); + else err_fputc('\n', stdout); + } + } else if (n_SQ != bns->n_seqs && bwa_verbose >= 2) + fprintf(stderr, "[W::%s] %d @SQ lines provided with -H; %d sequences in the index. Continue anyway.\n", __func__, n_SQ, bns->n_seqs); + if (n_HD == 0) { + err_printf("@HD\tVN:1.5\tSO:unsorted\tGO:query\n"); + } + if (hdr_line) err_printf("%s\n", hdr_line); + if (bwa_pg) err_printf("%s\n", bwa_pg); +} + +static char *bwa_escape(char *s) +{ + char *p, *q; + for (p = q = s; *p; ++p) { + if (*p == '\\') { + ++p; + if (*p == 't') *q++ = '\t'; + else if (*p == 'n') *q++ = '\n'; + else if (*p == 'r') *q++ = '\r'; + else if (*p == '\\') *q++ = '\\'; + } else *q++ = *p; + } + *q = '\0'; + return s; +} + +char *bwa_set_rg(const char *s) +{ + char *p, *q, *r, *rg_line = 0; + memset(bwa_rg_id, 0, 256); + if (strstr(s, "@RG") != s) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] the read group line is not started with @RG\n", __func__); + goto err_set_rg; + } + if (strstr(s, "\t") != NULL) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] the read group line contained literal characters -- replace with escaped tabs: \\t\n", __func__); + goto err_set_rg; + } + rg_line = strdup(s); + bwa_escape(rg_line); + if ((p = strstr(rg_line, "\tID:")) == 0) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] no ID within the read group line\n", __func__); + goto err_set_rg; + } + p += 4; + for (q = p; *q && *q != '\t' && *q != '\n'; ++q); + if (q - p + 1 > 256) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] @RG:ID is longer than 255 characters\n", __func__); + goto err_set_rg; + } + for (q = p, r = bwa_rg_id; *q && *q != '\t' && *q != '\n'; ++q) + *r++ = *q; + return rg_line; + +err_set_rg: + free(rg_line); + return 0; +} + +char *bwa_insert_header(const char *s, char *hdr) +{ + int len = 0; + if (s == 0 || s[0] != '@') return hdr; + if (hdr) { + len = strlen(hdr); + hdr = realloc(hdr, len + strlen(s) + 2); + hdr[len++] = '\n'; + strcpy(hdr + len, s); + } else hdr = strdup(s); + bwa_escape(hdr + len); + return hdr; +} diff --git a/bwa.h b/bwa.h new file mode 100644 index 0000000..583423b --- /dev/null +++ b/bwa.h @@ -0,0 +1,125 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#ifndef BWA_H_ +#define BWA_H_ + +#include +#include "bntseq.h" +#include "kstring.h" +#include "bwt.h" +#include "fmt_idx.h" + +#define BWA_IDX_BWT 0x1 +#define BWA_IDX_BNS 0x2 +#define BWA_IDX_PAC 0x4 +#define BWA_IDX_FMT 0x8 +#define BWA_IDX_ALL 0xF + +#define BWA_CTL_SIZE 0x10000 + +#define BWTALGO_AUTO 0 +#define BWTALGO_RB2 1 +#define BWTALGO_BWTSW 2 +#define BWTALGO_IS 3 + +#define BWA_DBG_QNAME 0x1 + +typedef struct { + uint64_t *kmer_offsets; // ert kmer + uint8_t *mlt_table; // ert mlt + uint8_t *bref; // binary ref + uint64_t kmer_size; + uint64_t mlt_size; + uint64_t bref_size; +} ERT; + +typedef struct { + bwt_t *bwt; // FM-index + FMTIndex *fmt;// FMT-index + bntseq_t *bns; // information on the reference sequences + uint8_t *pac; // the actual 2-bit encoded reference sequences with 'N' converted to a random base + ERT *ert; + + int is_shm; + int64_t l_mem; + uint8_t *mem; +} bwaidx_t; + +typedef struct { + int l_seq, id; + int m_name, m_comment, m_seq, m_qual; + char *name, *comment, *seq, *qual; + kstring_t sam; +} bseq1_t; + +typedef struct { + kstring_t sam; +} seq_sam_t; + +extern int bwa_verbose, bwa_dbg; +extern char bwa_rg_id[256]; + +#ifdef __cplusplus +extern "C" { +#endif + + //bseq1_t *bseq_read(int chunk_size, int *n_, void *ks1_, void *ks2_); + void bseq_read(int chunk_size, int *n_, void *ks1_, void *ks2_, int copy_comment, int64_t *size_, int *m_, bseq1_t **seqs_ptr); + void bseq_classify(int n, bseq1_t *seqs, int m[2], bseq1_t *sep[2]); + + void bwa_fill_scmat(int a, int b, int8_t mat[25]); + uint32_t *bwa_gen_cigar(const int8_t mat[25], int q, int r, int w_, int64_t l_pac, const uint8_t *pac, int l_query, uint8_t *query, int64_t rb, int64_t re, int *score, int *n_cigar, int *NM); + uint32_t *bwa_gen_cigar2(const int8_t mat[25], int o_del, int e_del, int o_ins, int e_ins, int w_, int64_t l_pac, const uint8_t *pac, int l_query, uint8_t *query, int64_t rb, int64_t re, int *score, int *n_cigar, int *NM); + + int bwa_idx_build(const char *fa, const char *prefix, int algo_type, int block_size); + + char *bwa_idx_infer_prefix(const char *hint); + bwt_t *bwa_idx_load_bwt(const char *hint); + + bwaidx_t *bwa_idx_load_from_shm(const char *hint); + bwaidx_t *bwa_idx_load_from_disk(const char *hint, int which); + bwaidx_t *bwa_fmtidx_load_from_shm(const char *hint); + bwaidx_t *bwa_ertidx_load_from_shm(const char *hint); + bwaidx_t *bwa_ertidx_load_from_disk(const char *hint); + bwaidx_t *bwa_idx_load(const char *hint, int which); + void bwa_idx_destroy(bwaidx_t *idx); + int bwa_idx2mem(bwaidx_t *idx); + int bwa_fmtidx2mem(bwaidx_t *idx); + int bwa_ertidx2mem(bwaidx_t *idx); + int bwa_mem2idx(int64_t l_mem, uint8_t *mem, bwaidx_t *idx); + int bwa_mem2fmtidx(int64_t l_mem, uint8_t *mem, bwaidx_t *idx); + int bwa_mem2ertidx(int64_t l_mem, uint8_t *mem, bwaidx_t *idx); + + void bwa_print_sam_hdr(const bntseq_t *bns, const char *hdr_line); + char *bwa_set_rg(const char *s); + char *bwa_insert_header(const char *s, char *hdr); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bwakit/README.md b/bwakit/README.md new file mode 100644 index 0000000..b7a67ea --- /dev/null +++ b/bwakit/README.md @@ -0,0 +1,115 @@ +## Introduction + +Bwakit is a self-consistent installation-free package of scripts and precompiled +binaries, providing an end-to-end solution to read mapping. In addition to the +basic mapping functionality implemented in bwa, bwakit is able to generate +proper human reference genome and to take advantage of ALT contigs, if present, +to improve read mapping and to perform HLA typing for high-coverage human data. +It can remap name- or coordinate-sorted BAM with read group and barcode +information retained. Bwakit also *optionally* trims adapters (via +[trimadap][ta]), marks duplicates (via [samblaster][sb]) and sorts the final +alignment (via [samtools][smtl]). + +Bwakit has two entry scripts: `run-gen-ref` which downloads and generates human +reference genomes, and `run-bwamem` which prints mapping command lines on the +standard output that can be piped to `sh` to execute. The two scripts will call +other programs or use data in `bwa.kit`. The following shows an example about +how to use bwakit: + +```sh +# Download the bwa-0.7.11 binary package (download link may change) +wget -O- http://sourceforge.net/projects/bio-bwa/files/bwakit/bwakit-0.7.12_x64-linux.tar.bz2/download \ + | gzip -dc | tar xf - +# Generate the GRCh38+ALT+decoy+HLA and create the BWA index +bwa.kit/run-gen-ref hs38DH # download GRCh38 and write hs38DH.fa +bwa.kit/bwa index hs38DH.fa # create BWA index +# mapping +bwa.kit/run-bwamem -o out -H hs38DH.fa read1.fq read2.fq | sh +``` + +The last mapping command line will generate the following files: + +* `out.aln.bam`: unsorted alignments with ALT-aware mapping quality. In this + file, one read may be placed on multiple overlapping ALT contigs at the same + time even if the read is mapped better to some contigs than others. This makes + it possible to analyze each contig independent of others. + +* `out.hla.top`: best genotypes for HLA-A, -B, -C, -DQA1, -DQB1 and -DRB1 genes. + +* `out.hla.all`: other possible genotypes on the six HLA genes. + +* `out.log.*`: bwa-mem, samblaster and HLA typing log files. + +Bwakit can be [downloaded here][res]. It is only available to x86_64-linux. The +scripts in the package are available in the [bwa/bwakit][kit] directory. +Packaging is done manually for now. + +## Limitations + +* HLA typing only works for high-coverage human data. The typing accuracy can + still be improved. We encourage researchers to develop better HLA typing tools + based on the intermediate output of bwakit (for each HLA gene included in the + index, bwakit writes all reads matching it in a separate file). + +* Duplicate marking only works when all reads from a single paired-end library + are provided as the input. This limitation is the necessary tradeoff of fast + MarkDuplicate provided by samblaster. + +* The adapter trimmer is chosen as it is fast, pipe friendly and does not + discard reads. However, it is conservative and suboptimal. If this is a + concern, it is recommended to preprocess input reads with a more sophisticated + adapter trimmer. We also hope existing trimmers can be modified to operate on + an interleaved FASTQ stream. We will replace trimadap once a better trimmer + meets our needs. + +* Bwakit can be memory demanding depends on the functionality invoked. For 30X + human data, bwa-mem takes about 11GB RAM with 32 threads, samblaster uses + close to 10GB and BAM shuffling (if the input is sorted BAM) uses several GB. + In the current setting, sorting uses about 10GB. + + +## Package Contents +``` +bwa.kit +|-- README.md This README file. +|-- run-bwamem *Entry script* for the entire mapping pipeline. +|-- bwa *BWA binary* +|-- k8 Interpretor for *.js scripts. +|-- bwa-postalt.js Post-process alignments to ALT contigs/decoys/HLA genes. +|-- htsbox Used by run-bwamem for shuffling BAMs and BAM=>FASTQ. +|-- samblaster MarkDuplicates for reads from the same library. v0.1.20 +|-- samtools SAMtools for sorting and SAM=>BAM conversion. v1.1 +|-- seqtk For FASTQ manipulation. +|-- trimadap Trim Illumina PE sequencing adapters. +| +|-- run-gen-ref *Entry script* for generating human reference genomes. +|-- resource-GRCh38 Resources for generating GRCh38 +| |-- hs38DH-extra.fa Decoy and HLA gene sequences. Used by run-gen-ref. +| `-- hs38DH.fa.alt ALT-to-GRCh38 alignment. Used by run-gen-ref. +| +|-- run-HLA HLA typing for sequences extracted by bwa-postalt.js. +|-- typeHLA.sh Type one HLA-gene. Called by run-HLA. +|-- typeHLA.js HLA typing from exon-to-contig alignment. Used by typeHLA.sh. +|-- typeHLA-selctg.js Select contigs overlapping HLA exons. Used by typeHLA.sh. +|-- fermi2.pl Fermi2 wrapper. Used by typeHLA.sh for de novo assembly. +|-- fermi2 Fermi2 binary. Used by fermi2.pl. +|-- ropebwt2 RopeBWT2 binary. Used by fermi2.pl. +|-- resource-human-HLA Resources for HLA typing +| |-- HLA-ALT-exons.bed Exonic regions of HLA ALT contigs. Used by typeHLA.sh. +| |-- HLA-CDS.fa CDS of HLA-{A,B,C,DQA1,DQB1,DRB1} genes from IMGT/HLA-3.18.0. +| |-- HLA-ALT-type.txt HLA types for each HLA ALT contig. Not used. +| `-- HLA-ALT-idx BWA indices of each HLA ALT contig. Used by typeHLA.sh +| `-- (...) +| +`-- doc BWA documentations + |-- bwa.1 Manpage + |-- NEWS.md Release Notes + |-- README.md GitHub README page + `-- README-alt.md Documentation for ALT mapping +``` + +[res]: https://sourceforge.net/projects/bio-bwa/files/bwakit +[sb]: https://github.com/GregoryFaust/samblaster +[ta]: https://github.com/lh3/seqtk/blob/master/trimadap.c +[smtl]: http://www.htslib.org +[kit]: https://github.com/lh3/bwa/tree/master/bwakit diff --git a/bwakit/bwa-postalt.js b/bwakit/bwa-postalt.js new file mode 100644 index 0000000..e00d3dc --- /dev/null +++ b/bwakit/bwa-postalt.js @@ -0,0 +1,524 @@ +/***************************************************************** + * The K8 Javascript interpreter is required to run this script. * + * * + * Source code: https://github.com/attractivechaos/k8 * + * Binary: http://sourceforge.net/projects/lh3/files/k8/ * + * * + * Data file used for generating GRCh38 ALT alignments: * + * * + * http://sourceforge.net/projects/bio-bwa/files/ * + *****************************************************************/ + +/****************** + *** From k8.js *** + ******************/ + +// Parse command-line options. A BSD getopt() clone in javascript. +var getopt = function(args, ostr) { + var oli; // option letter list index + if (typeof(getopt.place) == 'undefined') + getopt.ind = 0, getopt.arg = null, getopt.place = -1; + if (getopt.place == -1) { // update scanning pointer + if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') { + getopt.place = -1; + return null; + } + if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--" + ++getopt.ind; + getopt.place = -1; + return null; + } + } + var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity + if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) { + if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null. + if (getopt.place < 0) ++getopt.ind; + return '?'; + } + if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument + getopt.arg = null; + if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1; + } else { // need an argument + if (getopt.place >= 0 && getopt.place < args[getopt.ind].length) + getopt.arg = args[getopt.ind].substr(getopt.place); + else if (args.length <= ++getopt.ind) { // no arg + getopt.place = -1; + if (ostr.length > 0 && ostr.charAt(0) == ':') return ':'; + return '?'; + } else getopt.arg = args[getopt.ind]; // white space + getopt.place = -1; + ++getopt.ind; + } + return optopt; +} + +// reverse a string +Bytes.prototype.reverse = function() +{ + for (var i = 0; i < this.length>>1; ++i) { + var tmp = this[i]; + this[i] = this[this.length - i - 1]; + this[this.length - i - 1] = tmp; + } +} + +// reverse complement a DNA string +Bytes.prototype.revcomp = function() +{ + if (Bytes.rctab == null) { + var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn'; + var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn'; + Bytes.rctab = []; + for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0; + for (var i = 0; i < s1.length; ++i) + Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i); + } + for (var i = 0; i < this.length>>1; ++i) { + var tmp = this[this.length - i - 1]; + this[this.length - i - 1] = Bytes.rctab[this[i]]; + this[i] = Bytes.rctab[tmp]; + } + if (this.length&1) + this[this.length>>1] = Bytes.rctab[this[this.length>>1]]; +} + +// create index for a list of intervals for fast interval queries; ported from bedidx.c in samtools +function intv_ovlp(intv, bits) +{ + if (typeof bits == "undefined") bits = 13; + intv.sort(function(a,b) {return a[0]-b[0];}); + // create the index + var idx = [], max = 0; + for (var i = 0; i < intv.length; ++i) { + var b = intv[i][0]>>bits; + var e = (intv[i][1]-1)>>bits; + if (b != e) { + for (var j = b; j <= e; ++j) + if (idx[j] == null) idx[j] = i; + } else if (idx[b] == null) idx[b] = i; + max = max > e? max : e; + } + // closure + return function(_b, _e) { + var x = _b >> bits; + if (x > max) return []; + var off = idx[x]; + if (off == null) { + var i; + for (i = ((_e - 1) >> bits) - 1; i >= 0; --i) + if (idx[i] != null) break; + off = i < 0? 0 : idx[i]; + } + var ovlp = []; + for (var i = off; i < intv.length && intv[i][0] < _e; ++i) + if (intv[i][1] > _b) ovlp.push(intv[i]); + return ovlp; + } +} + +var re_cigar = /(\d+)([MIDSHN])/g; + +/****************************** + *** Generate ALT alignment *** + ******************************/ + +// given a pos on ALT and the ALT-to-REF CIGAR, find the pos on REF +function cigar2pos(cigar, pos) +{ + var x = 0, y = 0; + for (var i = 0; i < cigar.length; ++i) { + var op = cigar[i][0], len = cigar[i][1]; + if (op == 'M') { + if (y <= pos && pos < y + len) + return x + (pos - y); + x += len, y += len; + } else if (op == 'D') { + x += len; + } else if (op == 'I') { + if (y <= pos && pos < y + len) + return x; + y += len; + } else if (op == 'S' || op == 'H') { + if (y <= pos && pos < y + len) + return -1; + y += len; + } + } + return -1; +} + +// Parse a hit. $s is an array that looks something like ["chr1", "+12345", "100M", 5] +// Return an object keeping various information about the alignment. +function parse_hit(s, opt) +{ + var h = {}; + h.ctg = s[0]; + h.start = parseInt(s[1].substr(1)) - 1; + h.rev = (s[1].charAt(0) == '-'); + h.cigar = s[2]; + h.NM = parseInt(s[3]); + h.hard = false; + var m, l_ins, n_ins, l_del, n_del, l_match, l_skip, l_clip; + l_ins = l_del = n_ins = n_del = l_match = l_skip = l_clip = 0; + while ((m = re_cigar.exec(h.cigar)) != null) { + var l = parseInt(m[1]); + if (m[2] == 'M') l_match += l; + else if (m[2] == 'D') ++n_del, l_del += l; + else if (m[2] == 'I') ++n_ins, l_ins += l; + else if (m[2] == 'N') l_skip += l; + else if (m[2] == 'H' || m[2] == 'S') { + l_clip += l; + if (m[2] == 'H') h.hard = true; + } + } + h.end = h.start + l_match + l_del + l_skip; + h.NM = h.NM > l_del + l_ins? h.NM : l_del + l_ins; + h.score = Math.floor((opt.a * l_match - (opt.a + opt.b) * (h.NM - l_del - l_ins) - opt.o * (n_del + n_ins) - opt.e * (l_del + l_ins)) / opt.a + .499); + h.l_query = l_match + l_ins + l_clip; + return h; +} + +function print_buffer(buf2, fp_hla, hla) // output alignments +{ + if (buf2.length == 0) return; + for (var i = 0; i < buf2.length; ++i) + print(buf2[i].join("\t")); + if (fp_hla != null) { + var name = buf2[0][0] + '/' + (buf2[0][1]>>6&3) + ((buf2[0][1]&16)? '-' : '+'); + for (var x in hla) { + if (fp_hla[x] != null); + fp_hla[x].write('@' + name + '\n' + buf2[0][9] + '\n+\n' + buf2[0][10] + '\n'); + } + } +} + +function collect_hla_hits(idx, ctg, start, end, hla) // collect reads hit to HLA genes +{ + var m, ofunc = idx[ctg]; + if (ofunc == null) return; + var ovlp_alt = ofunc(start, end); + for (var i = 0; i < ovlp_alt.length; ++i) + if ((m = /^(HLA-[^\s\*]+)\*\d+/.exec(ovlp_alt[i][2])) != null) + hla[m[1]] = true; +} + +function bwa_postalt(args) +{ + var version = "r985"; + var c, opt = { a:1, b:4, o:6, e:1, min_mapq:10, min_sc:90, max_nm_sc:10, min_pa_ratio:1 }; + + while ((c = getopt(args, 'vp:r:')) != null) { + if (c == 'p') opt.pre = getopt.arg; + else if (c == 'r') opt.min_pa_ratio = parseFloat(getopt.arg); + else if (c == 'v') { print(version); exit(0); } + } + if (opt.min_pa_ratio > 1.) opt.min_pa_ratio = 1.; + + if (args.length == getopt.ind) { + print(""); + print("Usage: k8 bwa-postalt.js [options] [aln.sam]\n"); + print("Options: -p STR prefix of output files containting sequences matching HLA genes [null]"); + print(" -r FLOAT reduce mapQ to 0 if not overlapping lifted best and pa= 0) { + var line = buf.toString(); + if (line.charAt(0) == '@') continue; + var t = line.split("\t"); + if (t.length < 11) continue; // incomplete lines + is_alt[t[0]] = true; + var pos = parseInt(t[3]) - 1; + var flag = parseInt(t[1]); + if ((flag&4) || t[2] == '*') continue; + var m, cigar = [], l_qaln = 0, l_tlen = 0, l_qclip = 0; + if ((m = /^(HLA-[^\s\*]+)\*\d+/.exec(t[0])) != null) { // read HLA contigs + if (hla_ctg[m[1]] == null) hla_ctg[m[1]] = 0; + ++hla_ctg[m[1]]; + hla_chr = t[2]; + } + while ((m = re_cigar.exec(t[5])) != null) { + var l = parseInt(m[1]); + cigar.push([m[2] != 'H'? m[2] : 'S', l]); // convert hard clip to soft clip + if (m[2] == 'M') l_qaln += l, l_tlen += l; + else if (m[2] == 'I') l_qaln += l; + else if (m[2] == 'S' || m[2] == 'H') l_qclip += l; + else if (m[2] == 'D' || m[2] == 'N') l_tlen += l; + } + var j = flag&16? cigar.length-1 : 0; + var start = cigar[j][0] == 'S'? cigar[j][1] : 0; + if (intv_alt[t[0]] == null) intv_alt[t[0]] = []; + intv_alt[t[0]].push([start, start + l_qaln, l_qaln + l_qclip, t[2], flag&16? true : false, pos - 1, cigar, pos + l_tlen]); + if (intv_pri[t[2]] == null) intv_pri[t[2]] = []; + intv_pri[t[2]].push([pos, pos + l_tlen, t[0]]); + } + file.close(); + var idx_alt = {}, idx_pri = {}; + for (var ctg in intv_alt) idx_alt[ctg] = intv_ovlp(intv_alt[ctg]); + for (var ctg in intv_pri) idx_pri[ctg] = intv_ovlp(intv_pri[ctg]); + + // initialize the list of HLA contigs + var fp_hla = null; + if (opt.pre) { + fp_hla = {}; + for (var h in hla_ctg) + fp_hla[h] = new File(opt.pre + '.' + h + '.fq', "w"); + } + + // process SAM + var buf2 = [], hla = {}; + file = args.length - getopt.ind >= 2? new File(args[getopt.ind+1]) : new File(); + while (file.readline(buf) > 0) { + var m, line = buf.toString(); + + if (line.charAt(0) == '@') { // print and then skip the header line + print(line); + continue; + } + + var t = line.split("\t"); + t[1] = parseInt(t[1]); t[3] = parseInt(t[3]); t[4] = parseInt(t[4]); + + // print bufferred reads + if (buf2.length && (buf2[0][0] != t[0] || (buf2[0][1]&0xc0) != (t[1]&0xc0))) { + print_buffer(buf2, fp_hla, hla); + buf2 = [], hla = {}; + } + + // skip unmapped lines + if (t[1]&4) { + buf2.push(t); + continue; + } + + // parse the reported hit + var NM = (m = /\tNM:i:(\d+)/.exec(line)) == null? '0' : m[1]; + var flag = t[1]; + var h = parse_hit([t[2], ((flag&16)?'-':'+') + t[3], t[5], NM], opt); + if (t[2] == hla_chr) collect_hla_hits(idx_pri, h.ctg, h.start, h.end, hla); + + if (h.hard) { // the following does not work with hard clipped alignments + buf2.push(t); + continue; + } + var hits = [h]; + + // parse hits in the XA tag + if ((m = /\tXA:Z:(\S+)/.exec(line)) != null) { + var XA_strs = m[1].split(";"); + for (var i = 0; i < XA_strs.length; ++i) + if (XA_strs[i] != '') // as the last symbol in an XA tag is ";", the last split is an empty string + hits.push(parse_hit(XA_strs[i].split(","), opt)); + } + + // check if there are ALT hits + var has_alt = false; + for (var i = 0; i < hits.length; ++i) + if (is_alt[hits[i].ctg] != null) { + has_alt = true; + break; + } + if (!has_alt) { + buf2.push(t); + continue; + } + + // lift mapping positions to the primary assembly + var n_rpt_lifted = 0, rpt_lifted = null; + for (var i = 0; i < hits.length; ++i) { + var a, h = hits[i]; + + if (idx_alt[h.ctg] == null || (a = idx_alt[h.ctg](h.start, h.end)) == null || a.length == 0) + continue; + + // find the approximate position on the primary assembly + var lifted = []; + for (var j = 0; j < a.length; ++j) { + var s, e; + if (!a[j][4]) { // ALT is mapped to the forward strand of the primary assembly + s = cigar2pos(a[j][6], h.start); + e = cigar2pos(a[j][6], h.end - 1) + 1; + } else { + s = cigar2pos(a[j][6], a[j][2] - h.end); + e = cigar2pos(a[j][6], a[j][2] - h.start - 1) + 1; + } + if (s < 0 || e < 0) continue; // read is mapped to clippings in the ALT-to-chr alignment + s += a[j][5]; e += a[j][5]; + lifted.push([a[j][3], (h.rev!=a[j][4]), s, e]); + if (i == 0) ++n_rpt_lifted; + } + if (i == 0 && n_rpt_lifted == 1) rpt_lifted = lifted[0].slice(0); + if (lifted.length) hits[i].lifted = lifted; + } + + // prepare for hits grouping + for (var i = 0; i < hits.length; ++i) { // set keys for sorting + if (hits[i].lifted != null) // TODO: only the first element in lifted[] is used + hits[i].pctg = hits[i].lifted[0][0], hits[i].pstart = hits[i].lifted[0][2], hits[i].pend = hits[i].lifted[0][3]; + else hits[i].pctg = hits[i].ctg, hits[i].pstart = hits[i].start, hits[i].pend = hits[i].end; + hits[i].i = i; // keep the original index + } + + // group hits based on the lifted positions on non-ALT sequences + if (hits.length > 1) { + hits.sort(function(a,b) { return a.pctg != b.pctg? (a.pctg < b.pctg? -1 : 1) : a.pstart - b.pstart }); + var last_chr = null, end = 0, g = -1; + for (var i = 0; i < hits.length; ++i) { + if (last_chr != hits[i].pctg) ++g, last_chr = hits[i].pctg, end = 0; + else if (hits[i].pstart >= end) ++g; + hits[i].g = g; + end = end > hits[i].pend? end : hits[i].pend; + } + } else hits[0].g = 0; + + // find the index and group id of the reported hit; find the size of the reported group + var reported_g = null, reported_i = null, n_group0 = 0; + if (hits.length > 1) { + for (var i = 0; i < hits.length; ++i) + if (hits[i].i == 0) + reported_g = hits[i].g, reported_i = i; + for (var i = 0; i < hits.length; ++i) + if (hits[i].g == reported_g) + ++n_group0; + } else { + if (is_alt[hits[0].ctg] == null) { // no need to go through the following if the single hit is non-ALT + buf2.push(t); + continue; + } + reported_g = reported_i = 0, n_group0 = 1; + } + + // re-estimate mapping quality if necessary + var mapQ, ori_mapQ = t[4]; + if (n_group0 > 1) { + var group_max = []; + for (var i = 0; i < hits.length; ++i) { + var g = hits[i].g; + if (group_max[g] == null || group_max[g][0] < hits[i].score) + group_max[g] = [hits[i].score, g]; + } + if (group_max.length > 1) + group_max.sort(function(x,y) {return y[0]-x[0]}); + if (group_max[0][1] == reported_g) { // the best hit is the hit reported in SAM + mapQ = group_max.length == 1? 60 : 6 * (group_max[0][0] - group_max[1][0]); + } else mapQ = 0; + mapQ = mapQ < 60? mapQ : 60; + if (idx_alt[t[2]] == null) mapQ = mapQ < ori_mapQ? mapQ : ori_mapQ; + else mapQ = mapQ > ori_mapQ? mapQ : ori_mapQ; + } else mapQ = t[4]; + + // find out whether the read is overlapping HLA genes + if (hits[reported_i].pctg == hla_chr) { + var rpt_start = 1<<30, rpt_end = 0; + for (var i = 0; i < hits.length; ++i) { + var h = hits[i]; + if (h.g == reported_g) { + rpt_start = rpt_start < h.pstart? rpt_start : h.pstart; + rpt_end = rpt_end > h.pend ? rpt_end : h.pend; + } + } + collect_hla_hits(idx_pri, hla_chr, rpt_start, rpt_end, hla); + } + + // adjust the mapQ of the primary hits + if (n_rpt_lifted <= 1) { + var l = n_rpt_lifted == 1? rpt_lifted : null; + for (var i = 0; i < buf2.length; ++i) { + var s = buf2[i], is_ovlp = true; + if (l != null) { + if (l[0] != s[2]) is_ovlp = false; // different chr + else if (((s[1]&16) != 0) != l[1]) is_ovlp = false; // different strand + else { + var start = s[3] - 1, end = start; + while ((m = re_cigar.exec(t[5])) != null) + if (m[2] == 'M' || m[2] == 'D' || m[2] == 'N') + end += parseInt(m[1]); + if (!(start < l[3] && l[2] < end)) is_ovlp = false; // no overlap + } + } else is_ovlp = false; + // get the "pa" tag if present + var om = -1, pa = 10.; + for (var j = 11; j < s.length; ++j) + if ((m = /^om:i:(\d+)/.exec(s[j])) != null) + om = parseInt(m[1]); + else if ((m = /^pa:f:(\S+)/.exec(s[j])) != null) + pa = parseFloat(m[1]); + if (is_ovlp) { // overlapping the lifted hit + if (om > 0) s[4] = om; + s[4] = s[4] < mapQ? s[4] : mapQ; + } else if (pa < opt.min_pa_ratio) { // not overlapping; has a small pa + if (om < 0) s.push("om:i:" + s[4]); + s[4] = 0; + } + } + } + + // generate lifted_str + for (var i = 0; i < hits.length; ++i) { + if (hits[i].lifted && hits[i].lifted.length) { + var u = '', lifted = hits[i].lifted; + for (var j = 0; j < lifted.length; ++j) + u += lifted[j][0] + "," + lifted[j][2] + "," + lifted[j][3] + "," + (lifted[j][1]?'-':'+') + ";"; + hits[i].lifted_str = u; + } + } + + // stage the reported hit + t[4] = mapQ; + if (n_group0 > 1) t.push("om:i:"+ori_mapQ); + if (hits[reported_i].lifted_str) t.push("lt:Z:" + hits[reported_i].lifted_str); + buf2.push(t); + + // stage the hits generated from the XA tag + var cnt = 0, rs = null, rq = null; // rq: reverse quality; rs: reverse complement sequence + var rg = (m = /\t(RG:Z:\S+)/.exec(line)) != null? m[1] : null; + for (var i = 0; i < hits.length; ++i) { + if (hits[i].g != reported_g || i == reported_i) continue; + if (idx_alt[hits[i].ctg] == null) continue; + var s = [t[0], 0, hits[i].ctg, hits[i].start+1, mapQ, hits[i].cigar, t[6], t[7], t[8]]; + if (t[6] == '=' && s[2] != t[2]) s[6] = t[2]; + // print sequence/quality and set the rev flag + if (hits[i].rev == hits[reported_i].rev) { + s.push(t[9], t[10]); + s[1] = flag | 0x800; + } else { // we need to write the reverse sequence + if (rs == null || rq == null) { + aux.length = 0; + aux.set(t[9], 0); aux.revcomp(); rs = aux.toString(); + aux.set(t[10],0); aux.reverse(); rq = aux.toString(); + } + s.push(rs, rq); + s[1] = (flag ^ 0x10) | 0x800; + } + s.push("NM:i:" + hits[i].NM); + if (hits[i].lifted_str) s.push("lt:Z:" + hits[i].lifted_str); + if (rg != null) s.push(rg); + buf2.push(s); + } + } + print_buffer(buf2, fp_hla, hla); + file.close(); + if (fp_hla != null) + for (var h in fp_hla) + fp_hla[h].close(); + + buf.destroy(); + aux.destroy(); +} + +bwa_postalt(arguments); diff --git a/bwakit/run-HLA b/bwakit/run-HLA new file mode 100755 index 0000000..4fee16f --- /dev/null +++ b/bwakit/run-HLA @@ -0,0 +1,20 @@ +#!/bin/bash + +ctg_opt="" +if [ $# -gt 1 ] && [ $1 == '-A' ]; then + ctg_opt="-A" + shift +fi + +if [ $# -eq 0 ]; then + echo "Usage: $0 " + exit 1 +fi + +for f in $1.HLA-*.fq; do + gene=`echo $f | perl -pe 's/^.*(HLA-[A-Z]+[0-9]*).*fq$/$1/'` + echo -e "\n*** Processing gene $gene...\n" >&2 + `dirname $0`/typeHLA.sh $ctg_opt $1 $gene +done + +ls $1.HLA-*.gt | xargs -i echo grep ^GT {} \| head -1 | sh | sed "s,^GT,$1," diff --git a/bwakit/run-bwamem b/bwakit/run-bwamem new file mode 100755 index 0000000..4c0e8d0 --- /dev/null +++ b/bwakit/run-bwamem @@ -0,0 +1,187 @@ +#!/usr/bin/env perl + +use strict; +use warnings; +use Getopt::Std; + +my %opts = (t=>1); +getopts("MPSadskHo:R:x:t:", \%opts); + +die(' +Usage: run-bwamem [options] [file2] + +Options: -o STR prefix for output files [inferred from input] + -R STR read group header line such as \'@RG\tID:foo\tSM:bar\' [null] + -x STR read type: pacbio, ont2d or intractg [default] + intractg: intra-species contig (kb query, highly similar) + pacbio: pacbio subreads (~10kb query, high error rate) + ont2d: Oxford Nanopore reads (~10kb query, higher error rate) + -t INT number of threads [1] + + -H apply HLA typing + -a trim HiSeq2000/2500 PE resequencing adapters (via trimadap) + -d mark duplicate (via samblaster) + -S for BAM input, don\'t shuffle + -s sort the output alignment (via samtools; requring more RAM) + -k keep temporary files generated by typeHLA + -M mark shorter split hits as secondary + +Examples: + + * Map paired-end reads to GRCh38+ALT+decoy+HLA and perform HLA typing: + + run-bwamem -o prefix -t8 -HR"@RG\tID:foo\tSM:bar" hs38DH.fa read1.fq.gz read2.fq.gz + + Note: HLA typing is only effective for high-coverage data. The typing accuracy varies + with the quality of input. It is only intended for research purpose, not for diagnostic. + + * Remap coordinate-sorted BAM, transfer read groups tags, trim Illumina PE adapters and + sort the output. The BAM may contain single-end or paired-end reads, or a mixture of + the two types. Specifying -R stops read group transfer. + + run-bwamem -sao prefix hs38DH.fa old-srt.bam + + Note: the adaptor trimmer included in bwa.kit is chosen because it fits the current + mapping pipeline better. It is conservative and suboptimal. A more sophisticated + trimmer is recommended if this becomes a concern. + + * Remap name-grouped BAM and mark duplicates: + + run-bwamem -Sdo prefix hs38DH.fa old-unsrt.bam + + Note: streamed duplicate marking requires all reads from a single paired-end library + to be aligned at the same time. + +Output files: + + {-o}.aln.bam - final alignment + {-o}.hla.top - best genotypes for the 6 classical HLA genes (if there are HLA-* contigs) + {-o}.hla.all - additional HLA genotypes consistent with data + {-o}.log.* - log files + +') if @ARGV < 2; + +my $idx = $ARGV[0]; + +my $exepath = $0 =~/^\S+\/[^\/\s]+/? $0 : &which($0); +my $root = $0 =~/^(\S+)\/[^\/\s]+/? $1 : undef; +$root = $exepath =~/^(\S+)\/[^\/\s]+/? $1 : undef if !defined($root); +die "ERROR: failed to locate the 'bwa.kit' directory\n" if !defined($root); + +die("ERROR: failed to locate the BWA index. Please run '$root/bwa index -p $idx ref.fa'.\n") + unless (-f "$idx.bwt" && -f "$idx.pac" && -f "$idx.sa" && -f "$idx.ann" && -f "$idx.amb"); + +if (@ARGV >= 3 && $ARGV[1] =~ /\.(bam|sam|sam\.gz)$/) { + warn("WARNING: for SAM/BAM input, only the first sequence file is used.\n"); + @ARGV = 2; +} + +if (defined($opts{p}) && @ARGV >= 3) { + warn("WARNING: option -P is ignored as there are two input sequence files.\n"); + delete $opts{p}; +} + +my $prefix; +if (defined $opts{o}) { + $prefix = $opts{o}; +} elsif (@ARGV >= 3) { + my $len = length($ARGV[1]) < length($ARGV[2])? length($ARGV[1]) : length($ARGV[2]); + my $i; + for ($i = 0; $i < $len; ++$i) { + last if substr($ARGV[1], $i, 1) ne substr($ARGV[2], $i, 1) + } + $prefix = substr($ARGV[1], 0, $i) if $i > 0; +} elsif ($ARGV[1] =~ /^(\S+)\.(fastq|fq|fasta|fa|mag|mag\.gz|fasta\.gz|fa\.gz|fastq\.gz|fq\.gz|bam)$/) { + $prefix = $1; +} +die("ERROR: failed to identify the prefix for output. Please specify -o.\n") unless defined($prefix); + +my $size = 0; +my $comp_ratio = 3.; +for my $f (@ARGV[1..$#ARGV]) { + my @a = stat($f); + my $s = $a[7]; + die("ERROR: failed to read file $f\n") if !defined($s); + $s *= $comp_ratio if $f =~ /\.(gz|bam)$/; + $size += int($s) + 1; +} + +my $is_pe = (defined($opts{p}) || @ARGV >= 3)? 1 : 0; +my $is_bam = $ARGV[1] =~ /\.bam$/? 1 : 0; + +if (defined($opts{x})) { + delete($opts{d}); delete($opts{a}); delete $opts{p}; +} + +# for BAM input, find @RG header lines +my @RG_lines = (); +if ($is_bam && !defined($opts{R})) { + my $fh; + open($fh, "$root/samtools view -H $ARGV[1] |") || die; + while (<$fh>) { + chomp; + if (/^\@RG\t/) { + s/\t/\\t/g; + push(@RG_lines, "-H'$_'"); + } + } + close($fh); +} + +warn("WARNING: many programs require read groups. Please specify with -R if you can.\n") if !defined($opts{R}) && @RG_lines == 0; + +my $cmd = ''; +if ($is_bam) { + my $cmd_sam2bam = "cat $ARGV[1] \\\n"; + my $ntmps = int($size / 4e9) + 1; + my $cmd_shuf = !defined($opts{S})? " | $root/htsbox bamshuf -uOn$ntmps - $prefix.shuf \\\n" : ""; + my $bam2fq_opt = @RG_lines > 0? " -t" : ""; + my $cmd_bam2fq = " | $root/htsbox bam2fq -O$bam2fq_opt - \\\n"; + $cmd = $cmd_sam2bam . $cmd_shuf . $cmd_bam2fq; +} elsif (@ARGV >= 3) { + $cmd = "$root/seqtk mergepe $ARGV[1] $ARGV[2] \\\n"; +} else { + $cmd = "cat $ARGV[1] \\\n"; +} + +my $bwa_opts = "-p " . ($opts{t} > 1? "-t$opts{t} " : "") . (defined($opts{x})? "-x $opts{x} " : "") . (defined($opts{R})? "-R'$opts{R}' " : "") . (defined($opts{M})? "-M " : ""); +$bwa_opts .= join(" ", @RG_lines) . " -C " if @RG_lines > 0; + +$cmd .= " | $root/trimadap 2> $prefix.log.trim \\\n" if defined($opts{a}); +$cmd .= " | $root/bwa mem $bwa_opts$ARGV[0] - 2> $prefix.log.bwamem \\\n"; +$cmd .= " | $root/samblaster 2> $prefix.log.dedup \\\n" if defined($opts{d}); + +my $has_hla = 0; +if (-f "$ARGV[0].alt" && !defined($opts{P})) { + my $fh; + open($fh, "$ARGV[0].alt") || die; + while (<$fh>) { + $has_hla = 1 if /^HLA-[^\s\*]+\*\d+/; + } + close($fh); + my $hla_pre = $has_hla? "-p $prefix.hla " : ""; + $cmd .= " | $root/k8 $root/bwa-postalt.js $hla_pre$ARGV[0].alt \\\n"; +} + +my $t_sort = $opts{t} < 4? $opts{t} : 4; +$cmd .= defined($opts{s})? " | $root/samtools sort -@ $t_sort -m1G - -o $prefix.aln.bam;\n" : " | $root/samtools view -1 - > $prefix.aln.bam;\n"; + +if ($has_hla && defined($opts{H}) && (!defined($opts{x}) || $opts{x} eq 'intractg')) { + $cmd .= "$root/run-HLA ". (defined($opts{x}) && $opts{x} eq 'intractg'? "-A " : "") . "$prefix.hla > $prefix.hla.top 2> $prefix.log.hla;\n"; + $cmd .= "touch $prefix.hla.HLA-dummy.gt; cat $prefix.hla.HLA*.gt | grep ^GT | cut -f2- > $prefix.hla.all;\n"; + $cmd .= "rm -f $prefix.hla.HLA*;\n" unless defined($opts{k}); +} + +print $cmd; + +sub which +{ + my $file = shift; + my $path = (@_)? shift : $ENV{PATH}; + return if (!defined($path)); + foreach my $x (split(":", $path)) { + $x =~ s/\/$//; + return "$x/$file" if (-x "$x/$file"); + } + return; +} diff --git a/bwakit/run-gen-ref b/bwakit/run-gen-ref new file mode 100755 index 0000000..58fab68 --- /dev/null +++ b/bwakit/run-gen-ref @@ -0,0 +1,39 @@ +#!/bin/bash + +root=`dirname $0` + +url38="ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_full_analysis_set.fna.gz" +url37d5="ftp://ftp.ncbi.nlm.nih.gov/1000genomes/ftp/technical/reference/phase2_reference_assembly_sequence/hs37d5.fa.gz" + +if [ $# -eq 0 ]; then + echo "Usage: $0 " + echo "Analysis sets:" + echo " hs38 primary assembly of GRCh38 (incl. chromosomes, unplaced and unlocalized contigs) and EBV" + echo " hs38a hs38 plus ALT contigs" + echo " hs38DH hs38a plus decoy contigs and HLA genes (recommended for GRCh38 mapping)" + echo " hs37 primary assembly of GRCh37 (used by 1000g phase 1) plus the EBV genome" + echo " hs37d5 hs37 plus decoy contigs (used by 1000g phase 3)" + echo "" + echo "Note: This script downloads human reference genomes. For hs38a and hs38DH, it needs additional" + echo " sequences and ALT-to-REF mapping included in the bwa.kit package." + exit 1; +fi + +if [ $1 == "hs38DH" ]; then + (wget -O- $url38 | gzip -dc; cat $root/resource-GRCh38/hs38DH-extra.fa) > $1.fa + [ ! -f $1.fa.alt ] && cp $root/resource-GRCh38/hs38DH.fa.alt $1.fa.alt +elif [ $1 == "hs38a" ]; then + wget -O- $url38 | gzip -dc > $1.fa + [ ! -f $1.fa.alt ] && grep _alt $root/resource-GRCh38/hs38DH.fa.alt > $1.fa.alt +elif [ $1 == "hs38" ]; then + wget -O- $url38 | gzip -dc | awk '/^>/{f=/_alt/?0:1}f' > $1.fa +elif [ $1 == "hs37d5" ]; then + wget -O- $url37d5 | gzip -dc > $1.fa 2>/dev/null +elif [ $1 == "hs37" ]; then + wget -O- $url37d5 | gzip -dc 2>/dev/null | awk '/^>/{f=/>hs37d5/?0:1}f' > $1.fa +else + echo "ERROR: unknown genome build" +fi + +[ ! -f $1.fa.bwt ] && echo -e "\nPlease run 'bwa index $1.fa'...\n" + diff --git a/bwakit/typeHLA-selctg.js b/bwakit/typeHLA-selctg.js new file mode 100644 index 0000000..0e02a65 --- /dev/null +++ b/bwakit/typeHLA-selctg.js @@ -0,0 +1,62 @@ +var min_ovlp = 30; + +if (arguments.length < 3) { + print("Usage: k8 selctg.js [min_ovlp="+min_ovlp+"]"); + exit(1); +} + +if (arguments.length >= 4) min_ovlp = parseInt(arguments[3]); +var gene = arguments[0]; + +var buf = new Bytes(); + +var h = {}; +var file = new File(arguments[1]); +while (file.readline(buf) >= 0) { + var t = buf.toString().split("\t"); + if (t[3] != gene) continue; + if (h[t[0]] == null) h[t[0]] = []; + h[t[0]].push([parseInt(t[1]), parseInt(t[2])]); +} +file.close(); + +var s = {}, re = /(\d+)([MIDSHN])/g; +file = new File(arguments[2]); +while (file.readline(buf) >= 0) { + var line = buf.toString(); + var m, t = line.split("\t"); + var x = h[t[2]]; + if (x == null) continue; + + var start = parseInt(t[3]) - 1, end = start; + while ((m = re.exec(t[5])) != null) // parse CIGAR to get the end position + if (m[2] == 'M' || m[2] == 'D') + end += parseInt(m[1]); + + var max_ovlp = 0; + for (var i = 0; i < x.length; ++i) { + var max_left = x[i][0] > start? x[i][0] : start; + var min_rght = x[i][1] < end ? x[i][1] : end; + max_ovlp = max_ovlp > min_rght - max_left? max_ovlp : min_rght - max_left; + } + + var AS = null, XS = null; + if ((m = /AS:i:(\d+)/.exec(line)) != null) AS = parseInt(m[1]); + if ((m = /XS:i:(\d+)/.exec(line)) != null) XS = parseInt(m[1]); + + if (s[t[0]] == null) s[t[0]] = []; + s[t[0]].push([AS, XS, max_ovlp]); +} +file.close(); + +buf.destroy(); + +for (var x in s) { + var is_rejected = false, y = s[x]; + y.sort(function(a,b) {return b[0]-a[0]}); + for (var i = 0; i < y.length && y[i][0] == y[0][0]; ++i) + if (y[0][2] < min_ovlp || y[i][0] == y[i][1]) + is_rejected = true; + if (is_rejected) continue; + print(x); +} diff --git a/bwakit/typeHLA.js b/bwakit/typeHLA.js new file mode 100644 index 0000000..b265d07 --- /dev/null +++ b/bwakit/typeHLA.js @@ -0,0 +1,496 @@ +/***************************************************************** + * The K8 Javascript interpreter is required to run this script. * + * * + * Source code: https://github.com/attractivechaos/k8 * + * Binary: http://sourceforge.net/projects/lh3/files/k8/ * + *****************************************************************/ + +var getopt = function(args, ostr) { + var oli; // option letter list index + if (typeof(getopt.place) == 'undefined') + getopt.ind = 0, getopt.arg = null, getopt.place = -1; + if (getopt.place == -1) { // update scanning pointer + if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') { + getopt.place = -1; + return null; + } + if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--" + ++getopt.ind; + getopt.place = -1; + return null; + } + } + var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity + if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) { + if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null. + if (getopt.place < 0) ++getopt.ind; + return '?'; + } + if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument + getopt.arg = null; + if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1; + } else { // need an argument + if (getopt.place >= 0 && getopt.place < args[getopt.ind].length) + getopt.arg = args[getopt.ind].substr(getopt.place); + else if (args.length <= ++getopt.ind) { // no arg + getopt.place = -1; + if (ostr.length > 0 && ostr.charAt(0) == ':') return ':'; + return '?'; + } else getopt.arg = args[getopt.ind]; // white space + getopt.place = -1; + ++getopt.ind; + } + return optopt; +} + +/************************ + * Command line parsing * + ************************/ + +var ver = "r19"; +var c, thres_len = 50, thres_ratio = .8, thres_nm = 5, thres_frac = .33, dbg = false; + +// parse command line options +while ((c = getopt(arguments, "vdl:n:f:")) != null) { + if (c == 'l') thres_len = parseInt(getopt.arg); + else if (c == 'n') thres_nm = parseInt(getopt.arg); + else if (c == 'd') dbg = true; + else if (c == 'f') thres_frac = parseFloat(getopt.arg); + else if (c == 'v') { print(ver); exit(0); } +} +if (arguments.length == getopt.ind) { + print(""); + print("Usage: k8 typeHLA.js [options] \n"); + print("Options: -n INT drop a contig if the edit distance to the closest gene is >INT ["+thres_nm+"]"); + print(" -l INT drop a contig if its match too short ["+thres_len+"]"); + print(" -f FLOAT drop inconsistent contigs if their length = 0) { + var m, mm, line = buf.toString(); + var t = line.split("\t"); + var flag = parseInt(t[1]); + // SAM header + if (t[0].charAt(0) == '@') { + if (t[0] == '@SQ' && (m = /LN:(\d+)/.exec(line)) != null && (mm = /SN:(\S+)/.exec(line)) != null) + len[mm[1]] = parseInt(m[1]); + continue; + } + // parse gene name and exon number + var gene = null, exon = null; + if ((m = /^(HLA-[^\s_]+)_(\d+)/.exec(t[0])) != null) { + gene = m[1], exon = parseInt(m[2]) - 1; + if (gcnt[exon] == null) gcnt[exon] = {}; + gcnt[exon][gene] = true; + } + if (gene == null || exon == null || t[2] == '*') continue; + // parse clipping and aligned length + var x = 0, ts = parseInt(t[3]) - 1, te = ts, clip = [0, 0]; + while ((m = re_cigar.exec(t[5])) != null) { + var l = parseInt(m[1]); + if (m[2] == 'M') x += l, te += l; + else if (m[2] == 'I') x += l; + else if (m[2] == 'D') te += l; + else if (m[2] == 'S' || m[2] == 'H') clip[x==0?0:1] = l; + } + var tl = len[t[2]]; + var left = ts < clip[0]? ts : clip[0]; + var right = tl - te < clip[1]? tl - te : clip[1]; + var qs, qe, ql = clip[0] + x + clip[1]; + if (flag & 16) qs = clip[1], qe = ql - clip[0]; + else qs = clip[0], qe = ql - clip[1]; + var nm = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0; + list.push([t[2], gene, exon, ts, te, nm, left + right, qs, qe, ql]); // left+right should be 0 given a prefix-suffix alignment +} + +buf.destroy(); +file.close(); + +/************************************** + * Prepare data structures for typing * + **************************************/ + +// identify the primary exons, the exons associated with most genes +var pri_exon = [], n_pri_exons; +{ + var cnt = [], max = 0; + // count the number of genes per exon and track the max + for (var e = 0; e < gcnt.length; ++e) { + if (gcnt[e] != null) { + var c = 0, h = gcnt[e]; + for (var x in h) ++c; + cnt[e] = c; + max = max > c? max : c; + } else cnt[e] = 0; + } + warn("- Number of genes for each exon: [" +cnt.join(",") + "]"); + // find primary exons + var pri_list = []; + for (var e = 0; e < cnt.length; ++e) { + if (cnt[e] == max) pri_list.push(e + 1); + pri_exon[e] = cnt[e] == max? 1 : 0; + } + warn("- List of primary exon(s): ["+pri_list.join(",")+"]"); + n_pri_exons = pri_list.length; +} + +// convert strings to integers (for performance) +var ghash = {}, glist = [], chash = {}, clist = [], elist = []; +for (var i = 0; i < list.length; ++i) { + if (ghash[list[i][1]] == null) { + ghash[list[i][1]] = glist.length; + glist.push(list[i][1]); + } + if (chash[list[i][0]] == null) { + chash[list[i][0]] = clist.length; + clist.push(list[i][0]); + } + var g = ghash[list[i][1]]; + if (elist[g] == null) elist[g] = {}; + elist[g][list[i][2]] = true; +} + +// extract the 3rd and 4th digits +var gsub = [], gsuf = []; +for (var i = 0; i < glist.length; ++i) { + var m = /^HLA-[^*\s]+\*\d+:(\d+).*([A-Z]?)$/.exec(glist[i]); + gsub[i] = parseInt(m[1]); + gsuf[i] = /[A-Z]$/.test(glist[i])? 1 : 0; +} + +/************************************************* + * Collect genes with perfect matches on primary * + *************************************************/ + +// collect exons with fully covered by perfect match(es) +var perf_exons = []; + +function push_perf_exons(matches, last) +{ + matches.sort(function(a, b) { return a[0]-b[0]; }); + var cov = 0, start = 0, end = 0; + for (var i = 0; i < matches.length; ++i) { + if (matches[i][3] > 0) continue; + if (matches[i][0] <= end) + end = end > matches[i][1]? end : matches[i][1]; + else cov += end - start, start = matches[i][0], end = matches[i][1]; + } + cov += end - start; + if (matches[0][2] == cov) { + if (perf_exons[last[1]] == null) perf_exons[last[1]] = []; + //print(last[0], last[1], ghash[last[0]]); + perf_exons[last[1]].push(ghash[last[0]]); + } +} + +var last = [null, -1], matches = []; +for (var i = 0; i < list.length; ++i) { + var li = list[i]; + if (last[0] != li[1] || last[1] != li[2]) { + if (matches.length) push_perf_exons(matches, last); + matches = []; + last = [li[1], li[2]]; + } + matches.push([li[7], li[8], li[9], li[5]+li[6]]); +} +if (matches.length) push_perf_exons(matches, last); + +// for each gene, count how many primary exons are perfect +var pg_aux_cnt = {}; +for (var e = 0; e < perf_exons.length; ++e) { + if (!pri_exon[e]) continue; + var pe = perf_exons[e]; + var n = pe? pe.length : 0; + for (var i = 0; i < n; ++i) { + var g = pe[i]; + if (pg_aux_cnt[g] == null) pg_aux_cnt[g] = 1; + else ++pg_aux_cnt[g]; + } +} + +// find genes with perfect matches on the primary exons +var perf_genes = []; +for (var g in pg_aux_cnt) + if (pg_aux_cnt[g] == n_pri_exons) + perf_genes.push(parseInt(g)); +warn("- Found " +perf_genes.length+ " genes fully covered by perfect matches on the primary exon(s)"); + +var h_perf_genes = {}; +for (var i = 0; i < perf_genes.length; ++i) { + if (dbg) print("PG", glist[perf_genes[i]]); + h_perf_genes[perf_genes[i]] = true; +} + +/******************* + * Filter hit list * + *******************/ + +// reorganize hits to exons +function list2exons(list, flt_flag, perf_hash) +{ + var exons = []; + for (var i = 0; i < list.length; ++i) { + var li = list[i], c = chash[li[0]], g = ghash[li[1]]; + if (flt_flag != null && flt_flag[c] == 1) continue; + if (perf_hash != null && !perf_hash[g]) continue; + if (exons[li[2]] == null) exons[li[2]] = []; + exons[li[2]].push([c, g, li[5] + li[6], li[4] - li[3]]); + } + return exons; +} + +var exons = list2exons(list), flt_flag = [], ovlp_len = []; +for (var c = 0; c < clist.length; ++c) flt_flag[c] = ovlp_len[c] = 0; +for (var e = 0; e < exons.length; ++e) { + if (!pri_exon[e]) continue; + var ee = exons[e]; + var max_len = []; + for (var c = 0; c < clist.length; ++c) max_len[c] = 0; + for (var i = 0; i < ee.length; ++i) { + var l = ee[i][3] - ee[i][2]; + if (l < 1) l = 1; + if (max_len[ee[i][0]] < l) max_len[ee[i][0]] = l; + } + for (var c = 0; c < clist.length; ++c) ovlp_len[c] += max_len[c]; + for (var i = 0; i < ee.length; ++i) + flt_flag[ee[i][0]] |= (!h_perf_genes[ee[i][1]] || ee[i][2])? 1 : 1<<1; +} + +var l_cons = 0, l_incons = 0; +for (var c = 0; c < clist.length; ++c) + if (flt_flag[c]&2) l_cons += ovlp_len[c]; + else if (flt_flag[c] == 1) l_incons += ovlp_len[c]; + +warn("- Total length of contigs consistent/inconsistent with perfect genes: " +l_cons+ "/" +l_incons); +var attempt_perf = (l_incons/(l_cons+l_incons) < thres_frac); + +/******************************** + * Core function for genotyping * + ********************************/ + +function type_gene(perf_mode) +{ + if (perf_mode) { + var flt_list = []; + for (var c = 0; c < clist.length; ++c) + if (flt_flag[c] == 1) flt_list.push(clist[c]); + warn(" - Filtered " +flt_list.length+ " inconsistent contig(s): [" +flt_list.join(",")+ "]"); + exons = list2exons(list, flt_flag, h_perf_genes); + } else exons = list2exons(list); + + /*********************** + * Score each genotype * + ***********************/ + + // initialize genotype scores + var pair = []; + for (var i = 0; i < glist.length; ++i) { + pair[i] = []; + for (var j = 0; j <= i; ++j) + pair[i][j] = 0; + } + + // these two arrays are used to output debugging information + var score = [], ctg = []; + + function type_exon(e, gt_list) + { + function update_pair(x, m, is_pri) + { + var y, z; + y = (x>>14&0xff) + m < 0xff? (x>>14&0xff) + m : 0xff; + if (is_pri) z = (x>>22) + m < 0xff? (x>>22) + m : 0xff; + else z = x>>22; + return z<<22 | y<<14 | ((x&0x3fff) + (1<<6|is_pri)); + } + + score[e] = []; ctg[e] = []; + if (exons[e] == null) return; + var ee = exons[e], is_pri = pri_exon[e]? 1 : 0; + // find contigs and genes associated with the current exon + var ch = {}, gh = {}; + for (var i = 0; i < ee.length; ++i) + if (elist[ee[i][1]][e] != null) + ch[ee[i][0]] = true, gh[ee[i][1]] = true; + var ga = [], ca = ctg[e]; + for (var c in ch) ca.push(parseInt(c)); + for (var g in gh) ga.push(parseInt(g)); + var named_ca = []; + for (var i = 0; i < ca.length; ++i) named_ca.push(clist[ca[i]]); + warn(" - Processing exon "+(e+1)+" (" +ga.length+ " genes; " +ca.length+ " contigs: [" +named_ca.join(", ")+ "])..."); + // set unmapped entries to high mismatch + var sc = score[e]; + for (var k = 0; k < ga.length; ++k) { + var g = ga[k]; + if (sc[g] == null) sc[g] = []; + for (var i = 0; i < ca.length; ++i) + sc[g][ca[i]] = 0xff; + } + // convert representation again and compute max_len[] + var max_len = []; + for (var i = 0; i < ee.length; ++i) { + var c = ee[i][0], g = ee[i][1]; + if (gh[g] == null || ch[c] == null) continue; + sc[g][c] = sc[g][c] < ee[i][2]? sc[g][c] : ee[i][2]; + if (max_len[c] == null) max_len[c] = 0; + max_len[c] = max_len[c] > ee[i][3]? max_len[c] : ee[i][3]; + } + // drop mismapped contigs + var max_max_len = 0; + for (var k = 0; k < ca.length; ++k) + max_max_len = max_max_len > max_len[ca[k]]? max_max_len : max_len[ca[k]]; + var dropped = []; + for (var k = 0; k < ca.length; ++k) { + var min = 0x7fffffff, c = ca[k]; + for (var i = 0; i < ga.length; ++i) { + var g = ga[i]; + min = min < sc[g][c]? min : sc[g][c]; + } + dropped[c] = min > thres_nm? true : false; + if (max_len[c] < thres_len && max_len[c] < thres_ratio * max_max_len) dropped[c] = true; + if (dropped[c]) warn(" . Dropped low-quality contig " +clist[c]+ " (minNM=" +min+ "; maxLen=" +max_len[c]+ ")"); + } + // fill the pair array + if (gt_list == null) { + for (var i = 0; i < ga.length; ++i) { + var m = 0, gi = ga[i], g1 = sc[gi]; + // homozygous + for (var k = 0; k < ca.length; ++k) { + var c = ca[k]; + if (!dropped[c]) m += g1[c]; + } + pair[gi][gi] = update_pair(pair[gi][gi], m, is_pri); + // heterozygous + for (var j = i + 1; j < ga.length; ++j) { + var gj = ga[j], g2 = sc[gj], m = 0, a = [0, 0]; + for (var k = 0; k < ca.length; ++k) { + var c = ca[k]; + if (!dropped[c]) { + m += g1[c] < g2[c]? g1[c] : g2[c]; + ++a[g1[c]>22? min_nm_pri : pair[i][j]>>22; + + var gt_list = []; + for (var i = 0; i < glist.length; ++i) + for (var j = 0; j <= i; ++j) + if ((pair[i][j]&63) == n_pri_exons && pair[i][j]>>22 == min_nm_pri) + gt_list.push([i, j]); + + warn(" - Collected " +gt_list.length+ " top genotypes on the primary exon(s); minimal edit distance: " +min_nm_pri); + + // type other exons + warn(" - Processing other exon(s)..."); + for (var e = 0; e < exons.length; ++e) + if (!pri_exon[e]) type_exon(e, gt_list); + + /***************************** + * Choose the best genotypes * + *****************************/ + + // genotyping + var min_nm = 0x7fffffff; + for (var i = 0; i < glist.length; ++i) + for (var j = 0; j <= i; ++j) + if ((pair[i][j]&63) == n_pri_exons) + min_nm = min_nm < pair[i][j]>>14? min_nm : pair[i][j]>>14; + + var out = []; + for (var i = 0; i < glist.length; ++i) + for (var j = 0; j <= i; ++j) + if ((pair[i][j]&63) == n_pri_exons && pair[i][j]>>14 <= min_nm + 1) + out.push([pair[i][j]>>14, pair[i][j]>>6&0xff, i, j, (gsuf[i] + gsuf[j])<<16|(gsub[i] + gsub[j])]); + + out.sort(function(a, b) { return a[0]!=b[0]? a[0]-b[0] : a[1]!=b[1]? b[1]-a[1] : a[4]!=b[4]? a[4]-b[4] : a[2]!=b[2]? a[2]-b[2] : a[3]-b[3]}); + + return out; +} + +/********************** + * Perform genotyping * + **********************/ + +warn("- Typing in the imperfect mode..."); +var rst = type_gene(false); +if (attempt_perf) { + warn("- Typing in the perfect mode..."); + var rst_perf = type_gene(true); + warn("- Imperfect vs perfect mode: [" +(rst[0][0]>>8&0xff)+ "," +(rst[0][0]&0xff)+ "] vs [" +(rst_perf[0][0]>>8&0xff)+ "," +(rst_perf[0][0]&0xff)+ "]"); + if (rst_perf[0][0] < rst[0][0]) { + warn("- Chose the result from the perfect mode"); + rst = rst_perf; + } else warn("- Chose the result from the imperfect mode"); +} else warn("- Perfect mode is not attempted"); + +/********** + * Output * + **********/ + +for (var i = 0; i < rst.length; ++i) + print("GT", glist[rst[i][3]], glist[rst[i][2]], rst[i][0]>>8&0xff, rst[i][0]&0xff, rst[i][1]); diff --git a/bwakit/typeHLA.sh b/bwakit/typeHLA.sh new file mode 100755 index 0000000..b73100d --- /dev/null +++ b/bwakit/typeHLA.sh @@ -0,0 +1,49 @@ +#!/bin/bash + +is_ctg=0 + +if [ $# -gt 1 ] && [ $1 == '-A' ]; then + is_ctg=1 + shift +fi + +if [ $# -lt 2 ]; then + echo "Usage: $0 [-A] " + exit 1 +fi + +preres="resource-human-HLA" +root=`dirname $0` +pre=$1.$2 +touch $pre.gt + +if [ ! -s $pre.fq ]; then + echo '** Empty input file. Abort!' >&2 + exit 0 +fi + +if [ $is_ctg -eq 0 ]; then + echo "** De novo assembling..." >&2 + len=`$root/seqtk comp $pre.fq | awk '{++x;y+=$2}END{printf("%.0f\n", y/x)}'` + $root/fermi2.pl unitig -f $root/fermi2 -r $root/ropebwt2 -t2 -l$len -p $pre.tmp $pre.fq > $pre.tmp.mak + make -f $pre.tmp.mak >&2 + cp $pre.tmp.mag.gz $pre.mag.gz +else + rm -f $pre.tmp.mag.gz + ln -s $pre.fq $pre.tmp.mag.gz +fi + +echo "** Selecting contigs overlapping target exons..." >&2 +(ls $root/$preres/HLA-ALT-idx/*.fa.bwt | sed s,.bwt,, | xargs -i $root/bwa mem -t2 -B1 -O1 -E1 {} $pre.tmp.mag.gz 2>/dev/null) | grep -v ^@ | sort -k3,3 -k4,4n | gzip > $pre.tmp.ALT.sam.gz +$root/k8 $root/typeHLA-selctg.js $2 $root/$preres/HLA-ALT-exons.bed $pre.tmp.ALT.sam.gz | $root/seqtk subseq $pre.tmp.mag.gz - | gzip -1 > $pre.tmp.fq.gz + +echo "** Mapping exons to de novo contigs..." >&2 +$root/bwa index -p $pre.tmp $pre.tmp.fq.gz 2>/dev/null +$root/seqtk comp $root/$preres/HLA-CDS.fa | cut -f1 | grep ^$2 | $root/seqtk subseq $root/$preres/HLA-CDS.fa - | $root/bwa mem -aD.1 -t2 $pre.tmp - 2>/dev/null | gzip -1 > $pre.sam.gz + +echo "** Typing..." >&2 +$root/k8 $root/typeHLA.js $pre.sam.gz > $pre.gt + +# delete temporary files +rm -f $pre.tmp.* +[ $is_ctg -eq 1 ] && rm -f $pre.mag.gz diff --git a/bwamem.c b/bwamem.c new file mode 100644 index 0000000..649d588 --- /dev/null +++ b/bwamem.c @@ -0,0 +1,1663 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include +#include +#include +#include +#include +#ifdef HAVE_PTHREAD +#include +#endif + +#include "kstring.h" +#include "bwamem.h" +#include "bntseq.h" +#include "ksw.h" +#include "kvec.h" +#include "ksort.h" +#include "utils.h" +#include "fmt_idx.h" +#include "profiling.h" +#include "debug.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +/* Theory on probability and scoring *ungapped* alignment + * + * s'(a,b) = log[P(b|a)/P(b)] = log[4P(b|a)], assuming uniform base distribution + * s'(a,a) = log(4), s'(a,b) = log(4e/3), where e is the error rate + * + * Scale s'(a,b) to s(a,a) s.t. s(a,a)=x. Then s(a,b) = x*s'(a,b)/log(4), or conversely: s'(a,b)=s(a,b)*log(4)/x + * + * If the matching score is x and mismatch penalty is -y, we can compute error rate e: + * e = .75 * exp[-log(4) * y/x] + * + * log P(seq) = \sum_i log P(b_i|a_i) = \sum_i {s'(a,b) - log(4)} + * = \sum_i { s(a,b)*log(4)/x - log(4) } = log(4) * (S/x - l) + * + * where S=\sum_i s(a,b) is the alignment score. Converting to the phred scale: + * Q(seq) = -10/log(10) * log P(seq) = 10*log(4)/log(10) * (l - S/x) = 6.02 * (l - S/x) + * + * + * Gap open (zero gap): q' = log[P(gap-open)], r' = log[P(gap-ext)] (see Durbin et al. (1998) Section 4.1) + * Then q = x*log[P(gap-open)]/log(4), r = x*log[P(gap-ext)]/log(4) + * + * When there are gaps, l should be the length of alignment matches (i.e. the M operator in CIGAR) + */ + +static const bntseq_t *global_bns = 0; // for debugging only + +mem_opt_t *mem_opt_init() +{ + mem_opt_t *o; + o = calloc(1, sizeof(mem_opt_t)); + o->flag = 0; + o->a = 1; o->b = 4; + o->o_del = o->o_ins = 6; + o->e_del = o->e_ins = 1; + o->w = 100; + o->T = 30; + o->zdrop = 100; + o->pen_unpaired = 17; + o->pen_clip5 = o->pen_clip3 = 5; + + o->max_mem_intv = 20; + + o->min_seed_len = 19; + o->split_width = 10; + o->max_occ = 500; + o->max_chain_gap = 10000; + o->max_ins = 10000; + o->mask_level = 0.50; + o->drop_ratio = 0.50; + o->XA_drop_ratio = 0.80; + o->split_factor = 1.5; + o->chunk_size = 10000000; + o->n_threads = 1; + o->max_XA_hits = 5; + o->max_XA_hits_alt = 200; + o->max_matesw = 50; + o->mask_level_redun = 0.95; + o->min_chain_weight = 0; + o->max_chain_extend = 1<<30; + o->mapQ_coef_len = 50; o->mapQ_coef_fac = log(o->mapQ_coef_len); + bwa_fill_scmat(o->a, o->b, o->mat); + return o; +} + +/*************************** + * Collection SA invervals * + ***************************/ + +#define intv_lt(a, b) ((a).info < (b).info) +KSORT_INIT(mem_intv, bwtintv_t, intv_lt) + +static void mem_collect_intv(const mem_opt_t *opt, const FMTIndex *fmt, int len, const uint8_t *seq, smem_aux_t *a) +{ + int i, k, x = 0, old_n; + int start_width = 1; + int split_len = (int)(opt->min_seed_len * opt->split_factor + .499); + int max_seed_len = 0; + int start_N_num = 0, start_flag = 1; + a->mem.n = 0; + + // 1. first pass: find all SMEMs + while (x < len) { + if (seq[x] < 4) { + start_flag = 0; + x = fmt_smem(fmt, len, seq, x, start_width, opt->min_seed_len, 0, &a->mem1, a->tmpv[0]); + for (i = 0; i < a->mem1.n; ++i) { + bwtintv_t *p = &a->mem1.a[i]; + int slen = (uint32_t)p->info - (p->info >> 32); // seed length + max_seed_len = MAX(max_seed_len, slen); + if (slen >= opt->min_seed_len) { + kv_push(bwtintv_t, a->mem, *p); + } + } + } else { + ++x; + if (start_flag) ++start_N_num; + } + } + +#ifdef FILTER_FULL_MATCH + if (max_seed_len == len - start_N_num) goto collect_intv_end; +#endif + + // 2. second pass: find MEMs inside a long SMEM + old_n = a->mem.n; + for (k = 0; k < old_n; ++k) { + bwtintv_t *p = &a->mem.a[k]; + int start = p->info>>32, end = (int32_t)p->info; + if (end - start < split_len || p->x[2] > opt->split_width) continue; + fmt_smem(fmt, len, seq, (start + end) >> 1, p->x[2] + 1, opt->min_seed_len, p, &a->mem1, a->tmpv[0]); + for (i = 0; i < a->mem1.n; ++i) { + bwtintv_t *p = &a->mem1.a[i]; + int slen = (uint32_t)p->info - (p->info >> 32); + if (slen >= opt->min_seed_len) { + kv_push(bwtintv_t, a->mem, a->mem1.a[i]); + } + } + } + + // 3. third pass: LAST-like + if (opt->max_mem_intv > 0) { + x = 0; + while (x < len) { + if (seq[x] < 4) { + bwtintv_t m; + x = fmt_seed_strategy1(fmt, len, seq, x, opt->min_seed_len, opt->max_mem_intv, &m); + if (m.x[2] > 0) { + kv_push(bwtintv_t, a->mem, m); + } + } else ++x; + } + } + +#ifdef FILTER_FULL_MATCH +collect_intv_end: +#endif + // sort + ks_introsort(mem_intv, a->mem.n, a->mem.a); +} + +/************ + * Chaining * + ************/ + +#include "kbtree.h" + +#define chain_cmp(a, b) (((b).pos < (a).pos) - ((a).pos < (b).pos)) +KBTREE_INIT(chn, mem_chain_t, chain_cmp) + +// return 1 if the seed is merged into the chain +static int test_and_merge(const mem_opt_t *opt, int64_t l_pac, mem_chain_t *c, const mem_seed_t *p, int seed_rid) +{ + int64_t qend, rend, x, y; + const mem_seed_t *last = &c->seeds[c->n-1]; + qend = last->qbeg + last->len; + rend = last->rbeg + last->len; + if (seed_rid != c->rid) return 0; // different chr; request a new chain + if (p->qbeg >= c->seeds[0].qbeg && p->qbeg + p->len <= qend && p->rbeg >= c->seeds[0].rbeg && p->rbeg + p->len <= rend) + return 1; // contained seed; do nothing + if ((last->rbeg < l_pac || c->seeds[0].rbeg < l_pac) && p->rbeg >= l_pac) return 0; // don't chain if on different strand + + //return 0; // + x = p->qbeg - last->qbeg; // always non-negtive + y = p->rbeg - last->rbeg; + //fprintf(stderr, "x: %ld, y: %ld\n", x, y); + // ,seedchainlast,chainseed,seed + if (y >= 0 && x - y <= opt->w && y - x <= opt->w && x - last->len < opt->max_chain_gap && y - last->len < opt->max_chain_gap) { // grow the chain + if (c->n == c->m) { + c->m <<= 1; + c->seeds = realloc(c->seeds, c->m * sizeof(mem_seed_t)); + } + c->seeds[c->n++] = *p; + return 1; + } + return 0; // request to add a new chain +} + +int mem_chain_weight(const mem_chain_t *c) +{ + int64_t end; + int j, w = 0, tmp; + for (j = 0, end = 0; j < c->n; ++j) { + const mem_seed_t *s = &c->seeds[j]; + if (s->qbeg >= end) w += s->len; + else if (s->qbeg + s->len > end) w += s->qbeg + s->len - end; + end = end > s->qbeg + s->len? end : s->qbeg + s->len; + } + tmp = w; w = 0; + for (j = 0, end = 0; j < c->n; ++j) { + const mem_seed_t *s = &c->seeds[j]; + if (s->rbeg >= end) w += s->len; + else if (s->rbeg + s->len > end) w += s->rbeg + s->len - end; + end = end > s->rbeg + s->len? end : s->rbeg + s->len; + } + w = w < tmp? w : tmp; + return w < 1<<30? w : (1<<30)-1; +} + +void mem_print_chain(const bntseq_t *bns, mem_chain_v *chn) +{ + int i, j; + for (i = 0; i < chn->n; ++i) { + mem_chain_t *p = &chn->a[i]; + err_printf("* Found CHAIN(%d): n=%d; weight=%d", i, p->n, mem_chain_weight(p)); + for (j = 0; j < p->n; ++j) { + bwtint_t pos; + int is_rev; + pos = bns_depos(bns, p->seeds[j].rbeg, &is_rev); + if (is_rev) pos -= p->seeds[j].len - 1; + err_printf("\t%d;%d;%d,%ld(%s:%c%ld)", p->seeds[j].score, p->seeds[j].len, p->seeds[j].qbeg, (long)p->seeds[j].rbeg, bns->anns[p->rid].name, "+-"[is_rev], (long)(pos - bns->anns[p->rid].offset) + 1); + } + err_putchar('\n'); + } +} + +#define uint64_lt(a, b) ((a) > (b)) +KSORT_INIT(uint64_sort, uint64_t, uint64_lt) +mem_chain_v mem_chain(const mem_opt_t *opt, const FMTIndex *fmt, const bntseq_t *bns, int len, const uint8_t *seq, void *buf) +{ + int i, b, e, l_rep; + int64_t l_pac = bns->l_pac; + mem_chain_v chain; + kbtree_t(chn) *tree; + smem_aux_t *aux; + + + uint64_v v1, v2; + kv_init(v1); + kv_init(v2); + + kv_init(chain); + if (len < opt->min_seed_len) return chain; // if the query is shorter than the seed length, no match + tree = kb_init(chn, KB_DEFAULT_SIZE); + + aux = (smem_aux_t*)buf; + mem_collect_intv(opt, fmt, len, seq, aux); + +#define CHECK_ADD_CHAIN(tmp, lower, upper) \ + int rid, to_add = 0; \ + mem_chain_t tmp, *lower, *upper; \ + tmp.pos = s.rbeg; \ + s.qbeg = p->info >> 32; \ + s.score = s.len = slen; \ + rid = bns_intv2rid(bns, s.rbeg, s.rbeg + s.len); \ + if (rid < 0) \ + continue; \ + if (kb_size(tree)) \ + { \ + kb_intervalp(chn, tree, &tmp, &lower, &upper); \ + if (!lower || !test_and_merge(opt, l_pac, lower, &s, rid)) \ + to_add = 1; \ + } \ + else \ + to_add = 1; \ + if (to_add) \ + { \ + tmp.n = 1; \ + tmp.m = 4; \ + tmp.seeds = calloc(tmp.m, sizeof(mem_seed_t)); \ + tmp.seeds[0] = s; \ + tmp.rid = rid; \ + tmp.is_alt = !!bns->anns[rid].is_alt; \ + kb_putp(chn, tree, &tmp); \ + } + + for (i = 0, b = e = l_rep = 0; i < aux->mem.n; ++i) { // compute frac_rep + bwtintv_t *p = &aux->mem.a[i]; + int sb = (p->info>>32), se = (uint32_t)p->info; + if (p->x[2] <= opt->max_occ) continue; + if (sb > e) l_rep += e - b, b = sb, e = se; + else e = e > se? e : se; + } + l_rep += e - b; + for (i = 0; i < aux->mem.n; ++i) { + bwtintv_t *p = &aux->mem.a[i]; + int step, count, slen = (uint32_t)p->info - (p->info>>32); // seed length + int64_t k; + + if (p->num_match > 0) { + mem_seed_t s; + s.rbeg = p->rm[0].rs; + if (p->rm[0].reverse) s.rbeg = (fmt->l_pac << 1) - 1 - s.rbeg; + CHECK_ADD_CHAIN(tmp, lower, upper); + } else { + step = p->x[2] > opt->max_occ? p->x[2] / opt->max_occ : 1; + //step = 1; + for (k = count = 0; k < p->x[2] && count < opt->max_occ; k += step, ++count) { + mem_seed_t s; + s.rbeg = fmt_sa(fmt, p->x[0] + k); + CHECK_ADD_CHAIN(tmp, lower, upper); + } + } + } + kv_resize(mem_chain_t, chain, kb_size(tree)); + + #define traverse_func(p_) (chain.a[chain.n++] = *(p_)) + __kb_traverse(mem_chain_t, tree, traverse_func); + #undef traverse_func + + for (i = 0; i < chain.n; ++i) chain.a[i].frac_rep = (float)l_rep / len; + if (bwa_verbose >= 4) printf("* fraction of repetitive seeds: %.3f\n", (float)l_rep / len); + kb_destroy(chn, tree); + + return chain; +} + +/******************** + * Filtering chains * + ********************/ + +#define chn_beg(ch) ((ch).seeds->qbeg) +#define chn_end(ch) ((ch).seeds[(ch).n-1].qbeg + (ch).seeds[(ch).n-1].len) + +#define flt_lt(a, b) ((a).w > (b).w) +KSORT_INIT(mem_flt, mem_chain_t, flt_lt) + +int mem_chain_flt(const mem_opt_t *opt, int n_chn, mem_chain_t *a) +{ + int i, k; + kvec_t(int) chains = {0,0,0}; // this keeps int indices of the non-overlapping chains + if (n_chn == 0) return 0; // no need to filter + // compute the weight of each chain and drop chains with small weight + for (i = k = 0; i < n_chn; ++i) { + mem_chain_t *c = &a[i]; + c->first = -1; c->kept = 0; + c->w = mem_chain_weight(c); + if (c->w < opt->min_chain_weight) free(c->seeds); + else a[k++] = *c; + } + n_chn = k; + ks_introsort(mem_flt, n_chn, a); + // pairwise chain comparisons + a[0].kept = 3; + kv_push(int, chains, 0); + for (i = 1; i < n_chn; ++i) { + int large_ovlp = 0; + for (k = 0; k < chains.n; ++k) { + int j = chains.a[k]; + int b_max = chn_beg(a[j]) > chn_beg(a[i])? chn_beg(a[j]) : chn_beg(a[i]); + int e_min = chn_end(a[j]) < chn_end(a[i])? chn_end(a[j]) : chn_end(a[i]); + if (e_min > b_max && (!a[j].is_alt || a[i].is_alt)) { // have overlap; don't consider ovlp where the kept chain is ALT while the current chain is primary + int li = chn_end(a[i]) - chn_beg(a[i]); + int lj = chn_end(a[j]) - chn_beg(a[j]); + int min_l = li < lj? li : lj; + if (e_min - b_max >= min_l * opt->mask_level && min_l < opt->max_chain_gap) { // significant overlap + large_ovlp = 1; + if (a[j].first < 0) a[j].first = i; // keep the first shadowed hit s.t. mapq can be more accurate + if (a[i].w < a[j].w * opt->drop_ratio && a[j].w - a[i].w >= opt->min_seed_len<<1) + break; + } + } + } + if (k == chains.n) { + kv_push(int, chains, i); + a[i].kept = large_ovlp? 2 : 3; + } + } + for (i = 0; i < chains.n; ++i) { + mem_chain_t *c = &a[chains.a[i]]; + if (c->first >= 0) a[c->first].kept = 1; + } + free(chains.a); + for (i = k = 0; i < n_chn; ++i) { // don't extend more than opt->max_chain_extend .kept=1/2 chains + if (a[i].kept == 0 || a[i].kept == 3) continue; + if (++k >= opt->max_chain_extend) break; + } + for (; i < n_chn; ++i) + if (a[i].kept < 3) a[i].kept = 0; + for (i = k = 0; i < n_chn; ++i) { // free discarded chains + mem_chain_t *c = &a[i]; + if (c->kept == 0) free(c->seeds); + else a[k++] = a[i]; + } + return k; +} + +/****************************** + * De-overlap single-end hits * + ******************************/ + +#define alnreg_slt2(a, b) ((a).re < (b).re) +KSORT_INIT(mem_ars2, mem_alnreg_t, alnreg_slt2) + +#define alnreg_slt(a, b) ((a).score > (b).score || ((a).score == (b).score && ((a).rb < (b).rb || ((a).rb == (b).rb && (a).qb < (b).qb)))) +KSORT_INIT(mem_ars, mem_alnreg_t, alnreg_slt) + +#define alnreg_hlt(a, b) ((a).score > (b).score || ((a).score == (b).score && ((a).is_alt < (b).is_alt || ((a).is_alt == (b).is_alt && (a).hash < (b).hash)))) +KSORT_INIT(mem_ars_hash, mem_alnreg_t, alnreg_hlt) + +#define alnreg_hlt2(a, b) ((a).is_alt < (b).is_alt || ((a).is_alt == (b).is_alt && ((a).score > (b).score || ((a).score == (b).score && (a).hash < (b).hash)))) +KSORT_INIT(mem_ars_hash2, mem_alnreg_t, alnreg_hlt2) + +#define PATCH_MAX_R_BW 0.05f +#define PATCH_MIN_SC_RATIO 0.90f + +int mem_patch_reg(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, uint8_t *query, const mem_alnreg_t *a, const mem_alnreg_t *b, int *_w) +{ + int w, score, q_s, r_s; + double r; + if (bns == 0 || pac == 0 || query == 0) return 0; + assert(a->rid == b->rid && a->rb <= b->rb); + if (a->rb < bns->l_pac && b->rb >= bns->l_pac) return 0; // on different strands + if (a->qb >= b->qb || a->qe >= b->qe || a->re >= b->re) return 0; // not colinear + w = (a->re - b->rb) - (a->qe - b->qb); // required bandwidth + w = w > 0? w : -w; // l = abs(l) + r = (double)(a->re - b->rb) / (b->re - a->rb) - (double)(a->qe - b->qb) / (b->qe - a->qb); // relative bandwidth + r = r > 0.? r : -r; // r = fabs(r) + if (bwa_verbose >= 4) + printf("* potential hit merge between [%d,%d)<=>[%ld,%ld) and [%d,%d)<=>[%ld,%ld), @ %s; w=%d, r=%.4g\n", + a->qb, a->qe, (long)a->rb, (long)a->re, b->qb, b->qe, (long)b->rb, (long)b->re, bns->anns[a->rid].name, w, r); + if (a->re < b->rb || a->qe < b->qb) { // no overlap on query or on ref + if (w > opt->w<<1 || r >= PATCH_MAX_R_BW) return 0; // the bandwidth or the relative bandwidth is too large + } else if (w > opt->w<<2 || r >= PATCH_MAX_R_BW*2) return 0; // more permissive if overlapping on both ref and query + // global alignment + w += a->w + b->w; + w = w < opt->w<<2? w : opt->w<<2; + if (bwa_verbose >= 4) printf("* test potential hit merge with global alignment; w=%d\n", w); + bwa_gen_cigar2(opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, w, bns->l_pac, pac, b->qe - a->qb, query + a->qb, a->rb, b->re, &score, 0, 0); + q_s = (int)((double)(b->qe - a->qb) / ((b->qe - b->qb) + (a->qe - a->qb)) * (b->score + a->score) + .499); // predicted score from query + r_s = (int)((double)(b->re - a->rb) / ((b->re - b->rb) + (a->re - a->rb)) * (b->score + a->score) + .499); // predicted score from ref + if (bwa_verbose >= 4) printf("* score=%d;(%d,%d)\n", score, q_s, r_s); + if ((double)score / (q_s > r_s? q_s : r_s) < PATCH_MIN_SC_RATIO) return 0; + *_w = w; + return score; +} + +int mem_sort_dedup_patch(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, uint8_t *query, int n, mem_alnreg_t *a) +{ + int m, i, j; + if (n <= 1) return n; + ks_introsort(mem_ars2, n, a); // sort by the END position, not START! + for (i = 0; i < n; ++i) a[i].n_comp = 1; + for (i = 1; i < n; ++i) { + mem_alnreg_t *p = &a[i]; + if (p->rid != a[i-1].rid || p->rb >= a[i-1].re + opt->max_chain_gap) continue; // then no need to go into the loop below + for (j = i - 1; j >= 0 && p->rid == a[j].rid && p->rb < a[j].re + opt->max_chain_gap; --j) { + mem_alnreg_t *q = &a[j]; + int64_t or, oq, mr, mq; + int score, w; + if (q->qe == q->qb) continue; // a[j] has been excluded + or = q->re - p->rb; // overlap length on the reference + oq = q->qb < p->qb? q->qe - p->qb : p->qe - q->qb; // overlap length on the query + mr = q->re - q->rb < p->re - p->rb? q->re - q->rb : p->re - p->rb; // min ref len in alignment + mq = q->qe - q->qb < p->qe - p->qb? q->qe - q->qb : p->qe - p->qb; // min qry len in alignment + if (or > opt->mask_level_redun * mr && oq > opt->mask_level_redun * mq) { // one of the hits is redundant + if (p->score < q->score) { + p->qe = p->qb; + break; + } else q->qe = q->qb; + } else if (q->rb < p->rb && (score = mem_patch_reg(opt, bns, pac, query, q, p, &w)) > 0) { // then merge q into p + p->n_comp += q->n_comp + 1; + p->seedcov = p->seedcov > q->seedcov? p->seedcov : q->seedcov; + p->sub = p->sub > q->sub? p->sub : q->sub; + p->csub = p->csub > q->csub? p->csub : q->csub; + p->qb = q->qb, p->rb = q->rb; + p->truesc = p->score = score; + p->w = w; + q->qb = q->qe; + } + } + } + for (i = 0, m = 0; i < n; ++i) // exclude identical hits + if (a[i].qe > a[i].qb) { + if (m != i) a[m++] = a[i]; + else ++m; + } + n = m; + ks_introsort(mem_ars, n, a); + for (i = 1; i < n; ++i) { // mark identical hits + if (a[i].score == a[i-1].score && a[i].rb == a[i-1].rb && a[i].qb == a[i-1].qb) + a[i].qe = a[i].qb; + } + for (i = 1, m = 1; i < n; ++i) // exclude identical hits + if (a[i].qe > a[i].qb) { + if (m != i) a[m++] = a[i]; + else ++m; + } + return m; +} + +typedef kvec_t(int) int_v; + +static void mem_mark_primary_se_core(const mem_opt_t *opt, int n, mem_alnreg_t *a, int_v *z) +{ // similar to the loop in mem_chain_flt() + int i, k, tmp; + tmp = opt->a + opt->b; + tmp = opt->o_del + opt->e_del > tmp? opt->o_del + opt->e_del : tmp; + tmp = opt->o_ins + opt->e_ins > tmp? opt->o_ins + opt->e_ins : tmp; + z->n = 0; + kv_push(int, *z, 0); + for (i = 1; i < n; ++i) { + for (k = 0; k < z->n; ++k) { + int j = z->a[k]; + int b_max = a[j].qb > a[i].qb? a[j].qb : a[i].qb; + int e_min = a[j].qe < a[i].qe? a[j].qe : a[i].qe; + if (e_min > b_max) { // have overlap + int min_l = a[i].qe - a[i].qb < a[j].qe - a[j].qb? a[i].qe - a[i].qb : a[j].qe - a[j].qb; + if (e_min - b_max >= min_l * opt->mask_level) { // significant overlap + if (a[j].sub == 0) a[j].sub = a[i].score; + if (a[j].score - a[i].score <= tmp && (a[j].is_alt || !a[i].is_alt)) + ++a[j].sub_n; + break; + } + } + } + if (k == z->n) kv_push(int, *z, i); + else a[i].secondary = z->a[k]; + } +} + +int mem_mark_primary_se(const mem_opt_t *opt, int n, mem_alnreg_t *a, int64_t id) +{ + int i, n_pri; + int_v z = {0,0,0}; + if (n == 0) return 0; + for (i = n_pri = 0; i < n; ++i) { + a[i].sub = a[i].alt_sc = 0, a[i].secondary = a[i].secondary_all = -1, a[i].hash = hash_64(id+i); + if (!a[i].is_alt) ++n_pri; + } + ks_introsort(mem_ars_hash, n, a); + mem_mark_primary_se_core(opt, n, a, &z); + for (i = 0; i < n; ++i) { + mem_alnreg_t *p = &a[i]; + p->secondary_all = i; // keep the rank in the first round + if (!p->is_alt && p->secondary >= 0 && a[p->secondary].is_alt) + p->alt_sc = a[p->secondary].score; + } + if (n_pri >= 0 && n_pri < n) { + kv_resize(int, z, n); + if (n_pri > 0) ks_introsort(mem_ars_hash2, n, a); + for (i = 0; i < n; ++i) z.a[a[i].secondary_all] = i; + for (i = 0; i < n; ++i) { + if (a[i].secondary >= 0) { + a[i].secondary_all = z.a[a[i].secondary]; + if (a[i].is_alt) a[i].secondary = INT_MAX; + } else a[i].secondary_all = -1; + } + if (n_pri > 0) { // mark primary for hits to the primary assembly only + for (i = 0; i < n_pri; ++i) a[i].sub = 0, a[i].secondary = -1; + mem_mark_primary_se_core(opt, n_pri, a, &z); + } + } else { + for (i = 0; i < n; ++i) + a[i].secondary_all = a[i].secondary; + } + free(z.a); + return n_pri; +} + +/********************************* + * Test if a seed is good enough * + *********************************/ + +#define MEM_SHORT_EXT 50 +#define MEM_SHORT_LEN 200 + +#define MEM_HSP_COEF 1.1f +#define MEM_MINSC_COEF 5.5f +#define MEM_SEEDSW_COEF 0.05f + +int mem_seed_sw(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_query, const uint8_t *query, const mem_seed_t *s, buf_t *buf) +{ + int qb, qe, rid; + int64_t rb, re, mid, l_pac = bns->l_pac; + uint8_t *rseq = 0; + kswr_t x; + + if (s->len >= MEM_SHORT_LEN) return -1; // the seed is longer than the max-extend; no need to do SW + qb = s->qbeg, qe = s->qbeg + s->len; + rb = s->rbeg, re = s->rbeg + s->len; + mid = (rb + re) >> 1; + qb -= MEM_SHORT_EXT; qb = qb > 0? qb : 0; + qe += MEM_SHORT_EXT; qe = qe < l_query? qe : l_query; + rb -= MEM_SHORT_EXT; rb = rb > 0? rb : 0; + re += MEM_SHORT_EXT; re = re < l_pac<<1? re : l_pac<<1; + if (rb < l_pac && l_pac < re) { + if (mid < l_pac) re = l_pac; + else rb = l_pac; + } + if (qe - qb >= MEM_SHORT_LEN || re - rb >= MEM_SHORT_LEN) return -1; // the seed seems good enough; no need to do SW + + rseq = bns_fetch_seq(bns, pac, &rb, mid, &re, &rid); + //bns_fetch_seq_no_alloc(bns, pac, &rb, mid, &re, &rid, &buf->m, &buf->addr); rseq = buf->addr; + + x = ksw_align2(qe - qb, (uint8_t*)query + qb, re - rb, rseq, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, KSW_XSTART, 0); + free(rseq); + return x.score; +} + +void mem_flt_chained_seeds(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_query, const uint8_t *query, int n_chn, mem_chain_t *a, buf_t *buf) +{ + double min_l = opt->min_chain_weight? MEM_HSP_COEF * opt->min_chain_weight : MEM_MINSC_COEF * log(l_query); + int i, j, k, min_HSP_score = (int)(opt->a * min_l + .499); + if (min_l > MEM_SEEDSW_COEF * l_query) return; // don't run the following for short reads + for (i = 0; i < n_chn; ++i) { + mem_chain_t *c = &a[i]; + for (j = k = 0; j < c->n; ++j) { + mem_seed_t *s = &c->seeds[j]; + s->score = mem_seed_sw(opt, bns, pac, l_query, query, s, buf); + if (s->score < 0 || s->score >= min_HSP_score) { + s->score = s->score < 0? s->len * opt->a : s->score; + c->seeds[k++] = *s; + } + } + c->n = k; + } +} + +/**************************************** + * Construct the alignment from a chain * + ****************************************/ + +static inline int cal_max_gap(const mem_opt_t *opt, int qlen) +{ + int l_del = (int)((double)(qlen * opt->a - opt->o_del) / opt->e_del + 1.); + int l_ins = (int)((double)(qlen * opt->a - opt->o_ins) / opt->e_ins + 1.); + int l = l_del > l_ins? l_del : l_ins; + l = l > 1? l : 1; + return l < opt->w<<1? l : opt->w<<1; +} + +#define MAX_BAND_TRY 2 + +void mem_chain2aln(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_query, const uint8_t *query, const mem_chain_t *c, mem_alnreg_v *av, void *buf, int tid) +{ + int i, k, rid, max_off[2], aw[2]; // aw: actual bandwidth used in extension + int64_t l_pac = bns->l_pac, rmax[2], tmp, max = 0; + const mem_seed_t *s; + uint8_t *rseq = 0; + uint64_t *srt; + smem_aux_t *aux = (smem_aux_t*)buf; + + if (c->n == 0) return; + // get the max possible span + rmax[0] = l_pac<<1; rmax[1] = 0; + for (i = 0; i < c->n; ++i) { + int64_t b, e; + const mem_seed_t *t = &c->seeds[i]; + b = t->rbeg - (t->qbeg + cal_max_gap(opt, t->qbeg)); + e = t->rbeg + t->len + ((l_query - t->qbeg - t->len) + cal_max_gap(opt, l_query - t->qbeg - t->len)); + rmax[0] = rmax[0] < b? rmax[0] : b; + rmax[1] = rmax[1] > e? rmax[1] : e; + if (t->len > max) max = t->len; + } + rmax[0] = rmax[0] > 0? rmax[0] : 0; + rmax[1] = rmax[1] < l_pac<<1? rmax[1] : l_pac<<1; + if (rmax[0] < l_pac && l_pac < rmax[1]) { // crossing the forward-reverse boundary; then choose one side + if (c->seeds[0].rbeg < l_pac) rmax[1] = l_pac; // this works because all seeds are guaranteed to be on the same strand + else rmax[0] = l_pac; + } + // retrieve the reference sequence + rseq = bns_fetch_seq(bns, pac, &rmax[0], c->seeds[0].rbeg, &rmax[1], &rid); + //bns_fetch_seq_no_alloc(bns, pac, &rmax[0], c->seeds[0].rbeg, &rmax[1], &rid, &aux->seq_buf->m, &aux->seq_buf->addr); rseq = aux->seq_buf->addr; + + assert(c->rid == rid); + + srt = malloc(c->n * 8); + for (i = 0; i < c->n; ++i) + srt[i] = (uint64_t)c->seeds[i].score<<32 | i; + ks_introsort_64(c->n, srt); + + for (k = c->n - 1; k >= 0; --k) { + mem_alnreg_t *a; + s = &c->seeds[(uint32_t)srt[k]]; + + for (i = 0; i < av->n; ++i) { // test whether extension has been made before + mem_alnreg_t *p = &av->a[i]; + int64_t rd; + int qd, w, max_gap; + if (s->rbeg < p->rb || s->rbeg + s->len > p->re || s->qbeg < p->qb || s->qbeg + s->len > p->qe) continue; // not fully contained + if (s->len - p->seedlen0 > .1 * l_query) continue; // this seed may give a better alignment + // qd: distance ahead of the seed on query; rd: on reference + qd = s->qbeg - p->qb; rd = s->rbeg - p->rb; + max_gap = cal_max_gap(opt, qd < rd? qd : rd); // the maximal gap allowed in regions ahead of the seed + w = max_gap < p->w? max_gap : p->w; // bounded by the band width + if (qd - rd < w && rd - qd < w) break; // the seed is "around" a previous hit + // similar to the previous four lines, but this time we look at the region behind + qd = p->qe - (s->qbeg + s->len); rd = p->re - (s->rbeg + s->len); + max_gap = cal_max_gap(opt, qd < rd? qd : rd); + w = max_gap < p->w? max_gap : p->w; + if (qd - rd < w && rd - qd < w) break; + } + if (i < av->n) { // the seed is (almost) contained in an existing alignment; further testing is needed to confirm it is not leading to a different aln + if (bwa_verbose >= 4) + printf("** Seed(%d) [%ld;%ld,%ld] is almost contained in an existing alignment [%d,%d) <=> [%ld,%ld)\n", + k, (long)s->len, (long)s->qbeg, (long)s->rbeg, av->a[i].qb, av->a[i].qe, (long)av->a[i].rb, (long)av->a[i].re); + for (i = k + 1; i < c->n; ++i) { // check overlapping seeds in the same chain + const mem_seed_t *t; + if (srt[i] == 0) continue; + t = &c->seeds[(uint32_t)srt[i]]; + if (t->len < s->len * .95) continue; // only check overlapping if t is long enough; TODO: more efficient by early stopping + if (s->qbeg <= t->qbeg && s->qbeg + s->len - t->qbeg >= s->len>>2 && t->qbeg - s->qbeg != t->rbeg - s->rbeg) break; + if (t->qbeg <= s->qbeg && t->qbeg + t->len - s->qbeg >= s->len>>2 && s->qbeg - t->qbeg != s->rbeg - t->rbeg) break; + } + if (i == c->n) { // no overlapping seeds; then skip extension + srt[k] = 0; // mark that seed extension has not been performed + continue; + } + if (bwa_verbose >= 4) + printf("** Seed(%d) might lead to a different alignment even though it is contained. Extension will be performed.\n", k); + } + + a = kv_pushp(mem_alnreg_t, *av); + memset(a, 0, sizeof(mem_alnreg_t)); + a->w = aw[0] = aw[1] = opt->w; + a->score = a->truesc = -1; + a->rid = c->rid; + + if (bwa_verbose >= 4) err_printf("** ---> Extending from seed(%d) [%ld;%ld,%ld] @ %s <---\n", k, (long)s->len, (long)s->qbeg, (long)s->rbeg, bns->anns[c->rid].name); + if (s->qbeg) { // left extension + int qle, tle, gtle, gscore; + tmp = s->rbeg - rmax[0]; +#ifndef USE_AVX2 + uint8_t *rs, *qs; + qs = malloc(s->qbeg); + for (i = 0; i < s->qbeg; ++i) qs[i] = query[s->qbeg - 1 - i]; + rs = malloc(tmp); + for (i = 0; i < tmp; ++i) rs[i] = rseq[tmp - 1 - i]; +#endif + for (i = 0; i < MAX_BAND_TRY; ++i) { + int prev = a->score; + aw[0] = opt->w << i; + if (bwa_verbose >= 4) { + int j; + printf("*** Left ref: "); for (j = 0; j < tmp; ++j) putchar("ACGTN"[(int)rseq[tmp - 1 - j]]); putchar('\n'); + printf("*** Left query: "); for (j = 0; j < s->qbeg; ++j) putchar("ACGTN"[(int)query[s->qbeg - 1 - j]]); putchar('\n'); + } + PROF_START(bsw); +#ifndef USE_AVX2 + a->score = ksw_extend2(s->qbeg, qs, tmp, rs, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, aw[0], opt->pen_clip5, opt->zdrop, s->len * opt->a, &qle, &tle, >le, &gscore, &max_off[0], aux->sw_buf); +#else + a->score = ksw_extend2_avx2(s->qbeg, query, tmp, rseq, 1, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, opt->a, opt->b, aw[0], opt->pen_clip5, opt->zdrop, s->len * opt->a, &qle, &tle, >le, &gscore, &max_off[0], aux->sw_buf); +#endif + PROF_END(tprof[T_BSW][tid], bsw); + if (bwa_verbose >= 4) { printf("*** Left extension: prev_score=%d; score=%d; bandwidth=%d; max_off_diagonal_dist=%d\n", prev, a->score, aw[0], max_off[0]); fflush(stdout); } + if (a->score == prev || max_off[0] < (aw[0]>>1) + (aw[0]>>2)) break; + } + // check whether we prefer to reach the end of the query + if (gscore <= 0 || gscore <= a->score - opt->pen_clip5) { // local extension + a->qb = s->qbeg - qle, a->rb = s->rbeg - tle; + a->truesc = a->score; + } else { // to-end extension + a->qb = 0, a->rb = s->rbeg - gtle; + a->truesc = gscore; + } +#ifndef USE_AVX2 + free(qs); free(rs); +#endif + } else a->score = a->truesc = s->len * opt->a, a->qb = 0, a->rb = s->rbeg; + + if (s->qbeg + s->len != l_query) { // right extension + int qle, tle, qe, re, gtle, gscore, sc0 = a->score; + qe = s->qbeg + s->len; + re = s->rbeg + s->len - rmax[0]; + assert(re >= 0); + for (i = 0; i < MAX_BAND_TRY; ++i) { + int prev = a->score; + aw[1] = opt->w << i; + if (bwa_verbose >= 4) { + int j; + printf("*** Right ref: "); for (j = 0; j < rmax[1] - rmax[0] - re; ++j) putchar("ACGTN"[(int)rseq[re+j]]); putchar('\n'); + printf("*** Right query: "); for (j = 0; j < l_query - qe; ++j) putchar("ACGTN"[(int)query[qe+j]]); putchar('\n'); + } + PROF_START(bsw); +#ifndef USE_AVX2 + a->score = ksw_extend2(l_query - qe, query + qe, rmax[1] - rmax[0] - re, rseq + re, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, aw[1], opt->pen_clip3, opt->zdrop, sc0, &qle, &tle, >le, &gscore, &max_off[1], aux->sw_buf); +#else + a->score = ksw_extend2_avx2(l_query - qe, query + qe, rmax[1] - rmax[0] - re, rseq + re, 0, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, opt->a, opt->b, aw[1], opt->pen_clip3, opt->zdrop, sc0, &qle, &tle, >le, &gscore, &max_off[1], aux->sw_buf); +#endif + PROF_END(tprof[T_BSW][tid], bsw); + if (bwa_verbose >= 4) { printf("*** Right extension: prev_score=%d; score=%d; bandwidth=%d; max_off_diagonal_dist=%d\n", prev, a->score, aw[1], max_off[1]); fflush(stdout); } + if (a->score == prev || max_off[1] < (aw[1]>>1) + (aw[1]>>2)) break; + } + // similar to the above + if (gscore <= 0 || gscore <= a->score - opt->pen_clip3) { // local extension + a->qe = qe + qle, a->re = rmax[0] + re + tle; + a->truesc += a->score - sc0; + } else { // to-end extension + a->qe = l_query, a->re = rmax[0] + re + gtle; + a->truesc += gscore - sc0; + } + } else a->qe = l_query, a->re = s->rbeg + s->len; + if (bwa_verbose >= 4) printf("*** Added alignment region: [%d,%d) <=> [%ld,%ld); score=%d; {left,right}_bandwidth={%d,%d}\n", a->qb, a->qe, (long)a->rb, (long)a->re, a->score, aw[0], aw[1]); + + // compute seedcov + for (i = 0, a->seedcov = 0; i < c->n; ++i) { + const mem_seed_t *t = &c->seeds[i]; + if (t->qbeg >= a->qb && t->qbeg + t->len <= a->qe && t->rbeg >= a->rb && t->rbeg + t->len <= a->re) // seed fully contained + a->seedcov += t->len; // this is not very accurate, but for approx. mapQ, this is good enough + } + a->w = aw[0] > aw[1]? aw[0] : aw[1]; + a->seedlen0 = s->len; + + a->frac_rep = c->frac_rep; + } + free(srt); + free(rseq); +} + +/***************************** + * Basic hit->SAM conversion * + *****************************/ + +static inline int infer_bw(int l1, int l2, int score, int a, int q, int r) +{ + int w; + if (l1 == l2 && l1 * a - score < (q + r - a)<<1) return 0; // to get equal alignment length, we need at least two gaps + w = ((double)((l1 < l2? l1 : l2) * a - score - q) / r + 2.); + if (w < abs(l1 - l2)) w = abs(l1 - l2); + return w; +} + +static inline int get_rlen(int n_cigar, const uint32_t *cigar) +{ + int k, l; + for (k = l = 0; k < n_cigar; ++k) { + int op = cigar[k]&0xf; + if (op == 0 || op == 2) + l += cigar[k]>>4; + } + return l; +} + +static inline void add_cigar(const mem_opt_t *opt, mem_aln_t *p, kstring_t *str, int which) +{ + int i; + if (p->n_cigar) { // aligned + for (i = 0; i < p->n_cigar; ++i) { + int c = p->cigar[i]&0xf; + if (!(opt->flag&MEM_F_SOFTCLIP) && !p->is_alt && (c == 3 || c == 4)) + c = which? 4 : 3; // use hard clipping for supplementary alignments + kputw(p->cigar[i]>>4, str); kputc("MIDSH"[c], str); + } + } else kputc('*', str); // having a coordinate but unaligned (e.g. when copy_mate is true) +} + +void mem_aln2sam(const mem_opt_t *opt, const bntseq_t *bns, kstring_t *str, bseq1_t *s, int n, const mem_aln_t *list, int which, const mem_aln_t *m_) +{ + int i, l_name; + mem_aln_t ptmp = list[which], *p = &ptmp, mtmp, *m = 0; // make a copy of the alignment to convert + + if (m_) mtmp = *m_, m = &mtmp; + // set flag + p->flag |= m? 0x1 : 0; // is paired in sequencing + p->flag |= p->rid < 0? 0x4 : 0; // is mapped + p->flag |= m && m->rid < 0? 0x8 : 0; // is mate mapped + if (p->rid < 0 && m && m->rid >= 0) // copy mate to alignment + p->rid = m->rid, p->pos = m->pos, p->is_rev = m->is_rev, p->n_cigar = 0; + if (m && m->rid < 0 && p->rid >= 0) // copy alignment to mate + m->rid = p->rid, m->pos = p->pos, m->is_rev = p->is_rev, m->n_cigar = 0; + p->flag |= p->is_rev? 0x10 : 0; // is on the reverse strand + p->flag |= m && m->is_rev? 0x20 : 0; // is mate on the reverse strand + + // print up to CIGAR + l_name = strlen(s->name); + ks_resize(str, str->l + s->l_seq + l_name + (s->qual? s->l_seq : 0) + 20); + kputsn(s->name, l_name, str); kputc('\t', str); // QNAME + kputw((p->flag&0xffff) | (p->flag&0x10000? 0x100 : 0), str); kputc('\t', str); // FLAG + if (p->rid >= 0) { // with coordinate + kputs(bns->anns[p->rid].name, str); kputc('\t', str); // RNAME + kputl(p->pos + 1, str); kputc('\t', str); // POS + kputw(p->mapq, str); kputc('\t', str); // MAPQ + add_cigar(opt, p, str, which); + } else kputsn("*\t0\t0\t*", 7, str); // without coordinte + kputc('\t', str); + + // print the mate position if applicable + if (m && m->rid >= 0) { + if (p->rid == m->rid) kputc('=', str); + else kputs(bns->anns[m->rid].name, str); + kputc('\t', str); + kputl(m->pos + 1, str); kputc('\t', str); + if (p->rid == m->rid) { + int64_t p0 = p->pos + (p->is_rev? get_rlen(p->n_cigar, p->cigar) - 1 : 0); + int64_t p1 = m->pos + (m->is_rev? get_rlen(m->n_cigar, m->cigar) - 1 : 0); + if (m->n_cigar == 0 || p->n_cigar == 0) kputc('0', str); + else kputl(-(p0 - p1 + (p0 > p1? 1 : p0 < p1? -1 : 0)), str); + } else kputc('0', str); + } else kputsn("*\t0\t0", 5, str); + kputc('\t', str); + + // print SEQ and QUAL + if (p->flag & 0x100) { // for secondary alignments, don't write SEQ and QUAL + kputsn("*\t*", 3, str); + } else if (!p->is_rev) { // the forward strand + int i, qb = 0, qe = s->l_seq; + if (p->n_cigar && which && !(opt->flag&MEM_F_SOFTCLIP) && !p->is_alt) { // have cigar && not the primary alignment && not softclip all + if ((p->cigar[0]&0xf) == 4 || (p->cigar[0]&0xf) == 3) qb += p->cigar[0]>>4; + if ((p->cigar[p->n_cigar-1]&0xf) == 4 || (p->cigar[p->n_cigar-1]&0xf) == 3) qe -= p->cigar[p->n_cigar-1]>>4; + } + ks_resize(str, str->l + (qe - qb) + 1); + for (i = qb; i < qe; ++i) str->s[str->l++] = "ACGTN"[(int)s->seq[i]]; + kputc('\t', str); + if (s->qual) { // printf qual + ks_resize(str, str->l + (qe - qb) + 1); + for (i = qb; i < qe; ++i) str->s[str->l++] = s->qual[i]; + str->s[str->l] = 0; + } else kputc('*', str); + } else { // the reverse strand + int i, qb = 0, qe = s->l_seq; + if (p->n_cigar && which && !(opt->flag&MEM_F_SOFTCLIP) && !p->is_alt) { + if ((p->cigar[0]&0xf) == 4 || (p->cigar[0]&0xf) == 3) qe -= p->cigar[0]>>4; + if ((p->cigar[p->n_cigar-1]&0xf) == 4 || (p->cigar[p->n_cigar-1]&0xf) == 3) qb += p->cigar[p->n_cigar-1]>>4; + } + ks_resize(str, str->l + (qe - qb) + 1); + for (i = qe-1; i >= qb; --i) str->s[str->l++] = "TGCAN"[(int)s->seq[i]]; + kputc('\t', str); + if (s->qual) { // printf qual + ks_resize(str, str->l + (qe - qb) + 1); + for (i = qe-1; i >= qb; --i) str->s[str->l++] = s->qual[i]; + str->s[str->l] = 0; + } else kputc('*', str); + } + + // print optional tags + if (p->n_cigar) { + kputsn("\tNM:i:", 6, str); kputw(p->NM, str); + kputsn("\tMD:Z:", 6, str); kputs((char*)(p->cigar + p->n_cigar), str); + } + if (m && m->n_cigar) { kputsn("\tMC:Z:", 6, str); add_cigar(opt, m, str, which); } +// if (m) { kputsn("\tMQ:i:", 6, str); kputw(m->mapq, str);} + if (p->score >= 0) { kputsn("\tAS:i:", 6, str); kputw(p->score, str); } + if (p->sub >= 0) { kputsn("\tXS:i:", 6, str); kputw(p->sub, str); } + if (bwa_rg_id[0]) { kputsn("\tRG:Z:", 6, str); kputs(bwa_rg_id, str); } + if (!(p->flag & 0x100)) { // not multi-hit + for (i = 0; i < n; ++i) + if (i != which && !(list[i].flag&0x100)) break; + if (i < n) { // there are other primary hits; output them + kputsn("\tSA:Z:", 6, str); + for (i = 0; i < n; ++i) { + const mem_aln_t *r = &list[i]; + int k; + if (i == which || (r->flag&0x100)) continue; // proceed if: 1) different from the current; 2) not shadowed multi hit + kputs(bns->anns[r->rid].name, str); kputc(',', str); + kputl(r->pos+1, str); kputc(',', str); + kputc("+-"[r->is_rev], str); kputc(',', str); + for (k = 0; k < r->n_cigar; ++k) { + kputw(r->cigar[k]>>4, str); kputc("MIDSH"[r->cigar[k]&0xf], str); + } + kputc(',', str); kputw(r->mapq, str); + kputc(',', str); kputw(r->NM, str); + kputc(';', str); + } + } + if (p->alt_sc > 0) + ksprintf(str, "\tpa:f:%.3f", (double)p->score / p->alt_sc); + } + if (p->XA) { + kputsn((opt->flag&MEM_F_XB)? "\tXB:Z:" : "\tXA:Z:", 6, str); + kputs(p->XA, str); + } + if (s->comment) { kputc('\t', str); kputs(s->comment, str); } + if ((opt->flag&MEM_F_REF_HDR) && p->rid >= 0 && bns->anns[p->rid].anno != 0 && bns->anns[p->rid].anno[0] != 0) { + int tmp; + kputsn("\tXR:Z:", 6, str); + tmp = str->l; + kputs(bns->anns[p->rid].anno, str); + for (i = tmp; i < str->l; ++i) // replace TAB in the comment to SPACE + if (str->s[i] == '\t') str->s[i] = ' '; + } + kputc('\n', str); +} + +/************************ + * Integrated interface * + ************************/ + +int mem_approx_mapq_se(const mem_opt_t *opt, const mem_alnreg_t *a) +{ + int mapq, l, sub = a->sub? a->sub : opt->min_seed_len * opt->a; + double identity; + sub = a->csub > sub? a->csub : sub; + if (sub >= a->score) return 0; + l = a->qe - a->qb > a->re - a->rb? a->qe - a->qb : a->re - a->rb; + identity = 1. - (double)(l * opt->a - a->score) / (opt->a + opt->b) / l; + if (a->score == 0) { + mapq = 0; + } else if (opt->mapQ_coef_len > 0) { + double tmp; + tmp = l < opt->mapQ_coef_len? 1. : opt->mapQ_coef_fac / log(l); + tmp *= identity * identity; + mapq = (int)(6.02 * (a->score - sub) / opt->a * tmp * tmp + .499); + } else { + mapq = (int)(MEM_MAPQ_COEF * (1. - (double)sub / a->score) * log(a->seedcov) + .499); + mapq = identity < 0.95? (int)(mapq * identity * identity + .499) : mapq; + } + if (a->sub_n > 0) mapq -= (int)(4.343 * log(a->sub_n+1) + .499); + if (mapq > 60) mapq = 60; + if (mapq < 0) mapq = 0; + mapq = (int)(mapq * (1. - a->frac_rep) + .499); + return mapq; +} + +void mem_reorder_primary5(int T, mem_alnreg_v *a) +{ + int k, n_pri = 0, left_st = INT_MAX, left_k = -1; + mem_alnreg_t t; + for (k = 0; k < a->n; ++k) + if (a->a[k].secondary < 0 && !a->a[k].is_alt && a->a[k].score >= T) ++n_pri; + if (n_pri <= 1) return; // only one alignment + for (k = 0; k < a->n; ++k) { + mem_alnreg_t *p = &a->a[k]; + if (p->secondary >= 0 || p->is_alt || p->score < T) continue; + if (p->qb < left_st) left_st = p->qb, left_k = k; + } + assert(a->a[0].secondary < 0); + if (left_k == 0) return; // no need to reorder + t = a->a[0], a->a[0] = a->a[left_k], a->a[left_k] = t; + for (k = 1; k < a->n; ++k) { // update secondary and secondary_all + mem_alnreg_t *p = &a->a[k]; + if (p->secondary == 0) p->secondary = left_k; + else if (p->secondary == left_k) p->secondary = 0; + if (p->secondary_all == 0) p->secondary_all = left_k; + else if (p->secondary_all == left_k) p->secondary_all = 0; + } +} + +// TODO (future plan): group hits into a uint64_t[] array. This will be cleaner and more flexible +void mem_reg2sam(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, bseq1_t *s, mem_alnreg_v *a, int extra_flag, const mem_aln_t *m, seq_sam_t *ss) +{ + extern char **mem_gen_alt(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, mem_alnreg_v *a, int l_query, const char *query); + // kstring_t str; + kvec_t(mem_aln_t) aa; + int k, l; + char **XA = 0; + + if (!(opt->flag & MEM_F_ALL)) + XA = mem_gen_alt(opt, bns, pac, a, s->l_seq, s->seq); + kv_init(aa); + // str.l = str.m = 0; str.s = 0; + ss->sam.l = 0; + for (k = l = 0; k < a->n; ++k) { + mem_alnreg_t *p = &a->a[k]; + mem_aln_t *q; + if (p->score < opt->T) continue; + if (p->secondary >= 0 && (p->is_alt || !(opt->flag&MEM_F_ALL))) continue; + if (p->secondary >= 0 && p->secondary < INT_MAX && p->score < a->a[p->secondary].score * opt->drop_ratio) continue; + q = kv_pushp(mem_aln_t, aa); + *q = mem_reg2aln(opt, bns, pac, s->l_seq, s->seq, p); + assert(q->rid >= 0); // this should not happen with the new code + q->XA = XA? XA[k] : 0; + q->flag |= extra_flag; // flag secondary + if (p->secondary >= 0) q->sub = -1; // don't output sub-optimal score + if (l && p->secondary < 0) // if supplementary + q->flag |= (opt->flag&MEM_F_NO_MULTI)? 0x10000 : 0x800; + if (!(opt->flag & MEM_F_KEEP_SUPP_MAPQ) && l && !p->is_alt && q->mapq > aa.a[0].mapq) + q->mapq = aa.a[0].mapq; // lower mapq for supplementary mappings, unless -5 or -q is applied + ++l; + } + if (aa.n == 0) { // no alignments good enough; then write an unaligned record + mem_aln_t t; + t = mem_reg2aln(opt, bns, pac, s->l_seq, s->seq, 0); + t.flag |= extra_flag; + mem_aln2sam(opt, bns, &ss->sam, s, 1, &t, 0, m); + } else { + for (k = 0; k < aa.n; ++k) + mem_aln2sam(opt, bns, &ss->sam, s, aa.n, aa.a, k, m); + for (k = 0; k < aa.n; ++k) free(aa.a[k].cigar); + free(aa.a); + } + // s->sam = str.s; + if (XA) { + for (k = 0; k < a->n; ++k) free(XA[k]); + free(XA); + } +} + +mem_alnreg_v mem_align1_core(const mem_opt_t *opt, const FMTIndex *fmt, const bntseq_t *bns, const uint8_t *pac, int l_seq, char *seq, void *buf) +{ + int i; + mem_chain_v chn; + mem_alnreg_v regs; + + for (i = 0; i < l_seq; ++i) // convert to 2-bit encoding if we have not done so + seq[i] = seq[i] < 4? seq[i] : nst_nt4_table[(int)seq[i]]; + + chn = mem_chain(opt, fmt, bns, l_seq, (uint8_t*)seq, buf); + chn.n = mem_chain_flt(opt, chn.n, chn.a); + mem_flt_chained_seeds(opt, bns, pac, l_seq, (uint8_t *)seq, chn.n, chn.a, ((smem_aux_t *)buf)->seq_buf); + if (bwa_verbose >= 4) mem_print_chain(bns, &chn); + + kv_init(regs); + for (i = 0; i < chn.n; ++i) { + mem_chain_t *p = &chn.a[i]; + if (bwa_verbose >= 4) err_printf("* ---> Processing chain(%d) <---\n", i); + mem_chain2aln(opt, bns, pac, l_seq, (uint8_t*)seq, p, ®s, buf, 0); + free(chn.a[i].seeds); + } + free(chn.a); + regs.n = mem_sort_dedup_patch(opt, bns, pac, (uint8_t*)seq, regs.n, regs.a); + if (bwa_verbose >= 4) { + err_printf("* %ld chains remain after removing duplicated chains\n", regs.n); + for (i = 0; i < regs.n; ++i) { + mem_alnreg_t *p = ®s.a[i]; + printf("** %d, [%d,%d) <=> [%ld,%ld)\n", p->score, p->qb, p->qe, (long)p->rb, (long)p->re); + } + } + for (i = 0; i < regs.n; ++i) { + mem_alnreg_t *p = ®s.a[i]; + if (p->rid >= 0 && bns->anns[p->rid].is_alt) + p->is_alt = 1; + } + return regs; +} + +mem_aln_t mem_reg2aln(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_query, const char *query_, const mem_alnreg_t *ar) +{ + mem_aln_t a; + int i, w2, tmp, qb, qe, NM, score, is_rev, last_sc = -(1<<30), l_MD; + int64_t pos, rb, re; + uint8_t *query; + + memset(&a, 0, sizeof(mem_aln_t)); + if (ar == 0 || ar->rb < 0 || ar->re < 0) { // generate an unmapped record + a.rid = -1; a.pos = -1; a.flag |= 0x4; + return a; + } + qb = ar->qb, qe = ar->qe; + rb = ar->rb, re = ar->re; + query = malloc(l_query); + for (i = 0; i < l_query; ++i) // convert to the nt4 encoding + query[i] = query_[i] < 5? query_[i] : nst_nt4_table[(int)query_[i]]; + a.mapq = ar->secondary < 0? mem_approx_mapq_se(opt, ar) : 0; + if (ar->secondary >= 0) a.flag |= 0x100; // secondary alignment + tmp = infer_bw(qe - qb, re - rb, ar->truesc, opt->a, opt->o_del, opt->e_del); + w2 = infer_bw(qe - qb, re - rb, ar->truesc, opt->a, opt->o_ins, opt->e_ins); + w2 = w2 > tmp? w2 : tmp; + if (bwa_verbose >= 4) printf("* Band width: inferred=%d, cmd_opt=%d, alnreg=%d\n", w2, opt->w, ar->w); + if (w2 > opt->w) w2 = w2 < ar->w? w2 : ar->w; + i = 0; a.cigar = 0; + do { + free(a.cigar); + w2 = w2 < opt->w<<2? w2 : opt->w<<2; + a.cigar = bwa_gen_cigar2(opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, w2, bns->l_pac, pac, qe - qb, (uint8_t*)&query[qb], rb, re, &score, &a.n_cigar, &NM); + if (bwa_verbose >= 4) printf("* Final alignment: w2=%d, global_sc=%d, local_sc=%d\n", w2, score, ar->truesc); + if (score == last_sc || w2 == opt->w<<2) break; // it is possible that global alignment and local alignment give different scores + last_sc = score; + w2 <<= 1; + } while (++i < 3 && score < ar->truesc - opt->a); + l_MD = strlen((char*)(a.cigar + a.n_cigar)) + 1; + a.NM = NM; + pos = bns_depos(bns, rb < bns->l_pac? rb : re - 1, &is_rev); + a.is_rev = is_rev; + if (a.n_cigar > 0) { // squeeze out leading or trailing deletions + if ((a.cigar[0]&0xf) == 2) { + pos += a.cigar[0]>>4; + --a.n_cigar; + memmove(a.cigar, a.cigar + 1, a.n_cigar * 4 + l_MD); + } else if ((a.cigar[a.n_cigar-1]&0xf) == 2) { + --a.n_cigar; + memmove(a.cigar + a.n_cigar, a.cigar + a.n_cigar + 1, l_MD); // MD needs to be moved accordingly + } + } + if (qb != 0 || qe != l_query) { // add clipping to CIGAR + int clip5, clip3; + clip5 = is_rev? l_query - qe : qb; + clip3 = is_rev? qb : l_query - qe; + a.cigar = realloc(a.cigar, 4 * (a.n_cigar + 2) + l_MD); + if (clip5) { + memmove(a.cigar+1, a.cigar, a.n_cigar * 4 + l_MD); // make room for 5'-end clipping + a.cigar[0] = clip5<<4 | 3; + ++a.n_cigar; + } + if (clip3) { + memmove(a.cigar + a.n_cigar + 1, a.cigar + a.n_cigar, l_MD); // make room for 3'-end clipping + a.cigar[a.n_cigar++] = clip3<<4 | 3; + } + } + a.rid = bns_pos2rid(bns, pos); + assert(a.rid == ar->rid); + a.pos = pos - bns->anns[a.rid].offset; + a.score = ar->score; a.sub = ar->sub > ar->csub? ar->sub : ar->csub; + a.is_alt = ar->is_alt; a.alt_sc = ar->alt_sc; + free(query); + return a; +} + +static void worker_sam(void *data, int i, int tid) +{ + extern int mem_sam_pe(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, const mem_pestat_t pes[4], uint64_t id, bseq1_t s[2], mem_alnreg_v a[2], seq_sam_t ss[2], int tid); + extern void mem_reg2ovlp(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, bseq1_t *s, mem_alnreg_v *a); + mem_worker_t *w = (mem_worker_t*)data; + if (!(w->opt->flag&MEM_F_PE)) { + if (bwa_verbose >= 4) printf("=====> Finalizing read '%s' <=====\n", w->seqs[i].name); + mem_mark_primary_se(w->opt, w->regs[i].n, w->regs[i].a, w->n_processed + i); + if (w->opt->flag & MEM_F_PRIMARY5) mem_reorder_primary5(w->opt->T, &w->regs[i]); + mem_reg2sam(w->opt, w->bns, w->pac, &w->seqs[i], &w->regs[i], 0, 0, &w->sams[i]); + free(w->regs[i].a); + } else { + if (bwa_verbose >= 4) printf("=====> Finalizing read pair '%s' <=====\n", w->seqs[i<<1|0].name); + mem_sam_pe(w->opt, w->bns, w->pac, w->pes, (w->n_processed>>1) + i, &w->seqs[i<<1], &w->regs[i<<1], &w->sams[i<<1], tid); + free(w->regs[i<<1|0].a); free(w->regs[i<<1|1].a); + } +} + +static smem_aux_t *smem_aux_init() +{ + smem_aux_t *a; + a = calloc(1, sizeof(smem_aux_t)); + a->tmpv[0] = calloc(1, sizeof(bwtintv_v)); + a->tmpv[1] = calloc(1, sizeof(bwtintv_v)); + a->sw_buf = calloc(1, sizeof(buf_t)); + a->seq_buf = calloc(1, sizeof(buf_t)); + return a; +} + +static void smem_aux_destroy(smem_aux_t *a) +{ + free(a->tmpv[0]->a); free(a->tmpv[0]); + free(a->tmpv[1]->a); free(a->tmpv[1]); + free(a->mem.a); free(a->mem1.a); + free(a); +} + +// +mem_worker_t *init_mem_worker(const mem_opt_t *opt, const FMTIndex *fmt, const ERT *ert, const bntseq_t *bns, const uint8_t *pac, int useERT) +{ + int i = opt->n_threads, j; + mem_worker_t *w = calloc(1, sizeof(mem_worker_t)); + w->opt = opt; w->bns = bns; w->pac = pac; w->fmt = fmt; w->ert = ert; w->useERT = useERT; + w->calc_isize = 0; w->n = 0; w->regs = 0; + w->aux = malloc(i * sizeof(smem_aux_t)); + w->smem_arr = malloc(i * sizeof(smem_v *)); + w->chain_arr = malloc(i * sizeof(mem_chain_v *)); + w->isize_arr = malloc(i * sizeof(uint64_v *)); + + for (i = 0; i < opt->n_threads; ++i) { + w->aux[i] = smem_aux_init(); + w->smem_arr[i] = malloc(opt->batch_size * sizeof(smem_v)); + w->chain_arr[i] = malloc(opt->batch_size * sizeof(mem_chain_v)); + w->isize_arr[i] = calloc(4, sizeof(uint64_v)); + for (j = 0; j < opt->batch_size; ++j) { + kv_init(w->smem_arr[i][j].mem); + kv_init(w->smem_arr[i][j].pos_arr); + kv_init(w->chain_arr[i][j]); + } + } + return w; +} + +static void mem_collect_intv_batch(const mem_opt_t *opt, const FMTIndex *fmt, int len, const uint8_t *seq, smem_v *smem, smem_aux_t *a, int tid) +{ + int i, k, x = 0, old_n; + int start_width = 1; + int split_len = (int)(opt->min_seed_len * opt->split_factor + .499); + int max_seed_len = 0; + int start_N_num = 0, start_flag = 1; + smem->mem.n = 0; + // 1. first pass: find all SMEMs + // goto third_seed; + PROF_START(seed_1); + while (x < len) { + if (seq[x] < 4) { + start_flag = 0; + x = fmt_smem(fmt, len, seq, x, start_width, opt->min_seed_len, 0, &a->mem1, a->tmpv[0]); + for (i = 0; i < a->mem1.n; ++i) { + bwtintv_t *p = &a->mem1.a[i]; + int slen = (uint32_t)p->info - (p->info >> 32); // seed length + max_seed_len = MAX(max_seed_len, slen); + if (slen >= opt->min_seed_len) { + kv_push(bwtintv_t, smem->mem, *p); + } + } + // break; // for test + } else { + ++x; + if (start_flag) ++start_N_num; + } + } + PROF_END(tprof[T_SEED_1][tid], seed_1); + //goto third_seed; +#ifdef FILTER_FULL_MATCH + if (max_seed_len == len - start_N_num) { + goto collect_intv_end; + } +#endif + // 2. second pass: find MEMs inside a long SMEM + PROF_START(seed_2); + old_n = smem->mem.n; + for (k = 0; k < old_n; ++k) { + bwtintv_t *p = &smem->mem.a[k]; + int start = p->info>>32, end = (int32_t)p->info; + if (end - start < split_len || p->x[2] > opt->split_width) continue; + fmt_smem(fmt, len, seq, (start + end) >> 1, p->x[2] + 1, opt->min_seed_len, p, &a->mem1, a->tmpv[0]); + for (i = 0; i < a->mem1.n; ++i) { + bwtintv_t *p = &a->mem1.a[i]; + int slen = (uint32_t)p->info - (p->info >> 32); + if (slen >= opt->min_seed_len) { + kv_push(bwtintv_t, smem->mem, a->mem1.a[i]); + } + } + } + PROF_END(tprof[T_SEED_2][tid], seed_2); + +//third_seed: + // 3. third pass: LAST-like + PROF_START(seed_3); + if (opt->max_mem_intv > 0) { + x = 0; + while (x < len) { + if (seq[x] < 4) { + bwtintv_t m; + x = fmt_seed_strategy1(fmt, len, seq, x, opt->min_seed_len, opt->max_mem_intv, &m); + if (m.x[2] > 0) { + kv_push(bwtintv_t, smem->mem, m); + } + } else ++x; + } + } + PROF_END(tprof[T_SEED_3][tid], seed_3); + +#ifdef FILTER_FULL_MATCH +collect_intv_end: +#endif + // sort + ks_introsort(mem_intv, smem->mem.n, smem->mem.a); +} + +void find_smem(const mem_opt_t *opt, const FMTIndex *fmt, int len, const uint8_t *seq, smem_aux_t *aux, smem_v *smemv, int tid) +{ + int i, j; + + if (len < opt->min_seed_len) return; // if the query is shorter than the seed length, no match + mem_collect_intv_batch(opt, fmt, len, seq, smemv, aux, tid); + smemv->pos_arr.n = 0; + for (i=0; imem.n; ++i) { + bwtintv_t *p = &smemv->mem.a[i]; + int step, count; // seed length + int64_t k; + if (p->num_match > 0) { + for (j = 0; j < p->num_match; ++j) + { + uint64_t pos = p->rm[j].rs; + if (p->rm[j].reverse) pos = (fmt->l_pac << 1) - 1 - pos; + kv_push(uint64_t, smemv->pos_arr, pos); + } + } else { + step = p->x[2] > opt->max_occ ? p->x[2] / opt->max_occ : 1; + for (k = count = 0; k < p->x[2] && count < opt->max_occ; k += step, ++count) + { + PROF_START(sal); + uint64_t pos = fmt_sa_offset(fmt, p->x[0] + k); // this is the base coordinate in the forward-reverse reference + PROF_END(tprof[T_SAL][tid], sal); + kv_push(uint64_t, smemv->pos_arr, pos); + } + } + } +} + +void generate_chain(const mem_opt_t *opt, const FMTIndex *fmt, const bntseq_t *bns, int len, const uint8_t *seq, smem_v *smemv, mem_chain_v *chain, int tid) +{ + int i, j, b, e, l_rep; + int64_t l_pac = bns->l_pac; + kbtree_t(chn) * tree; + chain->n = 0; + + if (len < opt->min_seed_len) return; // if the query is shorter than the seed length, no match + tree = kb_init(chn, KB_DEFAULT_SIZE); + +#define CHECK_ADD_CHAIN(tmp, lower, upper) \ + int rid, to_add = 0; \ + mem_chain_t tmp, *lower, *upper; \ + tmp.pos = s.rbeg; \ + s.qbeg = p->info >> 32; \ + s.score = s.len = slen; \ + rid = bns_intv2rid(bns, s.rbeg, s.rbeg + s.len); \ + if (rid < 0) \ + continue; \ + if (kb_size(tree)) \ + { \ + kb_intervalp(chn, tree, &tmp, &lower, &upper); \ + if (!lower || !test_and_merge(opt, l_pac, lower, &s, rid)) \ + to_add = 1; \ + } \ + else \ + to_add = 1; \ + if (to_add) \ + { \ + tmp.n = 1; \ + tmp.m = 4; \ + tmp.seeds = calloc(tmp.m, sizeof(mem_seed_t)); \ + tmp.seeds[0] = s; \ + tmp.rid = rid; \ + tmp.is_alt = !!bns->anns[rid].is_alt; \ + kb_putp(chn, tree, &tmp); \ + } + + for (i = 0, b = e = l_rep = 0; i < smemv->mem.n; ++i) { // compute frac_rep + bwtintv_t *p = &smemv->mem.a[i]; + int sb = (p->info >> 32), se = (uint32_t)p->info; + if (p->x[2] <= opt->max_occ) continue; + if (sb > e) l_rep += e - b, b = sb, e = se; + else e = e > se ? e : se; + } + l_rep += e - b; + for (i = 0, j = 0; i < smemv->mem.n; ++i) { + bwtintv_t *p = &smemv->mem.a[i]; + int step, count, slen = (uint32_t)p->info - (p->info >> 32); // seed length + int64_t k; + if (p->num_match > 0) { + + for (k = 0; k < p->num_match; ++k) + { + mem_seed_t s; + s.rbeg = smemv->pos_arr.a[j++]; + CHECK_ADD_CHAIN(tmp, lower, upper); + } + } else { + step = p->x[2] > opt->max_occ ? p->x[2] / opt->max_occ : 1; + for (k = count = 0; k < p->x[2] && count < opt->max_occ; k += step, ++count) + { + mem_seed_t s; + uint64_t sa = smemv->pos_arr.a[j++]; + uint64_t sa_idx = sa << 16 >> 16; + s.rbeg = (sa >> 48) + bwt_get_sa((uint8_t *)fmt->sa, sa_idx); + // fprintf(gf[1], "%ld, %ld, %d\n", s.rbeg, p->info >> 32, (uint32_t)p->info); + CHECK_ADD_CHAIN(tmp, lower, upper); + } + } + } + if (chain->m < kb_size(tree)) { + kv_resize(mem_chain_t, *chain, kb_size(tree)); + } + +#define traverse_func(p_) (chain->a[chain->n++] = *(p_)) + __kb_traverse(mem_chain_t, tree, traverse_func); +#undef traverse_func + + for (i = 0; i < chain->n; ++i) chain->a[i].frac_rep = (float)l_rep / len; + if (bwa_verbose >= 4) printf("* fraction of repetitive seeds: %.3f\n", (float)l_rep / len); + kb_destroy(chn, tree); +} + +static inline int mem_infer_dir(int64_t l_pac, int64_t b1, int64_t b2, int64_t *dist) +{ + int64_t p2; + int r1 = (b1 >= l_pac), r2 = (b2 >= l_pac); + p2 = r1 == r2 ? b2 : (l_pac << 1) - 1 - b2; // p2 is the coordinate of read 2 on the read 1 strand + *dist = p2 > b1 ? p2 - b1 : b1 - p2; + return (r1 == r2 ? 0 : 1) ^ (p2 > b1 ? 0 : 3); +} + +static int cal_sub(const mem_opt_t *opt, mem_alnreg_v *r) +{ + int j; + for (j = 1; j < r->n; ++j) { // choose unique alignment + int b_max = r->a[j].qb > r->a[0].qb? r->a[j].qb : r->a[0].qb; + int e_min = r->a[j].qe < r->a[0].qe? r->a[j].qe : r->a[0].qe; + if (e_min > b_max) { // have overlap + int min_l = r->a[j].qe - r->a[j].qb < r->a[0].qe - r->a[0].qb? r->a[j].qe - r->a[j].qb : r->a[0].qe - r->a[0].qb; + if (e_min - b_max >= min_l * opt->mask_level) break; // significant overlap + } + } + return j < r->n? r->a[j].score : opt->min_seed_len * opt->a; +} +// mem +void mem_core_process(const mem_opt_t *opt, const FMTIndex *fmt, const bntseq_t *bns, const uint8_t *pac, + bseq1_t *seq_arr, int nseq, smem_aux_t *aux, smem_v *smem_arr, mem_chain_v *chain_arr, mem_alnreg_v *reg_arr, + int calc_isize, int64_t l_pac, uint64_v *isize, int tid) +{ + int i, j, l_seq; + mem_chain_v *chnp; + mem_alnreg_v *regp; + char *seq; + + // 1. seeding + PROF_START(seed_all); + for (i = 0; i < nseq; ++i) { + seq = seq_arr[i].seq; + l_seq = seq_arr[i].l_seq; + for (j = 0; j < l_seq; ++j) { + seq[j] = seq[j] < 4 ? seq[j] : nst_nt4_table[(int)seq[j]]; + } + find_smem(opt, fmt, l_seq, (uint8_t *)seq, aux, &smem_arr[i], tid); + } + PROF_END(tprof[T_SEED_ALL][tid], seed_all); + + // 2. chain + PROF_START(chain_all); + for (i=0; in = mem_chain_flt(opt, chnp->n, chnp->a); + PROF_END(tprof[T_FLT_CHAIN][tid], flt_chain); + PROF_START(flt_chained_seeds); + mem_flt_chained_seeds(opt, bns, pac, l_seq, (uint8_t*)seq, chnp->n, chnp->a, aux->seq_buf); + PROF_END(tprof[T_FLT_CHANNED_SEEDS][tid], flt_chained_seeds); + if (bwa_verbose >= 4) mem_print_chain(bns, chnp); + } + PROF_END(tprof[T_CHAIN_ALL][tid], chain_all); + + // 3. align + PROF_START(aln_all); + for (i=0; in; ++j) { + mem_chain_t *p = &chnp->a[j]; + if (bwa_verbose >= 4) err_printf("* ---> Processing chain(%d) <---\n", j); + mem_chain2aln(opt, bns, pac, l_seq, (uint8_t*)seq, p, regp, aux, tid); + free(chnp->a[j].seeds); + } + + free(chnp->a); chnp->m = 0; chnp->a = 0; + regp->n = mem_sort_dedup_patch(opt, bns, pac, (uint8_t *)seq, regp->n, regp->a); + if (bwa_verbose >= 4) { + err_printf("* %ld chains remain after removing duplicated chains\n", regp->n); + for (j = 0; j < regp->n; ++j) { + mem_alnreg_t *p = ®p->a[j]; + printf("** %d, [%d,%d) <=> [%ld,%ld)\n", p->score, p->qb, p->qe, (long)p->rb, (long)p->re); + } + } + for (j = 0; j < regp->n; ++j) { + mem_alnreg_t *p = ®p->a[j]; + if (p->rid >= 0 && bns->anns[p->rid].is_alt) + p->is_alt = 1; + } + } + PROF_END(tprof[T_ALN_ALL][tid], aln_all); + +#if 1 + // 4. calc insert size + +#define MIN_RATIO 0.8 + if (calc_isize) { + PROF_START(ins_size); + for (i = 0; i < nseq>>1; ++i) { + int dir; + int64_t is; + mem_alnreg_v *r[2]; + r[0] = (mem_alnreg_v*)®_arr[i<<1|0]; + r[1] = (mem_alnreg_v*)®_arr[i<<1|1]; + if (r[0]->n == 0 || r[1]->n == 0) continue; + if (cal_sub(opt, r[0]) > MIN_RATIO * r[0]->a[0].score) continue; + if (cal_sub(opt, r[1]) > MIN_RATIO * r[1]->a[0].score) continue; + if (r[0]->a[0].rid != r[1]->a[0].rid) continue; // not on the same chr + dir = mem_infer_dir(l_pac, r[0]->a[0].rb, r[1]->a[0].rb, &is); + if (is && is <= opt->max_ins) kv_push(uint64_t, isize[dir], is); + } + PROF_END(tprof[T_INS_SIZE][tid], ins_size); + } +#endif +} + +// smem,chain,align +static void worker_smem_align(void *data, int i, int tid) +{ + mem_worker_t *w = (mem_worker_t *)data; + int start = i * w->opt->batch_size; + int end = MIN(start + w->opt->batch_size, w->n_reads); + mem_core_process(w->opt, w->fmt, w->bns, w->pac, w->seqs + start, end - start, w->aux[tid], w->smem_arr[tid], w->chain_arr[tid], w->regs + start, w->calc_isize, w->bns->l_pac, w->isize_arr[tid], tid); +} + +void mem_process_seqs(const mem_opt_t *opt, mem_worker_t *w, int64_t n_processed, int n, bseq1_t *seqs, const mem_pestat_t *pes0, seq_sam_t *sams) +{ + extern void kt_for(int n_threads, void (*func)(void *, int, int), void *data, int n); + PROF_START(mem_prepare); + mem_pestat_t pes[4]; + int batch_size = opt->batch_size; // pair-end,2,pair-end + int n_batch = (n + batch_size - 1) / batch_size; + double ctime, rtime; + ctime = cputime(); rtime = realtime(); + global_bns = w->bns; + + w->opt = opt; + if (w->n < n) { + w->n = n; + w->regs = realloc(w->regs, n * sizeof(mem_alnreg_v)); + } + w->seqs = seqs; w->n_processed = n_processed; w->sams = sams; + w->n_reads = n; w->pes = &pes[0]; + +#if 1 + if ((opt->flag & MEM_F_PE) && !pes0) { // infer insert sizes if not provided + int i, j; + w->calc_isize = 1; + for (i = 0; i < opt->n_threads; ++i) + for (j = 0; j < 4; ++j) + w->isize_arr[i][j].n = 0; + } +#endif + PROF_END(gprof[G_MEM_PREPARE], mem_prepare); + + PROF_START(kernel); + kt_for(opt->n_threads, worker_smem_align, w, n_batch); // find mapping positions + PROF_END(gprof[G_MEM_KERNEL], kernel); + + PROF_START(pestat); + if (opt->flag&MEM_F_PE) { // infer insert sizes if not provided + if (pes0) memcpy(pes, pes0, 4 * sizeof(mem_pestat_t)); // if pes0 != NULL, set the insert-size distribution as pes0 + else mem_pestat(opt, w->bns->l_pac, n, w->isize_arr, pes); // otherwise, infer the insert size distribution from data + //else mem_pestat_old(opt, w->bns->l_pac, n, w->regs, pes); + } + PROF_END(gprof[G_MEM_PESTAT], pestat); + + PROF_START(mem_sam); + kt_for(opt->n_threads, worker_sam, w, (opt->flag&MEM_F_PE)? n>>1 : n); // generate alignment + PROF_END(gprof[G_MEM_SAM], mem_sam); + + //free(w.regs); + if (bwa_verbose >= 3) + fprintf(stderr, "[M::%s] Processed %d reads in %.3f CPU sec, %.3f real sec\n", __func__, n, cputime() - ctime, realtime() - rtime); +} diff --git a/bwamem.h b/bwamem.h new file mode 100644 index 0000000..e7fe380 --- /dev/null +++ b/bwamem.h @@ -0,0 +1,266 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#ifndef BWAMEM_H_ +#define BWAMEM_H_ + +#include "bwt.h" +#include "bntseq.h" +#include "bwa.h" +#include "fmt_idx.h" +#include "utils.h" + +#define MEM_MAPQ_COEF 30.0 +#define MEM_MAPQ_MAX 60 + +struct __smem_i; +typedef struct __smem_i smem_i; + +#define MEM_F_PE 0x2 +#define MEM_F_NOPAIRING 0x4 +#define MEM_F_ALL 0x8 +#define MEM_F_NO_MULTI 0x10 +#define MEM_F_NO_RESCUE 0x20 +#define MEM_F_REF_HDR 0x100 +#define MEM_F_SOFTCLIP 0x200 +#define MEM_F_SMARTPE 0x400 +#define MEM_F_PRIMARY5 0x800 +#define MEM_F_KEEP_SUPP_MAPQ 0x1000 +#define MEM_F_XB 0x2000 + +typedef struct { + int a, b; // match score and mismatch penalty + int o_del, e_del; + int o_ins, e_ins; + int pen_unpaired; // phred-scaled penalty for unpaired reads + int pen_clip5,pen_clip3;// clipping penalty. This score is not deducted from the DP score. + int w; // band width + int zdrop; // Z-dropoff + + uint64_t max_mem_intv; + + int T; // output score threshold; only affecting output + int flag; // see MEM_F_* macros + int min_seed_len; // minimum seed length + int min_chain_weight; + int max_chain_extend; + float split_factor; // split into a seed if MEM is longer than min_seed_len*split_factor + int split_width; // split into a seed if its occurence is smaller than this value + int max_occ; // skip a seed if its occurence is larger than this value + int max_chain_gap; // do not chain seed if it is max_chain_gap-bp away from the closest seed + int n_threads; // number of threads + int batch_size; // batch size of seqs to process at one time + int chunk_size; // process chunk_size-bp sequences in a batch + float mask_level; // regard a hit as redundant if the overlap with another better hit is over mask_level times the min length of the two hits + float drop_ratio; // drop a chain if its seed coverage is below drop_ratio times the seed coverage of a better chain overlapping with the small chain + float XA_drop_ratio; // when counting hits for the XA tag, ignore alignments with score < XA_drop_ratio * max_score; only effective for the XA tag + float mask_level_redun; + float mapQ_coef_len; + int mapQ_coef_fac; + int max_ins; // when estimating insert size distribution, skip pairs with insert longer than this value + int max_matesw; // perform maximally max_matesw rounds of mate-SW for each end + int max_XA_hits, max_XA_hits_alt; // if there are max_hits or fewer, output them all + int8_t mat[25]; // scoring matrix; mat[0] == 0 if unset +} mem_opt_t; + +typedef struct { + int64_t rb, re; // [rb,re): reference sequence in the alignment + int qb, qe; // [qb,qe): query sequence in the alignment + int rid; // reference seq ID + int score; // best local SW score + int truesc; // actual score corresponding to the aligned region; possibly smaller than $score + int sub; // 2nd best SW score + int alt_sc; + int csub; // SW score of a tandem hit + int sub_n; // approximate number of suboptimal hits + int w; // actual band width used in extension + int seedcov; // length of regions coverged by seeds + int secondary; // index of the parent hit shadowing the current hit; <0 if primary + int secondary_all; + int seedlen0; // length of the starting seed + int n_comp:30, is_alt:2; // number of sub-alignments chained together + float frac_rep; + uint64_t hash; +} mem_alnreg_t; + +typedef struct { size_t n, m; mem_alnreg_t *a; } mem_alnreg_v; + +typedef struct { + int low, high; // lower and upper bounds within which a read pair is considered to be properly paired + int failed; // non-zero if the orientation is not supported by sufficient data + double avg, std; // mean and stddev of the insert size distribution +} mem_pestat_t; + +typedef struct { // This struct is only used for the convenience of API. + int64_t pos; // forward strand 5'-end mapping position + int rid; // reference sequence index in bntseq_t; <0 for unmapped + int flag; // extra flag + uint32_t is_rev:1, is_alt:1, mapq:8, NM:22; // is_rev: whether on the reverse strand; mapq: mapping quality; NM: edit distance + int n_cigar; // number of CIGAR operations + uint32_t *cigar; // CIGAR in the BAM encoding: opLen<<4|op; op to integer mapping: MIDSH=>01234 + char *XA; // alternative mappings + + int score, sub, alt_sc; +} mem_aln_t; + +typedef struct { + int64_t rbeg; + int32_t qbeg, len; + int score; +} mem_seed_t; // unaligned memory + +typedef struct { + int n, m, first, rid; + uint32_t w:29, kept:2, is_alt:1; + float frac_rep; + int64_t pos; + mem_seed_t *seeds; +} mem_chain_t; + +typedef struct { size_t n, m; mem_chain_t *a; } mem_chain_v; + +typedef struct { + bwtintv_v mem, mem1, *tmpv[2]; + buf_t *sw_buf, *seq_buf; +} smem_aux_t; + +typedef struct { + bwtintv_v mem; + uint64_v pos_arr; +} smem_v; + +typedef struct { + int calc_isize; + const mem_opt_t *opt; + const bwt_t *bwt; + const FMTIndex *fmt; + const ERT *ert; + const bntseq_t *bns; + const uint8_t *pac; + const mem_pestat_t *pes; + smem_aux_t **aux; + bseq1_t *seqs; + seq_sam_t *sams; + smem_v **smem_arr; + mem_chain_v **chain_arr; + mem_alnreg_v *regs; + uint64_v **isize_arr; + int64_t n_processed; + int64_t n; + int64_t n_reads; + int useERT; +} mem_worker_t; + +#ifdef __cplusplus +extern "C" { +#endif + mem_worker_t *init_mem_worker(const mem_opt_t *opt, const FMTIndex *fmt, const ERT *ert, const bntseq_t *bns, const uint8_t *pac, int useERT); + + smem_i *smem_itr_init(const bwt_t *bwt); + void smem_itr_destroy(smem_i *itr); + void smem_set_query(smem_i *itr, int len, const uint8_t *query); + void smem_config(smem_i *itr, int min_intv, int max_len, uint64_t max_intv); + const bwtintv_v *smem_next(smem_i *itr); + + mem_opt_t *mem_opt_init(void); + void mem_fill_scmat(int a, int b, int8_t mat[25]); + + /** + * Align a batch of sequences and generate the alignments in the SAM format + * + * This routine requires $seqs[i].{l_seq,seq,name} and write $seqs[i].sam. + * Note that $seqs[i].sam may consist of several SAM lines if the + * corresponding sequence has multiple primary hits. + * + * In the paired-end mode (i.e. MEM_F_PE is set in $opt->flag), query + * sequences must be interleaved: $n must be an even number and the 2i-th + * sequence and the (2i+1)-th sequence constitute a read pair. In this + * mode, there should be enough (typically >50) unique pairs for the + * routine to infer the orientation and insert size. + * + * @param opt alignment parameters + * @param bwt FM-index of the reference sequence + * @param bns Information of the reference + * @param pac 2-bit encoded reference + * @param n number of query sequences + * @param seqs query sequences; $seqs[i].seq/sam to be modified after the call + * @param pes0 insert-size info; if NULL, infer from data; if not NULL, it should be an array with 4 elements, + * corresponding to each FF, FR, RF and RR orientation. See mem_pestat() for more info. + */ + void mem_process_seqs(const mem_opt_t *opt, mem_worker_t *w, int64_t n_processed, int n, bseq1_t *seqs, const mem_pestat_t *pes0, seq_sam_t *sams); + + /** + * Find the aligned regions for one query sequence + * + * Note that this routine does not generate CIGAR. CIGAR should be + * generated later by mem_reg2aln() below. + * + * @param opt alignment parameters + * @param bwt FM-index of the reference sequence + * @param bns Information of the reference + * @param pac 2-bit encoded reference + * @param l_seq length of query sequence + * @param seq query sequence + * + * @return list of aligned regions. + */ + mem_alnreg_v mem_align1(const mem_opt_t *opt, const bwt_t *bwt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq); + + /** + * Generate CIGAR and forward-strand position from alignment region + * + * @param opt alignment parameters + * @param bns Information of the reference + * @param pac 2-bit encoded reference + * @param l_seq length of query sequence + * @param seq query sequence + * @param ar one alignment region + * + * @return CIGAR, strand, mapping quality and forward-strand position + */ + mem_aln_t mem_reg2aln(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq, const mem_alnreg_t *ar); + mem_aln_t mem_reg2aln2(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq, const mem_alnreg_t *ar, const char *name); + + /** + * Infer the insert size distribution from interleaved alignment regions + * + * This function can be called after mem_align1(), as long as paired-end + * reads are properly interleaved. + * + * @param opt alignment parameters + * @param l_pac length of concatenated reference sequence + * @param n number of query sequences; must be an even number + * @param regs region array of size $n; 2i-th and (2i+1)-th elements constitute a pair + * @param pes inferred insert size distribution (output) + */ + void mem_pestat_old(const mem_opt_t *opt, int64_t l_pac, int n, const mem_alnreg_v *regs, mem_pestat_t pes[4]); + void mem_pestat(const mem_opt_t *opt, int64_t l_pac, int n, uint64_v **isize_arr, mem_pestat_t pes[4]); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bwamem_extra.c b/bwamem_extra.c new file mode 100644 index 0000000..c47b93f --- /dev/null +++ b/bwamem_extra.c @@ -0,0 +1,172 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include "bwa.h" +#include "bwamem.h" +#include "bntseq.h" +#include "kstring.h" + +/*************************** + * SMEM iterator interface * + ***************************/ + +struct __smem_i { + const bwt_t *bwt; + const uint8_t *query; + int start, len; + int min_intv, max_len; + uint64_t max_intv; + bwtintv_v *matches; // matches; to be returned by smem_next() + bwtintv_v *sub; // sub-matches inside the longest match; temporary + bwtintv_v *tmpvec[2]; // temporary arrays +}; + +smem_i *smem_itr_init(const bwt_t *bwt) +{ + smem_i *itr; + itr = calloc(1, sizeof(smem_i)); + itr->bwt = bwt; + itr->tmpvec[0] = calloc(1, sizeof(bwtintv_v)); + itr->tmpvec[1] = calloc(1, sizeof(bwtintv_v)); + itr->matches = calloc(1, sizeof(bwtintv_v)); + itr->sub = calloc(1, sizeof(bwtintv_v)); + itr->min_intv = 1; + itr->max_len = INT_MAX; + itr->max_intv = 0; + return itr; +} + +void smem_itr_destroy(smem_i *itr) +{ + free(itr->tmpvec[0]->a); free(itr->tmpvec[0]); + free(itr->tmpvec[1]->a); free(itr->tmpvec[1]); + free(itr->matches->a); free(itr->matches); + free(itr->sub->a); free(itr->sub); + free(itr); +} + +void smem_set_query(smem_i *itr, int len, const uint8_t *query) +{ + itr->query = query; + itr->start = 0; + itr->len = len; +} + +void smem_config(smem_i *itr, int min_intv, int max_len, uint64_t max_intv) +{ + itr->min_intv = min_intv; + itr->max_len = max_len; + itr->max_intv = max_intv; +} + +const bwtintv_v *smem_next(smem_i *itr) +{ + int ori_start; + itr->tmpvec[0]->n = itr->tmpvec[1]->n = itr->matches->n = itr->sub->n = 0; + if (itr->start >= itr->len || itr->start < 0) return 0; + while (itr->start < itr->len && itr->query[itr->start] > 3) ++itr->start; // skip ambiguous bases + if (itr->start == itr->len) return 0; + ori_start = itr->start; + itr->start = bwt_smem1a(itr->bwt, itr->len, itr->query, ori_start, itr->min_intv, itr->max_intv, itr->matches, itr->tmpvec); // search for SMEM + return itr->matches; +} + +/*********************** + *** Extra functions *** + ***********************/ + +mem_alnreg_v mem_align1(const mem_opt_t *opt, const bwt_t *bwt, const bntseq_t *bns, const uint8_t *pac, int l_seq, const char *seq_) +{ // the difference from mem_align1_core() is that this routine: 1) calls mem_mark_primary_se(); 2) does not modify the input sequence + extern mem_alnreg_v mem_align1_core(const mem_opt_t *opt, const bwt_t *bwt, const bntseq_t *bns, const uint8_t *pac, int l_seq, char *seq, void *buf); + extern void mem_mark_primary_se(const mem_opt_t *opt, int n, mem_alnreg_t *a, int64_t id); + mem_alnreg_v ar; + char *seq; + seq = malloc(l_seq); + memcpy(seq, seq_, l_seq); // makes a copy of seq_ + ar = mem_align1_core(opt, bwt, bns, pac, l_seq, seq, 0); + mem_mark_primary_se(opt, ar.n, ar.a, lrand48()); + free(seq); + return ar; +} + +static inline int get_pri_idx(double XA_drop_ratio, const mem_alnreg_t *a, int i) +{ + int k = a[i].secondary_all; + if (k >= 0 && a[i].score >= a[k].score * XA_drop_ratio) return k; + return -1; +} + +// Okay, returning strings is bad, but this has happened a lot elsewhere. If I have time, I need serious code cleanup. +char **mem_gen_alt(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, const mem_alnreg_v *a, int l_query, const char *query) // ONLY work after mem_mark_primary_se() +{ + int i, k, r, *cnt, tot; + kstring_t *aln = 0, str = {0,0,0}; + char **XA = 0, *has_alt; + + cnt = calloc(a->n, sizeof(int)); + has_alt = calloc(a->n, 1); + for (i = 0, tot = 0; i < a->n; ++i) { + r = get_pri_idx(opt->XA_drop_ratio, a->a, i); + if (r >= 0) { + ++cnt[r], ++tot; + if (a->a[i].is_alt) has_alt[r] = 1; + } + } + if (tot == 0) goto end_gen_alt; + aln = calloc(a->n, sizeof(kstring_t)); + for (i = 0; i < a->n; ++i) { + mem_aln_t t; + if ((r = get_pri_idx(opt->XA_drop_ratio, a->a, i)) < 0) continue; + if (cnt[r] > opt->max_XA_hits_alt || (!has_alt[r] && cnt[r] > opt->max_XA_hits)) continue; + t = mem_reg2aln(opt, bns, pac, l_query, query, &a->a[i]); + str.l = 0; + kputs(bns->anns[t.rid].name, &str); + kputc(',', &str); kputc("+-"[t.is_rev], &str); kputl(t.pos + 1, &str); + kputc(',', &str); + for (k = 0; k < t.n_cigar; ++k) { + kputw(t.cigar[k]>>4, &str); + kputc("MIDSHN"[t.cigar[k]&0xf], &str); + } + kputc(',', &str); kputw(t.NM, &str); + if (opt->flag & MEM_F_XB) { + kputc(',', &str); + kputw(t.score, &str); + kputc(',', &str); + kputw(t.mapq, &str); + } + kputc(';', &str); + free(t.cigar); + kputsn(str.s, str.l, &aln[r]); + } + XA = calloc(a->n, sizeof(char*)); + for (k = 0; k < a->n; ++k) + XA[k] = aln[k].s; + +end_gen_alt: + free(has_alt); free(cnt); free(aln); free(str.s); + return XA; +} diff --git a/bwamem_pair.c b/bwamem_pair.c new file mode 100644 index 0000000..7974447 --- /dev/null +++ b/bwamem_pair.c @@ -0,0 +1,699 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include +#include +#include "kstring.h" +#include "bwamem.h" +#include "kvec.h" +#include "utils.h" +#include "ksw.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + + +#define MIN_RATIO 0.8 +#define MIN_DIR_CNT 10 +#define MIN_DIR_RATIO 0.05 +#define OUTLIER_BOUND 2.0 +#define MAPPING_BOUND 3.0 +#define MAX_STDDEV 4.0 + +typedef struct { + int is_rev; + int qlen; + int tlen; + int xtra; + int64_t rb; + uint8_t *seq; + uint8_t *ref; + const mem_alnreg_t *a; + mem_alnreg_v *ma; +} align_arg_t; + +typedef kvec_t(align_arg_t) align_arg_v; + +typedef struct _matesw_node { + int l_seq; + int b_offset; + uint8_t *seq; + mem_alnreg_v *b; + mem_alnreg_v *a; + struct _matesw_node *next; +} matesw_node; + +static inline int mem_infer_dir(int64_t l_pac, int64_t b1, int64_t b2, int64_t *dist) +{ + int64_t p2; + int r1 = (b1 >= l_pac), r2 = (b2 >= l_pac); + p2 = r1 == r2? b2 : (l_pac<<1) - 1 - b2; // p2 is the coordinate of read 2 on the read 1 strand + *dist = p2 > b1? p2 - b1 : b1 - p2; + return (r1 == r2? 0 : 1) ^ (p2 > b1? 0 : 3); +} + +static int cal_sub(const mem_opt_t *opt, mem_alnreg_v *r) +{ + int j; + for (j = 1; j < r->n; ++j) { // choose unique alignment + int b_max = r->a[j].qb > r->a[0].qb? r->a[j].qb : r->a[0].qb; + int e_min = r->a[j].qe < r->a[0].qe? r->a[j].qe : r->a[0].qe; + if (e_min > b_max) { // have overlap + int min_l = r->a[j].qe - r->a[j].qb < r->a[0].qe - r->a[0].qb? r->a[j].qe - r->a[j].qb : r->a[0].qe - r->a[0].qb; + if (e_min - b_max >= min_l * opt->mask_level) break; // significant overlap + } + } + return j < r->n? r->a[j].score : opt->min_seed_len * opt->a; +} + +void mem_pestat(const mem_opt_t *opt, int64_t l_pac, int n, uint64_v **isize_arr, mem_pestat_t pes[4]) +{ + int i, j, d, max; + uint64_v isize[4]; + memset(pes, 0, 4 * sizeof(mem_pestat_t)); + memset(isize, 0, sizeof(kvec_t(int)) * 4); + for (i=0; in_threads; ++i) { + for (d=0; d<4; ++d) { + for (j=0; j= 3) fprintf(stderr, "[M::%s] # candidate unique pairs for (FF, FR, RF, RR): (%ld, %ld, %ld, %ld)\n", __func__, isize[0].n, isize[1].n, isize[2].n, isize[3].n); + for (d = 0; d < 4; ++d) { // TODO: this block is nearly identical to the one in bwtsw2_pair.c. It would be better to merge these two. + mem_pestat_t *r = &pes[d]; + uint64_v *q = &isize[d]; + int p25, p50, p75, x; + if (q->n < MIN_DIR_CNT) { + fprintf(stderr, "[M::%s] skip orientation %c%c as there are not enough pairs\n", __func__, "FR"[d>>1&1], "FR"[d&1]); + r->failed = 1; + free(q->a); + continue; + } else fprintf(stderr, "[M::%s] analyzing insert size distribution for orientation %c%c...\n", __func__, "FR"[d>>1&1], "FR"[d&1]); + ks_introsort_64(q->n, q->a); + p25 = q->a[(int)(.25 * q->n + .499)]; + p50 = q->a[(int)(.50 * q->n + .499)]; + p75 = q->a[(int)(.75 * q->n + .499)]; + r->low = (int)(p25 - OUTLIER_BOUND * (p75 - p25) + .499); + if (r->low < 1) r->low = 1; + r->high = (int)(p75 + OUTLIER_BOUND * (p75 - p25) + .499); + fprintf(stderr, "[M::%s] (25, 50, 75) percentile: (%d, %d, %d)\n", __func__, p25, p50, p75); + fprintf(stderr, "[M::%s] low and high boundaries for computing mean and std.dev: (%d, %d)\n", __func__, r->low, r->high); + for (i = x = 0, r->avg = 0; i < q->n; ++i) + if (q->a[i] >= r->low && q->a[i] <= r->high) + r->avg += q->a[i], ++x; + r->avg /= x; + for (i = 0, r->std = 0; i < q->n; ++i) + if (q->a[i] >= r->low && q->a[i] <= r->high) + r->std += (q->a[i] - r->avg) * (q->a[i] - r->avg); + r->std = sqrt(r->std / x); + fprintf(stderr, "[M::%s] mean and std.dev: (%.2f, %.2f)\n", __func__, r->avg, r->std); + r->low = (int)(p25 - MAPPING_BOUND * (p75 - p25) + .499); + r->high = (int)(p75 + MAPPING_BOUND * (p75 - p25) + .499); + if (r->low > r->avg - MAX_STDDEV * r->std) r->low = (int)(r->avg - MAX_STDDEV * r->std + .499); + if (r->high < r->avg + MAX_STDDEV * r->std) r->high = (int)(r->avg + MAX_STDDEV * r->std + .499); + if (r->low < 1) r->low = 1; + fprintf(stderr, "[M::%s] low and high boundaries for proper pairs: (%d, %d)\n", __func__, r->low, r->high); + free(q->a); + } + for (d = 0, max = 0; d < 4; ++d) + max = max > isize[d].n? max : isize[d].n; + for (d = 0; d < 4; ++d) + if (pes[d].failed == 0 && isize[d].n < max * MIN_DIR_RATIO) { + pes[d].failed = 1; + fprintf(stderr, "[M::%s] skip orientation %c%c\n", __func__, "FR"[d>>1&1], "FR"[d&1]); + } +} + +void mem_pestat_old(const mem_opt_t *opt, int64_t l_pac, int n, const mem_alnreg_v *regs, mem_pestat_t pes[4]) +{ + int i, d, max; + uint64_v isize[4]; + memset(pes, 0, 4 * sizeof(mem_pestat_t)); + memset(isize, 0, sizeof(kvec_t(int)) * 4); + for (i = 0; i < n>>1; ++i) { + int dir; + int64_t is; + mem_alnreg_v *r[2]; + r[0] = (mem_alnreg_v*)®s[i<<1|0]; + r[1] = (mem_alnreg_v*)®s[i<<1|1]; + if (r[0]->n == 0 || r[1]->n == 0) continue; + if (cal_sub(opt, r[0]) > MIN_RATIO * r[0]->a[0].score) continue; + if (cal_sub(opt, r[1]) > MIN_RATIO * r[1]->a[0].score) continue; + if (r[0]->a[0].rid != r[1]->a[0].rid) continue; // not on the same chr + dir = mem_infer_dir(l_pac, r[0]->a[0].rb, r[1]->a[0].rb, &is); + if (is && is <= opt->max_ins) kv_push(uint64_t, isize[dir], is); + } + if (bwa_verbose >= 3) fprintf(stderr, "[M::%s] # candidate unique pairs for (FF, FR, RF, RR): (%ld, %ld, %ld, %ld)\n", __func__, isize[0].n, isize[1].n, isize[2].n, isize[3].n); + for (d = 0; d < 4; ++d) { // TODO: this block is nearly identical to the one in bwtsw2_pair.c. It would be better to merge these two. + mem_pestat_t *r = &pes[d]; + uint64_v *q = &isize[d]; + int p25, p50, p75, x; + if (q->n < MIN_DIR_CNT) { + fprintf(stderr, "[M::%s] skip orientation %c%c as there are not enough pairs\n", __func__, "FR"[d>>1&1], "FR"[d&1]); + r->failed = 1; + free(q->a); + continue; + } else fprintf(stderr, "[M::%s] analyzing insert size distribution for orientation %c%c...\n", __func__, "FR"[d>>1&1], "FR"[d&1]); + ks_introsort_64(q->n, q->a); + p25 = q->a[(int)(.25 * q->n + .499)]; + p50 = q->a[(int)(.50 * q->n + .499)]; + p75 = q->a[(int)(.75 * q->n + .499)]; + r->low = (int)(p25 - OUTLIER_BOUND * (p75 - p25) + .499); + if (r->low < 1) r->low = 1; + r->high = (int)(p75 + OUTLIER_BOUND * (p75 - p25) + .499); + fprintf(stderr, "[M::%s] (25, 50, 75) percentile: (%d, %d, %d)\n", __func__, p25, p50, p75); + fprintf(stderr, "[M::%s] low and high boundaries for computing mean and std.dev: (%d, %d)\n", __func__, r->low, r->high); + for (i = x = 0, r->avg = 0; i < q->n; ++i) + if (q->a[i] >= r->low && q->a[i] <= r->high) + r->avg += q->a[i], ++x; + r->avg /= x; + for (i = 0, r->std = 0; i < q->n; ++i) + if (q->a[i] >= r->low && q->a[i] <= r->high) + r->std += (q->a[i] - r->avg) * (q->a[i] - r->avg); + r->std = sqrt(r->std / x); + fprintf(stderr, "[M::%s] mean and std.dev: (%.2f, %.2f)\n", __func__, r->avg, r->std); + r->low = (int)(p25 - MAPPING_BOUND * (p75 - p25) + .499); + r->high = (int)(p75 + MAPPING_BOUND * (p75 - p25) + .499); + if (r->low > r->avg - MAX_STDDEV * r->std) r->low = (int)(r->avg - MAX_STDDEV * r->std + .499); + if (r->high < r->avg + MAX_STDDEV * r->std) r->high = (int)(r->avg + MAX_STDDEV * r->std + .499); + if (r->low < 1) r->low = 1; + fprintf(stderr, "[M::%s] low and high boundaries for proper pairs: (%d, %d)\n", __func__, r->low, r->high); + free(q->a); + } + for (d = 0, max = 0; d < 4; ++d) + max = max > isize[d].n? max : isize[d].n; + for (d = 0; d < 4; ++d) + if (pes[d].failed == 0 && isize[d].n < max * MIN_DIR_RATIO) { + pes[d].failed = 1; + fprintf(stderr, "[M::%s] skip orientation %c%c\n", __func__, "FR"[d>>1&1], "FR"[d&1]); + } +} + +int mem_matesw(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, const mem_pestat_t pes[4], const mem_alnreg_t *a, int l_ms, const uint8_t *ms, mem_alnreg_v *ma) +{ + extern int mem_sort_dedup_patch(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, uint8_t *query, int n, mem_alnreg_t *a); + int64_t l_pac = bns->l_pac; + int i, r, skip[4], n = 0, rid; + for (r = 0; r < 4; ++r) + skip[r] = pes[r].failed? 1 : 0; + for (i = 0; i < ma->n; ++i) { // check which orinentation has been found + int64_t dist; + r = mem_infer_dir(l_pac, a->rb, ma->a[i].rb, &dist); + if (dist >= pes[r].low && dist <= pes[r].high) + skip[r] = 1; + } + if (skip[0] + skip[1] + skip[2] + skip[3] == 4) return 0; // consistent pair exist; no need to perform SW + for (r = 0; r < 4; ++r) { + int is_rev, is_larger; + uint8_t *seq, *rev = 0, *ref = 0; + int64_t rb, re; + if (skip[r]) continue; + is_rev = (r>>1 != (r&1)); // whether to reverse complement the mate + is_larger = !(r>>1); // whether the mate has larger coordinate + if (is_rev) { + rev = malloc(l_ms); // this is the reverse complement of $ms + for (i = 0; i < l_ms; ++i) rev[l_ms - 1 - i] = ms[i] < 4? 3 - ms[i] : 4; + seq = rev; + } else seq = (uint8_t*)ms; + if (!is_rev) { + rb = is_larger? a->rb + pes[r].low : a->rb - pes[r].high; + re = (is_larger? a->rb + pes[r].high: a->rb - pes[r].low) + l_ms; // if on the same strand, end position should be larger to make room for the seq length + } else { + rb = (is_larger? a->rb + pes[r].low : a->rb - pes[r].high) - l_ms; // similarly on opposite strands + re = is_larger? a->rb + pes[r].high: a->rb - pes[r].low; + } + if (rb < 0) rb = 0; + if (re > l_pac<<1) re = l_pac<<1; + if (rb < re) ref = bns_fetch_seq(bns, pac, &rb, (rb+re)>>1, &re, &rid); + if (a->rid == rid && re - rb >= opt->min_seed_len) { // no funny things happening + kswr_t aln; + mem_alnreg_t b; + int tmp, xtra = KSW_XSUBO | KSW_XSTART | (l_ms * opt->a < 250? KSW_XBYTE : 0) | (opt->min_seed_len * opt->a); + //fprintf(stderr, "%d\n", xtra); + aln = ksw_align2(l_ms, seq, re - rb, ref, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, xtra, 0); + memset(&b, 0, sizeof(mem_alnreg_t)); + if (aln.score >= opt->min_seed_len && aln.qb >= 0) { // something goes wrong if aln.qb < 0 + b.rid = a->rid; + b.is_alt = a->is_alt; + b.qb = is_rev? l_ms - (aln.qe + 1) : aln.qb; + b.qe = is_rev? l_ms - aln.qb : aln.qe + 1; + b.rb = is_rev? (l_pac<<1) - (rb + aln.te + 1) : rb + aln.tb; + b.re = is_rev? (l_pac<<1) - (rb + aln.tb) : rb + aln.te + 1; + b.score = aln.score; + b.csub = aln.score2; + b.secondary = -1; + b.seedcov = (b.re - b.rb < b.qe - b.qb? b.re - b.rb : b.qe - b.qb) >> 1; +// printf("*** %d, [%lld,%lld], %d:%d, (%lld,%lld), (%lld,%lld) == (%lld,%lld)\n", aln.score, rb, re, is_rev, is_larger, a->rb, a->re, ma->a[0].rb, ma->a[0].re, b.rb, b.re); + kv_push(mem_alnreg_t, *ma, b); // make room for a new element + // move b s.t. ma is sorted + for (i = 0; i < ma->n - 1; ++i) // find the insertion point + if (ma->a[i].score < b.score) break; + tmp = i; + for (i = ma->n - 1; i > tmp; --i) ma->a[i] = ma->a[i-1]; + ma->a[i] = b; + } + ++n; + } + if (n) ma->n = mem_sort_dedup_patch(opt, 0, 0, 0, ma->n, ma->a); + if (rev) free(rev); + free(ref); + } + return n; +} + +static inline void add_aln(const mem_opt_t *opt, const bntseq_t *bns, align_arg_t *arg, kswr_t *aln) +{ + extern int mem_sort_dedup_patch(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, uint8_t *query, int n, mem_alnreg_t *a); + + mem_alnreg_t b; + int is_rev = arg->is_rev; + const mem_alnreg_t *a = arg->a; + int64_t l_pac = bns->l_pac; + int64_t rb = arg->rb; + mem_alnreg_v *ma = arg->ma; + int i, tmp; + + memset(&b, 0, sizeof(mem_alnreg_t)); + b.rid = a->rid; + b.is_alt = a->is_alt; + b.qb = is_rev? arg->qlen - (aln->qe + 1) : aln->qb; + b.qe = is_rev? arg->qlen - aln->qb : aln->qe + 1; + b.rb = is_rev? (l_pac<<1) - (rb + aln->te + 1) : rb + aln->tb; + b.re = is_rev? (l_pac<<1) - (rb + aln->tb) : rb + aln->te + 1; + b.score = aln->score; + b.csub = aln->score2; + b.secondary = -1; + b.seedcov = (b.re - b.rb < b.qe - b.qb? b.re - b.rb : b.qe - b.qb) >> 1; + kv_push(mem_alnreg_t, *ma, b); // make room for a new element + // move b s.t. ma is sorted + for (i = 0; i < ma->n - 1; ++i) // find the insertion point + if (ma->a[i].score < b.score) break; + tmp = i; + for (i = ma->n - 1; i > tmp; --i) ma->a[i] = ma->a[i-1]; + ma->a[i] = b; + ma->n = mem_sort_dedup_patch(opt, 0, 0, 0, ma->n, ma->a); +} + +void ksw_align2_wrap(const mem_opt_t *opt, const bntseq_t *bns, align_arg_t *arg) +{ + kswr_t aln; + aln = ksw_align2(arg->qlen, arg->seq, arg->tlen, arg->ref, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, arg->xtra, 0); + if (aln.score >= opt->min_seed_len && aln.qb >= 0) { // something goes wrong if aln.qb < 0 + add_aln(opt, bns, arg, &aln); + } + if (arg->is_rev) free(arg->seq); + free(arg->ref); +} + +void ksw_align2_wrap2(const mem_opt_t *opt, const bntseq_t *bns, align_arg_t *arg1, align_arg_t *arg2) +{ + kswr_t aln1, aln2; + aln1 = ksw_align2(arg1->qlen, arg1->seq, arg1->tlen, arg1->ref, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, arg1->xtra, 0); + aln2 = ksw_align2(arg2->qlen, arg2->seq, arg2->tlen, arg2->ref, 5, opt->mat, opt->o_del, opt->e_del, opt->o_ins, opt->e_ins, arg2->xtra, 0); + if (aln1.score >= opt->min_seed_len && aln1.qb >= 0) { // something goes wrong if aln.qb < 0 + add_aln(opt, bns, arg1, &aln1); + } + if (aln2.score >= opt->min_seed_len && aln2.qb >= 0) { + add_aln(opt, bns, arg2, &aln2); + } + if (arg1->is_rev) free(arg1->seq); + if (arg2->is_rev) free(arg2->seq); + free(arg1->ref); + free(arg2->ref); +} + +int mem_matesw_new(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, const mem_pestat_t pes[4], const mem_alnreg_t *a, int l_ms, const uint8_t *ms, mem_alnreg_v *ma, align_arg_v *argv) +{ + int64_t l_pac = bns->l_pac; + int i, r, skip[4], n = 0, rid; + for (r = 0; r < 4; ++r) + skip[r] = pes[r].failed? 1 : 0; + for (i = 0; i < ma->n; ++i) { // check which orinentation has been found + int64_t dist; + r = mem_infer_dir(l_pac, a->rb, ma->a[i].rb, &dist); + if (dist >= pes[r].low && dist <= pes[r].high) + skip[r] = 1; + } + if (skip[0] + skip[1] + skip[2] + skip[3] == 4) return 0; // consistent pair exist; no need to perform SW + for (r = 0; r < 4; ++r) { + int is_rev, is_larger; + uint8_t *seq, *rev = 0, *ref = 0; + int64_t rb, re; + if (skip[r]) continue; + is_rev = (r>>1 != (r&1)); // whether to reverse complement the mate + is_larger = !(r>>1); // whether the mate has larger coordinate + if (!is_rev) { + rb = is_larger? a->rb + pes[r].low : a->rb - pes[r].high; + re = (is_larger? a->rb + pes[r].high: a->rb - pes[r].low) + l_ms; // if on the same strand, end position should be larger to make room for the seq length + } else { + rb = (is_larger? a->rb + pes[r].low : a->rb - pes[r].high) - l_ms; // similarly on opposite strands + re = is_larger? a->rb + pes[r].high: a->rb - pes[r].low; + } + if (rb < 0) rb = 0; + if (re > l_pac<<1) re = l_pac<<1; + if (rb < re) ref = bns_fetch_seq(bns, pac, &rb, (rb+re)>>1, &re, &rid); + if (a->rid == rid && re - rb >= opt->min_seed_len) { // no funny things happening + if (is_rev) { + rev = malloc(l_ms); // this is the reverse complement of $ms + for (i = 0; i < l_ms; ++i) rev[l_ms - 1 - i] = ms[i] < 4? 3 - ms[i] : 4; + seq = rev; + } else seq = (uint8_t*)ms; + int xtra = KSW_XSUBO | KSW_XSTART | (l_ms * opt->a < 250? KSW_XBYTE : 0) | (opt->min_seed_len * opt->a); + align_arg_t *arg = kv_pushp(align_arg_t, *argv); + + arg->is_rev = is_rev; + arg->qlen = l_ms; + arg->tlen = re - rb; + arg->xtra = xtra; + arg->rb = rb; + arg->seq = seq; + arg->ref = ref; + arg->a = a; + arg->ma = ma; + ++n; + } else { + free(ref); + } + } + return n; +} + +int mem_pair(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, const mem_pestat_t pes[4], bseq1_t s[2], mem_alnreg_v a[2], int id, int *sub, int *n_sub, int z[2], int n_pri[2]) +{ + pair64_v v, u; + int r, i, k, y[4], ret; // y[] keeps the last hit + int64_t l_pac = bns->l_pac; + kv_init(v); kv_init(u); + for (r = 0; r < 2; ++r) { // loop through read number + for (i = 0; i < n_pri[r]; ++i) { + pair64_t key; + mem_alnreg_t *e = &a[r].a[i]; + key.x = e->rb < l_pac? e->rb : (l_pac<<1) - 1 - e->rb; // forward position + key.x = (uint64_t)e->rid<<32 | (key.x - bns->anns[e->rid].offset); + key.y = (uint64_t)e->score << 32 | i << 2 | (e->rb >= l_pac)<<1 | r; + kv_push(pair64_t, v, key); + } + } + ks_introsort_128(v.n, v.a); + y[0] = y[1] = y[2] = y[3] = -1; + //for (i = 0; i < v.n; ++i) printf("[%d]\t%d\t%c%ld\n", i, (int)(v.a[i].y&1)+1, "+-"[v.a[i].y>>1&1], (long)v.a[i].x); + for (i = 0; i < v.n; ++i) { + for (r = 0; r < 2; ++r) { // loop through direction + int dir = r<<1 | (v.a[i].y>>1&1), which; + if (pes[dir].failed) continue; // invalid orientation + which = r<<1 | ((v.a[i].y&1)^1); + if (y[which] < 0) continue; // no previous hits + for (k = y[which]; k >= 0; --k) { // TODO: this is a O(n^2) solution in the worst case; remember to check if this loop takes a lot of time (I doubt) + int64_t dist; + int q; + double ns; + pair64_t *p; + if ((v.a[k].y&3) != which) continue; + dist = (int64_t)v.a[i].x - v.a[k].x; + //printf("%d: %lld\n", k, dist); + if (dist > pes[dir].high) break; + if (dist < pes[dir].low) continue; + ns = (dist - pes[dir].avg) / pes[dir].std; + q = (int)((v.a[i].y>>32) + (v.a[k].y>>32) + .721 * log(2. * erfc(fabs(ns) * M_SQRT1_2)) * opt->a + .499); // .721 = 1/log(4) + if (q < 0) q = 0; + p = kv_pushp(pair64_t, u); + p->y = (uint64_t)k<<32 | i; + p->x = (uint64_t)q<<32 | (hash_64(p->y ^ id<<8) & 0xffffffffU); + //printf("[%lld,%lld]\t%d\tdist=%ld\n", v.a[k].x, v.a[i].x, q, (long)dist); + } + } + y[v.a[i].y&3] = i; + } + if (u.n) { // found at least one proper pair + int tmp = opt->a + opt->b; + tmp = tmp > opt->o_del + opt->e_del? tmp : opt->o_del + opt->e_del; + tmp = tmp > opt->o_ins + opt->e_ins? tmp : opt->o_ins + opt->e_ins; + ks_introsort_128(u.n, u.a); + i = u.a[u.n-1].y >> 32; k = u.a[u.n-1].y << 32 >> 32; + z[v.a[i].y&1] = v.a[i].y<<32>>34; // index of the best pair + z[v.a[k].y&1] = v.a[k].y<<32>>34; + ret = u.a[u.n-1].x >> 32; + *sub = u.n > 1? u.a[u.n-2].x>>32 : 0; + for (i = (long)u.n - 2, *n_sub = 0; i >= 0; --i) + if (*sub - (int)(u.a[i].x>>32) <= tmp) ++*n_sub; + } else ret = 0, *sub = 0, *n_sub = 0; + free(u.a); free(v.a); + return ret; +} + +#define NEW_NODE(bidx, aidx) \ + if (barr[bidx].n) { \ + matesw_node *node; \ + tail->next = malloc(sizeof(matesw_node)); \ + node = tail->next; \ + node->l_seq = s[aidx].l_seq; \ + node->b_offset = 0; \ + node->seq = (uint8_t*)s[aidx].seq; \ + node->b = barr + bidx; \ + node->a = a + aidx; \ + node->next = 0; \ + tail = node; \ + } + +void mem_matesw_batch(const mem_opt_t *opt, const bntseq_t *bns, const uint8_t *pac, const mem_pestat_t pes[4], bseq1_t *s, mem_alnreg_v *a, int data_size) +{ + int i, j; + align_arg_v argv; + mem_alnreg_v *barr = calloc(data_size, sizeof(mem_alnreg_v)); + matesw_node head; + matesw_node *tail = &head, *pre = &head; + tail->next = 0; + kv_init(argv); + for (i = 0; i < data_size; i+=2) { + for (j = 0; j < a[i].n; ++j) { + if (a[i].a[j].score >= a[i].a[0].score - opt->pen_unpaired && j < opt->max_matesw) { + kv_push(mem_alnreg_t, barr[i], a[i].a[j]); + } + } + NEW_NODE(i, i+1); + for (j = 0; j < a[i+1].n; ++j) { + if (a[i+1].a[j].score >= a[i+1].a[0].score - opt->pen_unpaired && j < opt->max_matesw) { + kv_push(mem_alnreg_t, barr[i+1], a[i+1].a[j]); + } + } + NEW_NODE(i+1, i); + } + + tail = head.next; + while(tail) { + argv.n = 0; + while (tail) { + int nn = 0; + while (tail->b_offset < tail->b->n && !nn) { + nn = mem_matesw_new(opt, bns, pac, pes, &tail->b->a[tail->b_offset], tail->l_seq, tail->seq, tail->a, &argv); + ++ tail->b_offset; + } + if (!nn || tail->b_offset == tail->b->n) { // delete node + tail = tail->next; + free(pre->next); + pre->next = tail; + } else { + pre = tail; + tail = tail->next; + } + } + if (argv.n) { + for (i=0; iflag & MEM_F_NO_RESCUE)) { // then perform SW for the best alignment + mem_alnreg_v b[2]; + kv_init(b[0]); kv_init(b[1]); + for (i = 0; i < 2; ++i) + for (j = 0; j < a[i].n; ++j) + if (a[i].a[j].score >= a[i].a[0].score - opt->pen_unpaired) + kv_push(mem_alnreg_t, b[i], a[i].a[j]); + for (i = 0; i < 2; ++i) + for (j = 0; j < b[i].n && j < opt->max_matesw; ++j) + n += mem_matesw(opt, bns, pac, pes, &b[i].a[j], s[!i].l_seq, (uint8_t*)s[!i].seq, &a[!i]); + free(b[0].a); free(b[1].a); + } + PROF_END(tprof[T_SAM_MATESW][tid], matesw); + + n_pri[0] = mem_mark_primary_se(opt, a[0].n, a[0].a, id<<1|0); + n_pri[1] = mem_mark_primary_se(opt, a[1].n, a[1].a, id<<1|1); + if (opt->flag & MEM_F_PRIMARY5) { + mem_reorder_primary5(opt->T, &a[0]); + mem_reorder_primary5(opt->T, &a[1]); + } + if (opt->flag&MEM_F_NOPAIRING) goto no_pairing; + // pairing single-end hits + if (n_pri[0] && n_pri[1] && (o = mem_pair(opt, bns, pac, pes, s, a, id, &subo, &n_sub, z, n_pri)) > 0) { + int is_multi[2], q_pe, score_un, q_se[2]; + char **XA[2]; + // check if an end has multiple hits even after mate-SW + for (i = 0; i < 2; ++i) { + for (j = 1; j < n_pri[i]; ++j) + if (a[i].a[j].secondary < 0 && a[i].a[j].score >= opt->T) break; + is_multi[i] = j < n_pri[i]? 1 : 0; + } + if (is_multi[0] || is_multi[1]) goto no_pairing; // TODO: in rare cases, the true hit may be long but with low score + // compute mapQ for the best SE hit + score_un = a[0].a[0].score + a[1].a[0].score - opt->pen_unpaired; + //q_pe = o && subo < o? (int)(MEM_MAPQ_COEF * (1. - (double)subo / o) * log(a[0].a[z[0]].seedcov + a[1].a[z[1]].seedcov) + .499) : 0; + subo = subo > score_un? subo : score_un; + q_pe = raw_mapq(o - subo, opt->a); + if (n_sub > 0) q_pe -= (int)(4.343 * log(n_sub+1) + .499); + if (q_pe < 0) q_pe = 0; + if (q_pe > 60) q_pe = 60; + q_pe = (int)(q_pe * (1. - .5 * (a[0].a[0].frac_rep + a[1].a[0].frac_rep)) + .499); + // the following assumes no split hits + if (o > score_un) { // paired alignment is preferred + mem_alnreg_t *c[2]; + c[0] = &a[0].a[z[0]]; c[1] = &a[1].a[z[1]]; + for (i = 0; i < 2; ++i) { + if (c[i]->secondary >= 0) + c[i]->sub = a[i].a[c[i]->secondary].score, c[i]->secondary = -2; + q_se[i] = mem_approx_mapq_se(opt, c[i]); + } + q_se[0] = q_se[0] > q_pe? q_se[0] : q_pe < q_se[0] + 40? q_pe : q_se[0] + 40; + q_se[1] = q_se[1] > q_pe? q_se[1] : q_pe < q_se[1] + 40? q_pe : q_se[1] + 40; + extra_flag |= 2; + // cap at the tandem repeat score + q_se[0] = q_se[0] < raw_mapq(c[0]->score - c[0]->csub, opt->a)? q_se[0] : raw_mapq(c[0]->score - c[0]->csub, opt->a); + q_se[1] = q_se[1] < raw_mapq(c[1]->score - c[1]->csub, opt->a)? q_se[1] : raw_mapq(c[1]->score - c[1]->csub, opt->a); + } else { // the unpaired alignment is preferred + z[0] = z[1] = 0; + q_se[0] = mem_approx_mapq_se(opt, &a[0].a[0]); + q_se[1] = mem_approx_mapq_se(opt, &a[1].a[0]); + } + for (i = 0; i < 2; ++i) { + int k = a[i].a[z[i]].secondary_all; + if (k >= 0 && k < n_pri[i]) { // switch secondary and primary if both of them are non-ALT + assert(a[i].a[k].secondary_all < 0); + for (j = 0; j < a[i].n; ++j) + if (a[i].a[j].secondary_all == k || j == k) + a[i].a[j].secondary_all = z[i]; + a[i].a[z[i]].secondary_all = -1; + } + } + if (!(opt->flag & MEM_F_ALL)) { + for (i = 0; i < 2; ++i) + XA[i] = mem_gen_alt(opt, bns, pac, &a[i], s[i].l_seq, s[i].seq); + } else XA[0] = XA[1] = 0; + // write SAM + for (i = 0; i < 2; ++i) { + PROF_START(reg2aln); + h[i] = mem_reg2aln(opt, bns, pac, s[i].l_seq, s[i].seq, &a[i].a[z[i]]); + PROF_END(tprof[T_SAM_REG2ALN][tid], reg2aln); + h[i].mapq = q_se[i]; + h[i].flag |= 0x40<score < opt->T || p->secondary >= 0 || !p->is_alt) continue; + g[i] = mem_reg2aln(opt, bns, pac, s[i].l_seq, s[i].seq, p); + g[i].flag |= 0x800 | 0x40<= opt->T) which = 0; + else if (n_pri[i] < a[i].n && a[i].a[n_pri[i]].score >= opt->T) + which = n_pri[i]; + } + if (which >= 0) h[i] = mem_reg2aln(opt, bns, pac, s[i].l_seq, s[i].seq, &a[i].a[which]); + else h[i] = mem_reg2aln(opt, bns, pac, s[i].l_seq, s[i].seq, 0); + } + if (!(opt->flag & MEM_F_NOPAIRING) && h[0].rid == h[1].rid && h[0].rid >= 0) { // if the top hits from the two ends constitute a proper pair, flag it. + int64_t dist; + int d; + d = mem_infer_dir(bns->l_pac, a[0].a[0].rb, a[1].a[0].rb, &dist); + if (!pes[d].failed && dist >= pes[d].low && dist <= pes[d].high) extra_flag |= 2; + } + mem_reg2sam(opt, bns, pac, &s[0], &a[0], 0x41|extra_flag, &h[1], &ss[0]); + mem_reg2sam(opt, bns, pac, &s[1], &a[1], 0x81|extra_flag, &h[0], &ss[1]); + if (strcmp(s[0].name, s[1].name) != 0) err_fatal(__func__, "paired reads have different names: \"%s\", \"%s\"\n", s[0].name, s[1].name); + free(h[0].cigar); free(h[1].cigar); + return n; +} diff --git a/bwape.c b/bwape.c new file mode 100644 index 0000000..7090485 --- /dev/null +++ b/bwape.c @@ -0,0 +1,784 @@ +#include +#include +#include +#include +#include +#include +#include "bwtaln.h" +#include "kvec.h" +#include "bntseq.h" +#include "utils.h" +#include "bwase.h" +#include "bwa.h" +#include "ksw.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef struct { + int n; + bwtint_t *a; +} poslist_t; + +typedef struct { + double avg, std, ap_prior; + bwtint_t low, high, high_bayesian; +} isize_info_t; + +#define b128_eq(a, b) ((a).x == (b).x && (a).y == (b).y) +#define b128_hash(a) ((uint32_t)(a).x) + +#include "khash.h" +KHASH_INIT(b128, pair64_t, poslist_t, 1, b128_hash, b128_eq) + +typedef struct { + pair64_v arr; + pair64_v pos[2]; + kvec_t(bwt_aln1_t) aln[2]; +} pe_data_t; + +#define MIN_HASH_WIDTH 1000 + +extern int g_log_n[256]; // in bwase.c +static kh_b128_t *g_hash; + +void bwa_aln2seq_core(int n_aln, const bwt_aln1_t *aln, bwa_seq_t *s, int set_main, int n_multi); +void bwa_aln2seq(int n_aln, const bwt_aln1_t *aln, bwa_seq_t *s); +int bwa_approx_mapQ(const bwa_seq_t *p, int mm); +void bwa_print_sam1(const bntseq_t *bns, bwa_seq_t *p, const bwa_seq_t *mate, int mode, int max_top2); +bntseq_t *bwa_open_nt(const char *prefix); +void bwa_print_sam_SQ(const bntseq_t *bns); + +pe_opt_t *bwa_init_pe_opt() +{ + pe_opt_t *po; + po = (pe_opt_t*)calloc(1, sizeof(pe_opt_t)); + po->max_isize = 500; + po->force_isize = 0; + po->max_occ = 100000; + po->n_multi = 3; + po->N_multi = 10; + po->type = BWA_PET_STD; + po->is_sw = 1; + po->ap_prior = 1e-5; + return po; +} +/* +static double ierfc(double x) // inverse erfc(); iphi(x) = M_SQRT2 *ierfc(2 * x); +{ + const double a = 0.140012; + double b, c; + b = log(x * (2 - x)); + c = 2./M_PI/a + b / 2.; + return sqrt(sqrt(c * c - b / a) - c); +} +*/ + +// for normal distribution, this is about 3std +#define OUTLIER_BOUND 2.0 + +static int infer_isize(int n_seqs, bwa_seq_t *seqs[2], isize_info_t *ii, double ap_prior, int64_t L) +{ + uint64_t x, *isizes, n_ap = 0; + int n, i, tot, p25, p75, p50, max_len = 1, tmp; + double skewness = 0.0, kurtosis = 0.0, y; + + ii->avg = ii->std = -1.0; + ii->low = ii->high = ii->high_bayesian = 0; + isizes = (uint64_t*)calloc(n_seqs, 8); + for (i = 0, tot = 0; i != n_seqs; ++i) { + bwa_seq_t *p[2]; + p[0] = seqs[0] + i; p[1] = seqs[1] + i; + if (p[0]->mapQ >= 20 && p[1]->mapQ >= 20) { + x = (p[0]->pos < p[1]->pos)? p[1]->pos + p[1]->len - p[0]->pos : p[0]->pos + p[0]->len - p[1]->pos; + if (x < 100000) isizes[tot++] = x; + } + if (p[0]->len > max_len) max_len = p[0]->len; + if (p[1]->len > max_len) max_len = p[1]->len; + } + if (tot < 20) { + fprintf(stderr, "[infer_isize] fail to infer insert size: too few good pairs\n"); + free(isizes); + return -1; + } + ks_introsort_64(tot, isizes); + p25 = isizes[(int)(tot*0.25 + 0.5)]; + p50 = isizes[(int)(tot*0.50 + 0.5)]; + p75 = isizes[(int)(tot*0.75 + 0.5)]; + tmp = (int)(p25 - OUTLIER_BOUND * (p75 - p25) + .499); + ii->low = tmp > max_len? tmp : max_len; // ii->low is unsigned + ii->high = (int)(p75 + OUTLIER_BOUND * (p75 - p25) + .499); + if (ii->low > ii->high) { + fprintf(stderr, "[infer_isize] fail to infer insert size: upper bound is smaller than read length\n"); + free(isizes); + return -1; + } + for (i = 0, x = n = 0; i < tot; ++i) + if (isizes[i] >= ii->low && isizes[i] <= ii->high) + ++n, x += isizes[i]; + ii->avg = (double)x / n; + for (i = 0; i < tot; ++i) { + if (isizes[i] >= ii->low && isizes[i] <= ii->high) { + double tmp = (isizes[i] - ii->avg) * (isizes[i] - ii->avg); + ii->std += tmp; + skewness += tmp * (isizes[i] - ii->avg); + kurtosis += tmp * tmp; + } + } + kurtosis = kurtosis/n / (ii->std / n * ii->std / n) - 3; + ii->std = sqrt(ii->std / n); // it would be better as n-1, but n is usually very large + skewness = skewness / n / (ii->std * ii->std * ii->std); + for (y = 1.0; y < 10.0; y += 0.01) + if (.5 * erfc(y / M_SQRT2) < ap_prior / L * (y * ii->std + ii->avg)) break; + ii->high_bayesian = (bwtint_t)(y * ii->std + ii->avg + .499); + for (i = 0; i < tot; ++i) + if (isizes[i] > ii->high_bayesian) ++n_ap; + ii->ap_prior = .01 * (n_ap + .01) / tot; + if (ii->ap_prior < ap_prior) ii->ap_prior = ap_prior; + free(isizes); + fprintf(stderr, "[infer_isize] (25, 50, 75) percentile: (%d, %d, %d)\n", p25, p50, p75); + if (isnan(ii->std) || p75 > 100000) { + ii->low = ii->high = ii->high_bayesian = 0; ii->avg = ii->std = -1.0; + fprintf(stderr, "[infer_isize] fail to infer insert size: weird pairing\n"); + return -1; + } + for (y = 1.0; y < 10.0; y += 0.01) + if (.5 * erfc(y / M_SQRT2) < ap_prior / L * (y * ii->std + ii->avg)) break; + ii->high_bayesian = (bwtint_t)(y * ii->std + ii->avg + .499); + fprintf(stderr, "[infer_isize] low and high boundaries: %ld and %ld for estimating avg and std\n", (long)ii->low, (long)ii->high); + fprintf(stderr, "[infer_isize] inferred external isize from %d pairs: %.3lf +/- %.3lf\n", n, ii->avg, ii->std); + fprintf(stderr, "[infer_isize] skewness: %.3lf; kurtosis: %.3lf; ap_prior: %.2e\n", skewness, kurtosis, ii->ap_prior); + fprintf(stderr, "[infer_isize] inferred maximum insert size: %ld (%.2lf sigma)\n", (long)ii->high_bayesian, y); + return 0; +} + +static int pairing(bwa_seq_t *p[2], pe_data_t *d, const pe_opt_t *opt, int s_mm, const isize_info_t *ii) +{ + int i, j, o_n, subo_n, cnt_chg = 0, low_bound = ii->low, max_len; + uint64_t o_score, subo_score; + pair64_t last_pos[2][2], o_pos[2]; + max_len = p[0]->full_len; + if (max_len < p[1]->full_len) max_len = p[1]->full_len; + if (low_bound < max_len) low_bound = max_len; + + // here v>=u. When ii is set, we check insert size with ii; otherwise with opt->max_isize +#define __pairing_aux(u,v) do { \ + bwtint_t l = (v).x + p[(v).y&1]->len - ((u).x); \ + if ((u).x != (uint64_t)-1 && (v).x > (u).x && l >= max_len \ + && ((ii->high && l <= ii->high_bayesian) || (ii->high == 0 && l <= opt->max_isize))) \ + { \ + uint64_t s = d->aln[(v).y&1].a[(v).y>>2].score + d->aln[(u).y&1].a[(u).y>>2].score; \ + s *= 10; \ + if (ii->high) s += (int)(-4.343 * log(.5 * erfc(M_SQRT1_2 * fabs(l - ii->avg) / ii->std)) + .499); \ + s = s<<32 | (uint32_t)hash_64((u).x<<32 | (v).x); \ + if (s>>32 == o_score>>32) ++o_n; \ + else if (s>>32 < o_score>>32) { subo_n += o_n; o_n = 1; } \ + else ++subo_n; \ + if (s < o_score) subo_score = o_score, o_score = s, o_pos[(u).y&1] = (u), o_pos[(v).y&1] = (v); \ + else if (s < subo_score) subo_score = s; \ + } \ + } while (0) + +#define __pairing_aux2(q, w) do { \ + const bwt_aln1_t *r = d->aln[(w).y&1].a + ((w).y>>2); \ + (q)->extra_flag |= SAM_FPP; \ + if ((q)->pos != (w).x || (q)->strand != ((w).y>>1&1)) { \ + (q)->n_mm = r->n_mm; (q)->n_gapo = r->n_gapo; (q)->n_gape = r->n_gape; (q)->strand = (w).y>>1&1; \ + (q)->score = r->score; \ + (q)->pos = (w).x; \ + if ((q)->mapQ > 0) ++cnt_chg; \ + } \ + } while (0) + + o_score = subo_score = (uint64_t)-1; + o_n = subo_n = 0; + ks_introsort_128(d->arr.n, d->arr.a); + for (j = 0; j < 2; ++j) last_pos[j][0].x = last_pos[j][0].y = last_pos[j][1].x = last_pos[j][1].y = (uint64_t)-1; + if (opt->type == BWA_PET_STD) { + for (i = 0; i < d->arr.n; ++i) { + pair64_t x = d->arr.a[i]; + int strand = x.y>>1&1; + if (strand == 1) { // reverse strand, then check + int y = 1 - (x.y&1); + __pairing_aux(last_pos[y][1], x); + __pairing_aux(last_pos[y][0], x); + } else { // forward strand, then push + last_pos[x.y&1][0] = last_pos[x.y&1][1]; + last_pos[x.y&1][1] = x; + } + } + } else { + fprintf(stderr, "[paring] not implemented yet!\n"); + exit(1); + } + // set pairing + //fprintf(stderr, "[%ld, %d, %d, %d]\n", d->arr.n, (int)(o_score>>32), (int)(subo_score>>32), o_n); + if (o_score != (uint64_t)-1) { + int mapQ_p = 0; // this is the maximum mapping quality when one end is moved + //fprintf(stderr, "%d, %d\n", o_n, subo_n); + if (o_n == 1) { + if (subo_score == (uint64_t)-1) mapQ_p = 29; // no sub-optimal pair + else if ((subo_score>>32) - (o_score>>32) > s_mm * 10) mapQ_p = 23; // poor sub-optimal pair + else { + int n = subo_n > 255? 255 : subo_n; + mapQ_p = ((subo_score>>32) - (o_score>>32)) / 2 - g_log_n[n]; + if (mapQ_p < 0) mapQ_p = 0; + } + } + if ((p[0]->pos == o_pos[0].x && p[0]->strand == (o_pos[0].y>>1&1)) && (p[1]->pos == o_pos[1].x && p[1]->strand == (o_pos[1].y>>1&1))) { // both ends not moved + if (p[0]->mapQ > 0 && p[1]->mapQ > 0) { + int mapQ = p[0]->mapQ + p[1]->mapQ; + if (mapQ > 60) mapQ = 60; + p[0]->mapQ = p[1]->mapQ = mapQ; + } else { + if (p[0]->mapQ == 0) p[0]->mapQ = (mapQ_p + 7 < p[1]->mapQ)? mapQ_p + 7 : p[1]->mapQ; + if (p[1]->mapQ == 0) p[1]->mapQ = (mapQ_p + 7 < p[0]->mapQ)? mapQ_p + 7 : p[0]->mapQ; + } + } else if (p[0]->pos == o_pos[0].x && p[0]->strand == (o_pos[0].y>>1&1)) { // [1] moved + p[1]->seQ = 0; p[1]->mapQ = p[0]->mapQ; + if (p[1]->mapQ > mapQ_p) p[1]->mapQ = mapQ_p; + } else if (p[1]->pos == o_pos[1].x && p[1]->strand == (o_pos[1].y>>1&1)) { // [0] moved + p[0]->seQ = 0; p[0]->mapQ = p[1]->mapQ; + if (p[0]->mapQ > mapQ_p) p[0]->mapQ = mapQ_p; + } else { // both ends moved + p[0]->seQ = p[1]->seQ = 0; + mapQ_p -= 20; + if (mapQ_p < 0) mapQ_p = 0; + p[0]->mapQ = p[1]->mapQ = mapQ_p; + } + __pairing_aux2(p[0], o_pos[0]); + __pairing_aux2(p[1], o_pos[1]); + } + return cnt_chg; +} + +typedef struct { + kvec_t(bwt_aln1_t) aln; +} aln_buf_t; + +int bwa_cal_pac_pos_pe(const bntseq_t *bns, const char *prefix, bwt_t *const _bwt, int n_seqs, bwa_seq_t *seqs[2], FILE *fp_sa[2], isize_info_t *ii, + const pe_opt_t *opt, const gap_opt_t *gopt, const isize_info_t *last_ii) +{ + int i, j, cnt_chg = 0; + char str[1024]; + bwt_t *bwt; + pe_data_t *d; + aln_buf_t *buf[2]; + + d = (pe_data_t*)calloc(1, sizeof(pe_data_t)); + buf[0] = (aln_buf_t*)calloc(n_seqs, sizeof(aln_buf_t)); + buf[1] = (aln_buf_t*)calloc(n_seqs, sizeof(aln_buf_t)); + + if (_bwt == 0) { // load forward SA + strcpy(str, prefix); strcat(str, ".bwt"); bwt = bwt_restore_bwt(str); + strcpy(str, prefix); strcat(str, ".sa"); bwt_restore_sa(str, bwt); + } else bwt = _bwt; + + // SE + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *p[2]; + for (j = 0; j < 2; ++j) { + int n_aln; + p[j] = seqs[j] + i; + p[j]->n_multi = 0; + p[j]->extra_flag |= SAM_FPD | (j == 0? SAM_FR1 : SAM_FR2); + err_fread_noeof(&n_aln, 4, 1, fp_sa[j]); + if (n_aln > kv_max(d->aln[j])) + kv_resize(bwt_aln1_t, d->aln[j], n_aln); + d->aln[j].n = n_aln; + err_fread_noeof(d->aln[j].a, sizeof(bwt_aln1_t), n_aln, fp_sa[j]); + kv_copy(bwt_aln1_t, buf[j][i].aln, d->aln[j]); // backup d->aln[j] + // generate SE alignment and mapping quality + bwa_aln2seq(n_aln, d->aln[j].a, p[j]); + if (p[j]->type == BWA_TYPE_UNIQUE || p[j]->type == BWA_TYPE_REPEAT) { + int strand; + int max_diff = gopt->fnr > 0.0? bwa_cal_maxdiff(p[j]->len, BWA_AVG_ERR, gopt->fnr) : gopt->max_diff; + p[j]->seQ = p[j]->mapQ = bwa_approx_mapQ(p[j], max_diff); + p[j]->pos = bwa_sa2pos(bns, bwt, p[j]->sa, p[j]->len + p[j]->ref_shift, &strand); + p[j]->strand = strand; + if (p[j]->pos == (bwtint_t)-1) p[j]->type = BWA_TYPE_NO_MATCH; + } + } + } + + // infer isize + infer_isize(n_seqs, seqs, ii, opt->ap_prior, bwt->seq_len/2); + if (ii->avg < 0.0 && last_ii->avg > 0.0) *ii = *last_ii; + if (opt->force_isize) { + fprintf(stderr, "[%s] discard insert size estimate as user's request.\n", __func__); + ii->low = ii->high = 0; ii->avg = ii->std = -1.0; + } + + // PE + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *p[2]; + for (j = 0; j < 2; ++j) { + p[j] = seqs[j] + i; + kv_copy(bwt_aln1_t, d->aln[j], buf[j][i].aln); + } + if ((p[0]->type == BWA_TYPE_UNIQUE || p[0]->type == BWA_TYPE_REPEAT) + && (p[1]->type == BWA_TYPE_UNIQUE || p[1]->type == BWA_TYPE_REPEAT)) + { // only when both ends mapped + pair64_t x; + int j, k; + long long n_occ[2]; + for (j = 0; j < 2; ++j) { + n_occ[j] = 0; + for (k = 0; k < d->aln[j].n; ++k) + n_occ[j] += d->aln[j].a[k].l - d->aln[j].a[k].k + 1; + } + if (n_occ[0] > opt->max_occ || n_occ[1] > opt->max_occ) continue; + d->arr.n = 0; + for (j = 0; j < 2; ++j) { + for (k = 0; k < d->aln[j].n; ++k) { + bwt_aln1_t *r = d->aln[j].a + k; + bwtint_t l; + if (0 && r->l - r->k + 1 >= MIN_HASH_WIDTH) { // then check hash table + pair64_t key; + int ret; + key.x = r->k; key.y = r->l; + khint_t iter = kh_put(b128, g_hash, key, &ret); + if (ret) { // not in the hash table; ret must equal 1 as we never remove elements + poslist_t *z = &kh_val(g_hash, iter); + z->n = r->l - r->k + 1; + z->a = (bwtint_t*)malloc(sizeof(bwtint_t) * z->n); + for (l = r->k; l <= r->l; ++l) { + int strand; + z->a[l - r->k] = bwa_sa2pos(bns, bwt, l, p[j]->len + p[j]->ref_shift, &strand)<<1; + z->a[l - r->k] |= strand; + } + } + for (l = 0; l < kh_val(g_hash, iter).n; ++l) { + x.x = kh_val(g_hash, iter).a[l]>>1; + x.y = k<<2 | (kh_val(g_hash, iter).a[l]&1)<<1 | j; + kv_push(pair64_t, d->arr, x); + } + } else { // then calculate on the fly + for (l = r->k; l <= r->l; ++l) { + int strand; + x.x = bwa_sa2pos(bns, bwt, l, p[j]->len + p[j]->ref_shift, &strand); + x.y = k<<2 | strand<<1 | j; + kv_push(pair64_t, d->arr, x); + } + } + } + } + cnt_chg += pairing(p, d, opt, gopt->s_mm, ii); + } + + if (opt->N_multi || opt->n_multi) { + for (j = 0; j < 2; ++j) { + if (p[j]->type != BWA_TYPE_NO_MATCH) { + int k, n_multi; + if (!(p[j]->extra_flag&SAM_FPP) && p[1-j]->type != BWA_TYPE_NO_MATCH) { + bwa_aln2seq_core(d->aln[j].n, d->aln[j].a, p[j], 0, p[j]->c1+p[j]->c2-1 > opt->N_multi? opt->n_multi : opt->N_multi); + } else bwa_aln2seq_core(d->aln[j].n, d->aln[j].a, p[j], 0, opt->n_multi); + for (k = 0, n_multi = 0; k < p[j]->n_multi; ++k) { + int strand; + bwt_multi1_t *q = p[j]->multi + k; + q->pos = bwa_sa2pos(bns, bwt, q->pos, p[j]->len + q->ref_shift, &strand); + q->strand = strand; + if (q->pos != p[j]->pos && q->pos != (bwtint_t)-1) + p[j]->multi[n_multi++] = *q; + } + p[j]->n_multi = n_multi; + } + } + } + } + + // free + for (i = 0; i < n_seqs; ++i) { + kv_destroy(buf[0][i].aln); + kv_destroy(buf[1][i].aln); + } + free(buf[0]); free(buf[1]); + if (_bwt == 0) bwt_destroy(bwt); + kv_destroy(d->arr); + kv_destroy(d->pos[0]); kv_destroy(d->pos[1]); + kv_destroy(d->aln[0]); kv_destroy(d->aln[1]); + free(d); + return cnt_chg; +} + +#define SW_MIN_MATCH_LEN 20 +#define SW_MIN_MAPQ 17 + +// cnt = n_mm<<16 | n_gapo<<8 | n_gape +bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const ubyte_t *seq, int64_t *beg, int reglen, int *n_cigar, uint32_t *_cnt) +{ + kswr_t r; + uint32_t *cigar32 = 0; + bwa_cigar_t *cigar = 0; + ubyte_t *ref_seq; + bwtint_t k, x, y, l; + int xtra, gscore; + int8_t mat[25]; + + bwa_fill_scmat(1, 3, mat); + // check whether there are too many N's + if (reglen < SW_MIN_MATCH_LEN || (int64_t)l_pac - *beg < len) return 0; + for (k = 0, x = 0; k < len; ++k) + if (seq[k] >= 4) ++x; + if ((float)x/len >= 0.25 || len - x < SW_MIN_MATCH_LEN) return 0; + + // get reference subsequence + ref_seq = (ubyte_t*)calloc(reglen, 1); + for (k = *beg, l = 0; l < reglen && k < l_pac; ++k) + ref_seq[l++] = pacseq[k>>2] >> ((~k&3)<<1) & 3; + + // do alignment + xtra = KSW_XSUBO | KSW_XSTART | (len < 250? KSW_XBYTE : 0); + r = ksw_align(len, (uint8_t*)seq, l, ref_seq, 5, mat, 5, 1, xtra, 0); + gscore = ksw_global(r.qe - r.qb + 1, &seq[r.qb], r.te - r.tb + 1, &ref_seq[r.tb], 5, mat, 5, 1, 50, n_cigar, &cigar32); + cigar = (bwa_cigar_t*)cigar32; + for (k = 0; k < *n_cigar; ++k) + cigar[k] = __cigar_create((cigar32[k]&0xf), (cigar32[k]>>4)); + + if (r.score < SW_MIN_MATCH_LEN || r.score2 == r.score || gscore != r.score) { // poor hit or tandem hits or weird alignment + free(cigar); free(ref_seq); *n_cigar = 0; + return 0; + } + + // check whether the alignment is good enough + for (k = 0, x = y = 0; k < *n_cigar; ++k) { + bwa_cigar_t c = cigar[k]; + if (__cigar_op(c) == FROM_M) x += __cigar_len(c), y += __cigar_len(c); + else if (__cigar_op(c) == FROM_D) x += __cigar_len(c); + else y += __cigar_len(c); + } + if (x < SW_MIN_MATCH_LEN || y < SW_MIN_MATCH_LEN) { // not good enough + free(cigar); free(ref_seq); + *n_cigar = 0; + return 0; + } + + { // update cigar and coordinate; + int start = r.qb, end = r.qe + 1; + *beg += r.tb; + cigar = (bwa_cigar_t*)realloc(cigar, sizeof(bwa_cigar_t) * (*n_cigar + 2)); + if (start) { + memmove(cigar + 1, cigar, sizeof(bwa_cigar_t) * (*n_cigar)); + cigar[0] = __cigar_create(3, start); + ++(*n_cigar); + } + if (end < len) { + /*cigar[*n_cigar] = 3<<14 | (len - end);*/ + cigar[*n_cigar] = __cigar_create(3, (len - end)); + ++(*n_cigar); + } + } + + { // set *cnt + int n_mm, n_gapo, n_gape; + n_mm = n_gapo = n_gape = 0; + x = r.tb; y = r.qb; + for (k = 0; k < *n_cigar; ++k) { + bwa_cigar_t c = cigar[k]; + if (__cigar_op(c) == FROM_M) { + for (l = 0; l < (__cigar_len(c)); ++l) + if (ref_seq[x+l] < 4 && seq[y+l] < 4 && ref_seq[x+l] != seq[y+l]) ++n_mm; + x += __cigar_len(c), y += __cigar_len(c); + } else if (__cigar_op(c) == FROM_D) { + x += __cigar_len(c), ++n_gapo, n_gape += (__cigar_len(c)) - 1; + } else if (__cigar_op(c) == FROM_I) { + y += __cigar_len(c), ++n_gapo, n_gape += (__cigar_len(c)) - 1; + } + } + *_cnt = (uint32_t)n_mm<<16 | n_gapo<<8 | n_gape; + } + + free(ref_seq); + return cigar; +} + +ubyte_t *bwa_paired_sw(const bntseq_t *bns, const ubyte_t *_pacseq, int n_seqs, bwa_seq_t *seqs[2], const pe_opt_t *popt, const isize_info_t *ii) +{ + ubyte_t *pacseq; + int i; + uint64_t n_tot[2], n_mapped[2]; + + // load reference sequence + if (_pacseq == 0) { + pacseq = (ubyte_t*)calloc(bns->l_pac/4+1, 1); + err_rewind(bns->fp_pac); + err_fread_noeof(pacseq, 1, bns->l_pac/4+1, bns->fp_pac); + } else pacseq = (ubyte_t*)_pacseq; + if (!popt->is_sw || ii->avg < 0.0) return pacseq; + + // perform mate alignment + n_tot[0] = n_tot[1] = n_mapped[0] = n_mapped[1] = 0; + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *p[2]; + p[0] = seqs[0] + i; p[1] = seqs[1] + i; + if ((p[0]->mapQ >= SW_MIN_MAPQ || p[1]->mapQ >= SW_MIN_MAPQ) && (p[0]->extra_flag&SAM_FPP) == 0) { // unpaired and one read has high mapQ + int k, n_cigar[2], is_singleton, mapQ = 0, mq_adjust[2]; + int64_t beg[2], end[2]; + bwa_cigar_t *cigar[2]; + uint32_t cnt[2]; + + /* In the following, _pref points to the reference read + * which must be aligned; _pmate points to its mate which is + * considered to be modified. */ + +#define __set_rght_coor(_a, _b, _pref, _pmate) do { \ + (_a) = (int64_t)_pref->pos + ii->avg - 3 * ii->std - _pmate->len * 1.5; \ + (_b) = (_a) + 6 * ii->std + 2 * _pmate->len; \ + if ((_a) < (int64_t)_pref->pos + _pref->len) (_a) = _pref->pos + _pref->len; \ + if ((_b) > bns->l_pac) (_b) = bns->l_pac; \ + } while (0) + +#define __set_left_coor(_a, _b, _pref, _pmate) do { \ + (_a) = (int64_t)_pref->pos + _pref->len - ii->avg - 3 * ii->std - _pmate->len * 0.5; \ + (_b) = (_a) + 6 * ii->std + 2 * _pmate->len; \ + if ((_a) < 0) (_a) = 0; \ + if ((_b) > _pref->pos) (_b) = _pref->pos; \ + } while (0) + +#define __set_fixed(_pref, _pmate, _beg, _cnt) do { \ + _pmate->type = BWA_TYPE_MATESW; \ + _pmate->pos = _beg; \ + _pmate->seQ = _pref->seQ; \ + _pmate->strand = (popt->type == BWA_PET_STD)? 1 - _pref->strand : _pref->strand; \ + _pmate->n_mm = _cnt>>16; _pmate->n_gapo = _cnt>>8&0xff; _pmate->n_gape = _cnt&0xff; \ + _pmate->extra_flag |= SAM_FPP; \ + _pref->extra_flag |= SAM_FPP; \ + } while (0) + + mq_adjust[0] = mq_adjust[1] = 255; // not effective + is_singleton = (p[0]->type == BWA_TYPE_NO_MATCH || p[1]->type == BWA_TYPE_NO_MATCH)? 1 : 0; + + ++n_tot[is_singleton]; + cigar[0] = cigar[1] = 0; + n_cigar[0] = n_cigar[1] = 0; + if (popt->type != BWA_PET_STD) continue; // other types of pairing is not considered + for (k = 0; k < 2; ++k) { // p[1-k] is the reference read and p[k] is the read considered to be modified + ubyte_t *seq; + if (p[1-k]->type == BWA_TYPE_NO_MATCH) continue; // if p[1-k] is unmapped, skip + { // note that popt->type == BWA_PET_STD always true; in older versions, there was a branch for color-space FF/RR reads + if (p[1-k]->strand == 0) { // then the mate is on the reverse strand and has larger coordinate + __set_rght_coor(beg[k], end[k], p[1-k], p[k]); + seq = p[k]->rseq; + } else { // then the mate is on forward stand and has smaller coordinate + __set_left_coor(beg[k], end[k], p[1-k], p[k]); + seq = p[k]->seq; + seq_reverse(p[k]->len, seq, 0); // because ->seq is reversed; this will reversed back shortly + } + } + // perform SW alignment + cigar[k] = bwa_sw_core(bns->l_pac, pacseq, p[k]->len, seq, &beg[k], end[k] - beg[k], &n_cigar[k], &cnt[k]); + if (cigar[k] && p[k]->type != BWA_TYPE_NO_MATCH) { // re-evaluate cigar[k] + int s_old, clip = 0, s_new; + if (__cigar_op(cigar[k][0]) == 3) clip += __cigar_len(cigar[k][0]); + if (__cigar_op(cigar[k][n_cigar[k]-1]) == 3) clip += __cigar_len(cigar[k][n_cigar[k]-1]); + s_old = (int)((p[k]->n_mm * 9 + p[k]->n_gapo * 13 + p[k]->n_gape * 2) / 3. * 8. + .499); + s_new = (int)(((cnt[k]>>16) * 9 + (cnt[k]>>8&0xff) * 13 + (cnt[k]&0xff) * 2 + clip * 3) / 3. * 8. + .499); + s_old += -4.343 * log(ii->ap_prior / bns->l_pac); + s_new += (int)(-4.343 * log(.5 * erfc(M_SQRT1_2 * 1.5) + .499)); // assume the mapped isize is 1.5\sigma + if (s_old < s_new) { // reject SW alignment + mq_adjust[k] = s_new - s_old; + free(cigar[k]); cigar[k] = 0; n_cigar[k] = 0; + } else mq_adjust[k] = s_old - s_new; + } + // now revserse sequence back such that p[*]->seq looks untouched + if (popt->type == BWA_PET_STD) { + if (p[1-k]->strand == 1) seq_reverse(p[k]->len, seq, 0); + } else { + if (p[1-k]->strand == 0) seq_reverse(p[k]->len, seq, 0); + } + } + k = -1; // no read to be changed + if (cigar[0] && cigar[1]) { + k = p[0]->mapQ < p[1]->mapQ? 0 : 1; // p[k] to be fixed + mapQ = abs(p[1]->mapQ - p[0]->mapQ); + } else if (cigar[0]) k = 0, mapQ = p[1]->mapQ; + else if (cigar[1]) k = 1, mapQ = p[0]->mapQ; + if (k >= 0 && p[k]->pos != beg[k]) { + ++n_mapped[is_singleton]; + { // recalculate mapping quality + int tmp = (int)p[1-k]->mapQ - p[k]->mapQ/2 - 8; + if (tmp <= 0) tmp = 1; + if (mapQ > tmp) mapQ = tmp; + p[k]->mapQ = p[1-k]->mapQ = mapQ; + p[k]->seQ = p[1-k]->seQ = p[1-k]->seQ < mapQ? p[1-k]->seQ : mapQ; + if (p[k]->mapQ > mq_adjust[k]) p[k]->mapQ = mq_adjust[k]; + if (p[k]->seQ > mq_adjust[k]) p[k]->seQ = mq_adjust[k]; + } + // update CIGAR + free(p[k]->cigar); p[k]->cigar = cigar[k]; cigar[k] = 0; + p[k]->n_cigar = n_cigar[k]; + // update the rest of information + __set_fixed(p[1-k], p[k], beg[k], cnt[k]); + } + free(cigar[0]); free(cigar[1]); + } + } + fprintf(stderr, "[bwa_paired_sw] %lld out of %lld Q%d singletons are mated.\n", + (long long)n_mapped[1], (long long)n_tot[1], SW_MIN_MAPQ); + fprintf(stderr, "[bwa_paired_sw] %lld out of %lld Q%d discordant pairs are fixed.\n", + (long long)n_mapped[0], (long long)n_tot[0], SW_MIN_MAPQ); + return pacseq; +} + +void bwa_sai2sam_pe_core(const char *prefix, char *const fn_sa[2], char *const fn_fa[2], pe_opt_t *popt, const char *rg_line) +{ + extern bwa_seqio_t *bwa_open_reads(int mode, const char *fn_fa); + int i, j, n_seqs; + long long tot_seqs = 0; + bwa_seq_t *seqs[2]; + bwa_seqio_t *ks[2]; + clock_t t; + bntseq_t *bns; + FILE *fp_sa[2]; + gap_opt_t opt, opt0; + khint_t iter; + isize_info_t last_ii; // this is for the last batch of reads + char str[1024], magic[2][4]; + bwt_t *bwt; + uint8_t *pac; + + // initialization + bwase_initialize(); // initialize g_log_n[] in bwase.c + pac = 0; bwt = 0; + for (i = 1; i != 256; ++i) g_log_n[i] = (int)(4.343 * log(i) + 0.5); + bns = bns_restore(prefix); + srand48(bns->seed); + fp_sa[0] = xopen(fn_sa[0], "r"); + fp_sa[1] = xopen(fn_sa[1], "r"); + g_hash = kh_init(b128); + last_ii.avg = -1.0; + + err_fread_noeof(magic[0], 1, 4, fp_sa[0]); + err_fread_noeof(magic[1], 1, 4, fp_sa[1]); + if (strncmp(magic[0], SAI_MAGIC, 4) != 0 || strncmp(magic[1], SAI_MAGIC, 4) != 0) { + fprintf(stderr, "[E::%s] Unmatched SAI magic. Please re-run `aln' with the same version of bwa.\n", __func__); + exit(1); + } + err_fread_noeof(&opt, sizeof(gap_opt_t), 1, fp_sa[0]); + ks[0] = bwa_open_reads(opt.mode, fn_fa[0]); + opt0 = opt; + err_fread_noeof(&opt, sizeof(gap_opt_t), 1, fp_sa[1]); // overwritten! + ks[1] = bwa_open_reads(opt.mode, fn_fa[1]); + { // for Illumina alignment only + if (popt->is_preload) { + strcpy(str, prefix); strcat(str, ".bwt"); bwt = bwt_restore_bwt(str); + strcpy(str, prefix); strcat(str, ".sa"); bwt_restore_sa(str, bwt); + pac = (ubyte_t*)calloc(bns->l_pac/4+1, 1); + err_rewind(bns->fp_pac); + err_fread_noeof(pac, 1, bns->l_pac/4+1, bns->fp_pac); + } + } + + // core loop + bwa_print_sam_hdr(bns, rg_line); + while ((seqs[0] = bwa_read_seq(ks[0], 0x40000, &n_seqs, opt0.mode, opt0.trim_qual)) != 0) { + int cnt_chg; + isize_info_t ii; + ubyte_t *pacseq; + + seqs[1] = bwa_read_seq(ks[1], 0x40000, &n_seqs, opt.mode, opt.trim_qual); + tot_seqs += n_seqs; + t = clock(); + + fprintf(stderr, "[bwa_sai2sam_pe_core] convert to sequence coordinate... \n"); + cnt_chg = bwa_cal_pac_pos_pe(bns, prefix, bwt, n_seqs, seqs, fp_sa, &ii, popt, &opt, &last_ii); + fprintf(stderr, "[bwa_sai2sam_pe_core] time elapses: %.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); t = clock(); + fprintf(stderr, "[bwa_sai2sam_pe_core] changing coordinates of %d alignments.\n", cnt_chg); + + fprintf(stderr, "[bwa_sai2sam_pe_core] align unmapped mate...\n"); + pacseq = bwa_paired_sw(bns, pac, n_seqs, seqs, popt, &ii); + fprintf(stderr, "[bwa_sai2sam_pe_core] time elapses: %.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); t = clock(); + + fprintf(stderr, "[bwa_sai2sam_pe_core] refine gapped alignments... "); + for (j = 0; j < 2; ++j) + bwa_refine_gapped(bns, n_seqs, seqs[j], pacseq); + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); t = clock(); + if (pac == 0) free(pacseq); + + fprintf(stderr, "[bwa_sai2sam_pe_core] print alignments... "); + for (i = 0; i < n_seqs; ++i) { + bwa_seq_t *p[2]; + p[0] = seqs[0] + i; p[1] = seqs[1] + i; + if (p[0]->bc[0] || p[1]->bc[0]) { + strcat(p[0]->bc, p[1]->bc); + strcpy(p[1]->bc, p[0]->bc); + } + bwa_print_sam1(bns, p[0], p[1], opt.mode, opt.max_top2); + bwa_print_sam1(bns, p[1], p[0], opt.mode, opt.max_top2); + if (strcmp(p[0]->name, p[1]->name) != 0) err_fatal(__func__, "paired reads have different names: \"%s\", \"%s\"\n", p[0]->name, p[1]->name); + } + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); t = clock(); + + for (j = 0; j < 2; ++j) + bwa_free_read_seq(n_seqs, seqs[j]); + fprintf(stderr, "[bwa_sai2sam_pe_core] %lld sequences have been processed.\n", tot_seqs); + last_ii = ii; + } + + // destroy + bns_destroy(bns); + for (i = 0; i < 2; ++i) { + bwa_seq_close(ks[i]); + err_fclose(fp_sa[i]); + } + for (iter = kh_begin(g_hash); iter != kh_end(g_hash); ++iter) + if (kh_exist(g_hash, iter)) free(kh_val(g_hash, iter).a); + kh_destroy(b128, g_hash); + if (pac) { + free(pac); bwt_destroy(bwt); + } +} + +int bwa_sai2sam_pe(int argc, char *argv[]) +{ + int c; + pe_opt_t *popt; + char *prefix, *rg_line = 0; + + popt = bwa_init_pe_opt(); + while ((c = getopt(argc, argv, "a:o:sPn:N:c:f:Ar:")) >= 0) { + switch (c) { + case 'r': + if ((rg_line = bwa_set_rg(optarg)) == 0) return 1; + break; + case 'a': popt->max_isize = atoi(optarg); break; + case 'o': popt->max_occ = atoi(optarg); break; + case 's': popt->is_sw = 0; break; + case 'P': popt->is_preload = 1; break; + case 'n': popt->n_multi = atoi(optarg); break; + case 'N': popt->N_multi = atoi(optarg); break; + case 'c': popt->ap_prior = atof(optarg); break; + case 'f': xreopen(optarg, "w", stdout); break; + case 'A': popt->force_isize = 1; break; + default: return 1; + } + } + + if (optind + 5 > argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa sampe [options] \n\n"); + fprintf(stderr, "Options: -a INT maximum insert size [%d]\n", popt->max_isize); + fprintf(stderr, " -o INT maximum occurrences for one end [%d]\n", popt->max_occ); + fprintf(stderr, " -n INT maximum hits to output for paired reads [%d]\n", popt->n_multi); + fprintf(stderr, " -N INT maximum hits to output for discordant pairs [%d]\n", popt->N_multi); + fprintf(stderr, " -c FLOAT prior of chimeric rate (lower bound) [%.1le]\n", popt->ap_prior); + fprintf(stderr, " -f FILE sam file to output results to [stdout]\n"); + fprintf(stderr, " -r STR read group header line such as `@RG\\tID:foo\\tSM:bar' [null]\n"); + fprintf(stderr, " -P preload index into memory (for base-space reads only)\n"); + fprintf(stderr, " -s disable Smith-Waterman for the unmapped mate\n"); + fprintf(stderr, " -A disable insert size estimate (force -s)\n\n"); + fprintf(stderr, "Notes: 1. For SOLiD reads, corresponds R3 reads and to F3.\n"); + fprintf(stderr, " 2. For reads shorter than 30bp, applying a smaller -o is recommended to\n"); + fprintf(stderr, " to get a sensible speed at the cost of pairing accuracy.\n"); + fprintf(stderr, "\n"); + return 1; + } + if ((prefix = bwa_idx_infer_prefix(argv[optind])) == 0) { + fprintf(stderr, "[%s] fail to locate the index\n", __func__); + return 1; + } + bwa_sai2sam_pe_core(prefix, argv + optind + 1, argv + optind+3, popt, rg_line); + free(prefix); free(popt); + return 0; +} diff --git a/bwase.c b/bwase.c new file mode 100644 index 0000000..017890b --- /dev/null +++ b/bwase.c @@ -0,0 +1,606 @@ +#include +#include +#include +#include +#include +#include +#include +#include "bwase.h" +#include "bwtaln.h" +#include "bntseq.h" +#include "utils.h" +#include "kstring.h" +#include "bwa.h" +#include "ksw.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +int g_log_n[256]; + +void bwa_aln2seq_core(int n_aln, const bwt_aln1_t *aln, bwa_seq_t *s, int set_main, int n_multi) +{ + int i, cnt, best; + if (n_aln == 0) { + s->type = BWA_TYPE_NO_MATCH; + s->c1 = s->c2 = 0; + return; + } + + if (set_main) { + best = aln[0].score; + for (i = cnt = 0; i < n_aln; ++i) { + const bwt_aln1_t *p = aln + i; + if (p->score > best) break; + if (drand48() * (p->l - p->k + 1 + cnt) > (double)cnt) { + s->n_mm = p->n_mm; s->n_gapo = p->n_gapo; s->n_gape = p->n_gape; + s->ref_shift = (int)p->n_del - (int)p->n_ins; + s->score = p->score; + s->sa = p->k + (bwtint_t)((p->l - p->k + 1) * drand48()); + } + cnt += p->l - p->k + 1; + } + s->c1 = cnt; + for (; i < n_aln; ++i) cnt += aln[i].l - aln[i].k + 1; + s->c2 = cnt - s->c1; + s->type = s->c1 > 1? BWA_TYPE_REPEAT : BWA_TYPE_UNIQUE; + } + + if (n_multi) { + int k, rest, n_occ, z = 0; + for (k = n_occ = 0; k < n_aln; ++k) { + const bwt_aln1_t *q = aln + k; + n_occ += q->l - q->k + 1; + } + if (s->multi) free(s->multi); + if (n_occ > n_multi + 1) { // if there are too many hits, generate none of them + s->multi = 0; s->n_multi = 0; + return; + } + /* The following code is more flexible than what is required + * here. In principle, due to the requirement above, we can + * simply output all hits, but the following samples "rest" + * number of random hits. */ + rest = n_occ > n_multi + 1? n_multi + 1 : n_occ; // find one additional for ->sa + s->multi = calloc(rest, sizeof(bwt_multi1_t)); + for (k = 0; k < n_aln; ++k) { + const bwt_aln1_t *q = aln + k; + if (q->l - q->k + 1 <= rest) { + bwtint_t l; + for (l = q->k; l <= q->l; ++l) { + s->multi[z].pos = l; + s->multi[z].gap = q->n_gapo + q->n_gape; + s->multi[z].ref_shift = (int)q->n_del - (int)q->n_ins; + s->multi[z++].mm = q->n_mm; + } + rest -= q->l - q->k + 1; + } else { // Random sampling (http://code.activestate.com/recipes/272884/). In fact, we never come here. + int j, i; + for (j = rest, i = q->l - q->k + 1; j > 0; --j) { + double p = 1.0, x = drand48(); + while (x < p) p -= p * j / (i--); + s->multi[z].pos = q->l - i; + s->multi[z].gap = q->n_gapo + q->n_gape; + s->multi[z].ref_shift = (int)q->n_del - (int)q->n_ins; + s->multi[z++].mm = q->n_mm; + } + rest = 0; + break; + } + } + s->n_multi = z; + } +} + +void bwa_aln2seq(int n_aln, const bwt_aln1_t *aln, bwa_seq_t *s) +{ + bwa_aln2seq_core(n_aln, aln, s, 1, 0); +} + +int bwa_approx_mapQ(const bwa_seq_t *p, int mm) +{ + int n; + if (p->c1 == 0) return 23; + if (p->c1 > 1) return 0; + if (p->n_mm == mm) return 25; + if (p->c2 == 0) return 37; + n = (p->c2 >= 255)? 255 : p->c2; + return (23 < g_log_n[n])? 0 : 23 - g_log_n[n]; +} + +bwtint_t bwa_sa2pos(const bntseq_t *bns, const bwt_t *bwt, bwtint_t sapos, int ref_len, int *strand) +{ + bwtint_t pos_f; + int is_rev; + *strand = 0; // initialise strand to 0 otherwise we could return without setting it + pos_f = bwt_sa(bwt, sapos); // position on the forward-reverse coordinate + if (pos_f < bns->l_pac && bns->l_pac < pos_f + ref_len) return (bwtint_t)-1; + pos_f = bns_depos(bns, pos_f, &is_rev); // position on the forward strand; this may be the first base or the last base + *strand = !is_rev; + if (is_rev) pos_f = pos_f + 1 < ref_len? 0 : pos_f - ref_len + 1; // position of the first base + return pos_f; // FIXME: it is possible that pos_f < bns->anns[ref_id].offset +} + +/** + * Derive the actual position in the read from the given suffix array + * coordinates. Note that the position will be approximate based on + * whether indels appear in the read and whether calculations are + * performed from the start or end of the read. + */ +void bwa_cal_pac_pos_core(const bntseq_t *bns, const bwt_t *bwt, bwa_seq_t *seq, const int max_mm, const float fnr) +{ + int max_diff, strand; + if (seq->type != BWA_TYPE_UNIQUE && seq->type != BWA_TYPE_REPEAT) return; + max_diff = fnr > 0.0? bwa_cal_maxdiff(seq->len, BWA_AVG_ERR, fnr) : max_mm; + seq->seQ = seq->mapQ = bwa_approx_mapQ(seq, max_diff); + //fprintf(stderr, "%d\n", seq->ref_shift); + seq->pos = bwa_sa2pos(bns, bwt, seq->sa, seq->len + seq->ref_shift, &strand); + seq->strand = strand; + seq->seQ = seq->mapQ = bwa_approx_mapQ(seq, max_diff); + if (seq->pos == (bwtint_t)-1) seq->type = BWA_TYPE_NO_MATCH; +} + +void bwa_cal_pac_pos(const bntseq_t *bns, const char *prefix, int n_seqs, bwa_seq_t *seqs, int max_mm, float fnr) +{ + int i, j, strand, n_multi; + char str[1024]; + bwt_t *bwt; + // load forward SA + strcpy(str, prefix); strcat(str, ".bwt"); bwt = bwt_restore_bwt(str); + strcpy(str, prefix); strcat(str, ".sa"); bwt_restore_sa(str, bwt); + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *p = &seqs[i]; + bwa_cal_pac_pos_core(bns, bwt, p, max_mm, fnr); + for (j = n_multi = 0; j < p->n_multi; ++j) { + bwt_multi1_t *q = p->multi + j; + q->pos = bwa_sa2pos(bns, bwt, q->pos, p->len + q->ref_shift, &strand); + q->strand = strand; + if (q->pos != p->pos && q->pos != (bwtint_t)-1) + p->multi[n_multi++] = *q; + } + p->n_multi = n_multi; + } + bwt_destroy(bwt); +} + +#define SW_BW 50 + +bwa_cigar_t *bwa_refine_gapped_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, ubyte_t *seq, int ref_shift, bwtint_t *_rb, int *n_cigar) +{ + bwa_cigar_t *cigar = 0; + uint32_t *cigar32 = 0; + ubyte_t *rseq; + int64_t k, rb, re, rlen; + int8_t mat[25]; + int w; + + bwa_fill_scmat(1, 3, mat); + rb = *_rb; re = rb + len + ref_shift; + assert(re <= l_pac); + rseq = bns_get_seq(l_pac, pacseq, rb, re, &rlen); + assert(re - rb == rlen); + w = abs((int)rlen - len) * 1.5; + ksw_global(len, seq, rlen, rseq, 5, mat, 5, 1, SW_BW > w? SW_BW : w, n_cigar, &cigar32); + assert(*n_cigar > 0); + if ((cigar32[*n_cigar - 1]&0xf) == 1) cigar32[*n_cigar - 1] = (cigar32[*n_cigar - 1]>>4<<4) | 3; // change endding ins to soft clipping + if ((cigar32[0]&0xf) == 1) cigar32[0] = (cigar32[0]>>4<<4) | 3; // change beginning ins to soft clipping + if ((cigar32[*n_cigar - 1]&0xf) == 2) --*n_cigar; // delete endding del + if ((cigar32[0]&0xf) == 2) { // delete beginning del + *_rb += cigar32[0]>>4; + --*n_cigar; + memmove(cigar32, cigar32+1, (*n_cigar) * 4); + } + cigar = (bwa_cigar_t*)cigar32; + for (k = 0; k < *n_cigar; ++k) + cigar[k] = __cigar_create((cigar32[k]&0xf), (cigar32[k]>>4)); + free(rseq); + return cigar; +} + +char *bwa_cal_md1(int n_cigar, bwa_cigar_t *cigar, int len, bwtint_t pos, ubyte_t *seq, + bwtint_t l_pac, ubyte_t *pacseq, kstring_t *str, int *_nm) +{ + bwtint_t x, y; + int z, u, c, nm = 0; + str->l = 0; // reset + x = pos; y = 0; + if (cigar) { + int k, l; + for (k = u = 0; k < n_cigar; ++k) { + l = __cigar_len(cigar[k]); + if (__cigar_op(cigar[k]) == FROM_M) { + for (z = 0; z < l && x+z < l_pac; ++z) { + c = pacseq[(x+z)>>2] >> ((~(x+z)&3)<<1) & 3; + if (c > 3 || seq[y+z] > 3 || c != seq[y+z]) { + ksprintf(str, "%d", u); + kputc("ACGTN"[c], str); + ++nm; + u = 0; + } else ++u; + } + x += l; y += l; + } else if (__cigar_op(cigar[k]) == FROM_I || __cigar_op(cigar[k]) == FROM_S) { + y += l; + if (__cigar_op(cigar[k]) == FROM_I) nm += l; + } else if (__cigar_op(cigar[k]) == FROM_D) { + ksprintf(str, "%d", u); + kputc('^', str); + for (z = 0; z < l && x+z < l_pac; ++z) + kputc("ACGT"[pacseq[(x+z)>>2] >> ((~(x+z)&3)<<1) & 3], str); + u = 0; + x += l; nm += l; + } + } + } else { // no gaps + for (z = u = 0; z < (bwtint_t)len && x+z < l_pac; ++z) { + c = pacseq[(x+z)>>2] >> ((~(x+z)&3)<<1) & 3; + if (c > 3 || seq[y+z] > 3 || c != seq[y+z]) { + ksprintf(str, "%d", u); + kputc("ACGTN"[c], str); + ++nm; + u = 0; + } else ++u; + } + } + ksprintf(str, "%d", u); + *_nm = nm; + return strdup(str->s); +} + +void bwa_correct_trimmed(bwa_seq_t *s) +{ + if (s->len == s->full_len) return; + if (s->strand == 0) { // forward + if (s->cigar && __cigar_op(s->cigar[s->n_cigar-1]) == FROM_S) { // the last is S + s->cigar[s->n_cigar-1] += s->full_len - s->len; + } else { + if (s->cigar == 0) { + s->n_cigar = 2; + s->cigar = calloc(s->n_cigar, sizeof(bwa_cigar_t)); + s->cigar[0] = __cigar_create(0, s->len); + } else { + ++s->n_cigar; + s->cigar = realloc(s->cigar, s->n_cigar * sizeof(bwa_cigar_t)); + } + s->cigar[s->n_cigar-1] = __cigar_create(3, (s->full_len - s->len)); + } + } else { // reverse + if (s->cigar && __cigar_op(s->cigar[0]) == FROM_S) { // the first is S + s->cigar[0] += s->full_len - s->len; + } else { + if (s->cigar == 0) { + s->n_cigar = 2; + s->cigar = calloc(s->n_cigar, sizeof(bwa_cigar_t)); + s->cigar[1] = __cigar_create(0, s->len); + } else { + ++s->n_cigar; + s->cigar = realloc(s->cigar, s->n_cigar * sizeof(bwa_cigar_t)); + memmove(s->cigar + 1, s->cigar, (s->n_cigar-1) * sizeof(bwa_cigar_t)); + } + s->cigar[0] = __cigar_create(3, (s->full_len - s->len)); + } + } + s->len = s->full_len; +} + +void bwa_refine_gapped(const bntseq_t *bns, int n_seqs, bwa_seq_t *seqs, ubyte_t *_pacseq) +{ + ubyte_t *pacseq; + int i, j, k; + kstring_t *str; + + if (!_pacseq) { + pacseq = (ubyte_t*)calloc(bns->l_pac/4+1, 1); + err_rewind(bns->fp_pac); + err_fread_noeof(pacseq, 1, bns->l_pac/4+1, bns->fp_pac); + } else pacseq = _pacseq; + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *s = seqs + i; + seq_reverse(s->len, s->seq, 0); // IMPORTANT: s->seq is reversed here!!! + for (j = k = 0; j < s->n_multi; ++j) { + bwt_multi1_t *q = s->multi + j; + int n_cigar; + if (q->gap) { // gapped alignment + q->cigar = bwa_refine_gapped_core(bns->l_pac, pacseq, s->len, q->strand? s->rseq : s->seq, q->ref_shift, &q->pos, &n_cigar); + q->n_cigar = n_cigar; + if (q->cigar) s->multi[k++] = *q; + } else s->multi[k++] = *q; + } + s->n_multi = k; // this squeezes out gapped alignments which failed the CIGAR generation + if (s->type == BWA_TYPE_NO_MATCH || s->type == BWA_TYPE_MATESW || s->n_gapo == 0) continue; + s->cigar = bwa_refine_gapped_core(bns->l_pac, pacseq, s->len, s->strand? s->rseq : s->seq, s->ref_shift, &s->pos, &s->n_cigar); + if (s->cigar == 0) s->type = BWA_TYPE_NO_MATCH; + } + // generate MD tag + str = (kstring_t*)calloc(1, sizeof(kstring_t)); + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *s = seqs + i; + if (s->type != BWA_TYPE_NO_MATCH) { + int nm; + s->md = bwa_cal_md1(s->n_cigar, s->cigar, s->len, s->pos, s->strand? s->rseq : s->seq, bns->l_pac, pacseq, str, &nm); + s->nm = nm; + } + } + free(str->s); free(str); + + // correct for trimmed reads + for (i = 0; i < n_seqs; ++i) bwa_correct_trimmed(seqs + i); + + if (!_pacseq) free(pacseq); +} + +int64_t pos_end(const bwa_seq_t *p) +{ + if (p->cigar) { + int j; + int64_t x = p->pos; + for (j = 0; j != p->n_cigar; ++j) { + int op = __cigar_op(p->cigar[j]); + if (op == 0 || op == 2) x += __cigar_len(p->cigar[j]); + } + return x; + } else return p->pos + p->len; +} + +int64_t pos_end_multi(const bwt_multi1_t *p, int len) // analogy to pos_end() +{ + if (p->cigar) { + int j; + int64_t x = p->pos; + for (j = 0; j != p->n_cigar; ++j) { + int op = __cigar_op(p->cigar[j]); + if (op == 0 || op == 2) x += __cigar_len(p->cigar[j]); + } + return x; + } else return p->pos + len; +} + +static int64_t pos_5(const bwa_seq_t *p) +{ + if (p->type != BWA_TYPE_NO_MATCH) + return p->strand? pos_end(p) : p->pos; + return -1; +} + +void bwa_print_seq(FILE *stream, bwa_seq_t *seq) { + char buffer[4096]; + const int bsz = sizeof(buffer); + int i, j, l; + + if (seq->strand == 0) { + for (i = 0; i < seq->full_len; i += bsz) { + l = seq->full_len - i > bsz ? bsz : seq->full_len - i; + for (j = 0; j < l; j++) buffer[j] = "ACGTN"[seq->seq[i + j]]; + err_fwrite(buffer, 1, l, stream); + } + } else { + for (i = seq->full_len - 1; i >= 0; i -= bsz) { + l = i + 1 > bsz ? bsz : i + 1; + for (j = 0; j < l; j++) buffer[j] = "TGCAN"[seq->seq[i - j]]; + err_fwrite(buffer, 1, l, stream); + } + } +} + +void bwa_print_sam1(const bntseq_t *bns, bwa_seq_t *p, const bwa_seq_t *mate, int mode, int max_top2) +{ + int j; + if (p->type != BWA_TYPE_NO_MATCH || (mate && mate->type != BWA_TYPE_NO_MATCH)) { + int seqid, nn, am = 0, flag = p->extra_flag; + char XT; + + if (p->type == BWA_TYPE_NO_MATCH) { + p->pos = mate->pos; + p->strand = mate->strand; + flag |= SAM_FSU; + j = 1; + } else j = pos_end(p) - p->pos; // j is the length of the reference in the alignment + + // get seqid + nn = bns_cnt_ambi(bns, p->pos, j, &seqid); + if (p->type != BWA_TYPE_NO_MATCH && p->pos + j - bns->anns[seqid].offset > bns->anns[seqid].len) + flag |= SAM_FSU; // flag UNMAP as this alignment bridges two adjacent reference sequences + + // update flag and print it + if (p->strand) flag |= SAM_FSR; + if (mate) { + if (mate->type != BWA_TYPE_NO_MATCH) { + if (mate->strand) flag |= SAM_FMR; + } else flag |= SAM_FMU; + } + err_printf("%s\t%d\t%s\t", p->name, flag, bns->anns[seqid].name); + err_printf("%d\t%d\t", (int)(p->pos - bns->anns[seqid].offset + 1), p->mapQ); + + // print CIGAR + if (p->cigar) { + for (j = 0; j != p->n_cigar; ++j) + err_printf("%d%c", __cigar_len(p->cigar[j]), "MIDS"[__cigar_op(p->cigar[j])]); + } else if (p->type == BWA_TYPE_NO_MATCH) err_printf("*"); + else err_printf("%dM", p->len); + + // print mate coordinate + if (mate && mate->type != BWA_TYPE_NO_MATCH) { + int m_seqid; + long long isize; + am = mate->seQ < p->seQ? mate->seQ : p->seQ; // smaller single-end mapping quality + // redundant calculation here, but should not matter too much + bns_cnt_ambi(bns, mate->pos, mate->len, &m_seqid); + err_printf("\t%s\t", (seqid == m_seqid)? "=" : bns->anns[m_seqid].name); + isize = (seqid == m_seqid)? pos_5(mate) - pos_5(p) : 0; + if (p->type == BWA_TYPE_NO_MATCH) isize = 0; + err_printf("%d\t%lld\t", (int)(mate->pos - bns->anns[m_seqid].offset + 1), isize); + } else if (mate) err_printf("\t=\t%d\t0\t", (int)(p->pos - bns->anns[seqid].offset + 1)); + else err_printf("\t*\t0\t0\t"); + + // print sequence and quality + bwa_print_seq(stdout, p); + err_putchar('\t'); + if (p->qual) { + if (p->strand) seq_reverse(p->len, p->qual, 0); // reverse quality + err_printf("%s", p->qual); + } else err_printf("*"); + + if (bwa_rg_id[0]) err_printf("\tRG:Z:%s", bwa_rg_id); + if (p->bc[0]) err_printf("\tBC:Z:%s", p->bc); + if (p->clip_len < p->full_len) err_printf("\tXC:i:%d", p->clip_len); + if (p->type != BWA_TYPE_NO_MATCH) { + int i; + // calculate XT tag + XT = "NURM"[p->type]; + if (nn > 10) XT = 'N'; + // print tags + err_printf("\tXT:A:%c\t%s:i:%d", XT, (mode & BWA_MODE_COMPREAD)? "NM" : "CM", p->nm); + if (nn) err_printf("\tXN:i:%d", nn); + if (mate) err_printf("\tSM:i:%d\tAM:i:%d", p->seQ, am); + if (p->type != BWA_TYPE_MATESW) { // X0 and X1 are not available for this type of alignment + err_printf("\tX0:i:%d", p->c1); + if (p->c1 <= max_top2) err_printf("\tX1:i:%d", p->c2); + } + err_printf("\tXM:i:%d\tXO:i:%d\tXG:i:%d", p->n_mm, p->n_gapo, p->n_gapo+p->n_gape); + if (p->md) err_printf("\tMD:Z:%s", p->md); + // print multiple hits + if (p->n_multi) { + err_printf("\tXA:Z:"); + for (i = 0; i < p->n_multi; ++i) { + bwt_multi1_t *q = p->multi + i; + int k; + j = pos_end_multi(q, p->len) - q->pos; + nn = bns_cnt_ambi(bns, q->pos, j, &seqid); + err_printf("%s,%c%d,", bns->anns[seqid].name, q->strand? '-' : '+', + (int)(q->pos - bns->anns[seqid].offset + 1)); + if (q->cigar) { + for (k = 0; k < q->n_cigar; ++k) + err_printf("%d%c", __cigar_len(q->cigar[k]), "MIDS"[__cigar_op(q->cigar[k])]); + } else err_printf("%dM", p->len); + err_printf(",%d;", q->gap + q->mm); + } + } + } + err_putchar('\n'); + } else { // this read has no match + //ubyte_t *s = p->strand? p->rseq : p->seq; + int flag = p->extra_flag | SAM_FSU; + if (mate && mate->type == BWA_TYPE_NO_MATCH) flag |= SAM_FMU; + err_printf("%s\t%d\t*\t0\t0\t*\t*\t0\t0\t", p->name, flag); + //Why did this work differently to the version above?? + //for (j = 0; j != p->len; ++j) putchar("ACGTN"[(int)s[j]]); + bwa_print_seq(stdout, p); + err_putchar('\t'); + if (p->qual) { + if (p->strand) seq_reverse(p->len, p->qual, 0); // reverse quality + err_printf("%s", p->qual); + } else err_printf("*"); + if (bwa_rg_id[0]) err_printf("\tRG:Z:%s", bwa_rg_id); + if (p->bc[0]) err_printf("\tBC:Z:%s", p->bc); + if (p->clip_len < p->full_len) err_printf("\tXC:i:%d", p->clip_len); + err_putchar('\n'); + } +} + +void bwase_initialize() +{ + int i; + for (i = 1; i != 256; ++i) g_log_n[i] = (int)(4.343 * log(i) + 0.5); +} + +void bwa_sai2sam_se_core(const char *prefix, const char *fn_sa, const char *fn_fa, int n_occ, const char *rg_line) +{ + extern bwa_seqio_t *bwa_open_reads(int mode, const char *fn_fa); + int i, n_seqs, m_aln; + long long tot_seqs = 0; + bwt_aln1_t *aln = 0; + bwa_seq_t *seqs; + bwa_seqio_t *ks; + clock_t t; + bntseq_t *bns; + FILE *fp_sa; + gap_opt_t opt; + char magic[4]; + + // initialization + bwase_initialize(); + bns = bns_restore(prefix); + srand48(bns->seed); + fp_sa = xopen(fn_sa, "r"); + + m_aln = 0; + err_fread_noeof(magic, 1, 4, fp_sa); + if (strncmp(magic, SAI_MAGIC, 4) != 0) { + fprintf(stderr, "[E::%s] Unmatched SAI magic. Please re-run `aln' with the same version of bwa.\n", __func__); + exit(1); + } + err_fread_noeof(&opt, sizeof(gap_opt_t), 1, fp_sa); + bwa_print_sam_hdr(bns, rg_line); + // set ks + ks = bwa_open_reads(opt.mode, fn_fa); + // core loop + while ((seqs = bwa_read_seq(ks, 0x40000, &n_seqs, opt.mode, opt.trim_qual)) != 0) { + tot_seqs += n_seqs; + t = clock(); + + // read alignment + for (i = 0; i < n_seqs; ++i) { + bwa_seq_t *p = seqs + i; + int n_aln; + err_fread_noeof(&n_aln, 4, 1, fp_sa); + if (n_aln > m_aln) { + m_aln = n_aln; + aln = (bwt_aln1_t*)realloc(aln, sizeof(bwt_aln1_t) * m_aln); + } + err_fread_noeof(aln, sizeof(bwt_aln1_t), n_aln, fp_sa); + bwa_aln2seq_core(n_aln, aln, p, 1, n_occ); + } + + fprintf(stderr, "[bwa_aln_core] convert to sequence coordinate... "); + bwa_cal_pac_pos(bns, prefix, n_seqs, seqs, opt.max_diff, opt.fnr); // forward bwt will be destroyed here + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); t = clock(); + + fprintf(stderr, "[bwa_aln_core] refine gapped alignments... "); + bwa_refine_gapped(bns, n_seqs, seqs, 0); + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); t = clock(); + + fprintf(stderr, "[bwa_aln_core] print alignments... "); + for (i = 0; i < n_seqs; ++i) + bwa_print_sam1(bns, seqs + i, 0, opt.mode, opt.max_top2); + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + + bwa_free_read_seq(n_seqs, seqs); + fprintf(stderr, "[bwa_aln_core] %lld sequences have been processed.\n", tot_seqs); + } + + // destroy + bwa_seq_close(ks); + bns_destroy(bns); + err_fclose(fp_sa); + free(aln); +} + +int bwa_sai2sam_se(int argc, char *argv[]) +{ + int c, n_occ = 3; + char *prefix, *rg_line = 0; + while ((c = getopt(argc, argv, "hn:f:r:")) >= 0) { + switch (c) { + case 'h': break; + case 'r': + if ((rg_line = bwa_set_rg(optarg)) == 0) return 1; + break; + case 'n': n_occ = atoi(optarg); break; + case 'f': xreopen(optarg, "w", stdout); break; + default: return 1; + } + } + + if (optind + 3 > argc) { + fprintf(stderr, "Usage: fastbwa samse [-n max_occ] [-f out.sam] [-r RG_line] \n"); + return 1; + } + if ((prefix = bwa_idx_infer_prefix(argv[optind])) == 0) { + fprintf(stderr, "[%s] fail to locate the index\n", __func__); + return 1; + } + bwa_sai2sam_se_core(prefix, argv[optind+1], argv[optind+2], n_occ, rg_line); + free(prefix); + return 0; +} diff --git a/bwase.h b/bwase.h new file mode 100644 index 0000000..26a9f68 --- /dev/null +++ b/bwase.h @@ -0,0 +1,29 @@ +#ifndef BWASE_H +#define BWASE_H + +#include "bntseq.h" +#include "bwt.h" +#include "bwtaln.h" + +#ifdef __cplusplus +extern "C" { +#endif + + // Initialize mapping tables in the bwa single-end mapper. + void bwase_initialize(); + // Calculate the approximate position of the sequence from the specified bwt with loaded suffix array. + void bwa_cal_pac_pos_core(const bntseq_t *bns, const bwt_t* bwt, bwa_seq_t* seq, const int max_mm, const float fnr); + // Refine the approximate position of the sequence to an actual placement for the sequence. + void bwa_refine_gapped(const bntseq_t *bns, int n_seqs, bwa_seq_t *seqs, ubyte_t *_pacseq); + // Backfill certain alignment properties mainly centering around number of matches. + void bwa_aln2seq(int n_aln, const bwt_aln1_t *aln, bwa_seq_t *s); + // Calculate the end position of a read given a certain sequence. + int64_t pos_end(const bwa_seq_t *p); + // + bwtint_t bwa_sa2pos(const bntseq_t *bns, const bwt_t *bwt, bwtint_t sapos, int len, int *strand); + +#ifdef __cplusplus +} +#endif + +#endif // BWASE_H diff --git a/bwaseqio.c b/bwaseqio.c new file mode 100644 index 0000000..d850307 --- /dev/null +++ b/bwaseqio.c @@ -0,0 +1,235 @@ +#include +#include +#include "bwtaln.h" +#include "utils.h" +#include "bamlite.h" + +#include "kseq.h" +KSEQ_DECLARE(gzFile) + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +extern unsigned char nst_nt4_table[256]; +static char bam_nt16_nt4_table[] = { 4, 0, 1, 4, 2, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4 }; + +struct __bwa_seqio_t { + // for BAM input + int is_bam, which; // 1st bit: read1, 2nd bit: read2, 3rd: SE + bamFile fp; + // for fastq input + kseq_t *ks; +}; + +bwa_seqio_t *bwa_bam_open(const char *fn, int which) +{ + bwa_seqio_t *bs; + bam_header_t *h; + bs = (bwa_seqio_t*)calloc(1, sizeof(bwa_seqio_t)); + bs->is_bam = 1; + bs->which = which; + bs->fp = bam_open(fn, "r"); + if (0 == bs->fp) err_fatal_simple("Couldn't open bam file"); + h = bam_header_read(bs->fp); + bam_header_destroy(h); + return bs; +} + +bwa_seqio_t *bwa_seq_open(const char *fn) +{ + gzFile fp; + bwa_seqio_t *bs; + bs = (bwa_seqio_t*)calloc(1, sizeof(bwa_seqio_t)); + fp = xzopen(fn, "r"); + bs->ks = kseq_init(fp); + return bs; +} + +void bwa_seq_close(bwa_seqio_t *bs) +{ + if (bs == 0) return; + if (bs->is_bam) { + if (0 != bam_close(bs->fp)) err_fatal_simple("Error closing bam file"); + } else { + err_gzclose(bs->ks->f->f); + kseq_destroy(bs->ks); + } + free(bs); +} + +void seq_reverse(int len, ubyte_t *seq, int is_comp) +{ + int i; + if (is_comp) { + for (i = 0; i < len>>1; ++i) { + char tmp = seq[len-1-i]; + if (tmp < 4) tmp = 3 - tmp; + seq[len-1-i] = (seq[i] >= 4)? seq[i] : 3 - seq[i]; + seq[i] = tmp; + } + if (len&1) seq[i] = (seq[i] >= 4)? seq[i] : 3 - seq[i]; + } else { + for (i = 0; i < len>>1; ++i) { + char tmp = seq[len-1-i]; + seq[len-1-i] = seq[i]; seq[i] = tmp; + } + } +} + +int bwa_trim_read(int trim_qual, bwa_seq_t *p) +{ + int s = 0, l, max = 0, max_l = p->len; + if (trim_qual < 1 || p->qual == 0) return 0; + for (l = p->len - 1; l >= BWA_MIN_RDLEN; --l) { + s += trim_qual - (p->qual[l] - 33); + if (s < 0) break; + if (s > max) max = s, max_l = l; + } + p->clip_len = p->len = max_l; + return p->full_len - p->len; +} + +static bwa_seq_t *bwa_read_bam(bwa_seqio_t *bs, int n_needed, int *n, int is_comp, int trim_qual) +{ + bwa_seq_t *seqs, *p; + int n_seqs, l, i; + long n_trimmed = 0, n_tot = 0; + bam1_t *b; + int res; + + b = bam_init1(); + n_seqs = 0; + seqs = (bwa_seq_t*)calloc(n_needed, sizeof(bwa_seq_t)); + while ((res = bam_read1(bs->fp, b)) >= 0) { + uint8_t *s, *q; + int go = 0; + if ((bs->which & 1) && (b->core.flag & BAM_FREAD1)) go = 1; + if ((bs->which & 2) && (b->core.flag & BAM_FREAD2)) go = 1; + if ((bs->which & 4) && !(b->core.flag& BAM_FREAD1) && !(b->core.flag& BAM_FREAD2))go = 1; + if (go == 0) continue; + l = b->core.l_qseq; + p = &seqs[n_seqs++]; + p->tid = -1; // no assigned to a thread + p->qual = 0; + p->full_len = p->clip_len = p->len = l; + n_tot += p->full_len; + s = bam1_seq(b); q = bam1_qual(b); + p->seq = (ubyte_t*)calloc(p->len + 1, 1); + p->qual = (ubyte_t*)calloc(p->len + 1, 1); + for (i = 0; i != p->full_len; ++i) { + p->seq[i] = bam_nt16_nt4_table[(int)bam1_seqi(s, i)]; + p->qual[i] = q[i] + 33 < 126? q[i] + 33 : 126; + } + if (bam1_strand(b)) { // then reverse + seq_reverse(p->len, p->seq, 1); + seq_reverse(p->len, p->qual, 0); + } + if (trim_qual >= 1) n_trimmed += bwa_trim_read(trim_qual, p); + p->rseq = (ubyte_t*)calloc(p->full_len, 1); + memcpy(p->rseq, p->seq, p->len); + seq_reverse(p->len, p->seq, 0); // *IMPORTANT*: will be reversed back in bwa_refine_gapped() + seq_reverse(p->len, p->rseq, is_comp); + p->name = strdup((const char*)bam1_qname(b)); + if (n_seqs == n_needed) break; + } + if (res < 0 && res != -1) err_fatal_simple("Error reading bam file"); + *n = n_seqs; + if (n_seqs && trim_qual >= 1) + fprintf(stderr, "[bwa_read_seq] %.1f%% bases are trimmed.\n", 100.0f * n_trimmed/n_tot); + if (n_seqs == 0) { + free(seqs); + bam_destroy1(b); + return 0; + } + bam_destroy1(b); + return seqs; +} + +#define BARCODE_LOW_QUAL 13 + +bwa_seq_t *bwa_read_seq(bwa_seqio_t *bs, int n_needed, int *n, int mode, int trim_qual) +{ + bwa_seq_t *seqs, *p; + kseq_t *seq = bs->ks; + int n_seqs, l, i, is_comp = mode&BWA_MODE_COMPREAD, is_64 = mode&BWA_MODE_IL13, l_bc = mode>>24; + long n_trimmed = 0, n_tot = 0; + + if (l_bc > BWA_MAX_BCLEN) { + fprintf(stderr, "[%s] the maximum barcode length is %d.\n", __func__, BWA_MAX_BCLEN); + return 0; + } + if (bs->is_bam) return bwa_read_bam(bs, n_needed, n, is_comp, trim_qual); // l_bc has no effect for BAM input + n_seqs = 0; + seqs = (bwa_seq_t*)calloc(n_needed, sizeof(bwa_seq_t)); + while ((l = kseq_read(seq)) >= 0) { + if ((mode & BWA_MODE_CFY) && (seq->comment.l != 0)) { + // skip reads that are marked to be filtered by Casava + char *s = index(seq->comment.s, ':'); + if (s && *(++s) == 'Y') { + continue; + } + } + if (is_64 && seq->qual.l) + for (i = 0; i < seq->qual.l; ++i) seq->qual.s[i] -= 31; + if (seq->seq.l <= l_bc) continue; // sequence length equals or smaller than the barcode length + p = &seqs[n_seqs++]; + if (l_bc) { // then trim barcode + for (i = 0; i < l_bc; ++i) + p->bc[i] = (seq->qual.l && seq->qual.s[i]-33 < BARCODE_LOW_QUAL)? tolower(seq->seq.s[i]) : toupper(seq->seq.s[i]); + p->bc[i] = 0; + for (; i < seq->seq.l; ++i) + seq->seq.s[i - l_bc] = seq->seq.s[i]; + seq->seq.l -= l_bc; seq->seq.s[seq->seq.l] = 0; + if (seq->qual.l) { + for (i = l_bc; i < seq->qual.l; ++i) + seq->qual.s[i - l_bc] = seq->qual.s[i]; + seq->qual.l -= l_bc; seq->qual.s[seq->qual.l] = 0; + } + l = seq->seq.l; + } else p->bc[0] = 0; + p->tid = -1; // no assigned to a thread + p->qual = 0; + p->full_len = p->clip_len = p->len = l; + n_tot += p->full_len; + p->seq = (ubyte_t*)calloc(p->full_len, 1); + for (i = 0; i != p->full_len; ++i) + p->seq[i] = nst_nt4_table[(int)seq->seq.s[i]]; + if (seq->qual.l) { // copy quality + p->qual = (ubyte_t*)strdup((char*)seq->qual.s); + if (trim_qual >= 1) n_trimmed += bwa_trim_read(trim_qual, p); + } + p->rseq = (ubyte_t*)calloc(p->full_len, 1); + memcpy(p->rseq, p->seq, p->len); + seq_reverse(p->len, p->seq, 0); // *IMPORTANT*: will be reversed back in bwa_refine_gapped() + seq_reverse(p->len, p->rseq, is_comp); + p->name = strdup((const char*)seq->name.s); + { // trim /[12]$ + int t = strlen(p->name); + if (t > 2 && p->name[t-2] == '/' && (p->name[t-1] == '1' || p->name[t-1] == '2')) p->name[t-2] = '\0'; + } + if (n_seqs == n_needed) break; + } + *n = n_seqs; + if (n_seqs && trim_qual >= 1) + fprintf(stderr, "[bwa_read_seq] %.1f%% bases are trimmed.\n", 100.0f * n_trimmed/n_tot); + if (n_seqs == 0) { + free(seqs); + return 0; + } + return seqs; +} + +void bwa_free_read_seq(int n_seqs, bwa_seq_t *seqs) +{ + int i, j; + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *p = seqs + i; + for (j = 0; j < p->n_multi; ++j) + if (p->multi[j].cigar) free(p->multi[j].cigar); + free(p->name); + free(p->seq); free(p->rseq); free(p->qual); free(p->aln); free(p->md); free(p->multi); + free(p->cigar); + } + free(seqs); +} diff --git a/bwashm.c b/bwashm.c new file mode 100644 index 0000000..2c350d9 --- /dev/null +++ b/bwashm.c @@ -0,0 +1,414 @@ +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include "bwa.h" + +int bwa_shm_stage(bwaidx_t *idx, const char *hint, int useERT) +{ + + const char *name; + uint8_t *shm, *shm_idx; + uint16_t *cnt; + int shmid, to_init = 0, l; + char path[PATH_MAX + 1], *tmpfn = 0; + + if (hint == 0 || hint[0] == 0) return -1; + for (name = hint + strlen(hint) - 1; name >= hint && *name != '/'; --name); + ++name; + + if ((shmid = shm_open("/bwactl", O_RDWR, 0)) < 0) { + shmid = shm_open("/bwactl", O_CREAT|O_RDWR|O_EXCL, 0644); + to_init = 1; + } + if (shmid < 0) return -1; + if (ftruncate(shmid, BWA_CTL_SIZE) < 0) return -1; + shm = mmap(0, BWA_CTL_SIZE, PROT_READ|PROT_WRITE, MAP_SHARED, shmid, 0); + cnt = (uint16_t*)shm; + if (to_init) { + memset(shm, 0, BWA_CTL_SIZE); + cnt[1] = 4; + } + + // + if (idx->mem == 0) { + bwa_fmtidx2mem(idx); + } + + if (tmpfn) { + FILE *fp; + if ((fp = fopen(tmpfn, "wb")) != 0) { + int64_t rest = idx->l_mem; + while (rest > 0) { + int64_t l = rest < 0x1000000? rest : 0x1000000; + rest -= fwrite(&idx->mem[idx->l_mem - rest], 1, l, fp); + } + fclose(fp); + free(idx->mem); idx->mem = 0; + } else { + fprintf(stderr, "[W::%s] fail to create the temporary file. Option '-f' is ignored.\n", __func__); + tmpfn = 0; + } + } + + strcat(strcpy(path, "/bwaidx-"), name); + if ((shmid = shm_open(path, O_CREAT|O_RDWR|O_EXCL, 0644)) < 0) { + shm_unlink(path); + perror("shm_open()"); + return -1; + } + l = 8 + strlen(name) + 1; + if (cnt[1] + l > BWA_CTL_SIZE) return -1; + memcpy(shm + cnt[1], &idx->l_mem, 8); + memcpy(shm + cnt[1] + 8, name, l - 8); + cnt[1] += l; ++cnt[0]; + if (ftruncate(shmid, idx->l_mem) < 0) return -1; + shm_idx = mmap(0, idx->l_mem, PROT_READ|PROT_WRITE, MAP_SHARED, shmid, 0); + if (tmpfn) { + FILE *fp; + fp = fopen(tmpfn, "rb"); + int64_t rest = idx->l_mem; + while (rest > 0) { + int64_t l = rest < 0x1000000? rest : 0x1000000; + rest -= fread(&shm_idx[idx->l_mem - rest], 1, l, fp); + } + fclose(fp); + unlink(tmpfn); + } else { + memcpy(shm_idx, idx->mem, idx->l_mem); + free(idx->mem); + } + bwa_mem2fmtidx(idx->l_mem, shm_idx, idx); + idx->is_shm = 1; + return 0; +} + +#define INIT_SHM_LOAD \ + const char *name; \ + uint8_t *shm, *shm_idx; \ + uint16_t *cnt, i; \ + char *p, path[PATH_MAX + 1]; \ + int shmid; \ + int64_t l_mem; \ + bwaidx_t *idx; \ + if (hint == 0 || hint[0] == 0) return 0; \ + for (name = hint + strlen(hint) - 1; name >= hint && *name != '/'; --name); \ + ++name; \ + if ((shmid = shm_open("/bwactl", O_RDONLY, 0)) < 0) return 0; \ + shm = mmap(0, BWA_CTL_SIZE, PROT_READ, MAP_SHARED, shmid, 0); \ + cnt = (uint16_t*)shm; \ + if (cnt[0] == 0) return 0; \ + for (i = 0, p = (char*)(shm + 4); i < cnt[0]; ++i) { \ + memcpy(&l_mem, p, 8); p += 8; \ + if (strcmp(p, name) == 0) break; \ + p += strlen(p) + 1; \ + } \ + if (i == cnt[0]) return 0; \ + strcat(strcpy(path, "/bwaidx-"), name); \ + if ((shmid = shm_open(path, O_RDONLY, 0)) < 0) return 0; \ + shm_idx = mmap(0, l_mem, PROT_READ, MAP_SHARED, shmid, 0); \ + idx = calloc(1, sizeof(bwaidx_t)); + + +bwaidx_t *bwa_fmtidx_load_from_shm(const char *hint) +{ + INIT_SHM_LOAD; + bwa_mem2fmtidx(l_mem, shm_idx, idx); + idx->is_shm = 1; + return idx; +} + +bwaidx_t *bwa_idx_load_from_shm(const char *hint) +{ + const char *name; + uint8_t *shm, *shm_idx; + uint16_t *cnt, i; + char *p, path[PATH_MAX + 1]; + int shmid; + int64_t l_mem; + bwaidx_t *idx; + + if (hint == 0 || hint[0] == 0) return 0; + for (name = hint + strlen(hint) - 1; name >= hint && *name != '/'; --name); + ++name; + if ((shmid = shm_open("/bwactl", O_RDONLY, 0)) < 0) return 0; + shm = mmap(0, BWA_CTL_SIZE, PROT_READ, MAP_SHARED, shmid, 0); + cnt = (uint16_t*)shm; + if (cnt[0] == 0) return 0; + for (i = 0, p = (char*)(shm + 4); i < cnt[0]; ++i) { + memcpy(&l_mem, p, 8); p += 8; + if (strcmp(p, name) == 0) break; + p += strlen(p) + 1; + } + if (i == cnt[0]) return 0; + + strcat(strcpy(path, "/bwaidx-"), name); + if ((shmid = shm_open(path, O_RDONLY, 0)) < 0) return 0; + shm_idx = mmap(0, l_mem, PROT_READ, MAP_SHARED, shmid, 0); + idx = calloc(1, sizeof(bwaidx_t)); + bwa_mem2idx(l_mem, shm_idx, idx); + idx->is_shm = 1; + return idx; +} + +int bwa_shm_test(const char *hint) +{ + int shmid; + uint16_t *cnt, i; + char *p, *shm; + const char *name; + + if (hint == 0 || hint[0] == 0) return 0; + for (name = hint + strlen(hint) - 1; name >= hint && *name != '/'; --name); + ++name; + if ((shmid = shm_open("/bwactl", O_RDONLY, 0)) < 0) return 0; + shm = mmap(0, BWA_CTL_SIZE, PROT_READ, MAP_SHARED, shmid, 0); + cnt = (uint16_t*)shm; + for (i = 0, p = shm + 4; i < cnt[0]; ++i) { + if (strcmp(p + 8, name) == 0) return 1; + p += strlen(p) + 9; + } + return 0; +} + +int bwa_shm_list(void) +{ + int shmid; + uint16_t *cnt, i; + char *p, *shm; + if ((shmid = shm_open("/bwactl", O_RDONLY, 0)) < 0) return -1; + shm = mmap(0, BWA_CTL_SIZE, PROT_READ, MAP_SHARED, shmid, 0); + cnt = (uint16_t*)shm; + for (i = 0, p = shm + 4; i < cnt[0]; ++i) { + int64_t l_mem; + memcpy(&l_mem, p, 8); p += 8; + printf("%s\t%ld\n", p, (long)l_mem); + p += strlen(p) + 1; + } + return 0; +} + +int bwa_shm_destroy(void) +{ + int shmid; + uint16_t *cnt, i; + char *p, *shm; + char path[PATH_MAX + 1]; + + if ((shmid = shm_open("/bwactl", O_RDONLY, 0)) < 0) return -1; + shm = mmap(0, BWA_CTL_SIZE, PROT_READ, MAP_SHARED, shmid, 0); + cnt = (uint16_t*)shm; + for (i = 0, p = shm + 4; i < cnt[0]; ++i) { + int64_t l_mem; + memcpy(&l_mem, p, 8); p += 8; + strcat(strcpy(path, "/bwaidx-"), p); + shm_unlink(path); + p += strlen(p) + 1; + } + munmap(shm, BWA_CTL_SIZE); + shm_unlink("/bwactl"); + return 0; +} + +int bwa_shm_stage_fmt(const char *idx_prefix) +{ + const char *name; + uint8_t *shm, *mem; + uint16_t *cnt; + int shmid, to_init = 0, l; + char path[PATH_MAX]; + int64_t l_mem = 0, x = 0, k = 0; + char fn[PATH_MAX]; + FILE *fp; + FMTIndex fmt; + bntseq_t *bns; + int i; + // clac l_mem + // fmt + x = sizeof(FMTIndex); l_mem += x; + sprintf(fn, "%s.fmt", idx_prefix); + fp = xopen(fn, "rb"); + err_fseek(fp, 0, SEEK_END); + x = ftell(fp) - sizeof(bwtint_t) * 6 - 3; l_mem += x; + fmt.bwt_size = x >> 2; + fseek(fp, 0, SEEK_SET); + err_fread_noeof(&fmt.primary, sizeof(bwtint_t), 1, fp); + err_fread_noeof(&fmt.sec_primary, sizeof(bwtint_t), 1, fp); + err_fread_noeof(&fmt.sec_bcp, sizeof(uint8_t), 1, fp); + err_fread_noeof(&fmt.first_base, sizeof(uint8_t), 1, fp); + err_fread_noeof(&fmt.last_base, sizeof(uint8_t), 1, fp); + err_fread_noeof(fmt.L2 + 1, sizeof(bwtint_t), 4, fp); + fmt.seq_len = fmt.L2[4]; + fmt_gen_cnt_occ(&fmt); + err_fclose(fp); + // sa + sprintf(fn, "%s.bytesa", idx_prefix); + fp = xopen(fn, "rb"); + err_fseek(fp, sizeof(bwtint_t) * 5, SEEK_SET); + err_fread_noeof(&fmt.sa_intv, sizeof(bwtint_t), 1, fp); + fmt.n_sa = (fmt.seq_len + fmt.sa_intv) / fmt.sa_intv; + x = SA_BYTES(fmt.n_sa); l_mem += x; + err_fclose(fp); + // kmaer hash + x = (1 << (10 << 1)) * sizeof(KmerEntryArr) + + (1 << (11 << 1)) * sizeof(KmerEntry) + + (1 << (12 << 1)) * sizeof(KmerEntry); +#if HASH_KMER_LEN > 12 + x += (1 << (13 << 1)) * sizeof(KmerEntry); +#endif +#if HASH_KMER_LEN > 13 + x += (1 << (14 << 1)) * sizeof(KmerEntry); +#endif + l_mem += x; + // bns + x = sizeof(bntseq_t); l_mem += x; + bns = bns_restore(idx_prefix); + x = bns->n_holes * sizeof(bntamb1_t); l_mem += x; + x = bns->n_seqs * sizeof(bntann1_t); l_mem += x; + for (i = 0; i < bns->n_seqs; ++i) { + x = strlen(bns->anns[i].name) + 1; l_mem += x; + x = strlen(bns->anns[i].anno) + 1; l_mem += x; + } + // pac + x = bns->l_pac / 4 + 1; l_mem += x; + fmt.l_pac = bns->l_pac; + + fprintf(stderr, "l_mem: %ld\n", l_mem); + + for (name = idx_prefix + strlen(idx_prefix) - 1; name >= idx_prefix && *name != '/'; --name) ; + ++name; + if ((shmid = shm_open("/bwactl", O_RDWR, 0)) < 0) { + shmid = shm_open("/bwactl", O_CREAT|O_RDWR|O_EXCL, 0644); + to_init = 1; + } + if (shmid < 0) return -1; + if (ftruncate(shmid, BWA_CTL_SIZE) < 0) return -1; + shm = mmap(0, BWA_CTL_SIZE, PROT_READ|PROT_WRITE, MAP_SHARED, shmid, 0); + cnt = (uint16_t*)shm; + if (to_init) { + memset(shm, 0, BWA_CTL_SIZE); + cnt[1] = 4; + } + strcat(strcpy(path, "/bwaidx-"), name); + if ((shmid = shm_open(path, O_CREAT|O_RDWR|O_EXCL, 0644)) < 0) { + shm_unlink(path); + perror("shm_open()"); + return -1; + } + l = 8 + strlen(name) + 1; + if (cnt[1] + l > BWA_CTL_SIZE) return -1; + memcpy(shm + cnt[1], &l_mem, 8); + memcpy(shm + cnt[1] + 8, name, l - 8); + cnt[1] += l; ++cnt[0]; + if (ftruncate(shmid, l_mem) < 0) return -1; + mem = mmap(0, l_mem, PROT_READ|PROT_WRITE, MAP_SHARED, shmid, 0); + + // write to share mem + + // fmt + x = sizeof(FMTIndex); + memcpy(mem, &fmt, x); k = x; + sprintf(fn, "%s.fmt", idx_prefix); + fp = xopen(fn, "rb"); + err_fseek(fp, sizeof(bwtint_t) * 6 + 3, SEEK_SET); + x = fmt.bwt_size * 4; + fread_fix(fp, x, mem + k); k += x; + err_fclose(fp); + // sa + sprintf(fn, "%s.bytesa", idx_prefix); + fp = xopen(fn, "rb"); + err_fseek(fp, sizeof(bwtint_t) * 7, SEEK_SET); + x = SA_BYTES(fmt.n_sa); + fread_fix(fp, x, mem + k); k += x; + err_fclose(fp); + // kmer hash + sprintf(fn, "%s.kmer", idx_prefix); + fp = xopen(fn, "rb"); + x = (1 << (10 << 1)) * sizeof(KmerEntryArr); + fread_fix(fp, x, mem + k); k += x; + x = (1 << (11 << 1)) * sizeof(KmerEntry); + fread_fix(fp, x, mem + k); k += x; + x = (1 << (12 << 1)) * sizeof(KmerEntry); + fread_fix(fp, x, mem + k); k += x; +#if HASH_KMER_LEN > 12 + x = (1 << (13 << 1)) * sizeof(KmerEntry); + fread_fix(fp, x, mem + k); k += x; +#endif +#if HASH_KMER_LEN > 13 + x = (1 << (14 << 1)) * sizeof(KmerEntry); + fread_fix(fp, x, mem + k); k += x; +#endif + err_fclose(fp); + // bns + x = sizeof(bntseq_t); memcpy(mem + k, bns, x); k += x; + x = bns->n_holes * sizeof(bntamb1_t); memcpy(mem + k, bns->ambs, x); k += x; + x = bns->n_seqs * sizeof(bntann1_t); memcpy(mem + k, bns->anns, x); k += x; + for (i = 0; i < bns->n_seqs; ++i) { + x = strlen(bns->anns[i].name) + 1; memcpy(mem + k, bns->anns[i].name, x); k += x; + x = strlen(bns->anns[i].anno) + 1; memcpy(mem + k, bns->anns[i].anno, x); k += x; + } + // pac + x = bns->l_pac / 4 + 1; + err_fread_noeof(mem + k, 1, x, bns->fp_pac); k += x;// concatenated 2-bit encoded sequence + err_fclose(bns->fp_pac); + + fprintf(stderr, "k: %ld\n", k); + + return 0; +} + +int main_shm(int argc, char *argv[]) +{ + int c, to_list = 0, to_drop = 0, ret = 0; + char shm_prefix[PATH_MAX]; + while ((c = getopt(argc, argv, "ldZ")) >= 0) + { + if (c == 'l') to_list = 1; + else if (c == 'd') to_drop = 1; + } + if (optind == argc && !to_list && !to_drop) { + fprintf(stderr, "\nUsage: fastbwa shm [-d|-l] [-f tmpFile] [idxbase]\n\n"); + fprintf(stderr, "Options: -d destroy all indices in shared memory\n"); + fprintf(stderr, " -l list names of indices in shared memory\n"); + return 1; + } + if (optind < argc && (to_list || to_drop)) { + fprintf(stderr, "[E::%s] open -l or -d cannot be used when 'idxbase' is present\n", __func__); + return 1; + } + if (optind < argc) { + sprintf(shm_prefix, "%s", argv[optind]); + if (bwa_shm_test(shm_prefix) == 0) + { +#if 0 + bwaidx_t *idx; + if (useERT) + idx = bwa_ertidx_load_from_disk(argv[optind]); + else + idx = bwa_idx_load_from_disk(argv[optind], BWA_IDX_BNS | BWA_IDX_PAC | BWA_IDX_FMT); + if (bwa_shm_stage(idx, shm_prefix, useERT) < 0) { + fprintf(stderr, "[E::%s] failed to stage the index in shared memory\n", __func__); + ret = 1; + } + bwa_idx_destroy(idx); +#else + + if (bwa_shm_stage_fmt(argv[optind]) < 0) { + fprintf(stderr, "[E::%s] failed to stage the index in shared memory\n", __func__); + ret = 1; + } + +#endif + } + else + fprintf(stderr, "[M::%s] index '%s' is already in shared memory\n", __func__, argv[optind]); + } + if (to_list) bwa_shm_list(); + if (to_drop) bwa_shm_destroy(); + return ret; +} diff --git a/bwt.c b/bwt.c new file mode 100644 index 0000000..42b6641 --- /dev/null +++ b/bwt.c @@ -0,0 +1,638 @@ +/* The MIT License + + Copyright (c) 2008 Genome Research Ltd (GRL). + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li */ + +#include +#include +#include +#include +#include +#include +#include "utils.h" +#include "bwt.h" +#include "kvec.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +// A,T,C,G,,4,3 +void bwt_gen_cnt_table(bwt_t *bwt) +{ + int i, j; + for (i = 0; i != 256; ++i) { + uint32_t x = 0; + for (j = 0; j != 4; ++j) + x |= (((i&3) == j) + ((i>>2&3) == j) + ((i>>4&3) == j) + (i>>6 == j)) << (j<<3); + bwt->cnt_table[i] = x; + } +} + +static inline bwtint_t bwt_invPsi(const bwt_t *bwt, bwtint_t k) // compute inverse CSA +{ + bwtint_t x = k - (k > bwt->primary); + x = bwt_B0(bwt, x); + x = bwt->L2[x] + bwt_occ(bwt, k, x); + return k == bwt->primary ? 0 : x; +} + +// ,sa1,(0-1, ) +void inline bwt_set_sa(uint8_t *sa_arr, bwtint_t k, bwtint_t val) +{ + const bwtint_t block_idx = (k >> 3) * 33; // 8,33 + const int val_idx_in_block = k & 7; + const bwtint_t start_byte_idx = block_idx + (val_idx_in_block << 2); + bwtint_t *sa_addr = (bwtint_t *)(sa_arr + start_byte_idx); + // *sa_addr &= (1 << val_idx_in_block) - 1; // ,,, + *sa_addr |= (val & ((1L << 33) - 1)) << val_idx_in_block; +} + +// () +bwtint_t bwt_get_sa(uint8_t *sa_arr, bwtint_t k) +{ + const bwtint_t block_idx = (k >> 3) * 33; // 8,33 + const int val_idx_in_block = k & 7; + const bwtint_t start_byte_idx = block_idx + (val_idx_in_block << 2); + bwtint_t val = *(bwtint_t *)(sa_arr + start_byte_idx); + val = (val >> val_idx_in_block) & 8589934591; + return val; +} + +// kmerfmt +inline void kmer_getval_at(uint8_t *mem_addr, bwtintv_t *ok, int pos) +{ + bwtint_t x0, x1, x2; + int byte_idx = pos * 14; + uint8_t *arr = mem_addr + byte_idx; + x0 = *arr; + x0 = (x0 << 32) | *((uint32_t *)(arr + 1)); + arr += 5; + x1 = *arr; + x1 = (x1 << 32) | *((uint32_t *)(arr + 1)); + arr += 5; + x2 = *((uint32_t *)arr); + ok->x[0] = x0; + ok->x[1] = x1; + ok->x[2] = x2; +} + +// kmerposfmt +inline void kmer_setval_at(uint8_t *mem_addr, bwtintv_t ik, int pos) +{ + int byte_idx = pos * 14; + uint8_t *arr = mem_addr + byte_idx; + arr[0] = (uint8_t)(ik.x[0] >> 32); + *((uint32_t *)(arr + 1)) = (uint32_t)ik.x[0]; + arr += 5; + arr[0] = (uint8_t)(ik.x[1] >> 32); + *((uint32_t *)(arr + 1)) = (uint32_t)ik.x[1]; + arr += 5; + *((uint32_t *)arr) = (uint32_t)ik.x[2]; +} + +// kmerfmt, pos should be [0, 13] +inline void bwt_kmer_get(const KmerHash *kmer_hash, bwtintv_t *ok, uint32_t qbit, int pos) +{ +#if HASH_KMER_LEN == 14 + if (pos == 13) + kmer_getval_at(kmer_hash->ke14[qbit].intv_arr, ok, 0); + else if (pos == 12) + kmer_getval_at(kmer_hash->ke13[qbit >> 2].intv_arr, ok, 0); + else if (pos == 11) + kmer_getval_at(kmer_hash->ke12[qbit >> 4].intv_arr, ok, 0); + else if (pos == 10) + kmer_getval_at(kmer_hash->ke11[qbit >> 6].intv_arr, ok, 0); + else + kmer_getval_at(kmer_hash->ke10[qbit >> 8].intv_arr, ok, pos); +#elif HASH_KMER_LEN == 13 + if (pos == 12) + kmer_getval_at(kmer_hash->ke13[qbit].intv_arr, ok, 0); + else if (pos == 11) + kmer_getval_at(kmer_hash->ke12[qbit >> 2].intv_arr, ok, 0); + else if (pos == 10) + kmer_getval_at(kmer_hash->ke11[qbit >> 4].intv_arr, ok, 0); + else + kmer_getval_at(kmer_hash->ke10[qbit >> 6].intv_arr, ok, pos); +#else + if (pos == 11) + kmer_getval_at(kmer_hash->ke12[qbit].intv_arr, ok, 0); + else if (pos == 10) + kmer_getval_at(kmer_hash->ke11[qbit >> 2].intv_arr, ok, 0); + else + kmer_getval_at(kmer_hash->ke10[qbit >> 4].intv_arr, ok, pos); +#endif +} + +// bwt->bwt and bwt->occ must be precalculated +void bwt_cal_byte_sa(bwt_t *bwt, int intv) +{ + bwtint_t isa, sa, i, block_size; // S(isa) = sa isa,sa + double tmp_time, elapsed_time; + int intv_round = intv; // + + kv_roundup32(intv_round); + xassert(intv_round == intv, "SA sample interval is not a power of 2."); + xassert(bwt->bwt, "bwt_t::bwt is not initialized."); + + if (bwt->byte_sa) free(bwt->byte_sa); + bwt->sa_intv = intv; + bwt->n_sa = (bwt->seq_len + intv) / intv; + bwt->byte_sa = (uint8_t *)calloc(SA_BYTES(bwt->n_sa), 1); // 33 + fprintf(stderr, "bytes: %ld, sa size: %ld\n", SA_BYTES(bwt->n_sa), bwt->n_sa); + // calculate SA value + isa = 0; sa = bwt->seq_len; + block_size = bwt->seq_len / 100; + tmp_time = realtime(); + for (i = 0; i < bwt->seq_len; ++i) + { + if (i % block_size == 0) { + elapsed_time = realtime() - tmp_time; + fprintf(stderr, "%ld%% percent complished. %f s elapsed.\n", i / block_size, elapsed_time); + } + if (isa % intv == 0) { + bwt_set_sa(bwt->byte_sa, isa / intv, sa); // $, + if (i % (block_size / 2) == 0) + { + fprintf(stderr, "%ld %ld\n", sa, bwt_get_sa(bwt->byte_sa, isa / intv)); + } + } + --sa; // ,,isasasa + isa = bwt_invPsi(bwt, isa); // + } + if (isa % intv == 0) bwt_set_sa(bwt->byte_sa, isa / intv, sa); + // bwt_set_sa(bwt->byte_sa, 0, (bwtint_t)-1); // -1,set_sa + bwt_set_sa(bwt->byte_sa, 0, 8589934591); // before this line, bwt->sa[0] = bwt->seq_len +} + +// bwt->bwt and bwt->occ must be precalculated +void bwt_cal_sa(bwt_t *bwt, int intv) +{ + bwtint_t isa, sa, i; // S(isa) = sa + int intv_round = intv; + + kv_roundup32(intv_round); + xassert(intv_round == intv, "SA sample interval is not a power of 2."); + xassert(bwt->bwt, "bwt_t::bwt is not initialized."); + + if (bwt->sa) free(bwt->sa); + bwt->sa_intv = intv; + bwt->n_sa = (bwt->seq_len + intv) / intv; + bwt->sa = (bwtint_t*)calloc(bwt->n_sa, sizeof(bwtint_t)); + // calculate SA value + isa = 0; sa = bwt->seq_len; + for (i = 0; i < bwt->seq_len; ++i) { + if (isa % intv == 0) bwt->sa[isa/intv] = sa; + --sa; + isa = bwt_invPsi(bwt, isa); + } + if (isa % intv == 0) bwt->sa[isa/intv] = sa; + bwt->sa[0] = (bwtint_t)-1; // before this line, bwt->sa[0] = bwt->seq_len +} + +bwtint_t bwt_sa(const bwt_t *bwt, bwtint_t k) +{ + bwtint_t sa = 0, mask = bwt->sa_intv - 1; + while (k & mask) { + ++sa; + k = bwt_invPsi(bwt, k); + } + return sa + bwt->sa[k / bwt->sa_intv]; +} + +static inline int __occ_aux(uint64_t y, int c) +{ + // reduce nucleotide counting to bits counting + y = ((c&2)? y : ~y) >> 1 & ((c&1)? y : ~y) & 0x5555555555555555ull; + // count the number of 1s in y + y = (y & 0x3333333333333333ull) + (y >> 2 & 0x3333333333333333ull); + return ((y + (y >> 4)) & 0xf0f0f0f0f0f0f0full) * 0x101010101010101ull >> 56; +} + +bwtint_t bwt_occ(const bwt_t *bwt, bwtint_t k, ubyte_t c) +{ + bwtint_t n; + uint32_t *p, *end; + + if (k == bwt->seq_len) return bwt->L2[c+1] - bwt->L2[c]; + if (k == (bwtint_t)(-1)) return 0; + k -= (k >= bwt->primary); // because $ is not in bwt + + // retrieve Occ at k/OCC_INTERVAL + n = ((bwtint_t*)(p = bwt_occ_intv(bwt, k)))[c]; + p += sizeof(bwtint_t); // jump to the start of the first BWT cell + + // calculate Occ up to the last k/32 + end = p + (((k>>5) - ((k&~OCC_INTV_MASK)>>5))<<1); + for (; p < end; p += 2) n += __occ_aux((uint64_t)p[0]<<32 | p[1], c); + + // calculate Occ + n += __occ_aux(((uint64_t)p[0]<<32 | p[1]) & ~((1ull<<((~k&31)<<1)) - 1), c); + if (c == 0) n -= ~k&31; // corrected for the masked bits + + return n; +} + +// an analogy to bwt_occ() but more efficient, requiring k <= l +void bwt_2occ(const bwt_t *bwt, bwtint_t k, bwtint_t l, ubyte_t c, bwtint_t *ok, bwtint_t *ol) +{ + bwtint_t _k, _l; + _k = (k >= bwt->primary)? k-1 : k; + _l = (l >= bwt->primary)? l-1 : l; + if (_l/OCC_INTERVAL != _k/OCC_INTERVAL || k == (bwtint_t)(-1) || l == (bwtint_t)(-1)) { + *ok = bwt_occ(bwt, k, c); + *ol = bwt_occ(bwt, l, c); + } else { + bwtint_t m, n, i, j; + uint32_t *p; + if (k >= bwt->primary) --k; + if (l >= bwt->primary) --l; + n = ((bwtint_t*)(p = bwt_occ_intv(bwt, k)))[c]; + p += sizeof(bwtint_t); + // calculate *ok + j = k >> 5 << 5; + for (i = k/OCC_INTERVAL*OCC_INTERVAL; i < j; i += 32, p += 2) + n += __occ_aux((uint64_t)p[0]<<32 | p[1], c); + m = n; + n += __occ_aux(((uint64_t)p[0]<<32 | p[1]) & ~((1ull<<((~k&31)<<1)) - 1), c); + if (c == 0) n -= ~k&31; // corrected for the masked bits + *ok = n; + // calculate *ol + j = l >> 5 << 5; + for (; i < j; i += 32, p += 2) + m += __occ_aux((uint64_t)p[0]<<32 | p[1], c); + m += __occ_aux(((uint64_t)p[0]<<32 | p[1]) & ~((1ull<<((~l&31)<<1)) - 1), c); + if (c == 0) m -= ~l&31; // corrected for the masked bits + *ol = m; + } +} + +#define __occ_aux4(bwt, b) \ + ((bwt)->cnt_table[(b)&0xff] + (bwt)->cnt_table[(b)>>8&0xff] \ + + (bwt)->cnt_table[(b)>>16&0xff] + (bwt)->cnt_table[(b)>>24]) + +void bwt_occ4(const bwt_t *bwt, bwtint_t k, bwtint_t cnt[4]) +{ + bwtint_t x; + uint32_t *p, tmp, *end; + if (k == (bwtint_t)(-1)) { + memset(cnt, 0, 4 * sizeof(bwtint_t)); + return; + } + k -= (k >= bwt->primary); // because $ is not in bwt + p = bwt_occ_intv(bwt, k); + memcpy(cnt, p, 4 * sizeof(bwtint_t)); + p += sizeof(bwtint_t); // sizeof(bwtint_t) = 4*(sizeof(bwtint_t)/sizeof(uint32_t)) + end = p + ((k>>4) - ((k&~OCC_INTV_MASK)>>4)); // this is the end point of the following loop + for (x = 0; p < end; ++p) x += __occ_aux4(bwt, *p); + tmp = *p & ~((1U<<((~k&15)<<1)) - 1); + x += __occ_aux4(bwt, tmp) - (~k&15); + cnt[0] += x&0xff; cnt[1] += x>>8&0xff; cnt[2] += x>>16&0xff; cnt[3] += x>>24; +} + +// an analogy to bwt_occ4() but more efficient, requiring k <= l +void bwt_2occ4(const bwt_t *bwt, bwtint_t k, bwtint_t l, bwtint_t cntk[4], bwtint_t cntl[4]) +{ + bwtint_t _k, _l; + _k = k - (k >= bwt->primary); + _l = l - (l >= bwt->primary); + if (_l>>OCC_INTV_SHIFT != _k>>OCC_INTV_SHIFT || k == (bwtint_t)(-1) || l == (bwtint_t)(-1)) { + bwt_occ4(bwt, k, cntk); + bwt_occ4(bwt, l, cntl); + } else { + bwtint_t x, y; + uint32_t *p, tmp, *endk, *endl; + k -= (k >= bwt->primary); // because $ is not in bwt + l -= (l >= bwt->primary); + p = bwt_occ_intv(bwt, k); + memcpy(cntk, p, 4 * sizeof(bwtint_t)); + p += sizeof(bwtint_t); // sizeof(bwtint_t) = 4*(sizeof(bwtint_t)/sizeof(uint32_t)) + // prepare cntk[] + endk = p + ((k>>4) - ((k&~OCC_INTV_MASK)>>4)); + endl = p + ((l>>4) - ((l&~OCC_INTV_MASK)>>4)); + for (x = 0; p < endk; ++p) x += __occ_aux4(bwt, *p); + y = x; + tmp = *p & ~((1U<<((~k&15)<<1)) - 1); + x += __occ_aux4(bwt, tmp) - (~k&15); + // calculate cntl[] and finalize cntk[] + for (; p < endl; ++p) y += __occ_aux4(bwt, *p); + tmp = *p & ~((1U<<((~l&15)<<1)) - 1); + y += __occ_aux4(bwt, tmp) - (~l&15); + memcpy(cntl, cntk, 4 * sizeof(bwtint_t)); + cntk[0] += x&0xff; cntk[1] += x>>8&0xff; cntk[2] += x>>16&0xff; cntk[3] += x>>24; + cntl[0] += y&0xff; cntl[1] += y>>8&0xff; cntl[2] += y>>16&0xff; cntl[3] += y>>24; + } +} + +int bwt_match_exact(const bwt_t *bwt, int len, const ubyte_t *str, bwtint_t *sa_begin, bwtint_t *sa_end) +{ + bwtint_t k, l, ok, ol; + int i; + k = 0; l = bwt->seq_len; + for (i = len - 1; i >= 0; --i) { + ubyte_t c = str[i]; + if (c > 3) return 0; // no match + bwt_2occ(bwt, k - 1, l, c, &ok, &ol); + k = bwt->L2[c] + ok + 1; + l = bwt->L2[c] + ol; + if (k > l) break; // no match + } + if (k > l) return 0; // no match + if (sa_begin) *sa_begin = k; + if (sa_end) *sa_end = l; + return l - k + 1; +} + +int bwt_match_exact_alt(const bwt_t *bwt, int len, const ubyte_t *str, bwtint_t *k0, bwtint_t *l0) +{ + int i; + bwtint_t k, l, ok, ol; + k = *k0; l = *l0; + for (i = len - 1; i >= 0; --i) { + ubyte_t c = str[i]; + if (c > 3) return 0; // there is an N here. no match + bwt_2occ(bwt, k - 1, l, c, &ok, &ol); + k = bwt->L2[c] + ok + 1; + l = bwt->L2[c] + ol; + if (k > l) return 0; // no match + } + *k0 = k; *l0 = l; + return l - k + 1; +} + +/********************* + * Bidirectional BWT * + *********************/ + +void bwt_extend(const bwt_t *bwt, const bwtintv_t *ik, bwtintv_t ok[4], int is_back) +{ + bwtint_t tk[4], tl[4]; + int i; + bwt_2occ4(bwt, ik->x[!is_back] - 1, ik->x[!is_back] - 1 + ik->x[2], tk, tl); + for (i = 0; i != 4; ++i) { + ok[i].x[!is_back] = bwt->L2[i] + 1 + tk[i]; + ok[i].x[2] = tl[i] - tk[i]; + } + ok[3].x[is_back] = ik->x[is_back] + (ik->x[!is_back] <= bwt->primary && ik->x[!is_back] + ik->x[2] - 1 >= bwt->primary); + ok[2].x[is_back] = ok[3].x[is_back] + ok[3].x[2]; + ok[1].x[is_back] = ok[2].x[is_back] + ok[2].x[2]; + ok[0].x[is_back] = ok[1].x[is_back] + ok[1].x[2]; +} + +// kmer +inline uint64_t build_forward_kmer(const uint8_t *q, int qlen, int kmer_len, int *base_consumed) +{ + uint64_t qbit = 0, i; + qlen = qlen < kmer_len ? qlen : kmer_len; + for (i = 0; i < qlen; ++i) { + if (q[i] > 3) break; // N + qbit |= (uint64_t)q[i] << ((kmer_len - 1 - i) << 1); + } + *base_consumed = i; + return qbit; +} + +// fkmer +inline uint64_t build_backward_kmer(const uint8_t *q, int start_pos, int kmer_len, int *base_consumed) +{ + uint64_t qbit = 0; + int i, j, end_pos; + end_pos = start_pos - kmer_len; + end_pos = end_pos < 0 ? -1 : end_pos; + for (i = start_pos, j = 0; i > end_pos; --i, ++j) { + if (q[i] > 3) break; // N + qbit |= (uint64_t)q[i] << ((kmer_len - 1 - j) << 1); + } + *base_consumed = start_pos - i; + return (~qbit) & ((1L << (kmer_len << 1)) - 1); +} + +static void bwt_reverse_intvs(bwtintv_v *p) +{ + if (p->n > 1) { + int j; + for (j = 0; j < p->n>>1; ++j) { + bwtintv_t tmp = p->a[p->n - 1 - j]; + p->a[p->n - 1 - j] = p->a[j]; + p->a[j] = tmp; + } + } +} +// NOTE: $max_intv is not currently used in BWA-MEM +// smem(seed) +int bwt_smem1a(const bwt_t *bwt, int len, const uint8_t *q, int x, int min_intv, uint64_t max_intv, bwtintv_v *mem, bwtintv_v *tmpvec[2]) +{ + int i, j, c, ret; + bwtintv_t ik = {0}, ok[4] = {0}; + bwtintv_v a[2], *prev, *curr, *swap; + + mem->n = 0; + if (q[x] > 3) return x + 1; + if (min_intv < 1) min_intv = 1; // the interval size should be at least 1 + kv_init(a[0]); kv_init(a[1]); + prev = tmpvec && tmpvec[0]? tmpvec[0] : &a[0]; // use the temporary vector if provided + curr = tmpvec && tmpvec[1]? tmpvec[1] : &a[1]; + bwt_set_intv(bwt, q[x], ik); // the initial interval of a single base + ik.info = x + 1; + + for (i = x + 1, curr->n = 0; i < len; ++i) + { // forward search + if (ik.x[2] < max_intv) { // an interval small enough + kv_push(bwtintv_t, *curr, ik); + break; + } else if (q[i] < 4) { // an A/C/G/T base + c = 3 - q[i]; // complement of q[i] + + bwt_extend(bwt, &ik, ok, 0); + if (ok[c].x[2] != ik.x[2]) { // change of the interval size + kv_push(bwtintv_t, *curr, ik); + if (ok[c].x[2] < min_intv) break; // the interval size is too small to be extended further + } + ik = ok[c]; ik.info = i + 1; + } else { // an ambiguous base + kv_push(bwtintv_t, *curr, ik); + break; // always terminate extension at an ambiguous base; in this case, ia[0].info; // this will be the returned value + swap = curr; curr = prev; prev = swap; + + for (i = x - 1; i >= -1; --i) { // backward search for MEMs + c = i < 0? -1 : q[i] < 4? q[i] : -1; // c==-1 if i<0 or q[i] is an ambiguous base + for (j = 0, curr->n = 0; j < prev->n; ++j) { + bwtintv_t *p = &prev->a[j]; + if (c >= 0 && ik.x[2] >= max_intv) bwt_extend(bwt, p, ok, 1); + if (c < 0 || ik.x[2] < max_intv || ok[c].x[2] < min_intv) { // keep the hit if reaching the beginning or an ambiguous base or the intv is small enough + if (curr->n == 0) { // test curr->n>0 to make sure there are no longer matches + if (mem->n == 0 || i + 1 < mem->a[mem->n-1].info>>32) { // skip contained matches + ik = *p; ik.info |= (uint64_t)(i + 1)<<32; + kv_push(bwtintv_t, *mem, ik); + } + } // otherwise the match is contained in another longer match + } else if (curr->n == 0 || ok[c].x[2] != curr->a[curr->n-1].x[2]) { + ok[c].info = p->info; + kv_push(bwtintv_t, *curr, ok[c]); + } + } + if (curr->n == 0) break; + swap = curr; curr = prev; prev = swap; + } + bwt_reverse_intvs(mem); // s.t. sorted by the start coordinate + + if (tmpvec == 0 || tmpvec[0] == 0) free(a[0].a); + if (tmpvec == 0 || tmpvec[1] == 0) free(a[1].a); + return ret; +} + +int bwt_smem1(const bwt_t *bwt, int len, const uint8_t *q, int x, int min_intv, bwtintv_v *mem, bwtintv_v *tmpvec[2]) +{ + return bwt_smem1a(bwt, len, q, x, min_intv, 0, mem, tmpvec); +} + +int bwt_seed_strategy1(const bwt_t *bwt, int len, const uint8_t *q, int x, int min_len, int max_intv, bwtintv_t *mem) +{ + int i = x + 1, c, kmer_len; + bwtintv_t ik = {0}, ok[4] = {0}; + + memset(mem, 0, sizeof(bwtintv_t)); + if (q[x] > 3) return x + 1; + + uint32_t qbit = build_forward_kmer(&q[x], len - x, HASH_KMER_LEN, &kmer_len); + bwt_kmer_get(&bwt->kmer_hash, &ik, qbit, kmer_len - 1); + ik.info = x + kmer_len; + i = (int)ik.info; + + //bwt_set_intv(bwt, q[x], ik); // the initial interval of a single base + //i = x + 1; + + for (; i < len; ++i) { // forward search + if (q[i] < 4) { // an A/C/G/T base + c = 3 - q[i]; // complement of q[i] + bwt_extend(bwt, &ik, ok, 0); + if (ok[c].x[2] < max_intv && i - x >= min_len) { + *mem = ok[c]; + mem->info = (uint64_t)x<<32 | (i + 1); + return i + 1; + } + ik = ok[c]; + } else return i + 1; + } + return len; +} + +/************************* + * Read/write BWT and SA * + *************************/ + +void bwt_dump_bwt(const char *fn, const bwt_t *bwt) +{ + FILE *fp; + fp = xopen(fn, "wb"); + err_fwrite(&bwt->primary, sizeof(bwtint_t), 1, fp); + err_fwrite(bwt->L2+1, sizeof(bwtint_t), 4, fp); + err_fwrite(bwt->bwt, 4, bwt->bwt_size, fp); + err_fflush(fp); + err_fclose(fp); +} + +void bwt_dump_sa(const char *fn, const bwt_t *bwt) +{ + FILE *fp; + fp = xopen(fn, "wb"); + err_fwrite(&bwt->primary, sizeof(bwtint_t), 1, fp); + err_fwrite(bwt->L2+1, sizeof(bwtint_t), 4, fp); + err_fwrite(&bwt->sa_intv, sizeof(bwtint_t), 1, fp); + err_fwrite(&bwt->seq_len, sizeof(bwtint_t), 1, fp); + err_fwrite(bwt->sa + 1, sizeof(bwtint_t), bwt->n_sa - 1, fp); + err_fflush(fp); + err_fclose(fp); +} + +void bwt_dump_byte_sa(const char *fn, const bwt_t *bwt) +{ + FILE *fp; + fp = xopen(fn, "wb"); + err_fwrite(&bwt->primary, sizeof(bwtint_t), 1, fp); + err_fwrite(bwt->L2 + 1, sizeof(bwtint_t), 4, fp); + err_fwrite(&bwt->sa_intv, sizeof(bwtint_t), 1, fp); + err_fwrite(&bwt->seq_len, sizeof(bwtint_t), 1, fp); + err_fwrite(bwt->byte_sa, sizeof(bwtint_t), SA_BYTES(bwt->n_sa) >> 3, fp); + err_fflush(fp); + err_fclose(fp); +} + +void bwt_restore_sa(const char *fn, bwt_t *bwt) +{ + char skipped[256]; + FILE *fp; + bwtint_t primary; + + fp = xopen(fn, "rb"); + err_fread_noeof(&primary, sizeof(bwtint_t), 1, fp); + xassert(primary == bwt->primary, "SA-BWT inconsistency: primary is not the same."); + err_fread_noeof(skipped, sizeof(bwtint_t), 4, fp); // skip + err_fread_noeof(&bwt->sa_intv, sizeof(bwtint_t), 1, fp); + err_fread_noeof(&primary, sizeof(bwtint_t), 1, fp); + xassert(primary == bwt->seq_len, "SA-BWT inconsistency: seq_len is not the same."); + + bwt->n_sa = (bwt->seq_len + bwt->sa_intv) / bwt->sa_intv; + + bwt->sa = (bwtint_t *)calloc(bwt->n_sa, sizeof(bwtint_t)); + bwt->sa[0] = -1; + fread_fix(fp, sizeof(bwtint_t) * (bwt->n_sa - 1), bwt->sa + 1); + + err_fclose(fp); +} + +bwt_t *bwt_restore_bwt(const char *fn) +{ + bwt_t *bwt; + FILE *fp; + + bwt = (bwt_t*)calloc(1, sizeof(bwt_t)); + fp = xopen(fn, "rb"); + err_fseek(fp, 0, SEEK_END); + bwt->bwt_size = (err_ftell(fp) - sizeof(bwtint_t) * 5) >> 2; + bwt->bwt = (uint32_t*)calloc(bwt->bwt_size, 4); + err_fseek(fp, 0, SEEK_SET); + err_fread_noeof(&bwt->primary, sizeof(bwtint_t), 1, fp); + err_fread_noeof(bwt->L2+1, sizeof(bwtint_t), 4, fp); + fread_fix(fp, bwt->bwt_size<<2, bwt->bwt); + bwt->seq_len = bwt->L2[4]; + err_fclose(fp); + bwt_gen_cnt_table(bwt); + + return bwt; +} + +void bwt_destroy(bwt_t *bwt) +{ + if (bwt == 0) return; + free(bwt->sa); free(bwt->bwt); + free(bwt); +} diff --git a/bwt.h b/bwt.h new file mode 100644 index 0000000..e173724 --- /dev/null +++ b/bwt.h @@ -0,0 +1,184 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Contact: Heng Li */ + +#ifndef BWA_BWT_H +#define BWA_BWT_H + +#include +#include + +// requirement: (OCC_INTERVAL%16 == 0); please DO NOT change this line because some part of the code assume OCC_INTERVAL=0x80 +#define OCC_INTV_SHIFT 7 +#define OCC_INTERVAL (1LL<bwt[(k)/OCC_INTERVAL * (OCC_INTERVAL/(sizeof(uint32_t)*8/2) + sizeof(bwtint_t)/4*4) + sizeof(bwtint_t)/4*4 + (k)%OCC_INTERVAL/16]) +#define bwt_occ_intv(b, k) ((b)->bwt + (k)/OCC_INTERVAL * (OCC_INTERVAL/(sizeof(uint32_t)*8/2) + sizeof(bwtint_t)/4*4) +*/ + +// The following two lines are ONLY correct when OCC_INTERVAL==0x80 +#define bwt_bwt(b, k) ((b)->bwt[((k)>>7<<4) + sizeof(bwtint_t) + (((k)&0x7f)>>4)]) +#define bwt_occ_intv(b, k) ((b)->bwt + ((k)>>7<<4)) + +/* retrieve a character from the $-removed BWT string. Note that + * bwt_t::bwt is not exactly the BWT string and therefore this macro is + * called bwt_B0 instead of bwt_B */ +#define bwt_B0(b, k) (bwt_bwt(b, k)>>((~(k)&0xf)<<1)&3) + +#define bwt_set_intv(bwt, c, ik) ((ik).x[0] = (bwt)->L2[(int)(c)]+1, (ik).x[2] = (bwt)->L2[(int)(c)+1]-(bwt)->L2[(int)(c)], (ik).x[1] = (bwt)->L2[3-(c)]+1, (ik).info = 0) + +#ifdef __cplusplus +extern "C" { +#endif + + void bwt_dump_bwt(const char *fn, const bwt_t *bwt); + void bwt_dump_sa(const char *fn, const bwt_t *bwt); + void bwt_dump_byte_sa(const char *fn, const bwt_t *bwt); + + bwt_t *bwt_restore_bwt(const char *fn); + void bwt_restore_sa(const char *fn, bwt_t *bwt); + + void bwt_destroy(bwt_t *bwt); + + void bwt_bwtgen(const char *fn_pac, const char *fn_bwt); // from BWT-SW + void bwt_bwtgen2(const char *fn_pac, const char *fn_bwt, int block_size); // from BWT-SW + void bwt_cal_sa(bwt_t *bwt, int intv); + void bwt_cal_byte_sa(bwt_t *bwt, int intv); + + void bwt_bwtupdate_core(bwt_t *bwt); + + bwtint_t bwt_occ(const bwt_t *bwt, bwtint_t k, ubyte_t c); + void bwt_occ4(const bwt_t *bwt, bwtint_t k, bwtint_t cnt[4]); + bwtint_t bwt_sa(const bwt_t *bwt, bwtint_t k); + + void bwt_set_sa(uint8_t *sa_arr, bwtint_t k, bwtint_t val); + bwtint_t bwt_get_sa(uint8_t *sa_arr, bwtint_t k); + + void kmer_getval_at(uint8_t *mem_addr, bwtintv_t *ok, int pos); + void kmer_setval_at(uint8_t *mem_addr, bwtintv_t ik, int pos); + void bwt_kmer_get(const KmerHash *kmer_hash, bwtintv_t *ok, uint32_t qbit, int pos); + + uint64_t build_forward_kmer(const uint8_t *q, int qlen, int kmer_len, int *base_consumed); + uint64_t build_backward_kmer(const uint8_t *q, int start_pos, int kmer_len, int *base_consumed); + + // more efficient version of bwt_occ/bwt_occ4 for retrieving two close Occ values + void bwt_gen_cnt_table(bwt_t *bwt); + void bwt_2occ(const bwt_t *bwt, bwtint_t k, bwtint_t l, ubyte_t c, bwtint_t *ok, bwtint_t *ol); + void bwt_2occ4(const bwt_t *bwt, bwtint_t k, bwtint_t l, bwtint_t cntk[4], bwtint_t cntl[4]); + + int bwt_match_exact(const bwt_t *bwt, int len, const ubyte_t *str, bwtint_t *sa_begin, bwtint_t *sa_end); + int bwt_match_exact_alt(const bwt_t *bwt, int len, const ubyte_t *str, bwtint_t *k0, bwtint_t *l0); + + /** + * Extend bi-SA-interval _ik_ + */ + void bwt_extend(const bwt_t *bwt, const bwtintv_t *ik, bwtintv_t ok[4], int is_back); + + /** + * Given a query _q_, collect potential SMEMs covering position _x_ and store them in _mem_. + * Return the end of the longest exact match starting from _x_. + */ + int bwt_smem1(const bwt_t *bwt, int len, const uint8_t *q, int x, int min_intv, bwtintv_v *mem, bwtintv_v *tmpvec[2]); + int bwt_smem1a(const bwt_t *bwt, int len, const uint8_t *q, int x, int min_intv, uint64_t max_intv, bwtintv_v *mem, bwtintv_v *tmpvec[2]); + + int bwt_seed_strategy1(const bwt_t *bwt, int len, const uint8_t *q, int x, int min_len, int max_intv, bwtintv_t *mem); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bwt_gen.c b/bwt_gen.c new file mode 100644 index 0000000..5702791 --- /dev/null +++ b/bwt_gen.c @@ -0,0 +1,1629 @@ +/* + + BWTConstruct.c BWT-Index Construction + + This module constructs BWT and auxiliary data structures. + + Copyright (C) 2004, Wong Chi Kwong. + + This program is free software; you can redistribute it and/or + modify it under the terms of the GNU General Public License + as published by the Free Software Foundation; either version 2 + of the License, or (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program; if not, write to the Free Software + Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. + +*/ + +#include +#include +#include +#include +#include +#include +#include "QSufSort.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef uint64_t bgint_t; +typedef int64_t sbgint_t; + +#define ALPHABET_SIZE 4 +#define BIT_PER_CHAR 2 +#define CHAR_PER_WORD 16 +#define CHAR_PER_BYTE 4 + +#define BITS_IN_WORD 32 +#define BITS_IN_BYTE 8 +#define BYTES_IN_WORD 4 + +#define ALL_ONE_MASK 0xFFFFFFFF +#define DNA_OCC_CNT_TABLE_SIZE_IN_WORD 65536 + +#define BITS_PER_OCC_VALUE 16 +#define OCC_VALUE_PER_WORD 2 +#define OCC_INTERVAL 256 +#define OCC_INTERVAL_MAJOR 65536 + +#define TRUE 1 +#define FALSE 0 + +#define BWTINC_INSERT_SORT_NUM_ITEM 7 + +#define MIN_AVAILABLE_WORD 0x10000 + +#define average(value1, value2) ( ((value1) & (value2)) + ((value1) ^ (value2)) / 2 ) +#define min(value1, value2) ( ((value1) < (value2)) ? (value1) : (value2) ) +#define max(value1, value2) ( ((value1) > (value2)) ? (value1) : (value2) ) +#define med3(a, b, c) ( ac ? b : a>c ? c : a)) +#define swap(a, b, t); t = a; a = b; b = t; +#define truncateLeft(value, offset) ( (value) << (offset) >> (offset) ) +#define truncateRight(value, offset) ( (value) >> (offset) << (offset) ) +#define DNA_OCC_SUM_EXCEPTION(sum) ((sum & 0xfefefeff) == 0) + +typedef struct BWT { + bgint_t textLength; // length of the text + bgint_t inverseSa0; // SA-1[0] + bgint_t *cumulativeFreq; // cumulative frequency + unsigned int *bwtCode; // BWT code + unsigned int *occValue; // Occurrence values stored explicitly + bgint_t *occValueMajor; // Occurrence values stored explicitly + unsigned int *decodeTable; // For decoding BWT by table lookup + bgint_t bwtSizeInWord; // Temporary variable to hold the memory allocated + bgint_t occSizeInWord; // Temporary variable to hold the memory allocated + bgint_t occMajorSizeInWord; // Temporary variable to hold the memory allocated +} BWT; + +typedef struct BWTInc { + BWT *bwt; + unsigned int numberOfIterationDone; + bgint_t *cumulativeCountInCurrentBuild; + bgint_t availableWord; + bgint_t buildSize; + bgint_t initialMaxBuildSize; + bgint_t incMaxBuildSize; + unsigned int firstCharInLastIteration; + unsigned int *workingMemory; + unsigned int *packedText; + unsigned char *textBuffer; + unsigned int *packedShift; +} BWTInc; + +static bgint_t TextLengthFromBytePacked(bgint_t bytePackedLength, unsigned int bitPerChar, + unsigned int lastByteLength) +{ + return (bytePackedLength - 1) * (BITS_IN_BYTE / bitPerChar) + lastByteLength; +} + +static void initializeVAL(unsigned int *startAddr, const bgint_t length, const unsigned int initValue) +{ + bgint_t i; + for (i=0; i>= 2; + } + } + +} +// for BWTIncCreate() +static bgint_t BWTOccValueMajorSizeInWord(const bgint_t numChar) +{ + bgint_t numOfOccValue; + unsigned numOfOccIntervalPerMajor; + numOfOccValue = (numChar + OCC_INTERVAL - 1) / OCC_INTERVAL + 1; // Value at both end for bi-directional encoding + numOfOccIntervalPerMajor = OCC_INTERVAL_MAJOR / OCC_INTERVAL; + return (numOfOccValue + numOfOccIntervalPerMajor - 1) / numOfOccIntervalPerMajor * ALPHABET_SIZE; +} +// for BWTIncCreate() +static bgint_t BWTOccValueMinorSizeInWord(const bgint_t numChar) +{ + bgint_t numOfOccValue; + numOfOccValue = (numChar + OCC_INTERVAL - 1) / OCC_INTERVAL + 1; // Value at both end for bi-directional encoding + return (numOfOccValue + OCC_VALUE_PER_WORD - 1) / OCC_VALUE_PER_WORD * ALPHABET_SIZE; +} +// for BWTIncCreate() +static bgint_t BWTResidentSizeInWord(const bgint_t numChar) { + + bgint_t numCharRoundUpToOccInterval; + + // The $ in BWT at the position of inverseSa0 is not encoded + numCharRoundUpToOccInterval = (numChar + OCC_INTERVAL - 1) / OCC_INTERVAL * OCC_INTERVAL; + + return (numCharRoundUpToOccInterval + CHAR_PER_WORD - 1) / CHAR_PER_WORD; + +} + +static void BWTIncSetBuildSizeAndTextAddr(BWTInc *bwtInc) +{ + bgint_t maxBuildSize; + + if (bwtInc->bwt->textLength == 0) { + // initial build + // Minus 2 because n+1 entries of seq and rank needed for n char + maxBuildSize = (bwtInc->availableWord - (2 + OCC_INTERVAL / CHAR_PER_WORD) * (sizeof(bgint_t) / 4)) + / (2 * CHAR_PER_WORD + 1) * CHAR_PER_WORD / (sizeof(bgint_t) / 4); + if (bwtInc->initialMaxBuildSize > 0) { + bwtInc->buildSize = min(bwtInc->initialMaxBuildSize, maxBuildSize); + } else { + bwtInc->buildSize = maxBuildSize; + } + } else { + // Minus 3 because n+1 entries of sorted rank, seq and rank needed for n char + // Minus numberOfIterationDone because bwt slightly shift to left in each iteration + maxBuildSize = (bwtInc->availableWord - bwtInc->bwt->bwtSizeInWord - bwtInc->bwt->occSizeInWord + - (3 + bwtInc->numberOfIterationDone * OCC_INTERVAL / BIT_PER_CHAR) * (sizeof(bgint_t) / 4)) + / 3 / (sizeof(bgint_t) / 4); + if (maxBuildSize < CHAR_PER_WORD) { + fprintf(stderr, "BWTIncSetBuildSizeAndTextAddr(): Not enough space allocated to continue construction!\n"); + exit(1); + } + if (bwtInc->incMaxBuildSize > 0) { + bwtInc->buildSize = min(bwtInc->incMaxBuildSize, maxBuildSize); + } else { + bwtInc->buildSize = maxBuildSize; + } + if (bwtInc->buildSize < CHAR_PER_WORD) + bwtInc->buildSize = CHAR_PER_WORD; + } + + if (bwtInc->buildSize < CHAR_PER_WORD) { + fprintf(stderr, "BWTIncSetBuildSizeAndTextAddr(): Not enough space allocated to continue construction!\n"); + exit(1); + } + + bwtInc->buildSize = bwtInc->buildSize / CHAR_PER_WORD * CHAR_PER_WORD; + + bwtInc->packedText = bwtInc->workingMemory + 2 * (bwtInc->buildSize + 1) * (sizeof(bgint_t) / 4); + bwtInc->textBuffer = (unsigned char*)(bwtInc->workingMemory + (bwtInc->buildSize + 1) * (sizeof(bgint_t) / 4)); +} + +// for ceilLog2() +unsigned int leadingZero(const unsigned int input) +{ + unsigned int l; + const static unsigned int leadingZero8bit[256] = {8,7,6,6,5,5,5,5,4,4,4,4,4,4,4,4,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3, + 2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2,2, + 1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1, + 1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1, + 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0, + 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0, + 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0, + 0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0,0}; + + if (input & 0xFFFF0000) { + if (input & 0xFF000000) { + l = leadingZero8bit[input >> 24]; + } else { + l = 8 + leadingZero8bit[input >> 16]; + } + } else { + if (input & 0x0000FF00) { + l = 16 + leadingZero8bit[input >> 8]; + } else { + l = 24 + leadingZero8bit[input]; + } + } + return l; + +} +// for BitPerBytePackedChar() +static unsigned int ceilLog2(const unsigned int input) +{ + if (input <= 1) return 0; + return BITS_IN_WORD - leadingZero(input - 1); + +} +// for ConvertBytePackedToWordPacked() +static unsigned int BitPerBytePackedChar(const unsigned int alphabetSize) +{ + unsigned int bitPerChar; + bitPerChar = ceilLog2(alphabetSize); + // Return the largest number of bit that does not affect packing efficiency + if (BITS_IN_BYTE / (BITS_IN_BYTE / bitPerChar) > bitPerChar) + bitPerChar = BITS_IN_BYTE / (BITS_IN_BYTE / bitPerChar); + return bitPerChar; +} +// for ConvertBytePackedToWordPacked() +static unsigned int BitPerWordPackedChar(const unsigned int alphabetSize) +{ + return ceilLog2(alphabetSize); +} + +static void ConvertBytePackedToWordPacked(const unsigned char *input, unsigned int *output, const unsigned int alphabetSize, + const bgint_t textLength) +{ + bgint_t i; + unsigned int j, k, c; + unsigned int bitPerBytePackedChar; + unsigned int bitPerWordPackedChar; + unsigned int charPerWord; + unsigned int charPerByte; + unsigned int bytePerIteration; + bgint_t byteProcessed = 0; + bgint_t wordProcessed = 0; + unsigned int mask, shift; + + unsigned int buffer[BITS_IN_WORD]; + + bitPerBytePackedChar = BitPerBytePackedChar(alphabetSize); + bitPerWordPackedChar = BitPerWordPackedChar(alphabetSize); + charPerByte = BITS_IN_BYTE / bitPerBytePackedChar; + charPerWord = BITS_IN_WORD / bitPerWordPackedChar; + + bytePerIteration = charPerWord / charPerByte; + mask = truncateRight(ALL_ONE_MASK, BITS_IN_WORD - bitPerWordPackedChar); + shift = BITS_IN_WORD - BITS_IN_BYTE + bitPerBytePackedChar - bitPerWordPackedChar; + + while ((wordProcessed + 1) * charPerWord < textLength) { + + k = 0; + for (i=0; i> bitPerWordPackedChar * i; + } + output[wordProcessed] = c; + wordProcessed++; + + } + + k = 0; + for (i=0; i < (textLength - wordProcessed * charPerWord - 1) / charPerByte + 1; i++) { + c = (unsigned int)input[byteProcessed] << shift; + for (j=0; j> bitPerWordPackedChar * i; + } + output[wordProcessed] = c; +} + +BWT *BWTCreate(const bgint_t textLength, unsigned int *decodeTable) +{ + BWT *bwt; + + bwt = (BWT*)calloc(1, sizeof(BWT)); + + bwt->textLength = 0; + + bwt->cumulativeFreq = (bgint_t*)calloc((ALPHABET_SIZE + 1), sizeof(bgint_t)); + initializeVAL_bg(bwt->cumulativeFreq, ALPHABET_SIZE + 1, 0); + + bwt->bwtSizeInWord = 0; + + // Generate decode tables + if (decodeTable == NULL) { + bwt->decodeTable = (unsigned*)calloc(DNA_OCC_CNT_TABLE_SIZE_IN_WORD, sizeof(unsigned int)); + GenerateDNAOccCountTable(bwt->decodeTable); + } else { + // FIXME Prevent BWTFree() from freeing decodeTable in this case + bwt->decodeTable = decodeTable; + } + + bwt->occMajorSizeInWord = BWTOccValueMajorSizeInWord(textLength); + bwt->occValueMajor = (bgint_t*)calloc(bwt->occMajorSizeInWord, sizeof(bgint_t)); + + bwt->occSizeInWord = 0; + bwt->occValue = NULL; + + return bwt; +} + +BWTInc *BWTIncCreate(const bgint_t textLength, unsigned int initialMaxBuildSize, unsigned int incMaxBuildSize) +{ + BWTInc *bwtInc; + unsigned int i, n_iter; + + if (textLength < incMaxBuildSize) incMaxBuildSize = textLength; + if (textLength < initialMaxBuildSize) initialMaxBuildSize = textLength; + + bwtInc = (BWTInc*)calloc(1, sizeof(BWTInc)); + bwtInc->numberOfIterationDone = 0; + bwtInc->bwt = BWTCreate(textLength, NULL); + bwtInc->initialMaxBuildSize = initialMaxBuildSize; + bwtInc->incMaxBuildSize = incMaxBuildSize; + bwtInc->cumulativeCountInCurrentBuild = (bgint_t*)calloc((ALPHABET_SIZE + 1), sizeof(bgint_t)); + initializeVAL_bg(bwtInc->cumulativeCountInCurrentBuild, ALPHABET_SIZE + 1, 0); + + // Build frequently accessed data + bwtInc->packedShift = (unsigned*)calloc(CHAR_PER_WORD, sizeof(unsigned int)); + for (i=0; ipackedShift[i] = BITS_IN_WORD - (i+1) * BIT_PER_CHAR; + + n_iter = (textLength - initialMaxBuildSize) / incMaxBuildSize + 1; + bwtInc->availableWord = BWTResidentSizeInWord(textLength) + BWTOccValueMinorSizeInWord(textLength) // minimal memory requirement + + OCC_INTERVAL / BIT_PER_CHAR * n_iter * 2 * (sizeof(bgint_t) / 4) // buffer at the end of occ array + + incMaxBuildSize/5 * 3 * (sizeof(bgint_t) / 4); // space for the 3 temporary arrays in each iteration + if (bwtInc->availableWord < MIN_AVAILABLE_WORD) bwtInc->availableWord = MIN_AVAILABLE_WORD; // lh3: otherwise segfaul when availableWord is too small + fprintf(stderr, "[%s] textLength=%ld, availableWord=%ld\n", __func__, (long)textLength, (long)bwtInc->availableWord); + bwtInc->workingMemory = (unsigned*)calloc(bwtInc->availableWord, BYTES_IN_WORD); + + return bwtInc; +} +// for BWTIncConstruct() +static void BWTIncPutPackedTextToRank(const unsigned int *packedText, bgint_t* __restrict rank, + bgint_t* __restrict cumulativeCount, const bgint_t numChar) +{ + bgint_t i; + unsigned int j; + unsigned int c, t; + unsigned int packedMask; + bgint_t rankIndex; + bgint_t lastWord; + unsigned int numCharInLastWord; + + lastWord = (numChar - 1) / CHAR_PER_WORD; + numCharInLastWord = numChar - lastWord * CHAR_PER_WORD; + + packedMask = ALL_ONE_MASK >> (BITS_IN_WORD - BIT_PER_CHAR); + rankIndex = numChar - 1; + + t = packedText[lastWord] >> (BITS_IN_WORD - numCharInLastWord * BIT_PER_CHAR); + for (i=0; i>= BIT_PER_CHAR; + } + + for (i=lastWord; i--;) { // loop from lastWord - 1 to 0 + t = packedText[i]; + for (j=0; j>= BIT_PER_CHAR; + } + } + + // Convert occurrence to cumulativeCount + cumulativeCount[2] += cumulativeCount[1]; + cumulativeCount[3] += cumulativeCount[2]; + cumulativeCount[4] += cumulativeCount[3]; +} + + +static void ForwardDNAAllOccCountNoLimit(const unsigned int* dna, const bgint_t index, + bgint_t* __restrict occCount, const unsigned int* dnaDecodeTable) +{ + static const unsigned int truncateRightMask[16] = { 0x00000000, 0xC0000000, 0xF0000000, 0xFC000000, + 0xFF000000, 0xFFC00000, 0xFFF00000, 0xFFFC0000, + 0xFFFF0000, 0xFFFFC000, 0xFFFFF000, 0xFFFFFC00, + 0xFFFFFF00, 0xFFFFFFC0, 0xFFFFFFF0, 0xFFFFFFFC }; + + bgint_t iteration, i; + unsigned int wordToCount, charToCount; + unsigned int j, c, sum; + + occCount[0] = 0; + occCount[1] = 0; + occCount[2] = 0; + occCount[3] = 0; + + iteration = index / 256; + wordToCount = (index - iteration * 256) / 16; + charToCount = index - iteration * 256 - wordToCount * 16; + + for (i=0; i> 16]; + sum += dnaDecodeTable[*dna & 0x0000FFFF]; + dna++; + } + if (!DNA_OCC_SUM_EXCEPTION(sum)) { + occCount[0] += sum & 0x000000FF; sum >>= 8; + occCount[1] += sum & 0x000000FF; sum >>= 8; + occCount[2] += sum & 0x000000FF; sum >>= 8; + occCount[3] += sum; + } else { + // only some or all of the 3 bits are on + // in reality, only one of the four cases are possible + if (sum == 0x00000100) { + occCount[0] += 256; + } else if (sum == 0x00010000) { + occCount[1] += 256; + } else if (sum == 0x01000000) { + occCount[2] += 256; + } else if (sum == 0x00000000) { + occCount[3] += 256; + } else { + fprintf(stderr, "ForwardDNAAllOccCountNoLimit(): DNA occ sum exception!\n"); + exit(1); + } + } + + } + + sum = 0; + for (j=0; j> 16]; + sum += dnaDecodeTable[*dna & 0x0000FFFF]; + dna++; + } + + if (charToCount > 0) { + c = *dna & truncateRightMask[charToCount]; // increase count of 'a' by 16 - c; + sum += dnaDecodeTable[c >> 16]; + sum += dnaDecodeTable[c & 0xFFFF]; + sum += charToCount - 16; // decrease count of 'a' by 16 - positionToProcess + } + + occCount[0] += sum & 0x000000FF; sum >>= 8; + occCount[1] += sum & 0x000000FF; sum >>= 8; + occCount[2] += sum & 0x000000FF; sum >>= 8; + occCount[3] += sum; +} + +static void BWTIncBuildPackedBwt(const bgint_t *relativeRank, unsigned int* __restrict bwt, const bgint_t numChar, + const bgint_t *cumulativeCount, const unsigned int *packedShift) { + + bgint_t i, r; + unsigned int c; + bgint_t previousRank, currentRank; + bgint_t wordIndex, charIndex; + bgint_t inverseSa0; + + inverseSa0 = previousRank = relativeRank[0]; + + for (i=1; i<=numChar; i++) { + currentRank = relativeRank[i]; + // previousRank > cumulativeCount[c] because $ is one of the char + c = (previousRank > cumulativeCount[1]) + (previousRank > cumulativeCount[2]) + + (previousRank > cumulativeCount[3]); + // set bwt for currentRank + if (c > 0) { + // c <> 'a' + r = currentRank; + if (r > inverseSa0) { + // - 1 because $ at inverseSa0 is not encoded + r--; + } + wordIndex = r / CHAR_PER_WORD; + charIndex = r - wordIndex * CHAR_PER_WORD; + bwt[wordIndex] |= c << packedShift[charIndex]; + } + previousRank = currentRank; + } +} + +static inline bgint_t BWTOccValueExplicit(const BWT *bwt, const bgint_t occIndexExplicit, + const unsigned int character) +{ + bgint_t occIndexMajor; + + occIndexMajor = occIndexExplicit * OCC_INTERVAL / OCC_INTERVAL_MAJOR; + + if (occIndexExplicit % OCC_VALUE_PER_WORD == 0) { + return bwt->occValueMajor[occIndexMajor * ALPHABET_SIZE + character] + + (bwt->occValue[occIndexExplicit / OCC_VALUE_PER_WORD * ALPHABET_SIZE + character] >> 16); + + } else { + return bwt->occValueMajor[occIndexMajor * ALPHABET_SIZE + character] + + (bwt->occValue[occIndexExplicit / OCC_VALUE_PER_WORD * ALPHABET_SIZE + character] & 0x0000FFFF); + } +} + + +static unsigned int ForwardDNAOccCount(const unsigned int* dna, const unsigned int index, const unsigned int character, + const unsigned int* dnaDecodeTable) +{ + static const unsigned int truncateRightMask[16] = { 0x00000000, 0xC0000000, 0xF0000000, 0xFC000000, + 0xFF000000, 0xFFC00000, 0xFFF00000, 0xFFFC0000, + 0xFFFF0000, 0xFFFFC000, 0xFFFFF000, 0xFFFFFC00, + 0xFFFFFF00, 0xFFFFFFC0, 0xFFFFFFF0, 0xFFFFFFFC }; + + unsigned int wordToCount, charToCount; + unsigned int i, c; + unsigned int sum = 0; + + wordToCount = index / 16; + charToCount = index - wordToCount * 16; + + for (i=0; i> 16]; + sum += dnaDecodeTable[dna[i] & 0x0000FFFF]; + } + + if (charToCount > 0) { + c = dna[i] & truncateRightMask[charToCount]; // increase count of 'a' by 16 - c; + sum += dnaDecodeTable[c >> 16]; + sum += dnaDecodeTable[c & 0xFFFF]; + sum += charToCount - 16; // decrease count of 'a' by 16 - positionToProcess + } + + return (sum >> (character * 8)) & 0x000000FF; + +} + +static unsigned int BackwardDNAOccCount(const unsigned int* dna, const unsigned int index, const unsigned int character, + const unsigned int* dnaDecodeTable) +{ + static const unsigned int truncateLeftMask[16] = { 0x00000000, 0x00000003, 0x0000000F, 0x0000003F, + 0x000000FF, 0x000003FF, 0x00000FFF, 0x00003FFF, + 0x0000FFFF, 0x0003FFFF, 0x000FFFFF, 0x003FFFFF, + 0x00FFFFFF, 0x03FFFFFF, 0x0FFFFFFF, 0x3FFFFFFF }; + + unsigned int wordToCount, charToCount; + unsigned int i, c; + unsigned int sum = 0; + + wordToCount = index / 16; + charToCount = index - wordToCount * 16; + + dna -= wordToCount + 1; + + if (charToCount > 0) { + c = *dna & truncateLeftMask[charToCount]; // increase count of 'a' by 16 - c; + sum += dnaDecodeTable[c >> 16]; + sum += dnaDecodeTable[c & 0xFFFF]; + sum += charToCount - 16; // decrease count of 'a' by 16 - positionToProcess + } + + for (i=0; i> 16]; + sum += dnaDecodeTable[*dna & 0x0000FFFF]; + } + + return (sum >> (character * 8)) & 0x000000FF; + +} + +bgint_t BWTOccValue(const BWT *bwt, bgint_t index, const unsigned int character) +{ + bgint_t occValue; + bgint_t occExplicitIndex, occIndex; + + // $ is supposed to be positioned at inverseSa0 but it is not encoded + // therefore index is subtracted by 1 for adjustment + if (index > bwt->inverseSa0) + index--; + + occExplicitIndex = (index + OCC_INTERVAL / 2 - 1) / OCC_INTERVAL; // Bidirectional encoding + occIndex = occExplicitIndex * OCC_INTERVAL; + occValue = BWTOccValueExplicit(bwt, occExplicitIndex, character); + + if (occIndex == index) + return occValue; + + if (occIndex < index) { + return occValue + ForwardDNAOccCount(bwt->bwtCode + occIndex / CHAR_PER_WORD, index - occIndex, character, bwt->decodeTable); + } else { + return occValue - BackwardDNAOccCount(bwt->bwtCode + occIndex / CHAR_PER_WORD, occIndex - index, character, bwt->decodeTable); + } +} + +static bgint_t BWTIncGetAbsoluteRank(BWT *bwt, bgint_t* __restrict absoluteRank, bgint_t* __restrict seq, + const unsigned int *packedText, const bgint_t numChar, + const bgint_t* cumulativeCount, const unsigned int firstCharInLastIteration) +{ + bgint_t saIndex; + bgint_t lastWord; + unsigned int packedMask; + bgint_t i; + unsigned int c, t, j; + bgint_t rankIndex; + unsigned int shift; + bgint_t seqIndexFromStart[ALPHABET_SIZE]; + bgint_t seqIndexFromEnd[ALPHABET_SIZE]; + + for (i=0; i> shift; + saIndex = bwt->inverseSa0; + rankIndex = numChar - 1; + + lastWord = numChar / CHAR_PER_WORD; + for (i=lastWord; i--;) { // loop from lastWord - 1 to 0 + t = packedText[i]; + for (j=0; jcumulativeFreq[c] + BWTOccValue(bwt, saIndex, c) + 1; + // A counting sort using the first character of suffix is done here + // If rank > inverseSa0 -> fill seq from end, otherwise fill seq from start -> to leave the right entry for inverseSa0 + if (saIndex > bwt->inverseSa0) { + seq[seqIndexFromEnd[c]] = rankIndex; + absoluteRank[seqIndexFromEnd[c]] = saIndex; + seqIndexFromEnd[c]--; + } else { + seq[seqIndexFromStart[c]] = rankIndex; + absoluteRank[seqIndexFromStart[c]] = saIndex; + seqIndexFromStart[c]++; + } + rankIndex--; + t >>= BIT_PER_CHAR; + } + } + + absoluteRank[seqIndexFromStart[firstCharInLastIteration]] = bwt->inverseSa0; // representing the substring of all preceding characters + seq[seqIndexFromStart[firstCharInLastIteration]] = numChar; + + return seqIndexFromStart[firstCharInLastIteration]; +} + +static void BWTIncSortKey(bgint_t* __restrict key, bgint_t* __restrict seq, const bgint_t numItem) +{ + #define EQUAL_KEY_THRESHOLD 4 // Partition for equal key if data array size / the number of data with equal value with pivot < EQUAL_KEY_THRESHOLD + + int64_t lowIndex, highIndex, midIndex; + int64_t lowPartitionIndex, highPartitionIndex; + int64_t lowStack[32], highStack[32]; + int stackDepth; + int64_t i, j; + bgint_t tempSeq, tempKey; + int64_t numberOfEqualKey; + + if (numItem < 2) return; + + stackDepth = 0; + + lowIndex = 0; + highIndex = numItem - 1; + + for (;;) { + + for (;;) { + + // Sort small array of data + if (highIndex - lowIndex < BWTINC_INSERT_SORT_NUM_ITEM) { // Insertion sort on smallest arrays + for (i=lowIndex+1; i<=highIndex; i++) { + tempSeq = seq[i]; + tempKey = key[i]; + for (j = i; j > lowIndex && key[j-1] > tempKey; j--) { + seq[j] = seq[j-1]; + key[j] = key[j-1]; + } + if (j != i) { + seq[j] = tempSeq; + key[j] = tempKey; + } + } + break; + } + + // Choose pivot as median of the lowest, middle, and highest data; sort the three data + + midIndex = average(lowIndex, highIndex); + if (key[lowIndex] > key[midIndex]) { + tempSeq = seq[lowIndex]; + tempKey = key[lowIndex]; + seq[lowIndex] = seq[midIndex]; + key[lowIndex] = key[midIndex]; + seq[midIndex] = tempSeq; + key[midIndex] = tempKey; + } + if (key[lowIndex] > key[highIndex]) { + tempSeq = seq[lowIndex]; + tempKey = key[lowIndex]; + seq[lowIndex] = seq[highIndex]; + key[lowIndex] = key[highIndex]; + seq[highIndex] = tempSeq; + key[highIndex] = tempKey; + } + if (key[midIndex] > key[highIndex]) { + tempSeq = seq[midIndex]; + tempKey = key[midIndex]; + seq[midIndex] = seq[highIndex]; + key[midIndex] = key[highIndex]; + seq[highIndex] = tempSeq; + key[highIndex] = tempKey; + } + + // Partition data + + numberOfEqualKey = 0; + + lowPartitionIndex = lowIndex + 1; + highPartitionIndex = highIndex - 1; + + for (;;) { + while (lowPartitionIndex <= highPartitionIndex && key[lowPartitionIndex] <= key[midIndex]) { + numberOfEqualKey += (key[lowPartitionIndex] == key[midIndex]); + lowPartitionIndex++; + } + while (lowPartitionIndex < highPartitionIndex) { + if (key[midIndex] >= key[highPartitionIndex]) { + numberOfEqualKey += (key[midIndex] == key[highPartitionIndex]); + break; + } + highPartitionIndex--; + } + if (lowPartitionIndex >= highPartitionIndex) { + break; + } + tempSeq = seq[lowPartitionIndex]; + tempKey = key[lowPartitionIndex]; + seq[lowPartitionIndex] = seq[highPartitionIndex]; + key[lowPartitionIndex] = key[highPartitionIndex]; + seq[highPartitionIndex] = tempSeq; + key[highPartitionIndex] = tempKey; + if (highPartitionIndex == midIndex) { + // partition key has been moved + midIndex = lowPartitionIndex; + } + lowPartitionIndex++; + highPartitionIndex--; + } + + // Adjust the partition index + highPartitionIndex = lowPartitionIndex; + lowPartitionIndex--; + + // move the partition key to end of low partition + tempSeq = seq[midIndex]; + tempKey = key[midIndex]; + seq[midIndex] = seq[lowPartitionIndex]; + key[midIndex] = key[lowPartitionIndex]; + seq[lowPartitionIndex] = tempSeq; + key[lowPartitionIndex] = tempKey; + + if (highIndex - lowIndex + BWTINC_INSERT_SORT_NUM_ITEM <= EQUAL_KEY_THRESHOLD * numberOfEqualKey) { + + // Many keys = partition key; separate the equal key data from the lower partition + + midIndex = lowIndex; + + for (;;) { + while (midIndex < lowPartitionIndex && key[midIndex] < key[lowPartitionIndex]) { + midIndex++; + } + while (midIndex < lowPartitionIndex && key[lowPartitionIndex] == key[lowPartitionIndex - 1]) { + lowPartitionIndex--; + } + if (midIndex >= lowPartitionIndex) { + break; + } + tempSeq = seq[midIndex]; + tempKey = key[midIndex]; + seq[midIndex] = seq[lowPartitionIndex - 1]; + key[midIndex] = key[lowPartitionIndex - 1]; + seq[lowPartitionIndex - 1] = tempSeq; + key[lowPartitionIndex - 1] = tempKey; + midIndex++; + lowPartitionIndex--; + } + + } + + if (lowPartitionIndex - lowIndex > highIndex - highPartitionIndex) { + // put the larger partition to stack + lowStack[stackDepth] = lowIndex; + highStack[stackDepth] = lowPartitionIndex - 1; + stackDepth++; + // sort the smaller partition first + lowIndex = highPartitionIndex; + } else { + // put the larger partition to stack + lowStack[stackDepth] = highPartitionIndex; + highStack[stackDepth] = highIndex; + stackDepth++; + // sort the smaller partition first + if (lowPartitionIndex > lowIndex) { + highIndex = lowPartitionIndex - 1; + } else { + // all keys in the partition equals to the partition key + break; + } + } + continue; + } + + // Pop a range from stack + if (stackDepth > 0) { + stackDepth--; + lowIndex = lowStack[stackDepth]; + highIndex = highStack[stackDepth]; + continue; + } else return; + } +} + + +static void BWTIncBuildRelativeRank(bgint_t* __restrict sortedRank, bgint_t* __restrict seq, + bgint_t* __restrict relativeRank, const bgint_t numItem, + bgint_t oldInverseSa0, const bgint_t *cumulativeCount) +{ + bgint_t i, c; + bgint_t s, r; + bgint_t lastRank, lastIndex; +// bgint_t oldInverseSa0RelativeRank = 0; + bgint_t freq; + + lastIndex = numItem; + lastRank = sortedRank[numItem]; + if (lastRank > oldInverseSa0) { + sortedRank[numItem]--; // to prepare for merging; $ is not encoded in bwt + } + s = seq[numItem]; + relativeRank[s] = numItem; + if (lastRank == oldInverseSa0) { +// oldInverseSa0RelativeRank = numItem; + oldInverseSa0++; // so that this segment of code is not run again + lastRank++; // so that oldInverseSa0 become a sorted group with 1 item + } + + c = ALPHABET_SIZE - 1; + freq = cumulativeCount[c]; + + for (i=numItem; i--;) { // from numItem - 1 to 0 + r = sortedRank[i]; + if (r > oldInverseSa0) + sortedRank[i]--; // to prepare for merging; $ is not encoded in bwt + s = seq[i]; + if (i < freq) { + if (lastIndex >= freq) + lastRank++; // to trigger the group across alphabet boundary to be split + c--; + freq = cumulativeCount[c]; + } + if (r == lastRank) { + relativeRank[s] = lastIndex; + } else { + if (i == lastIndex - 1) { + if (lastIndex < numItem && (sbgint_t)seq[lastIndex + 1] < 0) { + seq[lastIndex] = seq[lastIndex + 1] - 1; + } else { + seq[lastIndex] = (bgint_t)-1; + } + } + lastIndex = i; + lastRank = r; + relativeRank[s] = i; + if (r == oldInverseSa0) { +// oldInverseSa0RelativeRank = i; + oldInverseSa0++; // so that this segment of code is not run again + lastRank++; // so that oldInverseSa0 become a sorted group with 1 item + } + } + } + +} + +static void BWTIncBuildBwt(unsigned int* insertBwt, const bgint_t *relativeRank, const bgint_t numChar, + const bgint_t *cumulativeCount) +{ + unsigned int c; + bgint_t i; + bgint_t previousRank, currentRank; + + previousRank = relativeRank[0]; + + for (i=1; i<=numChar; i++) { + currentRank = relativeRank[i]; + c = (previousRank >= cumulativeCount[1]) + (previousRank >= cumulativeCount[2]) + + (previousRank >= cumulativeCount[3]); + insertBwt[currentRank] = c; + previousRank = currentRank; + } +} + +static void BWTIncMergeBwt(const bgint_t *sortedRank, const unsigned int* oldBwt, const unsigned int *insertBwt, + unsigned int* __restrict mergedBwt, const bgint_t numOldBwt, const bgint_t numInsertBwt) +{ +// unsigned int bitsInWordMinusBitPerChar; + bgint_t leftShift, rightShift; + bgint_t o; + bgint_t oIndex, iIndex, mIndex; + bgint_t mWord, mChar, oWord, oChar; + bgint_t numInsert; + +// bitsInWordMinusBitPerChar = BITS_IN_WORD - BIT_PER_CHAR; + + oIndex = 0; + iIndex = 0; + mIndex = 0; + + mWord = 0; + mChar = 0; + + mergedBwt[0] = 0; // this can be cleared as merged Bwt slightly shift to the left in each iteration + + while (oIndex < numOldBwt) { + + // copy from insertBwt + while (iIndex <= numInsertBwt && sortedRank[iIndex] <= oIndex) { + if (sortedRank[iIndex] != 0) { // special value to indicate that this is for new inverseSa0 + mergedBwt[mWord] |= insertBwt[iIndex] << (BITS_IN_WORD - (mChar + 1) * BIT_PER_CHAR); + mIndex++; + mChar++; + if (mChar == CHAR_PER_WORD) { + mChar = 0; + mWord++; + mergedBwt[mWord] = 0; // no need to worry about crossing mergedBwt boundary + } + } + iIndex++; + } + + // Copy from oldBwt to mergedBwt + if (iIndex <= numInsertBwt) { + o = sortedRank[iIndex]; + } else { + o = numOldBwt; + } + numInsert = o - oIndex; + + oWord = oIndex / CHAR_PER_WORD; + oChar = oIndex - oWord * CHAR_PER_WORD; + if (oChar > mChar) { + leftShift = (oChar - mChar) * BIT_PER_CHAR; + rightShift = (CHAR_PER_WORD + mChar - oChar) * BIT_PER_CHAR; + mergedBwt[mWord] = mergedBwt[mWord] + | (oldBwt[oWord] << (oChar * BIT_PER_CHAR) >> (mChar * BIT_PER_CHAR)) + | (oldBwt[oWord+1] >> rightShift); + oIndex += min(numInsert, CHAR_PER_WORD - mChar); + while (o > oIndex) { + oWord++; + mWord++; + mergedBwt[mWord] = (oldBwt[oWord] << leftShift) | (oldBwt[oWord+1] >> rightShift); + oIndex += CHAR_PER_WORD; + } + } else if (oChar < mChar) { + rightShift = (mChar - oChar) * BIT_PER_CHAR; + leftShift = (CHAR_PER_WORD + oChar - mChar) * BIT_PER_CHAR; + mergedBwt[mWord] = mergedBwt[mWord] + | (oldBwt[oWord] << (oChar * BIT_PER_CHAR) >> (mChar * BIT_PER_CHAR)); + oIndex += min(numInsert, CHAR_PER_WORD - mChar); + while (o > oIndex) { + oWord++; + mWord++; + mergedBwt[mWord] = (oldBwt[oWord-1] << leftShift) | (oldBwt[oWord] >> rightShift); + oIndex += CHAR_PER_WORD; + } + } else { // oChar == mChar + mergedBwt[mWord] = mergedBwt[mWord] | truncateLeft(oldBwt[oWord], mChar * BIT_PER_CHAR); + oIndex += min(numInsert, CHAR_PER_WORD - mChar); + while (o > oIndex) { + oWord++; + mWord++; + mergedBwt[mWord] = oldBwt[oWord]; + oIndex += CHAR_PER_WORD; + } + } + oIndex = o; + mIndex += numInsert; + + // Clear the trailing garbage in mergedBwt + mWord = mIndex / CHAR_PER_WORD; + mChar = mIndex - mWord * CHAR_PER_WORD; + if (mChar == 0) { + mergedBwt[mWord] = 0; + } else { + mergedBwt[mWord] = truncateRight(mergedBwt[mWord], (BITS_IN_WORD - mChar * BIT_PER_CHAR)); + } + + } + + // copy from insertBwt + while (iIndex <= numInsertBwt) { + if (sortedRank[iIndex] != 0) { + mergedBwt[mWord] |= insertBwt[iIndex] << (BITS_IN_WORD - (mChar + 1) * BIT_PER_CHAR); + mIndex++; + mChar++; + if (mChar == CHAR_PER_WORD) { + mChar = 0; + mWord++; + mergedBwt[mWord] = 0; // no need to worry about crossing mergedBwt boundary + } + } + iIndex++; + } +} + +void BWTClearTrailingBwtCode(BWT *bwt) +{ + bgint_t bwtResidentSizeInWord; + bgint_t wordIndex, offset; + bgint_t i; + + bwtResidentSizeInWord = BWTResidentSizeInWord(bwt->textLength); + + wordIndex = bwt->textLength / CHAR_PER_WORD; + offset = (bwt->textLength - wordIndex * CHAR_PER_WORD) * BIT_PER_CHAR; + if (offset > 0) { + bwt->bwtCode[wordIndex] = truncateRight(bwt->bwtCode[wordIndex], BITS_IN_WORD - offset); + } else { + if (wordIndex < bwtResidentSizeInWord) { + bwt->bwtCode[wordIndex] = 0; + } + } + + for (i=wordIndex+1; ibwtCode[i] = 0; + } +} + + +void BWTGenerateOccValueFromBwt(const unsigned int* bwt, unsigned int* __restrict occValue, + bgint_t* __restrict occValueMajor, + const bgint_t textLength, const unsigned int* decodeTable) +{ + bgint_t numberOfOccValueMajor, numberOfOccValue; + unsigned int wordBetweenOccValue; + bgint_t numberOfOccIntervalPerMajor; + unsigned int c; + bgint_t i, j; + bgint_t occMajorIndex; + bgint_t occIndex, bwtIndex; + bgint_t sum; // perhaps unsigned is big enough + bgint_t tempOccValue0[ALPHABET_SIZE], tempOccValue1[ALPHABET_SIZE]; + + wordBetweenOccValue = OCC_INTERVAL / CHAR_PER_WORD; + + // Calculate occValue + numberOfOccValue = (textLength + OCC_INTERVAL - 1) / OCC_INTERVAL + 1; // Value at both end for bi-directional encoding + numberOfOccIntervalPerMajor = OCC_INTERVAL_MAJOR / OCC_INTERVAL; + numberOfOccValueMajor = (numberOfOccValue + numberOfOccIntervalPerMajor - 1) / numberOfOccIntervalPerMajor; + + tempOccValue0[0] = 0; + tempOccValue0[1] = 0; + tempOccValue0[2] = 0; + tempOccValue0[3] = 0; + occValueMajor[0] = 0; + occValueMajor[1] = 0; + occValueMajor[2] = 0; + occValueMajor[3] = 0; + + occIndex = 0; + bwtIndex = 0; + for (occMajorIndex=1; occMajorIndex> 16]; + sum += decodeTable[c & 0x0000FFFF]; + bwtIndex++; + } + if (!DNA_OCC_SUM_EXCEPTION(sum)) { + tempOccValue1[0] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[1] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[2] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[3] += sum; + } else { + if (sum == 0x00000100) { + tempOccValue1[0] += 256; + } else if (sum == 0x00010000) { + tempOccValue1[1] += 256; + } else if (sum == 0x01000000) { + tempOccValue1[2] += 256; + } else { + tempOccValue1[3] += 256; + } + } + occValue[occIndex * 4 + 0] = (tempOccValue0[0] << 16) | tempOccValue1[0]; + occValue[occIndex * 4 + 1] = (tempOccValue0[1] << 16) | tempOccValue1[1]; + occValue[occIndex * 4 + 2] = (tempOccValue0[2] << 16) | tempOccValue1[2]; + occValue[occIndex * 4 + 3] = (tempOccValue0[3] << 16) | tempOccValue1[3]; + tempOccValue0[0] = tempOccValue1[0]; + tempOccValue0[1] = tempOccValue1[1]; + tempOccValue0[2] = tempOccValue1[2]; + tempOccValue0[3] = tempOccValue1[3]; + sum = 0; + + occIndex++; + + for (j=0; j> 16]; + sum += decodeTable[c & 0x0000FFFF]; + bwtIndex++; + } + if (!DNA_OCC_SUM_EXCEPTION(sum)) { + tempOccValue0[0] += (sum & 0x000000FF); sum >>= 8; + tempOccValue0[1] += (sum & 0x000000FF); sum >>= 8; + tempOccValue0[2] += (sum & 0x000000FF); sum >>= 8; + tempOccValue0[3] += sum; + } else { + if (sum == 0x00000100) { + tempOccValue0[0] += 256; + } else if (sum == 0x00010000) { + tempOccValue0[1] += 256; + } else if (sum == 0x01000000) { + tempOccValue0[2] += 256; + } else { + tempOccValue0[3] += 256; + } + } + } + + occValueMajor[occMajorIndex * 4 + 0] = occValueMajor[(occMajorIndex - 1) * 4 + 0] + tempOccValue0[0]; + occValueMajor[occMajorIndex * 4 + 1] = occValueMajor[(occMajorIndex - 1) * 4 + 1] + tempOccValue0[1]; + occValueMajor[occMajorIndex * 4 + 2] = occValueMajor[(occMajorIndex - 1) * 4 + 2] + tempOccValue0[2]; + occValueMajor[occMajorIndex * 4 + 3] = occValueMajor[(occMajorIndex - 1) * 4 + 3] + tempOccValue0[3]; + tempOccValue0[0] = 0; + tempOccValue0[1] = 0; + tempOccValue0[2] = 0; + tempOccValue0[3] = 0; + + } + + while (occIndex < (numberOfOccValue-1)/2) { + sum = 0; + tempOccValue1[0] = tempOccValue0[0]; + tempOccValue1[1] = tempOccValue0[1]; + tempOccValue1[2] = tempOccValue0[2]; + tempOccValue1[3] = tempOccValue0[3]; + for (j=0; j> 16]; + sum += decodeTable[c & 0x0000FFFF]; + bwtIndex++; + } + if (!DNA_OCC_SUM_EXCEPTION(sum)) { + tempOccValue1[0] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[1] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[2] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[3] += sum; + } else { + if (sum == 0x00000100) { + tempOccValue1[0] += 256; + } else if (sum == 0x00010000) { + tempOccValue1[1] += 256; + } else if (sum == 0x01000000) { + tempOccValue1[2] += 256; + } else { + tempOccValue1[3] += 256; + } + } + occValue[occIndex * 4 + 0] = (tempOccValue0[0] << 16) | tempOccValue1[0]; + occValue[occIndex * 4 + 1] = (tempOccValue0[1] << 16) | tempOccValue1[1]; + occValue[occIndex * 4 + 2] = (tempOccValue0[2] << 16) | tempOccValue1[2]; + occValue[occIndex * 4 + 3] = (tempOccValue0[3] << 16) | tempOccValue1[3]; + tempOccValue0[0] = tempOccValue1[0]; + tempOccValue0[1] = tempOccValue1[1]; + tempOccValue0[2] = tempOccValue1[2]; + tempOccValue0[3] = tempOccValue1[3]; + sum = 0; + occIndex++; + + for (j=0; j> 16]; + sum += decodeTable[c & 0x0000FFFF]; + bwtIndex++; + } + if (!DNA_OCC_SUM_EXCEPTION(sum)) { + tempOccValue0[0] += (sum & 0x000000FF); sum >>= 8; + tempOccValue0[1] += (sum & 0x000000FF); sum >>= 8; + tempOccValue0[2] += (sum & 0x000000FF); sum >>= 8; + tempOccValue0[3] += sum; + } else { + if (sum == 0x00000100) { + tempOccValue0[0] += 256; + } else if (sum == 0x00010000) { + tempOccValue0[1] += 256; + } else if (sum == 0x01000000) { + tempOccValue0[2] += 256; + } else { + tempOccValue0[3] += 256; + } + } + } + + sum = 0; + tempOccValue1[0] = tempOccValue0[0]; + tempOccValue1[1] = tempOccValue0[1]; + tempOccValue1[2] = tempOccValue0[2]; + tempOccValue1[3] = tempOccValue0[3]; + + if (occIndex * 2 < numberOfOccValue - 1) { + for (j=0; j> 16]; + sum += decodeTable[c & 0x0000FFFF]; + bwtIndex++; + } + if (!DNA_OCC_SUM_EXCEPTION(sum)) { + tempOccValue1[0] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[1] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[2] += (sum & 0x000000FF); sum >>= 8; + tempOccValue1[3] += sum; + } else { + if (sum == 0x00000100) { + tempOccValue1[0] += 256; + } else if (sum == 0x00010000) { + tempOccValue1[1] += 256; + } else if (sum == 0x01000000) { + tempOccValue1[2] += 256; + } else { + tempOccValue1[3] += 256; + } + } + } + + occValue[occIndex * 4 + 0] = (tempOccValue0[0] << 16) | tempOccValue1[0]; + occValue[occIndex * 4 + 1] = (tempOccValue0[1] << 16) | tempOccValue1[1]; + occValue[occIndex * 4 + 2] = (tempOccValue0[2] << 16) | tempOccValue1[2]; + occValue[occIndex * 4 + 3] = (tempOccValue0[3] << 16) | tempOccValue1[3]; + +} + +static void BWTIncConstruct(BWTInc *bwtInc, const bgint_t numChar) +{ + unsigned int i; + bgint_t mergedBwtSizeInWord, mergedOccSizeInWord; + unsigned int firstCharInThisIteration; + + bgint_t *relativeRank, *seq, *sortedRank; + unsigned int *insertBwt, *mergedBwt; + bgint_t newInverseSa0RelativeRank, oldInverseSa0RelativeRank, newInverseSa0; + + mergedBwtSizeInWord = BWTResidentSizeInWord(bwtInc->bwt->textLength + numChar); + mergedOccSizeInWord = BWTOccValueMinorSizeInWord(bwtInc->bwt->textLength + numChar); + + initializeVAL_bg(bwtInc->cumulativeCountInCurrentBuild, ALPHABET_SIZE + 1, 0); + + if (bwtInc->bwt->textLength == 0) { // Initial build + + // Set address + seq = (bgint_t*)bwtInc->workingMemory; + relativeRank = seq + bwtInc->buildSize + 1; + // mergedBwt and packedTex may share memory + mergedBwt = insertBwt = bwtInc->workingMemory + bwtInc->availableWord - mergedBwtSizeInWord; // build in place + + assert((void*)(relativeRank + bwtInc->buildSize + 1) <= (void*)bwtInc->packedText); + assert((void*)(relativeRank + bwtInc->buildSize + 1) <= (void*)mergedBwt); + + // ->packedText is not used any more and may be overwritten by mergedBwt + BWTIncPutPackedTextToRank(bwtInc->packedText, relativeRank, bwtInc->cumulativeCountInCurrentBuild, numChar); + + firstCharInThisIteration = relativeRank[0]; + relativeRank[numChar] = 0; + + // Sort suffix + QSufSortSuffixSort((qsint_t*)relativeRank, (qsint_t*)seq, (qsint_t)numChar, (qsint_t)ALPHABET_SIZE - 1, 0, FALSE); + newInverseSa0 = relativeRank[0]; + + // Clear BWT area + initializeVAL(insertBwt, mergedBwtSizeInWord, 0); + + // Build BWT + BWTIncBuildPackedBwt(relativeRank, insertBwt, numChar, bwtInc->cumulativeCountInCurrentBuild, bwtInc->packedShift); + + // so that the cumulativeCount is not deducted + bwtInc->firstCharInLastIteration = ALPHABET_SIZE; + + } else { // Incremental build + // Set address + sortedRank = (bgint_t*)bwtInc->workingMemory; + seq = sortedRank + bwtInc->buildSize + 1; + insertBwt = (unsigned*)seq; // insertBwt and seq share memory + // relativeRank and ->packedText may share memory + relativeRank = seq + bwtInc->buildSize + 1; + + assert((void*)relativeRank <= (void*)bwtInc->packedText); + + // Store the first character of this iteration + firstCharInThisIteration = bwtInc->packedText[0] >> (BITS_IN_WORD - BIT_PER_CHAR); + + // Count occurrence of input text + ForwardDNAAllOccCountNoLimit(bwtInc->packedText, numChar, bwtInc->cumulativeCountInCurrentBuild + 1, bwtInc->bwt->decodeTable); + // Add the first character of the previous iteration to represent the inverseSa0 of the previous iteration + bwtInc->cumulativeCountInCurrentBuild[bwtInc->firstCharInLastIteration + 1]++; + bwtInc->cumulativeCountInCurrentBuild[2] += bwtInc->cumulativeCountInCurrentBuild[1]; + bwtInc->cumulativeCountInCurrentBuild[3] += bwtInc->cumulativeCountInCurrentBuild[2]; + bwtInc->cumulativeCountInCurrentBuild[4] += bwtInc->cumulativeCountInCurrentBuild[3]; + + // Get rank of new suffix among processed suffix + // The seq array is built into ALPHABET_SIZE + 2 groups; ALPHABET_SIZE groups + 1 group divided into 2 by inverseSa0 + inverseSa0 as 1 group + // ->packedText is not used any more and will be overwritten by relativeRank + oldInverseSa0RelativeRank = BWTIncGetAbsoluteRank(bwtInc->bwt, sortedRank, seq, bwtInc->packedText, + numChar, bwtInc->cumulativeCountInCurrentBuild, bwtInc->firstCharInLastIteration); + + // Sort rank by ALPHABET_SIZE + 2 groups (or ALPHABET_SIZE + 1 groups when inverseSa0 sit on the border of a group) + for (i=0; icumulativeCountInCurrentBuild[i] > oldInverseSa0RelativeRank || + bwtInc->cumulativeCountInCurrentBuild[i+1] <= oldInverseSa0RelativeRank) { + BWTIncSortKey(sortedRank + bwtInc->cumulativeCountInCurrentBuild[i], seq + bwtInc->cumulativeCountInCurrentBuild[i], bwtInc->cumulativeCountInCurrentBuild[i+1] - bwtInc->cumulativeCountInCurrentBuild[i]); + } else { + if (bwtInc->cumulativeCountInCurrentBuild[i] < oldInverseSa0RelativeRank) { + BWTIncSortKey(sortedRank + bwtInc->cumulativeCountInCurrentBuild[i], seq + bwtInc->cumulativeCountInCurrentBuild[i], oldInverseSa0RelativeRank - bwtInc->cumulativeCountInCurrentBuild[i]); + } + if (bwtInc->cumulativeCountInCurrentBuild[i+1] > oldInverseSa0RelativeRank + 1) { + BWTIncSortKey(sortedRank + oldInverseSa0RelativeRank + 1, seq + oldInverseSa0RelativeRank + 1, bwtInc->cumulativeCountInCurrentBuild[i+1] - oldInverseSa0RelativeRank - 1); + } + } + } + + // build relative rank; sortedRank is updated for merging to cater for the fact that $ is not encoded in bwt + // the cumulative freq information is used to make sure that inverseSa0 and suffix beginning with different characters are kept in different unsorted groups) + BWTIncBuildRelativeRank(sortedRank, seq, relativeRank, numChar, bwtInc->bwt->inverseSa0, bwtInc->cumulativeCountInCurrentBuild); + assert(relativeRank[numChar] == oldInverseSa0RelativeRank); + + // Sort suffix + QSufSortSuffixSort((qsint_t*)relativeRank, (qsint_t*)seq, (qsint_t)numChar, (qsint_t)numChar, 1, TRUE); + + newInverseSa0RelativeRank = relativeRank[0]; + newInverseSa0 = sortedRank[newInverseSa0RelativeRank] + newInverseSa0RelativeRank; + + sortedRank[newInverseSa0RelativeRank] = 0; // a special value so that this is skipped in the merged bwt + + // Build BWT; seq is overwritten by insertBwt + BWTIncBuildBwt(insertBwt, relativeRank, numChar, bwtInc->cumulativeCountInCurrentBuild); + + // Merge BWT; relativeRank may be overwritten by mergedBwt + mergedBwt = bwtInc->workingMemory + bwtInc->availableWord - mergedBwtSizeInWord + - bwtInc->numberOfIterationDone * OCC_INTERVAL / BIT_PER_CHAR * (sizeof(bgint_t) / 4); // minus numberOfIteration * occInterval to create a buffer for merging + assert(mergedBwt >= insertBwt + numChar); + BWTIncMergeBwt(sortedRank, bwtInc->bwt->bwtCode, insertBwt, mergedBwt, bwtInc->bwt->textLength, numChar); + } + + // Build auxiliary structure and update info and pointers in BWT + bwtInc->bwt->textLength += numChar; + bwtInc->bwt->bwtCode = mergedBwt; + bwtInc->bwt->bwtSizeInWord = mergedBwtSizeInWord; + bwtInc->bwt->occSizeInWord = mergedOccSizeInWord; + assert(mergedBwt >= bwtInc->workingMemory + mergedOccSizeInWord); + + bwtInc->bwt->occValue = mergedBwt - mergedOccSizeInWord; + + BWTClearTrailingBwtCode(bwtInc->bwt); + BWTGenerateOccValueFromBwt(bwtInc->bwt->bwtCode, bwtInc->bwt->occValue, bwtInc->bwt->occValueMajor, + bwtInc->bwt->textLength, bwtInc->bwt->decodeTable); + + bwtInc->bwt->inverseSa0 = newInverseSa0; + + bwtInc->bwt->cumulativeFreq[1] += bwtInc->cumulativeCountInCurrentBuild[1] - (bwtInc->firstCharInLastIteration <= 0); + bwtInc->bwt->cumulativeFreq[2] += bwtInc->cumulativeCountInCurrentBuild[2] - (bwtInc->firstCharInLastIteration <= 1); + bwtInc->bwt->cumulativeFreq[3] += bwtInc->cumulativeCountInCurrentBuild[3] - (bwtInc->firstCharInLastIteration <= 2); + bwtInc->bwt->cumulativeFreq[4] += bwtInc->cumulativeCountInCurrentBuild[4] - (bwtInc->firstCharInLastIteration <= 3); + + bwtInc->firstCharInLastIteration = firstCharInThisIteration; + + // Set build size and text address for the next build + BWTIncSetBuildSizeAndTextAddr(bwtInc); + bwtInc->numberOfIterationDone++; + +} + +BWTInc *BWTIncConstructFromPacked(const char *inputFileName, bgint_t initialMaxBuildSize, bgint_t incMaxBuildSize) +{ + + FILE *packedFile; + bgint_t packedFileLen; + bgint_t totalTextLength; + bgint_t textToLoad, textSizeInByte; + bgint_t processedTextLength; + unsigned char lastByteLength; + + BWTInc *bwtInc; + + packedFile = (FILE*)fopen(inputFileName, "rb"); + + if (packedFile == NULL) { + fprintf(stderr, "BWTIncConstructFromPacked() : Cannot open %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + + if (fseek(packedFile, -1, SEEK_END) != 0) { + fprintf(stderr, "BWTIncConstructFromPacked() : Can't seek on %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + packedFileLen = ftell(packedFile); + if (packedFileLen == -1) { + fprintf(stderr, "BWTIncConstructFromPacked() : Can't ftell on %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + if (fread(&lastByteLength, sizeof(unsigned char), 1, packedFile) != 1) { + fprintf(stderr, + "BWTIncConstructFromPacked() : Can't read from %s : %s\n", + inputFileName, + ferror(packedFile)? strerror(errno) : "Unexpected end of file"); + exit(1); + } + totalTextLength = TextLengthFromBytePacked(packedFileLen, BIT_PER_CHAR, lastByteLength); + + bwtInc = BWTIncCreate(totalTextLength, initialMaxBuildSize, incMaxBuildSize); + + BWTIncSetBuildSizeAndTextAddr(bwtInc); + + if (bwtInc->buildSize > totalTextLength) { + textToLoad = totalTextLength; + } else { + textToLoad = totalTextLength - ((totalTextLength - bwtInc->buildSize + CHAR_PER_WORD - 1) / CHAR_PER_WORD * CHAR_PER_WORD); + } + textSizeInByte = textToLoad / CHAR_PER_BYTE; // excluded the odd byte + + if (fseek(packedFile, -((long)textSizeInByte + 2), SEEK_CUR) != 0) { + fprintf(stderr, "BWTIncConstructFromPacked() : Can't seek on %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + if (fread(bwtInc->textBuffer, sizeof(unsigned char), textSizeInByte + 1, packedFile) != textSizeInByte + 1) { + fprintf(stderr, + "BWTIncConstructFromPacked() : Can't read from %s : %s\n", + inputFileName, + ferror(packedFile)? strerror(errno) : "Unexpected end of file"); + exit(1); + } + if (fseek(packedFile, -((long)textSizeInByte + 1), SEEK_CUR) != 0) { + fprintf(stderr, "BWTIncConstructFromPacked() : Can't seek on %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + + ConvertBytePackedToWordPacked(bwtInc->textBuffer, bwtInc->packedText, ALPHABET_SIZE, textToLoad); + BWTIncConstruct(bwtInc, textToLoad); + + processedTextLength = textToLoad; + + while (processedTextLength < totalTextLength) { + textToLoad = bwtInc->buildSize / CHAR_PER_WORD * CHAR_PER_WORD; + if (textToLoad > totalTextLength - processedTextLength) { + textToLoad = totalTextLength - processedTextLength; + } + textSizeInByte = textToLoad / CHAR_PER_BYTE; + if (fseek(packedFile, -((long)textSizeInByte), SEEK_CUR) != 0) { + fprintf(stderr, "BWTIncConstructFromPacked() : Can't seek on %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + if (fread(bwtInc->textBuffer, sizeof(unsigned char), textSizeInByte, packedFile) != textSizeInByte) { + fprintf(stderr, + "BWTIncConstructFromPacked() : Can't read from %s : %s\n", + inputFileName, + ferror(packedFile)? strerror(errno) : "Unexpected end of file"); + exit(1); + } + if (fseek(packedFile, -((long)textSizeInByte), SEEK_CUR) != 0) { + fprintf(stderr, "BWTIncConstructFromPacked() : Can't seek on %s : %s\n", + inputFileName, strerror(errno)); + exit(1); + } + ConvertBytePackedToWordPacked(bwtInc->textBuffer, bwtInc->packedText, ALPHABET_SIZE, textToLoad); + BWTIncConstruct(bwtInc, textToLoad); + processedTextLength += textToLoad; + if (bwtInc->numberOfIterationDone % 10 == 0) { + fprintf(stderr, "[BWTIncConstructFromPacked] %lu iterations done. %lu characters processed.\n", + (long)bwtInc->numberOfIterationDone, (long)processedTextLength); + } + } + + fclose(packedFile); + return bwtInc; +} + +void BWTIncFree(BWTInc *bwtInc) +{ + if (bwtInc == 0) return; + free(bwtInc->bwt->cumulativeFreq); + free(bwtInc->bwt->occValueMajor); + free(bwtInc->bwt->decodeTable); + free(bwtInc->bwt); + free(bwtInc->workingMemory); + free(bwtInc->cumulativeCountInCurrentBuild); + free(bwtInc->packedShift); + free(bwtInc); +} + +static bgint_t BWTFileSizeInWord(const bgint_t numChar) +{ + // The $ in BWT at the position of inverseSa0 is not encoded + return (numChar + CHAR_PER_WORD - 1) / CHAR_PER_WORD; +} + +void BWTSaveBwtCodeAndOcc(const BWT *bwt, const char *bwtFileName, const char *occValueFileName) +{ + FILE *bwtFile; +/* FILE *occValueFile; */ + bgint_t bwtLength; + + bwtFile = (FILE*)fopen(bwtFileName, "wb"); + if (bwtFile == NULL) { + fprintf(stderr, + "BWTSaveBwtCodeAndOcc(): Cannot open %s for writing: %s\n", + bwtFileName, strerror(errno)); + exit(1); + } + + bwtLength = BWTFileSizeInWord(bwt->textLength); + + if (fwrite(&bwt->inverseSa0, sizeof(bgint_t), 1, bwtFile) != 1 + || fwrite(bwt->cumulativeFreq + 1, + sizeof(bgint_t), ALPHABET_SIZE, bwtFile) != ALPHABET_SIZE + || fwrite(bwt->bwtCode, + sizeof(unsigned int), bwtLength, bwtFile) != bwtLength) { + fprintf(stderr, "BWTSaveBwtCodeAndOcc(): Error writing to %s : %s\n", + bwtFileName, strerror(errno)); + exit(1); + } + if (fclose(bwtFile) != 0) { + fprintf(stderr, "BWTSaveBwtCodeAndOcc(): Error on closing %s : %s\n", + bwtFileName, strerror(errno)); + exit(1); + } +} + +void bwt_bwtgen2(const char *fn_pac, const char *fn_bwt, int block_size) +{ + BWTInc *bwtInc; + bwtInc = BWTIncConstructFromPacked(fn_pac, block_size, block_size); + fprintf(stderr, "[bwt_gen] Finished constructing BWT in %u iterations.\n", bwtInc->numberOfIterationDone); + BWTSaveBwtCodeAndOcc(bwtInc->bwt, fn_bwt, 0); + BWTIncFree(bwtInc); +} + +void bwt_bwtgen(const char *fn_pac, const char *fn_bwt) +{ + bwt_bwtgen2(fn_pac, fn_bwt, 10000000); +} + +int bwt_bwtgen_main(int argc, char *argv[]) +{ + if (argc < 3) { + fprintf(stderr, "Usage: bwtgen \n"); + return 1; + } + bwt_bwtgen(argv[1], argv[2]); + return 0; +} + +#ifdef MAIN_BWT_GEN + +int main(int argc, char *argv[]) +{ + return bwt_bwtgen_main(argc, argv); +} + +#endif diff --git a/bwt_lite.c b/bwt_lite.c new file mode 100644 index 0000000..eb16da6 --- /dev/null +++ b/bwt_lite.c @@ -0,0 +1,98 @@ +#include +#include +#include +#include "bwt_lite.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +int is_sa(const uint8_t *T, int *SA, int n); +int is_bwt(uint8_t *T, int n); + +bwtl_t *bwtl_seq2bwtl(int len, const uint8_t *seq) +{ + bwtl_t *b; + int i; + b = (bwtl_t*)calloc(1, sizeof(bwtl_t)); + b->seq_len = len; + + { // calculate b->bwt + uint8_t *s; + b->sa = (uint32_t*)calloc(len + 1, 4); + is_sa(seq, (int*)b->sa, len); + s = (uint8_t*)calloc(len + 1, 1); + for (i = 0; i <= len; ++i) { + if (b->sa[i] == 0) b->primary = i; + else s[i] = seq[b->sa[i] - 1]; + } + for (i = b->primary; i < len; ++i) s[i] = s[i + 1]; + b->bwt_size = (len + 15) / 16; + b->bwt = (uint32_t*)calloc(b->bwt_size, 4); + for (i = 0; i < len; ++i) + b->bwt[i>>4] |= s[i] << ((15 - (i&15)) << 1); + free(s); + } + { // calculate b->occ + uint32_t c[4]; + b->n_occ = (len + 15) / 16 * 4; + b->occ = (uint32_t*)calloc(b->n_occ, 4); + memset(c, 0, 16); + for (i = 0; i < len; ++i) { + if (i % 16 == 0) + memcpy(b->occ + (i/16) * 4, c, 16); + ++c[bwtl_B0(b, i)]; + } + memcpy(b->L2+1, c, 16); + for (i = 2; i < 5; ++i) b->L2[i] += b->L2[i-1]; + } + { // generate cnt_table + for (i = 0; i != 256; ++i) { + uint32_t j, x = 0; + for (j = 0; j != 4; ++j) + x |= (((i&3) == j) + ((i>>2&3) == j) + ((i>>4&3) == j) + (i>>6 == j)) << (j<<3); + b->cnt_table[i] = x; + } + } + return b; +} +uint32_t bwtl_occ(const bwtl_t *bwt, uint32_t k, uint8_t c) +{ + uint32_t n, b; + if (k == bwt->seq_len) return bwt->L2[c+1] - bwt->L2[c]; + if (k == (uint32_t)(-1)) return 0; + if (k >= bwt->primary) --k; // because $ is not in bwt + n = bwt->occ[k/16<<2|c]; + b = bwt->bwt[k/16] & ~((1U<<((15-(k&15))<<1)) - 1); + n += (bwt->cnt_table[b&0xff] + bwt->cnt_table[b>>8&0xff] + + bwt->cnt_table[b>>16&0xff] + bwt->cnt_table[b>>24]) >> (c<<3) & 0xff; + if (c == 0) n -= 15 - (k&15); // corrected for the masked bits + return n; +} +void bwtl_occ4(const bwtl_t *bwt, uint32_t k, uint32_t cnt[4]) +{ + uint32_t x, b; + if (k == (uint32_t)(-1)) { + memset(cnt, 0, 16); + return; + } + if (k >= bwt->primary) --k; // because $ is not in bwt + memcpy(cnt, bwt->occ + (k>>4<<2), 16); + b = bwt->bwt[k>>4] & ~((1U<<((~k&15)<<1)) - 1); + x = bwt->cnt_table[b&0xff] + bwt->cnt_table[b>>8&0xff] + + bwt->cnt_table[b>>16&0xff] + bwt->cnt_table[b>>24]; + x -= 15 - (k&15); + cnt[0] += x&0xff; cnt[1] += x>>8&0xff; cnt[2] += x>>16&0xff; cnt[3] += x>>24; +} +void bwtl_2occ4(const bwtl_t *bwt, uint32_t k, uint32_t l, uint32_t cntk[4], uint32_t cntl[4]) +{ + bwtl_occ4(bwt, k, cntk); + bwtl_occ4(bwt, l, cntl); +} +void bwtl_destroy(bwtl_t *bwt) +{ + if (bwt) { + free(bwt->occ); free(bwt->bwt); free(bwt->sa); + free(bwt); + } +} diff --git a/bwt_lite.h b/bwt_lite.h new file mode 100644 index 0000000..4fadcce --- /dev/null +++ b/bwt_lite.h @@ -0,0 +1,29 @@ +#ifndef BWT_LITE_H_ +#define BWT_LITE_H_ + +#include + +typedef struct { + uint32_t seq_len, bwt_size, n_occ; + uint32_t primary; + uint32_t *bwt, *occ, *sa, L2[5]; + uint32_t cnt_table[256]; +} bwtl_t; + +#define bwtl_B0(b, k) ((b)->bwt[(k)>>4]>>((~(k)&0xf)<<1)&3) + +#ifdef __cplusplus +extern "C" { +#endif + + bwtl_t *bwtl_seq2bwtl(int len, const uint8_t *seq); + uint32_t bwtl_occ(const bwtl_t *bwt, uint32_t k, uint8_t c); + void bwtl_occ4(const bwtl_t *bwt, uint32_t k, uint32_t cnt[4]); + void bwtl_2occ4(const bwtl_t *bwt, uint32_t k, uint32_t l, uint32_t cntk[4], uint32_t cntl[4]); + void bwtl_destroy(bwtl_t *bwt); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bwtaln.c b/bwtaln.c new file mode 100644 index 0000000..a3ccc51 --- /dev/null +++ b/bwtaln.c @@ -0,0 +1,321 @@ +#include +#include +#include +#include +#include +#include +#include +#ifdef HAVE_CONFIG_H +#include "config.h" +#endif +#include "bwtaln.h" +#include "bwtgap.h" +#include "utils.h" +#include "bwa.h" + +#ifdef HAVE_PTHREAD +#include +#endif + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +gap_opt_t *gap_init_opt() +{ + gap_opt_t *o; + o = (gap_opt_t*)calloc(1, sizeof(gap_opt_t)); + /* IMPORTANT: s_mm*10 should be about the average base error + rate. Voilating this requirement will break pairing! */ + o->s_mm = 3; o->s_gapo = 11; o->s_gape = 4; + o->max_diff = -1; o->max_gapo = 1; o->max_gape = 6; + o->indel_end_skip = 5; o->max_del_occ = 10; o->max_entries = 2000000; + o->mode = BWA_MODE_GAPE | BWA_MODE_COMPREAD; + o->seed_len = 32; o->max_seed_diff = 2; + o->fnr = 0.04; + o->n_threads = 1; + o->max_top2 = 30; + o->trim_qual = 0; + return o; +} + +int bwa_cal_maxdiff(int l, double err, double thres) +{ + double elambda = exp(-l * err); + double sum, y = 1.0; + int k, x = 1; + for (k = 1, sum = elambda; k < 1000; ++k) { + y *= l * err; + x *= k; + sum += elambda * y / x; + if (1.0 - sum < thres) return k; + } + return 2; +} + +// width must be filled as zero +int bwt_cal_width(const bwt_t *bwt, int len, const ubyte_t *str, bwt_width_t *width) +{ + bwtint_t k, l, ok, ol; + int i, bid; + bid = 0; + k = 0; l = bwt->seq_len; + for (i = 0; i < len; ++i) { + ubyte_t c = str[i]; + if (c < 4) { + bwt_2occ(bwt, k - 1, l, c, &ok, &ol); + k = bwt->L2[c] + ok + 1; + l = bwt->L2[c] + ol; + } + if (k > l || c > 3) { // then restart + k = 0; + l = bwt->seq_len; + ++bid; + } + width[i].w = l - k + 1; + width[i].bid = bid; + } + width[len].w = 0; + width[len].bid = ++bid; + return bid; +} + +void bwa_cal_sa_reg_gap(int tid, bwt_t *const bwt, int n_seqs, bwa_seq_t *seqs, const gap_opt_t *opt) +{ + int i, j, max_l = 0, max_len; + gap_stack_t *stack; + bwt_width_t *w, *seed_w; + gap_opt_t local_opt = *opt; + + // initiate priority stack + for (i = max_len = 0; i != n_seqs; ++i) + if (seqs[i].len > max_len) max_len = seqs[i].len; + if (opt->fnr > 0.0) local_opt.max_diff = bwa_cal_maxdiff(max_len, BWA_AVG_ERR, opt->fnr); + if (local_opt.max_diff < local_opt.max_gapo) local_opt.max_gapo = local_opt.max_diff; + stack = gap_init_stack(local_opt.max_diff, local_opt.max_gapo, local_opt.max_gape, &local_opt); + + seed_w = (bwt_width_t*)calloc(opt->seed_len+1, sizeof(bwt_width_t)); + w = 0; + for (i = 0; i != n_seqs; ++i) { + bwa_seq_t *p = seqs + i; +#ifdef HAVE_PTHREAD + if (i % opt->n_threads != tid) continue; +#endif + p->sa = 0; p->type = BWA_TYPE_NO_MATCH; p->c1 = p->c2 = 0; p->n_aln = 0; p->aln = 0; + if (max_l < p->len) { + max_l = p->len; + w = (bwt_width_t*)realloc(w, (max_l + 1) * sizeof(bwt_width_t)); + memset(w, 0, (max_l + 1) * sizeof(bwt_width_t)); + } + bwt_cal_width(bwt, p->len, p->seq, w); + if (opt->fnr > 0.0) local_opt.max_diff = bwa_cal_maxdiff(p->len, BWA_AVG_ERR, opt->fnr); + local_opt.seed_len = opt->seed_len < p->len? opt->seed_len : 0x7fffffff; + if (p->len > opt->seed_len) + bwt_cal_width(bwt, opt->seed_len, p->seq + (p->len - opt->seed_len), seed_w); + // core function + for (j = 0; j < p->len; ++j) // we need to complement + p->seq[j] = p->seq[j] > 3? 4 : 3 - p->seq[j]; + p->aln = bwt_match_gap(bwt, p->len, p->seq, w, p->len <= opt->seed_len? 0 : seed_w, &local_opt, &p->n_aln, stack); + //fprintf(stderr, "mm=%lld,ins=%lld,del=%lld,gapo=%lld\n", p->aln->n_mm, p->aln->n_ins, p->aln->n_del, p->aln->n_gapo); + // clean up the unused data in the record + free(p->name); free(p->seq); free(p->rseq); free(p->qual); + p->name = 0; p->seq = p->rseq = p->qual = 0; + } + free(seed_w); free(w); + gap_destroy_stack(stack); +} + +#ifdef HAVE_PTHREAD +typedef struct { + int tid; + bwt_t *bwt; + int n_seqs; + bwa_seq_t *seqs; + const gap_opt_t *opt; +} thread_aux_t; + +static void *worker(void *data) +{ + thread_aux_t *d = (thread_aux_t*)data; + bwa_cal_sa_reg_gap(d->tid, d->bwt, d->n_seqs, d->seqs, d->opt); + return 0; +} +#endif + +bwa_seqio_t *bwa_open_reads(int mode, const char *fn_fa) +{ + bwa_seqio_t *ks; + if (mode & BWA_MODE_BAM) { // open BAM + int which = 0; + if (mode & BWA_MODE_BAM_SE) which |= 4; + if (mode & BWA_MODE_BAM_READ1) which |= 1; + if (mode & BWA_MODE_BAM_READ2) which |= 2; + if (which == 0) which = 7; // then read all reads + ks = bwa_bam_open(fn_fa, which); + } else ks = bwa_seq_open(fn_fa); + return ks; +} + +void bwa_aln_core(const char *prefix, const char *fn_fa, const gap_opt_t *opt) +{ + int i, n_seqs; + long long tot_seqs = 0; + bwa_seq_t *seqs; + bwa_seqio_t *ks; + clock_t t; + bwt_t *bwt; + + // initialization + ks = bwa_open_reads(opt->mode, fn_fa); + + { // load BWT + char *str = (char*)calloc(strlen(prefix) + 10, 1); + strcpy(str, prefix); strcat(str, ".bwt"); bwt = bwt_restore_bwt(str); + free(str); + } + + // core loop + err_fwrite(SAI_MAGIC, 1, 4, stdout); + err_fwrite(opt, sizeof(gap_opt_t), 1, stdout); + while ((seqs = bwa_read_seq(ks, 0x40000, &n_seqs, opt->mode, opt->trim_qual)) != 0) { + tot_seqs += n_seqs; + t = clock(); + + fprintf(stderr, "[bwa_aln_core] calculate SA coordinate... "); + +#ifdef HAVE_PTHREAD + if (opt->n_threads <= 1) { // no multi-threading at all + bwa_cal_sa_reg_gap(0, bwt, n_seqs, seqs, opt); + } else { + pthread_t *tid; + pthread_attr_t attr; + thread_aux_t *data; + int j; + pthread_attr_init(&attr); + pthread_attr_setdetachstate(&attr, PTHREAD_CREATE_JOINABLE); + data = (thread_aux_t*)calloc(opt->n_threads, sizeof(thread_aux_t)); + tid = (pthread_t*)calloc(opt->n_threads, sizeof(pthread_t)); + for (j = 0; j < opt->n_threads; ++j) { + data[j].tid = j; data[j].bwt = bwt; + data[j].n_seqs = n_seqs; data[j].seqs = seqs; data[j].opt = opt; + pthread_create(&tid[j], &attr, worker, data + j); + } + for (j = 0; j < opt->n_threads; ++j) pthread_join(tid[j], 0); + free(data); free(tid); + } +#else + bwa_cal_sa_reg_gap(0, bwt, n_seqs, seqs, opt); +#endif + + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + + t = clock(); + fprintf(stderr, "[bwa_aln_core] write to the disk... "); + for (i = 0; i < n_seqs; ++i) { + bwa_seq_t *p = seqs + i; + err_fwrite(&p->n_aln, 4, 1, stdout); + if (p->n_aln) err_fwrite(p->aln, sizeof(bwt_aln1_t), p->n_aln, stdout); + } + fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + + bwa_free_read_seq(n_seqs, seqs); + fprintf(stderr, "[bwa_aln_core] %lld sequences have been processed.\n", tot_seqs); + } + + // destroy + bwt_destroy(bwt); + bwa_seq_close(ks); +} + +int bwa_aln(int argc, char *argv[]) +{ + int c, opte = -1; + gap_opt_t *opt; + char *prefix; + + opt = gap_init_opt(); + while ((c = getopt(argc, argv, "n:o:e:i:d:l:k:LR:m:t:NM:O:E:q:f:b012IYB:")) >= 0) { + switch (c) { + case 'n': + if (strstr(optarg, ".")) opt->fnr = atof(optarg), opt->max_diff = -1; + else opt->max_diff = atoi(optarg), opt->fnr = -1.0; + break; + case 'o': opt->max_gapo = atoi(optarg); break; + case 'e': opte = atoi(optarg); break; + case 'M': opt->s_mm = atoi(optarg); break; + case 'O': opt->s_gapo = atoi(optarg); break; + case 'E': opt->s_gape = atoi(optarg); break; + case 'd': opt->max_del_occ = atoi(optarg); break; + case 'i': opt->indel_end_skip = atoi(optarg); break; + case 'l': opt->seed_len = atoi(optarg); break; + case 'k': opt->max_seed_diff = atoi(optarg); break; + case 'm': opt->max_entries = atoi(optarg); break; + case 't': opt->n_threads = atoi(optarg); break; + case 'L': opt->mode |= BWA_MODE_LOGGAP; break; + case 'R': opt->max_top2 = atoi(optarg); break; + case 'q': opt->trim_qual = atoi(optarg); break; + case 'N': opt->mode |= BWA_MODE_NONSTOP; opt->max_top2 = 0x7fffffff; break; + case 'f': xreopen(optarg, "wb", stdout); break; + case 'b': opt->mode |= BWA_MODE_BAM; break; + case '0': opt->mode |= BWA_MODE_BAM_SE; break; + case '1': opt->mode |= BWA_MODE_BAM_READ1; break; + case '2': opt->mode |= BWA_MODE_BAM_READ2; break; + case 'I': opt->mode |= BWA_MODE_IL13; break; + case 'Y': opt->mode |= BWA_MODE_CFY; break; + case 'B': opt->mode |= atoi(optarg) << 24; break; + default: return 1; + } + } + if (opte > 0) { + opt->max_gape = opte; + opt->mode &= ~BWA_MODE_GAPE; + } + + if (optind + 2 > argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa aln [options] \n\n"); + fprintf(stderr, "Options: -n NUM max #diff (int) or missing prob under %.2f err rate (float) [%.2f]\n", + BWA_AVG_ERR, opt->fnr); + fprintf(stderr, " -o INT maximum number or fraction of gap opens [%d]\n", opt->max_gapo); + fprintf(stderr, " -e INT maximum number of gap extensions, -1 for disabling long gaps [-1]\n"); + fprintf(stderr, " -i INT do not put an indel within INT bp towards the ends [%d]\n", opt->indel_end_skip); + fprintf(stderr, " -d INT maximum occurrences for extending a long deletion [%d]\n", opt->max_del_occ); + fprintf(stderr, " -l INT seed length [%d]\n", opt->seed_len); + fprintf(stderr, " -k INT maximum differences in the seed [%d]\n", opt->max_seed_diff); + fprintf(stderr, " -m INT maximum entries in the queue [%d]\n", opt->max_entries); + fprintf(stderr, " -t INT number of threads [%d]\n", opt->n_threads); + fprintf(stderr, " -M INT mismatch penalty [%d]\n", opt->s_mm); + fprintf(stderr, " -O INT gap open penalty [%d]\n", opt->s_gapo); + fprintf(stderr, " -E INT gap extension penalty [%d]\n", opt->s_gape); + fprintf(stderr, " -R INT stop searching when there are >INT equally best hits [%d]\n", opt->max_top2); + fprintf(stderr, " -q INT quality threshold for read trimming down to %dbp [%d]\n", BWA_MIN_RDLEN, opt->trim_qual); + fprintf(stderr, " -f FILE file to write output to instead of stdout\n"); + fprintf(stderr, " -B INT length of barcode\n"); + fprintf(stderr, " -L log-scaled gap penalty for long deletions\n"); + fprintf(stderr, " -N non-iterative mode: search for all n-difference hits (slooow)\n"); + fprintf(stderr, " -I the input is in the Illumina 1.3+ FASTQ-like format\n"); + fprintf(stderr, " -b the input read file is in the BAM format\n"); + fprintf(stderr, " -0 use single-end reads only (effective with -b)\n"); + fprintf(stderr, " -1 use the 1st read in a pair (effective with -b)\n"); + fprintf(stderr, " -2 use the 2nd read in a pair (effective with -b)\n"); + fprintf(stderr, " -Y filter Casava-filtered sequences\n"); + fprintf(stderr, "\n"); + return 1; + } + if (opt->fnr > 0.0) { + int i, k; + for (i = 17, k = 0; i <= 250; ++i) { + int l = bwa_cal_maxdiff(i, BWA_AVG_ERR, opt->fnr); + if (l != k) fprintf(stderr, "[bwa_aln] %dbp reads: max_diff = %d\n", i, l); + k = l; + } + } + if ((prefix = bwa_idx_infer_prefix(argv[optind])) == 0) { + fprintf(stderr, "[%s] fail to locate the index\n", __func__); + free(opt); + return 1; + } + bwa_aln_core(prefix, argv[optind+1], opt); + free(opt); free(prefix); + return 0; +} diff --git a/bwtaln.h b/bwtaln.h new file mode 100644 index 0000000..4616ff5 --- /dev/null +++ b/bwtaln.h @@ -0,0 +1,153 @@ +#ifndef BWTALN_H +#define BWTALN_H + +#include +#include "bwt.h" + +#define BWA_TYPE_NO_MATCH 0 +#define BWA_TYPE_UNIQUE 1 +#define BWA_TYPE_REPEAT 2 +#define BWA_TYPE_MATESW 3 + +#define SAM_FPD 1 // paired +#define SAM_FPP 2 // properly paired +#define SAM_FSU 4 // self-unmapped +#define SAM_FMU 8 // mate-unmapped +#define SAM_FSR 16 // self on the reverse strand +#define SAM_FMR 32 // mate on the reverse strand +#define SAM_FR1 64 // this is read one +#define SAM_FR2 128 // this is read two +#define SAM_FSC 256 // secondary alignment + +#define BWA_AVG_ERR 0.02 +#define BWA_MIN_RDLEN 35 // for read trimming + +#define BWA_MAX_BCLEN 63 // maximum barcode length; 127 is the maximum + +#ifndef bns_pac +#define bns_pac(pac, k) ((pac)[(k)>>2] >> ((~(k)&3)<<1) & 3) +#endif + +#define FROM_M 0 +#define FROM_I 1 +#define FROM_D 2 +#define FROM_S 3 + +#define SAI_MAGIC "SAI\1" + +typedef struct { + bwtint_t w; + int bid; +} bwt_width_t; + +typedef struct { + uint64_t n_mm:8, n_gapo:8, n_gape:8, score:20, n_ins:10, n_del:10; + bwtint_t k, l; +} bwt_aln1_t; + +typedef uint16_t bwa_cigar_t; +/* rgoya: If changing order of bytes, beware of operations like: + * s->cigar[0] += s->full_len - s->len; + */ +#define CIGAR_OP_SHIFT 14 +#define CIGAR_LN_MASK 0x3fff + +#define __cigar_op(__cigar) ((__cigar)>>CIGAR_OP_SHIFT) +#define __cigar_len(__cigar) ((__cigar)&CIGAR_LN_MASK) +#define __cigar_create(__op, __len) ((__op)< +#include +#include +#include "bwtgap.h" +#include "bwtaln.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#define STATE_M 0 +#define STATE_I 1 +#define STATE_D 2 + +#define aln_score(m,o,e,p) ((m)*(p)->s_mm + (o)*(p)->s_gapo + (e)*(p)->s_gape) + +gap_stack_t *gap_init_stack2(int max_score) +{ + gap_stack_t *stack; + stack = (gap_stack_t*)calloc(1, sizeof(gap_stack_t)); + stack->n_stacks = max_score; + stack->stacks = (gap_stack1_t*)calloc(stack->n_stacks, sizeof(gap_stack1_t)); + return stack; +} + +gap_stack_t *gap_init_stack(int max_mm, int max_gapo, int max_gape, const gap_opt_t *opt) +{ + return gap_init_stack2(aln_score(max_mm+1, max_gapo+1, max_gape+1, opt)); +} + +void gap_destroy_stack(gap_stack_t *stack) +{ + int i; + for (i = 0; i != stack->n_stacks; ++i) free(stack->stacks[i].stack); + free(stack->stacks); + free(stack); +} + +static void gap_reset_stack(gap_stack_t *stack) +{ + int i; + for (i = 0; i != stack->n_stacks; ++i) + stack->stacks[i].n_entries = 0; + stack->best = stack->n_stacks; + stack->n_entries = 0; +} + +static inline void gap_push(gap_stack_t *stack, int i, bwtint_t k, bwtint_t l, int n_mm, int n_gapo, int n_gape, int n_ins, int n_del, + int state, int is_diff, const gap_opt_t *opt) +{ + int score; + gap_entry_t *p; + gap_stack1_t *q; + score = aln_score(n_mm, n_gapo, n_gape, opt); + q = stack->stacks + score; + if (q->n_entries == q->m_entries) { + q->m_entries = q->m_entries? q->m_entries<<1 : 4; + q->stack = (gap_entry_t*)realloc(q->stack, sizeof(gap_entry_t) * q->m_entries); + } + p = q->stack + q->n_entries; + p->info = (uint32_t)score<<21 | i; p->k = k; p->l = l; + p->n_mm = n_mm; p->n_gapo = n_gapo; p->n_gape = n_gape; + p->n_ins = n_ins; p->n_del = n_del; + p->state = state; + p->last_diff_pos = is_diff? i : 0; + ++(q->n_entries); + ++(stack->n_entries); + if (stack->best > score) stack->best = score; +} + +static inline void gap_pop(gap_stack_t *stack, gap_entry_t *e) +{ + gap_stack1_t *q; + q = stack->stacks + stack->best; + *e = q->stack[q->n_entries - 1]; + --(q->n_entries); + --(stack->n_entries); + if (q->n_entries == 0 && stack->n_entries) { // reset best + int i; + for (i = stack->best + 1; i < stack->n_stacks; ++i) + if (stack->stacks[i].n_entries != 0) break; + stack->best = i; + } else if (stack->n_entries == 0) stack->best = stack->n_stacks; +} + +static inline void gap_shadow(int x, int len, bwtint_t max, int last_diff_pos, bwt_width_t *w) +{ + int i, j; + for (i = j = 0; i < last_diff_pos; ++i) { + if (w[i].w > x) w[i].w -= x; + else if (w[i].w == x) { + w[i].bid = 1; + w[i].w = max - (++j); + } // else should not happen + } +} + +static inline int int_log2(uint32_t v) +{ + int c = 0; + if (v & 0xffff0000u) { v >>= 16; c |= 16; } + if (v & 0xff00) { v >>= 8; c |= 8; } + if (v & 0xf0) { v >>= 4; c |= 4; } + if (v & 0xc) { v >>= 2; c |= 2; } + if (v & 0x2) c |= 1; + return c; +} + +bwt_aln1_t *bwt_match_gap(bwt_t *const bwt, int len, const ubyte_t *seq, bwt_width_t *width, + bwt_width_t *seed_width, const gap_opt_t *opt, int *_n_aln, gap_stack_t *stack) +{ // $seq is the reverse complement of the input read + int best_score = aln_score(opt->max_diff+1, opt->max_gapo+1, opt->max_gape+1, opt); + int best_diff = opt->max_diff + 1, max_diff = opt->max_diff; + int best_cnt = 0; + int max_entries = 0, j, _j, n_aln, m_aln; + bwt_aln1_t *aln; + + m_aln = 4; n_aln = 0; + aln = (bwt_aln1_t*)calloc(m_aln, sizeof(bwt_aln1_t)); + + // check whether there are too many N + for (j = _j = 0; j < len; ++j) + if (seq[j] > 3) ++_j; + if (_j > max_diff) { + *_n_aln = n_aln; + return aln; + } + + //for (j = 0; j != len; ++j) printf("#0 %d: [%d,%u]\t[%d,%u]\n", j, w[0][j].bid, w[0][j].w, w[1][j].bid, w[1][j].w); + gap_reset_stack(stack); // reset stack + gap_push(stack, len, 0, bwt->seq_len, 0, 0, 0, 0, 0, 0, 0, opt); + + while (stack->n_entries) { + gap_entry_t e; + int i, m, m_seed = 0, hit_found, allow_diff, allow_M, tmp; + bwtint_t k, l, cnt_k[4], cnt_l[4], occ; + + if (max_entries < stack->n_entries) max_entries = stack->n_entries; + if (stack->n_entries > opt->max_entries) break; + gap_pop(stack, &e); // get the best entry + k = e.k; l = e.l; // SA interval + i = e.info&0xffff; // length + if (!(opt->mode & BWA_MODE_NONSTOP) && e.info>>21 > best_score + opt->s_mm) break; // no need to proceed + + m = max_diff - (e.n_mm + e.n_gapo); + if (opt->mode & BWA_MODE_GAPE) m -= e.n_gape; + if (m < 0) continue; + if (seed_width) { // apply seeding + m_seed = opt->max_seed_diff - (e.n_mm + e.n_gapo); + if (opt->mode & BWA_MODE_GAPE) m_seed -= e.n_gape; + } + //printf("#1\t[%d,%d,%d,%c]\t[%d,%d,%d]\t[%u,%u]\t[%u,%u]\t%d\n", stack->n_entries, a, i, "MID"[e.state], e.n_mm, e.n_gapo, e.n_gape, width[i-1].bid, width[i-1].w, k, l, e.last_diff_pos); + if (i > 0 && m < width[i-1].bid) continue; + + // check whether a hit is found + hit_found = 0; + if (i == 0) hit_found = 1; + else if (m == 0 && (e.state == STATE_M || (opt->mode&BWA_MODE_GAPE) || e.n_gape == opt->max_gape)) { // no diff allowed + if (bwt_match_exact_alt(bwt, i, seq, &k, &l)) hit_found = 1; + else continue; // no hit, skip + } + + if (hit_found) { // action for found hits + int score = aln_score(e.n_mm, e.n_gapo, e.n_gape, opt); + int do_add = 1; + //printf("#2 hits found: %d:(%u,%u)\n", e.n_mm+e.n_gapo, k, l); + if (n_aln == 0) { + best_score = score; + best_diff = e.n_mm + e.n_gapo; + if (opt->mode & BWA_MODE_GAPE) best_diff += e.n_gape; + if (!(opt->mode & BWA_MODE_NONSTOP)) + max_diff = (best_diff + 1 > opt->max_diff)? opt->max_diff : best_diff + 1; // top2 behaviour + } + if (score == best_score) best_cnt += l - k + 1; + else if (best_cnt > opt->max_top2) break; // top2b behaviour + if (e.n_gapo) { // check whether the hit has been found. this may happen when a gap occurs in a tandem repeat + for (j = 0; j != n_aln; ++j) + if (aln[j].k == k && aln[j].l == l) break; + if (j < n_aln) do_add = 0; + } + if (do_add) { // append + bwt_aln1_t *p; + gap_shadow(l - k + 1, len, bwt->seq_len, e.last_diff_pos, width); + if (n_aln == m_aln) { + m_aln <<= 1; + aln = (bwt_aln1_t*)realloc(aln, m_aln * sizeof(bwt_aln1_t)); + memset(aln + m_aln/2, 0, m_aln/2*sizeof(bwt_aln1_t)); + } + p = aln + n_aln; + p->n_mm = e.n_mm; p->n_gapo = e.n_gapo; p->n_gape = e.n_gape; + p->n_ins = e.n_ins; p->n_del = e.n_del; + p->k = k; p->l = l; + p->score = score; + //fprintf(stderr, "*** n_mm=%d,n_gapo=%d,n_gape=%d,n_ins=%d,n_del=%d\n", e.n_mm, e.n_gapo, e.n_gape, e.n_ins, e.n_del); + ++n_aln; + } + continue; + } + + --i; + bwt_2occ4(bwt, k - 1, l, cnt_k, cnt_l); // retrieve Occ values + occ = l - k + 1; + // test whether diff is allowed + allow_diff = allow_M = 1; + if (i > 0) { + int ii = i - (len - opt->seed_len); + if (width[i-1].bid > m-1) allow_diff = 0; + else if (width[i-1].bid == m-1 && width[i].bid == m-1 && width[i-1].w == width[i].w) allow_M = 0; + if (seed_width && ii > 0) { + if (seed_width[ii-1].bid > m_seed-1) allow_diff = 0; + else if (seed_width[ii-1].bid == m_seed-1 && seed_width[ii].bid == m_seed-1 + && seed_width[ii-1].w == seed_width[ii].w) allow_M = 0; + } + } + // indels + tmp = (opt->mode & BWA_MODE_LOGGAP)? int_log2(e.n_gape + e.n_gapo)/2+1 : e.n_gapo + e.n_gape; + if (allow_diff && i >= opt->indel_end_skip + tmp && len - i >= opt->indel_end_skip + tmp) { + if (e.state == STATE_M) { // gap open + if (e.n_gapo < opt->max_gapo) { // gap open is allowed + // insertion + gap_push(stack, i, k, l, e.n_mm, e.n_gapo + 1, e.n_gape, e.n_ins + 1, e.n_del, STATE_I, 1, opt); + // deletion + for (j = 0; j != 4; ++j) { + k = bwt->L2[j] + cnt_k[j] + 1; + l = bwt->L2[j] + cnt_l[j]; + if (k <= l) gap_push(stack, i + 1, k, l, e.n_mm, e.n_gapo + 1, e.n_gape, e.n_ins, e.n_del + 1, STATE_D, 1, opt); + } + } + } else if (e.state == STATE_I) { // extention of an insertion + if (e.n_gape < opt->max_gape) // gap extention is allowed + gap_push(stack, i, k, l, e.n_mm, e.n_gapo, e.n_gape + 1, e.n_ins + 1, e.n_del, STATE_I, 1, opt); + } else if (e.state == STATE_D) { // extention of a deletion + if (e.n_gape < opt->max_gape) { // gap extention is allowed + if (e.n_gape + e.n_gapo < max_diff || occ < opt->max_del_occ) { + for (j = 0; j != 4; ++j) { + k = bwt->L2[j] + cnt_k[j] + 1; + l = bwt->L2[j] + cnt_l[j]; + if (k <= l) gap_push(stack, i + 1, k, l, e.n_mm, e.n_gapo, e.n_gape + 1, e.n_ins, e.n_del + 1, STATE_D, 1, opt); + } + } + } + } + } + // mismatches + if (allow_diff && allow_M) { // mismatch is allowed + for (j = 1; j <= 4; ++j) { + int c = (seq[i] + j) & 3; + int is_mm = (j != 4 || seq[i] > 3); + k = bwt->L2[c] + cnt_k[c] + 1; + l = bwt->L2[c] + cnt_l[c]; + if (k <= l) gap_push(stack, i, k, l, e.n_mm + is_mm, e.n_gapo, e.n_gape, e.n_ins, e.n_del, STATE_M, is_mm, opt); + } + } else if (seq[i] < 4) { // try exact match only + int c = seq[i] & 3; + k = bwt->L2[c] + cnt_k[c] + 1; + l = bwt->L2[c] + cnt_l[c]; + if (k <= l) gap_push(stack, i, k, l, e.n_mm, e.n_gapo, e.n_gape, e.n_ins, e.n_del, STATE_M, 0, opt); + } + } + + *_n_aln = n_aln; + //fprintf(stderr, "max_entries = %d\n", max_entries); + return aln; +} diff --git a/bwtgap.h b/bwtgap.h new file mode 100644 index 0000000..9085b62 --- /dev/null +++ b/bwtgap.h @@ -0,0 +1,40 @@ +#ifndef BWTGAP_H_ +#define BWTGAP_H_ + +#include "bwt.h" +#include "bwtaln.h" + +typedef struct { // recursion stack + uint32_t info; // score<<21 | i + uint32_t n_mm:8, n_gapo:8, n_gape:8, state:2, n_seed_mm:6; + uint32_t n_ins:16, n_del:16; + int last_diff_pos; + bwtint_t k, l; // (k,l) is the SA region of [i,n-1] +} gap_entry_t; + +typedef struct { + int n_entries, m_entries; + gap_entry_t *stack; +} gap_stack1_t; + +typedef struct { + int n_stacks, best, n_entries; + gap_stack1_t *stacks; +} gap_stack_t; + +#ifdef __cplusplus +extern "C" { +#endif + + gap_stack_t *gap_init_stack2(int max_score); + gap_stack_t *gap_init_stack(int max_mm, int max_gapo, int max_gape, const gap_opt_t *opt); + void gap_destroy_stack(gap_stack_t *stack); + bwt_aln1_t *bwt_match_gap(bwt_t *const bwt, int len, const ubyte_t *seq, bwt_width_t *w, + bwt_width_t *seed_w, const gap_opt_t *opt, int *_n_aln, gap_stack_t *stack); + void bwa_aln2seq(int n_aln, const bwt_aln1_t *aln, bwa_seq_t *s); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bwtindex.c b/bwtindex.c new file mode 100644 index 0000000..308b7b7 --- /dev/null +++ b/bwtindex.c @@ -0,0 +1,453 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include +#include +#include +#include +#include "bntseq.h" +#include "bwa.h" +#include "bwt.h" +#include "utils.h" +#include "rle.h" +#include "rope.h" + +#ifdef _DIVBWT +#include "divsufsort.h" +#endif + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + + +int is_bwt(ubyte_t *T, int n); + +int64_t bwa_seq_len(const char *fn_pac) +{ + FILE *fp; + int64_t pac_len; + ubyte_t c; + fp = xopen(fn_pac, "rb"); + err_fseek(fp, -1, SEEK_END); + pac_len = err_ftell(fp); + err_fread_noeof(&c, 1, 1, fp); + err_fclose(fp); + return (pac_len - 1) * 4 + (int)c; +} + +bwt_t *bwt_pac2bwt(const char *fn_pac, int use_is) +{ + bwt_t *bwt; + ubyte_t *buf, *buf2; + int64_t i, pac_size; + FILE *fp; + + // initialization + bwt = (bwt_t*)calloc(1, sizeof(bwt_t)); + bwt->seq_len = bwa_seq_len(fn_pac); + bwt->bwt_size = (bwt->seq_len + 15) >> 4; + fp = xopen(fn_pac, "rb"); + + // prepare sequence + pac_size = (bwt->seq_len>>2) + ((bwt->seq_len&3) == 0? 0 : 1); + buf2 = (ubyte_t*)calloc(pac_size, 1); + err_fread_noeof(buf2, 1, pac_size, fp); + err_fclose(fp); + memset(bwt->L2, 0, 5 * 4); + buf = (ubyte_t*)calloc(bwt->seq_len + 1, 1); + for (i = 0; i < bwt->seq_len; ++i) { + buf[i] = buf2[i>>2] >> ((3 - (i&3)) << 1) & 3; + ++bwt->L2[1+buf[i]]; + } + for (i = 2; i <= 4; ++i) bwt->L2[i] += bwt->L2[i-1]; + free(buf2); + + // Burrows-Wheeler Transform + if (use_is) { + bwt->primary = is_bwt(buf, bwt->seq_len); + } else { + rope_t *r; + int64_t x; + rpitr_t itr; + const uint8_t *blk; + + r = rope_init(ROPE_DEF_MAX_NODES, ROPE_DEF_BLOCK_LEN); + for (i = bwt->seq_len - 1, x = 0; i >= 0; --i) { + int c = buf[i] + 1; + x = rope_insert_run(r, x, c, 1, 0) + 1; + while (--c >= 0) x += r->c[c]; + } + bwt->primary = x; + rope_itr_first(r, &itr); + x = 0; + while ((blk = rope_itr_next_block(&itr)) != 0) { + const uint8_t *q = blk + 2, *end = blk + 2 + *rle_nptr(blk); + while (q < end) { + int c = 0; + int64_t l; + rle_dec1(q, c, l); + for (i = 0; i < l; ++i) + buf[x++] = c - 1; + } + } + rope_destroy(r); + } + bwt->bwt = (uint32_t*)calloc(bwt->bwt_size, 4); + for (i = 0; i < bwt->seq_len; ++i) + bwt->bwt[i>>4] |= buf[i] << ((15 - (i&15)) << 1); + free(buf); + return bwt; +} + +int bwa_pac2bwt(int argc, char *argv[]) // the "pac2bwt" command; IMPORTANT: bwt generated at this step CANNOT be used with BWA. bwtupdate is required! +{ + bwt_t *bwt; + int c, use_is = 1; + while ((c = getopt(argc, argv, "d")) >= 0) { + switch (c) { + case 'd': use_is = 0; break; + default: return 1; + } + } + if (optind + 2 > argc) { + fprintf(stderr, "Usage: fastbwa pac2bwt [-d] \n"); + return 1; + } + bwt = bwt_pac2bwt(argv[optind], use_is); + bwt_dump_bwt(argv[optind+1], bwt); + bwt_destroy(bwt); + return 0; +} + +int bwa_pac2bref(int argc, char *argv[]) +{ + FILE *fp_pac, *fp_bref; + uint64_t pac_size, pac_len, seq_len, bref_size; + int64_t i; + uint8_t *pac_buf, *bref_buf; + uint8_t c; + char pac_file_name[PATH_MAX]; + char binary_ref_name[PATH_MAX]; + if (optind + 1 > argc) + { + fprintf(stderr, "Usage: fastbwa pac2ref \n"); + return 1; + } + sprintf(pac_file_name, "%s.pac", argv[optind]); + sprintf(binary_ref_name, "%s.ert.0123", argv[optind]); + + fp_pac = xopen(pac_file_name, "rb"); + err_fseek(fp_pac, -1, SEEK_END); + pac_len = err_ftell(fp_pac); + err_fread_noeof(&c, 1, 1, fp_pac); + seq_len = (pac_len - 1) * 4 + (int)c; + + err_fseek(fp_pac, 0, SEEK_SET); + pac_size = (seq_len >> 2) + ((seq_len & 3) == 0 ? 0 : 1); + pac_buf = (uint8_t *)calloc(pac_size, 1); + err_fread_noeof(pac_buf, 1, pac_size, fp_pac); + err_fclose(fp_pac); + + bref_size = seq_len * 2; + bref_buf = (uint8_t *)malloc(bref_size); + for (i = 0; i < seq_len; ++i) { + int nt = pac_buf[i >> 2] >> ((3 - (i & 3)) << 1) & 3; + bref_buf[i] = nt; + } + + for (i = seq_len - 1; i >= 0; --i) { + int64_t j = bref_size - i - 1; + bref_buf[j] = 3 - bref_buf[i]; + } + + fp_bref = xopen(binary_ref_name, "wb"); + err_fwrite(bref_buf, sizeof(uint8_t), bref_size, fp_bref); + + free(bref_buf); + free(pac_buf); + err_fclose(fp_bref); + + return 0; +} + +#define bwt_B00(b, k) ((b)->bwt[(k)>>4]>>((~(k)&0xf)<<1)&3) + +void bwt_bwtupdate_core(bwt_t *bwt) +{ + bwtint_t i, k, c[4], n_occ; + uint32_t *buf; + + n_occ = (bwt->seq_len + OCC_INTERVAL - 1) / OCC_INTERVAL + 1; + bwt->bwt_size += n_occ * sizeof(bwtint_t); // the new size + buf = (uint32_t*)calloc(bwt->bwt_size, 4); // will be the new bwt + c[0] = c[1] = c[2] = c[3] = 0; + for (i = k = 0; i < bwt->seq_len; ++i) { + if (i % OCC_INTERVAL == 0) { + memcpy(buf + k, c, sizeof(bwtint_t) * 4); + k += sizeof(bwtint_t); // in fact: sizeof(bwtint_t)=4*(sizeof(bwtint_t)/4) + } + if (i % 16 == 0) buf[k++] = bwt->bwt[i/16]; // 16 == sizeof(uint32_t)/2 + ++c[bwt_B00(bwt, i)]; + } + // the last element + memcpy(buf + k, c, sizeof(bwtint_t) * 4); + xassert(k + sizeof(bwtint_t) == bwt->bwt_size, "inconsistent bwt_size"); + // update bwt + free(bwt->bwt); bwt->bwt = buf; +} + +int bwa_bwtupdate(int argc, char *argv[]) // the "bwtupdate" command +{ + bwt_t *bwt; + if (argc != 2) { + fprintf(stderr, "Usage: fastbwa bwtupdate \n"); + return 1; + } + bwt = bwt_restore_bwt(argv[1]); + bwt_bwtupdate_core(bwt); + bwt_dump_bwt(argv[1], bwt); + bwt_destroy(bwt); + return 0; +} + +int bwa_bwt2sa(int argc, char *argv[]) // the "bwt2sa" command +{ + bwt_t *bwt; + int c, sa_intv = 32; + while ((c = getopt(argc, argv, "i:")) >= 0) { + switch (c) { + case 'i': sa_intv = atoi(optarg); break; + default: return 1; + } + } + if (optind + 2 > argc) { + fprintf(stderr, "Usage: fastbwa bwt2sa [-i %d] \n", sa_intv); + return 1; + } + bwt = bwt_restore_bwt(argv[optind]); + bwt_cal_sa(bwt, sa_intv); + bwt_dump_sa(argv[optind+1], bwt); + bwt_destroy(bwt); + return 0; +} + +int bwa_bwt2bytesa(int argc, char *argv[]) // the "bwt2bytesa" command +{ + bwt_t *bwt; + int c, sa_intv = 32; + while ((c = getopt(argc, argv, "i:")) >= 0) { + switch (c) { + case 'i': sa_intv = atoi(optarg); break; + default: return 1; + } + } + if (optind + 2 > argc) { + fprintf(stderr, "Usage: fastbwa bwt2bytesa [-i %d] \n", sa_intv); + return 1; + } + bwt = bwt_restore_bwt(argv[optind]); + bwt_cal_byte_sa(bwt, sa_intv); + bwt_dump_byte_sa(argv[optind+1], bwt); + bwt_destroy(bwt); + return 0; +} + +int bwa_bwt2fmt(int argc, char *argv[]) // create fmt index +{ + bwt_t *bwt; + //char buf[1024]; + if (optind + 1 > argc) { + fprintf(stderr, "Usage: fastbwa bwt2fmt \n"); + return 1; + } + bwt = bwt_restore_bwt(argv[optind]); + FMTIndex *fmt; + fmt = create_fmt_from_bwt(bwt); + dump_fmt(argv[optind + 1], fmt); + // sprintf(buf, "%s.kmer", argv[optind + 1]); + return 0; +} + +int bwa_build_kmer(int argc, char *argv[]) +{ + char buf[1024]; + if (optind + 1 > argc) + { + fprintf(stderr, "Usage: fastbwa build_kmerhash \n"); + return 1; + } + FMTIndex *fmt = fmt_restore_fmt(argv[optind]); + fmt_create_kmer_index(fmt); + sprintf(buf, "%s", argv[optind + 1]); + fmt_dump_kmer_idx(buf, &fmt->kmer_hash); + return 0; +} + +int bwa_index(int argc, char *argv[]) // the "index" command +{ + int num_threads = 1; + int c, algo_type = BWTALGO_AUTO, is_64 = 0, block_size = 10000000; + char *prefix = 0, *str; + while ((c = getopt(argc, argv, "6a:p:b:")) >= 0) { + switch (c) { + case 'a': // if -a is not set, algo_type will be determined later + if (strcmp(optarg, "rb2") == 0) algo_type = BWTALGO_RB2; + else if (strcmp(optarg, "bwtsw") == 0) algo_type = BWTALGO_BWTSW; + else if (strcmp(optarg, "is") == 0) algo_type = BWTALGO_IS; + else err_fatal(__func__, "unknown algorithm: '%s'.", optarg); + break; + case 'p': prefix = strdup(optarg); break; + case '6': is_64 = 1; break; + case 't': + num_threads = atoi(optarg); + assert(num_threads > 0 && num_threads < 256); + break; + case 'b': + block_size = strtol(optarg, &str, 10); + if (*str == 'G' || *str == 'g') block_size *= 1024 * 1024 * 1024; + else if (*str == 'M' || *str == 'm') block_size *= 1024 * 1024; + else if (*str == 'K' || *str == 'k') block_size *= 1024; + break; + default: return 1; + } + } + + if (optind + 1 > argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa index [options] \n\n"); + fprintf(stderr, "Options: -a STR BWT construction algorithm: bwtsw, is or rb2 [auto]\n"); + fprintf(stderr, " -p STR prefix of the index [same as fasta name]\n"); + fprintf(stderr, " -t INT number of threads for ERT index building [%d]\n", num_threads); + fprintf(stderr, " -b INT block size for the bwtsw algorithm (effective with -a bwtsw) [%d]\n", block_size); + fprintf(stderr, " -6 index files named as .64.* instead of .* \n"); + fprintf(stderr, "\n"); + fprintf(stderr, "Warning: `-a bwtsw' does not work for short genomes, while `-a is' and\n"); + fprintf(stderr, " `-a div' do not work not for long genomes.\n\n"); + return 1; + } + if (prefix == 0) { + prefix = malloc(strlen(argv[optind]) + 4); + strcpy(prefix, argv[optind]); + if (is_64) strcat(prefix, ".64"); + } + bwa_idx_build(argv[optind], prefix, algo_type, block_size); + free(prefix); + return 0; +} + +int bwa_idx_build(const char *fa, const char *prefix, int algo_type, int block_size) +{ + extern void bwa_pac_rev_core(const char *fn, const char *fn_rev); + + char *str, *str2, *str3; + clock_t t; + int64_t l_pac; + + str = (char*)calloc(strlen(prefix) + 10, 1); + str2 = (char*)calloc(strlen(prefix) + 10, 1); + str3 = (char*)calloc(strlen(prefix) + 10, 1); + + { // nucleotide indexing + gzFile fp = xzopen(fa, "r"); + t = clock(); + if (bwa_verbose >= 3) fprintf(stderr, "[bwa_index] Pack FASTA... "); + l_pac = bns_fasta2bntseq(fp, prefix, 0); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + err_gzclose(fp); + } + if (algo_type == 0) algo_type = l_pac > 50000000? 2 : 3; // set the algorithm for generating BWT + { + strcpy(str, prefix); strcat(str, ".pac"); + strcpy(str2, prefix); strcat(str2, ".bwt"); + t = clock(); + if (bwa_verbose >= 3) fprintf(stderr, "[bwa_index] Construct BWT for the packed sequence...\n"); + if (algo_type == 2) bwt_bwtgen2(str, str2, block_size); + else if (algo_type == 1 || algo_type == 3) { + bwt_t *bwt; + bwt = bwt_pac2bwt(str, algo_type == 3); + bwt_dump_bwt(str2, bwt); + bwt_destroy(bwt); + } + if (bwa_verbose >= 3) fprintf(stderr, "[bwa_index] %.2f seconds elapse.\n", (float)(clock() - t) / CLOCKS_PER_SEC); + } + { + bwt_t *bwt; + strcpy(str, prefix); strcat(str, ".bwt"); + t = clock(); + if (bwa_verbose >= 3) fprintf(stderr, "[bwa_index] Update BWT... "); + bwt = bwt_restore_bwt(str); + bwt_bwtupdate_core(bwt); + bwt_dump_bwt(str, bwt); + bwt_destroy(bwt); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + } + { + gzFile fp = xzopen(fa, "r"); + t = clock(); + if (bwa_verbose >= 3) fprintf(stderr, "[bwa_index] Pack forward-only FASTA... "); + l_pac = bns_fasta2bntseq(fp, prefix, 1); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + err_gzclose(fp); + } + { + bwt_t *bwt; + strcpy(str, prefix); strcat(str, ".bwt"); + strcpy(str3, prefix); strcat(str3, ".sa"); + t = clock(); + if (bwa_verbose >= 3) fprintf(stderr, "[bwa_index] Construct SA from BWT and Occ... "); + bwt = bwt_restore_bwt(str); + bwt_cal_sa(bwt, 32); + bwt_dump_sa(str3, bwt); +// bwt_destroy(bwt); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + { + // build FMT-Index + t = clock(); + FMTIndex *fmt; + strcpy(str, prefix); strcat(str, ".fmt"); + fmt = create_fmt_from_bwt(bwt); + dump_fmt(str, fmt); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + // create Kmer-Hash + t = clock(); + fmt_create_kmer_index(fmt); + strcpy(str, prefix); strcat(str, ".kmer"); + fmt_dump_kmer_idx(str, &fmt->kmer_hash); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + // create byte sa + t = clock(); + bwt_cal_byte_sa(bwt, 4); + strcpy(str, prefix); strcat(str, ".bytesa"); + bwt_dump_byte_sa(str, bwt); + if (bwa_verbose >= 3) fprintf(stderr, "%.2f sec\n", (float)(clock() - t) / CLOCKS_PER_SEC); + } + } + free(str3); free(str2); free(str); + return 0; +} diff --git a/bwtsw2.h b/bwtsw2.h new file mode 100644 index 0000000..0ec9676 --- /dev/null +++ b/bwtsw2.h @@ -0,0 +1,69 @@ +#ifndef LH3_BWTSW2_H +#define LH3_BWTSW2_H + +#include +#include "bntseq.h" +#include "bwt_lite.h" +#include "bwt.h" + +#define BSW2_FLAG_MATESW 0x100 +#define BSW2_FLAG_TANDEM 0x200 +#define BSW2_FLAG_MOVED 0x400 +#define BSW2_FLAG_RESCUED 0x800 + +typedef struct { + int skip_sw:8, cpy_cmt:8, hard_clip:16; + int a, b, q, r, t, qr, bw, max_ins, max_chain_gap; + int z, is, t_seeds, multi_2nd; + float mask_level, coef; + int n_threads, chunk_size; +} bsw2opt_t; + +typedef struct { + bwtint_t k, l; + uint32_t flag:18, n_seeds:13, is_rev:1; + int len, G, G2; + int beg, end; +} bsw2hit_t; + +typedef struct { + int flag, nn, n_cigar, chr, pos, qual, mchr, mpos, pqual, isize, nm; + uint32_t *cigar; +} bsw2aux_t; + +typedef struct { + int n, max; + bsw2hit_t *hits; + bsw2aux_t *aux; +} bwtsw2_t; + +typedef struct { + void *stack; + int max_l; + uint8_t *aln_mem; +} bsw2global_t; + +typedef struct { + int l, tid; + char *name, *seq, *qual, *sam, *comment; +} bsw2seq1_t; + +#ifdef __cplusplus +extern "C" { +#endif + + bsw2opt_t *bsw2_init_opt(); + bwtsw2_t **bsw2_core(const bntseq_t *bns, const bsw2opt_t *opt, const bwtl_t *target, const bwt_t *query, bsw2global_t *pool); + void bsw2_aln(const bsw2opt_t *opt, const bntseq_t *bns, bwt_t * const target, const char *fn, const char *fn2); + void bsw2_destroy(bwtsw2_t *b); + + bsw2global_t *bsw2_global_init(); + void bsw2_global_destroy(bsw2global_t *_pool); + + void bsw2_pair(const bsw2opt_t *opt, int64_t l_pac, const uint8_t *pac, int n, bsw2seq1_t *seq, bwtsw2_t **hit); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/bwtsw2_aux.c b/bwtsw2_aux.c new file mode 100644 index 0000000..5a996d4 --- /dev/null +++ b/bwtsw2_aux.c @@ -0,0 +1,779 @@ +#include +#include +#include +#ifdef HAVE_CONFIG_H +#include "config.h" +#endif +#ifdef HAVE_PTHREAD +#include +#endif +#include "bntseq.h" +#include "bwt_lite.h" +#include "utils.h" +#include "bwtsw2.h" +#include "kstring.h" +#include "bwa.h" +#include "ksw.h" + +#include "kseq.h" +KSEQ_DECLARE(gzFile) + +#include "ksort.h" +#define __left_lt(a, b) ((a).end > (b).end) +KSORT_INIT(hit, bsw2hit_t, __left_lt) + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + + +extern unsigned char nst_nt4_table[256]; + +unsigned char nt_comp_table[256] = { + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','T','V','G', 'H','N','N','C', 'D','N','N','M', 'N','K','N','N', + 'N','N','Y','S', 'A','N','B','W', 'X','R','N','N', 'N','N','N','N', + 'n','t','v','g', 'h','n','n','c', 'd','n','n','m', 'n','k','n','n', + 'n','n','y','s', 'a','n','b','w', 'x','r','n','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', + 'N','N','N','N', 'N','N','N','N', 'N','N','N','N', 'N','N','N','N' +}; + +extern int bsw2_resolve_duphits(const bntseq_t *bns, const bwt_t *bwt, bwtsw2_t *b, int IS); +extern int bsw2_resolve_query_overlaps(bwtsw2_t *b, float mask_level); + +bsw2opt_t *bsw2_init_opt() +{ + bsw2opt_t *o = (bsw2opt_t*)calloc(1, sizeof(bsw2opt_t)); + o->a = 1; o->b = 3; o->q = 5; o->r = 2; o->t = 30; + o->bw = 50; + o->max_ins = 20000; + o->z = 1; o->is = 3; o->t_seeds = 5; o->hard_clip = 0; o->skip_sw = 0; + o->mask_level = 0.50f; o->coef = 5.5f; + o->qr = o->q + o->r; o->n_threads = 1; o->chunk_size = 10000000; + o->max_chain_gap = 10000; + o->cpy_cmt = 0; + return o; +} + +void bsw2_destroy(bwtsw2_t *b) +{ + int i; + if (b == 0) return; + if (b->aux) + for (i = 0; i < b->n; ++i) free(b->aux[i].cigar); + free(b->aux); free(b->hits); + free(b); +} + +bwtsw2_t *bsw2_dup_no_cigar(const bwtsw2_t *b) +{ + bwtsw2_t *p; + p = calloc(1, sizeof(bwtsw2_t)); + p->max = p->n = b->n; + if (b->n) { + kroundup32(p->max); + p->hits = calloc(p->max, sizeof(bsw2hit_t)); + memcpy(p->hits, b->hits, p->n * sizeof(bsw2hit_t)); + } + return p; +} + +#define __gen_ap(par, opt) do { \ + int i; \ + for (i = 0; i < 25; ++i) (par).matrix[i] = -(opt)->b; \ + for (i = 0; i < 4; ++i) (par).matrix[i*5+i] = (opt)->a; \ + (par).gap_open = (opt)->q; (par).gap_ext = (opt)->r; \ + (par).gap_end = (opt)->r; \ + (par).row = 5; (par).band_width = opt->bw; \ + } while (0) + +void bsw2_extend_left(const bsw2opt_t *opt, bwtsw2_t *b, uint8_t *_query, int lq, uint8_t *pac, bwtint_t l_pac, uint8_t *_mem) +{ + int i; + bwtint_t k; + uint8_t *target = 0, *query; + int8_t mat[25]; + + bwa_fill_scmat(opt->a, opt->b, mat); + query = calloc(lq, 1); + // sort according to the descending order of query end + ks_introsort(hit, b->n, b->hits); + target = calloc(((lq + 1) / 2 * opt->a + opt->r) / opt->r + lq, 1); + // reverse _query + for (i = 0; i < lq; ++i) query[lq - i - 1] = _query[i]; + // core loop + for (i = 0; i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + int lt = ((p->beg + 1) / 2 * opt->a + opt->r) / opt->r + lq; + int score, j, qle, tle; + p->n_seeds = 1; + if (p->l || p->k == 0) continue; + for (j = score = 0; j < i; ++j) { + bsw2hit_t *q = b->hits + j; + if (q->beg <= p->beg && q->k <= p->k && q->k + q->len >= p->k + p->len) { + if (q->n_seeds < (1<<13) - 2) ++q->n_seeds; + ++score; + } + } + if (score) continue; + if (lt > p->k) lt = p->k; + for (k = p->k - 1, j = 0; k > 0 && j < lt; --k) // FIXME: k=0 not considered! + target[j++] = pac[k>>2] >> (~k&3)*2 & 0x3; + lt = j; + score = ksw_extend(p->beg, &query[lq - p->beg], lt, target, 5, mat, opt->q, opt->r, opt->bw, 0, -1, p->G, &qle, &tle, 0, 0, 0, 0); + if (score > p->G) { // extensible + p->G = score; + p->k -= tle; + p->len += tle; + p->beg -= qle; + } + } + free(query); free(target); +} + +void bsw2_extend_rght(const bsw2opt_t *opt, bwtsw2_t *b, uint8_t *query, int lq, uint8_t *pac, bwtint_t l_pac, uint8_t *_mem) +{ + int i; + bwtint_t k; + uint8_t *target; + int8_t mat[25]; + + bwa_fill_scmat(opt->a, opt->b, mat); + target = calloc(((lq + 1) / 2 * opt->a + opt->r) / opt->r + lq, 1); + for (i = 0; i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + int lt = ((lq - p->beg + 1) / 2 * opt->a + opt->r) / opt->r + lq; + int j, score, qle, tle; + if (p->l) continue; + for (k = p->k, j = 0; k < p->k + lt && k < l_pac; ++k) + target[j++] = pac[k>>2] >> (~k&3)*2 & 0x3; + lt = j; + score = ksw_extend(lq - p->beg, &query[p->beg], lt, target, 5, mat, opt->q, opt->r, opt->bw, 0, -1, 1, &qle, &tle, 0, 0, 0, 0) - 1; +// if (score < p->G) fprintf(stderr, "[bsw2_extend_hits] %d < %d\n", score, p->G); + if (score >= p->G) { + p->G = score; + p->len = tle; + p->end = p->beg + qle; + } + } + free(target); +} + +/* generate CIGAR array(s) in b->cigar[] */ +static void gen_cigar(const bsw2opt_t *opt, int lq, uint8_t *seq[2], int64_t l_pac, const uint8_t *pac, bwtsw2_t *b, const char *name) +{ + int i; + int8_t mat[25]; + + bwa_fill_scmat(opt->a, opt->b, mat); + for (i = 0; i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + bsw2aux_t *q = b->aux + i; + uint8_t *query; + int beg, end, score; + if (p->l) continue; + beg = (p->flag & 0x10)? lq - p->end : p->beg; + end = (p->flag & 0x10)? lq - p->beg : p->end; + query = seq[(p->flag & 0x10)? 1 : 0] + beg; + q->cigar = bwa_gen_cigar(mat, opt->q, opt->r, opt->bw, l_pac, pac, end - beg, query, p->k, p->k + p->len, &score, &q->n_cigar, &q->nm); +#if 0 + if (name && score != p->G) { // debugging only + int j, glen = 0; + for (j = 0; j < q->n_cigar; ++j) + if ((q->cigar[j]&0xf) == 1 || (q->cigar[j]&0xf) == 2) + glen += q->cigar[j]>>4; + fprintf(stderr, "[E::%s] %s - unequal score: %d != %d; (qlen, aqlen, arlen, glen, bw) = (%d, %d, %d, %d, %d)\n", + __func__, name, score, p->G, lq, end - beg, p->len, glen, opt->bw); + } +#endif + if (q->cigar && (beg != 0 || end < lq)) { // write soft clipping + q->cigar = realloc(q->cigar, 4 * (q->n_cigar + 2)); + if (beg != 0) { + memmove(q->cigar + 1, q->cigar, q->n_cigar * 4); + q->cigar[0] = beg<<4 | 4; + ++q->n_cigar; + } + if (end < lq) { + q->cigar[q->n_cigar] = (lq - end)<<4 | 4; + ++q->n_cigar; + } + } + } +} + +/* this is for the debugging purpose only */ +void bsw2_debug_hits(const bwtsw2_t *b) +{ + int i; + printf("# raw hits: %d\n", b->n); + for (i = 0; i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + if (p->G > 0) + printf("G=%d, G2=%d, len=%d, [%d,%d), k=%lu, l=%lu, #seeds=%d, is_rev=%d\n", p->G, p->G2, p->len, p->beg, p->end, (long)p->k, (long)p->l, p->n_seeds, p->is_rev); + } +} + +static void merge_hits(bwtsw2_t *b[2], int l, int is_reverse) +{ + int i; + if (b[0]->n + b[1]->n > b[0]->max) { + b[0]->max = b[0]->n + b[1]->n; + b[0]->hits = realloc(b[0]->hits, b[0]->max * sizeof(bsw2hit_t)); + } + for (i = 0; i < b[1]->n; ++i) { + bsw2hit_t *p = b[0]->hits + b[0]->n + i; + *p = b[1]->hits[i]; + if (is_reverse) { + int x = p->beg; + p->beg = l - p->end; + p->end = l - x; + p->flag |= 0x10; + } + } + b[0]->n += b[1]->n; + bsw2_destroy(b[1]); + b[1] = 0; +} +/* seq[0] is the forward sequence and seq[1] is the reverse complement. */ +static bwtsw2_t *bsw2_aln1_core(const bsw2opt_t *opt, const bntseq_t *bns, uint8_t *pac, const bwt_t *target, + int l, uint8_t *seq[2], bsw2global_t *pool) +{ + extern void bsw2_chain_filter(const bsw2opt_t *opt, int len, bwtsw2_t *b[2]); + bwtsw2_t *b[2], **bb[2], **_b, *p; + int k, j; + bwtl_t *query; + query = bwtl_seq2bwtl(l, seq[0]); + _b = bsw2_core(bns, opt, query, target, pool); + bwtl_destroy(query); + for (k = 0; k < 2; ++k) { + bb[k] = calloc(2, sizeof(void*)); + bb[k][0] = calloc(1, sizeof(bwtsw2_t)); + bb[k][1] = calloc(1, sizeof(bwtsw2_t)); + } + for (k = 0; k < 2; ++k) { // separate _b into bb[2] based on the strand + for (j = 0; j < _b[k]->n; ++j) { + bsw2hit_t *q; + p = bb[_b[k]->hits[j].is_rev][k]; + if (p->n == p->max) { + p->max = p->max? p->max<<1 : 8; + p->hits = realloc(p->hits, p->max * sizeof(bsw2hit_t)); + } + q = &p->hits[p->n++]; + *q = _b[k]->hits[j]; + if (_b[k]->hits[j].is_rev) { + int x = q->beg; + q->beg = l - q->end; + q->end = l - x; + } + } + } + b[0] = bb[0][1]; b[1] = bb[1][1]; // bb[*][1] are "narrow SA hits" + bsw2_chain_filter(opt, l, b); // NB: only unique seeds are chained + for (k = 0; k < 2; ++k) { + bsw2_extend_left(opt, bb[k][1], seq[k], l, pac, bns->l_pac, pool->aln_mem); + merge_hits(bb[k], l, 0); // bb[k][1] is merged to bb[k][0] here + bsw2_resolve_duphits(0, 0, bb[k][0], 0); + bsw2_extend_rght(opt, bb[k][0], seq[k], l, pac, bns->l_pac, pool->aln_mem); + bsw2_resolve_duphits(0, 0, bb[k][0], 0); + b[k] = bb[k][0]; + free(bb[k]); + } + merge_hits(b, l, 1); // again, b[1] is merged to b[0] + bsw2_resolve_query_overlaps(b[0], opt->mask_level); + bsw2_destroy(_b[0]); bsw2_destroy(_b[1]); free(_b); + return b[0]; +} + +/* set ->flag to records the origin of the hit (to forward bwt or reverse bwt) */ +static void flag_fr(bwtsw2_t *b[2]) +{ + int i, j; + for (i = 0; i < b[0]->n; ++i) { + bsw2hit_t *p = b[0]->hits + i; + p->flag |= 0x10000; + } + for (i = 0; i < b[1]->n; ++i) { + bsw2hit_t *p = b[1]->hits + i; + p->flag |= 0x20000; + } + for (i = 0; i < b[0]->n; ++i) { + bsw2hit_t *p = b[0]->hits + i; + for (j = 0; j < b[1]->n; ++j) { + bsw2hit_t *q = b[1]->hits + j; + if (q->beg == p->beg && q->end == p->end && q->k == p->k && q->len == p->len && q->G == p->G) { + q->flag |= 0x30000; p->flag |= 0x30000; + break; + } + } + } +} + +typedef struct { + int n, max; + bsw2seq1_t *seq; +} bsw2seq_t; + +static int fix_cigar(const bntseq_t *bns, bsw2hit_t *p, int n_cigar, uint32_t *cigar) +{ + // FIXME: this routine does not work if the query bridge three reference sequences + int32_t coor, refl, lq; + int x, y, i, seqid; + bns_cnt_ambi(bns, p->k, p->len, &seqid); + coor = p->k - bns->anns[seqid].offset; + refl = bns->anns[seqid].len; + x = coor; y = 0; + // test if the alignment goes beyond the boundary + for (i = 0; i < n_cigar; ++i) { + int op = cigar[i]&0xf, ln = cigar[i]>>4; + if (op == 1 || op == 4 || op == 5) y += ln; + else if (op == 2) x += ln; + else x += ln, y += ln; + } + lq = y; // length of the query sequence + if (x > refl) { // then fix it + int j, nc, mq[2], nlen[2]; + uint32_t *cn; + bwtint_t kk = 0; + nc = mq[0] = mq[1] = nlen[0] = nlen[1] = 0; + cn = calloc(n_cigar + 3, 4); + x = coor; y = 0; + for (i = j = 0; i < n_cigar; ++i) { + int op = cigar[i]&0xf, ln = cigar[i]>>4; + if (op == 4 || op == 5 || op == 1) { // ins or clipping + y += ln; + cn[j++] = cigar[i]; + } else if (op == 2) { // del + if (x + ln >= refl && nc == 0) { + cn[j++] = (uint32_t)(lq - y)<<4 | 4; + nc = j; + cn[j++] = (uint32_t)y<<4 | 4; + kk = p->k + (x + ln - refl); + nlen[0] = x - coor; + nlen[1] = p->len - nlen[0] - ln; + } else cn[j++] = cigar[i]; + x += ln; + } else if (op == 0) { // match + if (x + ln >= refl && nc == 0) { + // FIXME: not consider a special case where a split right between M and I + cn[j++] = (uint32_t)(refl - x)<<4 | 0; // write M + cn[j++] = (uint32_t)(lq - y - (refl - x))<<4 | 4; // write S + nc = j; + mq[0] += refl - x; + cn[j++] = (uint32_t)(y + (refl - x))<<4 | 4; + if (x + ln - refl) cn[j++] = (uint32_t)(x + ln - refl)<<4 | 0; + mq[1] += x + ln - refl; + kk = bns->anns[seqid].offset + refl; + nlen[0] = refl - coor; + nlen[1] = p->len - nlen[0]; + } else { + cn[j++] = cigar[i]; + mq[nc?1:0] += ln; + } + x += ln; y += ln; + } + } + if (mq[0] > mq[1]) { // then take the first alignment + n_cigar = nc; + memcpy(cigar, cn, 4 * nc); + p->len = nlen[0]; + } else { + p->k = kk; p->len = nlen[1]; + n_cigar = j - nc; + memcpy(cigar, cn + nc, 4 * (j - nc)); + } + free(cn); + } + return n_cigar; +} + +static void write_aux(const bsw2opt_t *opt, const bntseq_t *bns, int qlen, uint8_t *seq[2], const uint8_t *pac, bwtsw2_t *b, const char *name) +{ + int i; + // allocate for b->aux + if (b->n<<1 < b->max) { + b->max = b->n; + kroundup32(b->max); + b->hits = realloc(b->hits, b->max * sizeof(bsw2hit_t)); + } + b->aux = calloc(b->n, sizeof(bsw2aux_t)); + // generate CIGAR + gen_cigar(opt, qlen, seq, bns->l_pac, pac, b, name); + // fix CIGAR, generate mapQ, and write chromosomal position + for (i = 0; i < b->n; ++i) { + bsw2hit_t *p = &b->hits[i]; + bsw2aux_t *q = &b->aux[i]; + q->flag = p->flag & 0xfe; + q->isize = 0; + if (p->l == 0) { // unique hit + float c = 1.0; + int subo; + // fix out-of-boundary CIGAR + q->n_cigar = fix_cigar(bns, p, q->n_cigar, q->cigar); + // compute mapQ + subo = p->G2 > opt->t? p->G2 : opt->t; + if (p->flag>>16 == 1 || p->flag>>16 == 2) c *= .5; + if (p->n_seeds < 2) c *= .2; + q->qual = (int)(c * (p->G - subo) * (250.0 / p->G + 0.03 / opt->a) + .499); + if (q->qual > 250) q->qual = 250; + if (q->qual < 0) q->qual = 0; + if (p->flag&1) q->qual = 0; // this is a random hit + q->pqual = q->qual; // set the paired qual as qual + // get the chromosomal position + q->nn = bns_cnt_ambi(bns, p->k, p->len, &q->chr); + q->pos = p->k - bns->anns[q->chr].offset; + } else q->qual = 0, q->n_cigar = 0, q->chr = q->pos = -1, q->nn = 0; + } +} + +static void update_mate_aux(bwtsw2_t *b, const bwtsw2_t *m) +{ + int i; + if (m == 0) return; + // update flag, mchr and mpos + for (i = 0; i < b->n; ++i) { + bsw2aux_t *q = &b->aux[i]; + q->flag |= 1; // paired + if (m->n == 0) q->flag |= 8; // mate unmapped + if (m->n == 1) { + q->mchr = m->aux[0].chr; + q->mpos = m->aux[0].pos; + if (m->aux[0].flag&0x10) q->flag |= 0x20; // mate reverse strand + if (q->chr == q->mchr) { // set insert size + if (q->mpos + m->hits[0].len > q->pos) + q->isize = q->mpos + m->hits[0].len - q->pos; + else q->isize = q->mpos - q->pos - b->hits[0].len; + } else q->isize = 0; + } else q->mchr = q->mpos = -1; + } + // update mapping quality + if (b->n == 1 && m->n == 1) { + bsw2hit_t *p = &b->hits[0]; + if (p->flag & BSW2_FLAG_MATESW) { // this alignment is found by Smith-Waterman + if (!(p->flag & BSW2_FLAG_TANDEM) && b->aux[0].pqual < 20) + b->aux[0].pqual = 20; + if (b->aux[0].pqual >= m->aux[0].qual) b->aux[0].pqual = m->aux[0].qual; + } else if ((p->flag & 2) && !(m->hits[0].flag & BSW2_FLAG_MATESW)) { // properly paired + if (!(p->flag & BSW2_FLAG_TANDEM)) { // pqual is bounded by [b->aux[0].qual,m->aux[0].qual] + b->aux[0].pqual += 20; + if (b->aux[0].pqual > m->aux[0].qual) b->aux[0].pqual = m->aux[0].qual; + if (b->aux[0].pqual < b->aux[0].qual) b->aux[0].pqual = b->aux[0].qual; + } + } + } +} + +/* generate SAM lines for a sequence in ks with alignment stored in + * b. ks->name and ks->seq will be freed and set to NULL in the end. */ +static void print_hits(const bntseq_t *bns, const bsw2opt_t *opt, bsw2seq1_t *ks, bwtsw2_t *b, int is_pe, bwtsw2_t *bmate) +{ + int i, k; + kstring_t str; + memset(&str, 0, sizeof(kstring_t)); + if (b == 0 || b->n == 0) { // no hits + ksprintf(&str, "%s\t4\t*\t0\t0\t*\t*\t0\t0\t", ks->name); + for (i = 0; i < ks->l; ++i) kputc(ks->seq[i], &str); + if (ks->qual) { + kputc('\t', &str); + for (i = 0; i < ks->l; ++i) kputc(ks->qual[i], &str); + } else kputs("\t*", &str); + kputc('\n', &str); + } + for (i = 0; b && i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + bsw2aux_t *q = b->aux + i; + int j, beg, end, type = 0; + // print mandatory fields before SEQ + if (q->cigar == 0) q->flag |= 0x4; + ksprintf(&str, "%s\t%d", ks->name, q->flag | (opt->multi_2nd && i? 0x100 : 0)); + ksprintf(&str, "\t%s\t%ld", q->chr>=0? bns->anns[q->chr].name : "*", (long)q->pos + 1); + if (p->l == 0 && q->cigar) { // not a repetitive hit + ksprintf(&str, "\t%d\t", q->pqual); + for (k = 0; k < q->n_cigar; ++k) + ksprintf(&str, "%d%c", q->cigar[k]>>4, (opt->hard_clip? "MIDNHHP" : "MIDNSHP")[q->cigar[k]&0xf]); + } else ksprintf(&str, "\t0\t*"); + if (!is_pe) kputs("\t*\t0\t0\t", &str); + else ksprintf(&str, "\t%s\t%d\t%d\t", q->mchr==q->chr? "=" : (q->mchr<0? "*" : bns->anns[q->mchr].name), q->mpos+1, q->isize); + // get the sequence begin and end + beg = 0; end = ks->l; + if (opt->hard_clip && q->cigar) { + if ((q->cigar[0]&0xf) == 4) beg += q->cigar[0]>>4; + if ((q->cigar[q->n_cigar-1]&0xf) == 4) end -= q->cigar[q->n_cigar-1]>>4; + } + for (j = beg; j < end; ++j) { + if (p->flag&0x10) kputc(nt_comp_table[(int)ks->seq[ks->l - 1 - j]], &str); + else kputc(ks->seq[j], &str); + } + // print base quality if present + if (ks->qual) { + kputc('\t', &str); + for (j = beg; j < end; ++j) { + if (p->flag&0x10) kputc(ks->qual[ks->l - 1 - j], &str); + else kputc(ks->qual[j], &str); + } + } else kputs("\t*", &str); + // print optional tags + ksprintf(&str, "\tAS:i:%d\tXS:i:%d\tXF:i:%d\tXE:i:%d\tNM:i:%d", p->G, p->G2, p->flag>>16, p->n_seeds, q->nm); + if (q->nn) ksprintf(&str, "\tXN:i:%d", q->nn); + if (p->l) ksprintf(&str, "\tXI:i:%d", p->l - p->k + 1); + if (p->flag&BSW2_FLAG_MATESW) type |= 1; + if (p->flag&BSW2_FLAG_TANDEM) type |= 2; + if (type) ksprintf(&str, "\tXT:i:%d", type); + if (opt->cpy_cmt && ks->comment) { + int l = strlen(ks->comment); + if (l >= 6 && ks->comment[2] == ':' && ks->comment[4] == ':') { + kputc('\t', &str); kputs(ks->comment, &str); + } + } + kputc('\n', &str); + } + ks->sam = str.s; + free(ks->seq); ks->seq = 0; + free(ks->qual); ks->qual = 0; + free(ks->name); ks->name = 0; +} + +static void update_opt(bsw2opt_t *dst, const bsw2opt_t *src, int qlen) +{ + double ll = log(qlen); + int i, k; + *dst = *src; + if (dst->t < ll * dst->coef) dst->t = (int)(ll * dst->coef + .499); + // set band width: the query length sets a boundary on the maximum band width + k = (qlen * dst->a - 2 * dst->q) / (2 * dst->r + dst->a); + i = (qlen * dst->a - dst->a - dst->t) / dst->r; + if (k > i) k = i; + if (k < 1) k = 1; // I do not know if k==0 causes troubles + dst->bw = src->bw < k? src->bw : k; +} + +/* Core routine to align reads in _seq. It is separated from + * process_seqs() to realize multi-threading */ +static void bsw2_aln_core(bsw2seq_t *_seq, const bsw2opt_t *_opt, const bntseq_t *bns, uint8_t *pac, const bwt_t *target, int is_pe) +{ + int x; + bsw2opt_t opt; + bsw2global_t *pool = bsw2_global_init(); + bwtsw2_t **buf; + buf = calloc(_seq->n, sizeof(void*)); + for (x = 0; x < _seq->n; ++x) { + bsw2seq1_t *p = _seq->seq + x; + uint8_t *seq[2], *rseq[2]; + int i, l, k; + bwtsw2_t *b[2]; + l = p->l; + update_opt(&opt, _opt, p->l); + if (pool->max_l < l) { // then enlarge working space for aln_extend_core() + int tmp = ((l + 1) / 2 * opt.a + opt.r) / opt.r + l; + pool->max_l = l; + pool->aln_mem = realloc(pool->aln_mem, (tmp + 2) * 24); + } + // set seq[2] and rseq[2] + seq[0] = calloc(l * 4, 1); + seq[1] = seq[0] + l; + rseq[0] = seq[1] + l; rseq[1] = rseq[0] + l; + // convert sequences to 2-bit representation + for (i = k = 0; i < l; ++i) { + int c = nst_nt4_table[(int)p->seq[i]]; + if (c >= 4) { c = (int)(drand48() * 4); ++k; } // FIXME: ambiguous bases are not properly handled + seq[0][i] = c; + seq[1][l-1-i] = 3 - c; + rseq[0][l-1-i] = 3 - c; + rseq[1][i] = c; + } + if (l - k < opt.t) { // too few unambiguous bases + buf[x] = calloc(1, sizeof(bwtsw2_t)); + free(seq[0]); continue; + } + // alignment + b[0] = bsw2_aln1_core(&opt, bns, pac, target, l, seq, pool); + for (k = 0; k < b[0]->n; ++k) + if (b[0]->hits[k].n_seeds < opt.t_seeds) break; + if (k < b[0]->n) { + b[1] = bsw2_aln1_core(&opt, bns, pac, target, l, rseq, pool); + for (i = 0; i < b[1]->n; ++i) { + bsw2hit_t *p = &b[1]->hits[i]; + int x = p->beg; + p->flag ^= 0x10, p->is_rev ^= 1; // flip the strand + p->beg = l - p->end; + p->end = l - x; + } + flag_fr(b); + merge_hits(b, l, 0); + bsw2_resolve_duphits(0, 0, b[0], 0); + bsw2_resolve_query_overlaps(b[0], opt.mask_level); + } else b[1] = 0; + // generate CIGAR and print SAM + buf[x] = bsw2_dup_no_cigar(b[0]); + // free + free(seq[0]); + bsw2_destroy(b[0]); + } + if (is_pe) bsw2_pair(&opt, bns->l_pac, pac, _seq->n, _seq->seq, buf); + for (x = 0; x < _seq->n; ++x) { + bsw2seq1_t *p = _seq->seq + x; + uint8_t *seq[2]; + int i; + seq[0] = malloc(p->l * 2); seq[1] = seq[0] + p->l; + for (i = 0; i < p->l; ++i) { + int c = nst_nt4_table[(int)p->seq[i]]; + if (c >= 4) c = (int)(drand48() * 4); + seq[0][i] = c; + seq[1][p->l-1-i] = 3 - c; + } + update_opt(&opt, _opt, p->l); + write_aux(&opt, bns, p->l, seq, pac, buf[x], _seq->seq[x].name); + free(seq[0]); + } + for (x = 0; x < _seq->n; ++x) { + if (is_pe) update_mate_aux(buf[x], buf[x^1]); + print_hits(bns, &opt, &_seq->seq[x], buf[x], is_pe, buf[x^1]); + } + for (x = 0; x < _seq->n; ++x) bsw2_destroy(buf[x]); + free(buf); + bsw2_global_destroy(pool); +} + +#ifdef HAVE_PTHREAD +typedef struct { + int tid, is_pe; + bsw2seq_t *_seq; + const bsw2opt_t *_opt; + const bntseq_t *bns; + uint8_t *pac; + const bwt_t *target; +} thread_aux_t; + +/* another interface to bsw2_aln_core() to facilitate pthread_create() */ +static void *worker(void *data) +{ + thread_aux_t *p = (thread_aux_t*)data; + bsw2_aln_core(p->_seq, p->_opt, p->bns, p->pac, p->target, p->is_pe); + return 0; +} +#endif + +/* process sequences stored in _seq, generate SAM lines for these + * sequences and reset _seq afterwards. */ +static void process_seqs(bsw2seq_t *_seq, const bsw2opt_t *opt, const bntseq_t *bns, uint8_t *pac, const bwt_t *target, int is_pe) +{ + int i; + is_pe = is_pe? 1 : 0; + +#ifdef HAVE_PTHREAD + if (opt->n_threads <= 1) { + bsw2_aln_core(_seq, opt, bns, pac, target, is_pe); + } else { + pthread_t *tid; + pthread_attr_t attr; + thread_aux_t *data; + int j; + pthread_attr_init(&attr); + pthread_attr_setdetachstate(&attr, PTHREAD_CREATE_JOINABLE); + data = (thread_aux_t*)calloc(opt->n_threads, sizeof(thread_aux_t)); + tid = (pthread_t*)calloc(opt->n_threads, sizeof(pthread_t)); + for (j = 0; j < opt->n_threads; ++j) { + thread_aux_t *p = data + j; + p->tid = j; p->_opt = opt; p->bns = bns; p->is_pe = is_pe; + p->pac = pac; p->target = target; + p->_seq = calloc(1, sizeof(bsw2seq_t)); + p->_seq->max = (_seq->n + opt->n_threads - 1) / opt->n_threads + 1; + p->_seq->n = 0; + p->_seq->seq = calloc(p->_seq->max, sizeof(bsw2seq1_t)); + } + for (i = 0; i < _seq->n; ++i) { // assign sequences to each thread + bsw2seq_t *p = data[(i>>is_pe)%opt->n_threads]._seq; + p->seq[p->n++] = _seq->seq[i]; + } + for (j = 0; j < opt->n_threads; ++j) pthread_create(&tid[j], &attr, worker, &data[j]); + for (j = 0; j < opt->n_threads; ++j) pthread_join(tid[j], 0); + for (j = 0; j < opt->n_threads; ++j) data[j]._seq->n = 0; + for (i = 0; i < _seq->n; ++i) { // copy the result from each thread back + bsw2seq_t *p = data[(i>>is_pe)%opt->n_threads]._seq; + _seq->seq[i] = p->seq[p->n++]; + } + for (j = 0; j < opt->n_threads; ++j) { + thread_aux_t *p = data + j; + free(p->_seq->seq); + free(p->_seq); + } + free(data); free(tid); + } +#else + bsw2_aln_core(_seq, opt, bns, pac, target, is_pe); +#endif + + // print and reset + for (i = 0; i < _seq->n; ++i) { + bsw2seq1_t *p = _seq->seq + i; + if (p->sam) err_printf("%s", p->sam); + free(p->name); free(p->seq); free(p->qual); free(p->sam); + p->tid = -1; p->l = 0; + p->name = p->seq = p->qual = p->sam = 0; + } + err_fflush(stdout); + _seq->n = 0; +} + +void bsw2_aln(const bsw2opt_t *opt, const bntseq_t *bns, bwt_t * const target, const char *fn, const char *fn2) +{ + gzFile fp, fp2; + kseq_t *ks, *ks2; + int l, is_pe = 0, i, n, m = 0; + int64_t seq_size = 0; + uint8_t *pac; + bsw2seq_t *_seq; + bseq1_t *bseq = 0; + + pac = calloc(bns->l_pac/4+1, 1); + for (l = 0; l < bns->n_seqs; ++l) + err_printf("@SQ\tSN:%s\tLN:%d\n", bns->anns[l].name, bns->anns[l].len); + err_fread_noeof(pac, 1, bns->l_pac/4+1, bns->fp_pac); + fp = xzopen(fn, "r"); + ks = kseq_init(fp); + _seq = calloc(1, sizeof(bsw2seq_t)); + if (fn2) { + fp2 = xzopen(fn2, "r"); + ks2 = kseq_init(fp2); + is_pe = 1; + } else fp2 = 0, ks2 = 0, is_pe = 0; + bseq_read(opt->chunk_size * opt->n_threads, &n, ks, ks2, 1, &seq_size, &m, &bseq); + while (n > 0) { + int size = 0; + if (n > _seq->max) { + _seq->max = n; + kroundup32(_seq->max); + _seq->seq = realloc(_seq->seq, _seq->max * sizeof(bsw2seq1_t)); + } + _seq->n = n; + for (i = 0; i < n; ++i) { + bseq1_t *b = &bseq[i]; + bsw2seq1_t *p = &_seq->seq[i]; + p->tid = -1; p->l = b->l_seq; + p->name = b->name; p->seq = b->seq; p->qual = b->qual; p->comment = b->comment; p->sam = 0; + size += p->l; + } + fprintf(stderr, "[bsw2_aln] read %d sequences/pairs (%d bp) ...\n", n, size); + process_seqs(_seq, opt, bns, pac, target, is_pe); + bseq_read(opt->chunk_size * opt->n_threads, &n, ks, ks2, 1, &seq_size, &m, &bseq); + } + // free + if (bseq) free(bseq); + free(pac); + free(_seq->seq); free(_seq); + kseq_destroy(ks); + err_gzclose(fp); + if (fn2) { + kseq_destroy(ks2); + err_gzclose(fp2); + } +} diff --git a/bwtsw2_chain.c b/bwtsw2_chain.c new file mode 100644 index 0000000..ade77e7 --- /dev/null +++ b/bwtsw2_chain.c @@ -0,0 +1,112 @@ +#include +#include "bwtsw2.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef struct { + uint32_t tbeg, tend; + int qbeg, qend; + uint32_t flag:1, idx:31; + int chain; // also reuse as a counter +} hsaip_t; + +#define _hsaip_lt(a, b) ((a).qbeg < (b).qbeg) + +#include "ksort.h" +KSORT_INIT(hsaip, hsaip_t, _hsaip_lt) + +static int chaining(const bsw2opt_t *opt, int shift, int n, hsaip_t *z, hsaip_t *chain) +{ + int j, k, m = 0; + ks_introsort(hsaip, n, z); + for (j = 0; j < n; ++j) { + hsaip_t *p = z + j; + for (k = m - 1; k >= 0; --k) { + hsaip_t *q = chain + k; + int x = p->qbeg - q->qbeg; // always positive + int y = p->tbeg - q->tbeg; + if (y > 0 && x < opt->max_chain_gap && y < opt->max_chain_gap && x - y <= opt->bw && y - x <= opt->bw) { // chained + if (p->qend > q->qend) q->qend = p->qend; + if (p->tend > q->tend) q->tend = p->tend; + ++q->chain; + p->chain = shift + k; + break; + } else if (q->chain > opt->t_seeds * 2) k = 0; // if the chain is strong enough, do not check the previous chains + } + if (k < 0) { // not added to any previous chains + chain[m] = *p; + chain[m].chain = 1; + chain[m].idx = p->chain = shift + m; + ++m; + } + } + return m; +} + +void bsw2_chain_filter(const bsw2opt_t *opt, int len, bwtsw2_t *b[2]) +{ + hsaip_t *z[2], *chain[2]; + int i, j, k, n[2], m[2], thres = opt->t_seeds * 2; + char *flag; + // initialization + n[0] = b[0]->n; n[1] = b[1]->n; + z[0] = calloc(n[0] + n[1], sizeof(hsaip_t)); + z[1] = z[0] + n[0]; + chain[0] = calloc(n[0] + n[1], sizeof(hsaip_t)); + for (k = j = 0; k < 2; ++k) { + for (i = 0; i < b[k]->n; ++i) { + bsw2hit_t *p = b[k]->hits + i; + hsaip_t *q = z[k] + i; + q->flag = k; q->idx = i; + q->tbeg = p->k; q->tend = p->k + p->len; + q->chain = -1; + q->qbeg = p->beg; q->qend = p->end; + } + } + // chaining + m[0] = chaining(opt, 0, n[0], z[0], chain[0]); + chain[1] = chain[0] + m[0]; + m[1] = chaining(opt, m[0], n[1], z[1], chain[1]); + // change query coordinate on the reverse strand + for (k = 0; k < m[1]; ++k) { + hsaip_t *p = chain[1] + k; + int tmp = p->qbeg; + p->qbeg = len - p->qend; p->qend = len - tmp; + } + //for (k = 0; k < m[0]; ++k) printf("%d, [%d,%d), [%d,%d)\n", chain[0][k].chain, chain[0][k].tbeg, chain[0][k].tend, chain[0][k].qbeg, chain[0][k].qend); + // filtering + flag = calloc(m[0] + m[1], 1); + ks_introsort(hsaip, m[0] + m[1], chain[0]); + for (k = 1; k < m[0] + m[1]; ++k) { + hsaip_t *p = chain[0] + k; + for (j = 0; j < k; ++j) { + hsaip_t *q = chain[0] + j; + if (flag[q->idx]) continue; + if (q->qend >= p->qend && q->chain > p->chain * thres && p->chain < thres) { + flag[p->idx] = 1; + break; + } + } + } + for (k = 0; k < n[0] + n[1]; ++k) { + hsaip_t *p = z[0] + k; + if (flag[p->chain]) + b[p->flag]->hits[p->idx].G = 0; + } + free(flag); + // squeeze out filtered elements in b[2] + for (k = 0; k < 2; ++k) { + for (j = i = 0; j < n[k]; ++j) { + bsw2hit_t *p = b[k]->hits + j; + if (p->G) { + if (i != j) b[k]->hits[i++] = *p; + else ++i; + } + } + b[k]->n = i; + } + // free + free(z[0]); free(chain[0]); +} diff --git a/bwtsw2_core.c b/bwtsw2_core.c new file mode 100644 index 0000000..1119601 --- /dev/null +++ b/bwtsw2_core.c @@ -0,0 +1,619 @@ +#include +#include +#include +#include +#include +#include "bwt_lite.h" +#include "bwtsw2.h" +#include "bwt.h" +#include "kvec.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef struct { + bwtint_t k, l; +} qintv_t; + +#define qintv_eq(a, b) ((a).k == (b).k && (a).l == (b).l) +#define qintv_hash(a) ((a).k>>7^(a).l<<17) + +#include "khash.h" +KHASH_INIT(qintv, qintv_t, uint64_t, 1, qintv_hash, qintv_eq) +KHASH_MAP_INIT_INT64(64, uint64_t) + +#define MINUS_INF -0x3fffffff +#define MASK_LEVEL 0.90f + +struct __mempool_t; +static void mp_destroy(struct __mempool_t*); +typedef struct { + bwtint_t qk, ql; + int I, D, G; + uint32_t pj:2, qlen:30; + int tlen; + int ppos, upos; + int cpos[4]; +} bsw2cell_t; + +#include "ksort.h" +KSORT_INIT_GENERIC(int) +#define __hitG_lt(a, b) (((a).G + ((int)(a).n_seeds<<2)) > (b).G + ((int)(b).n_seeds<<2)) +KSORT_INIT(hitG, bsw2hit_t, __hitG_lt) + +static const bsw2cell_t g_default_cell = { 0, 0, MINUS_INF, MINUS_INF, MINUS_INF, 0, 0, 0, -1, -1, {-1, -1, -1, -1} }; + +typedef struct { + int n, max; + uint32_t tk, tl; // this is fine + bsw2cell_t *array; +} bsw2entry_t, *bsw2entry_p; + +/* --- BEGIN: Stack operations --- */ +typedef struct { + int n_pending; + kvec_t(bsw2entry_p) stack0, pending; + struct __mempool_t *pool; +} bsw2stack_t; + +#define stack_isempty(s) (kv_size(s->stack0) == 0 && s->n_pending == 0) +static void stack_destroy(bsw2stack_t *s) { mp_destroy(s->pool); kv_destroy(s->stack0); kv_destroy(s->pending); free(s); } +inline static void stack_push0(bsw2stack_t *s, bsw2entry_p e) { kv_push(bsw2entry_p, s->stack0, e); } +inline static bsw2entry_p stack_pop(bsw2stack_t *s) +{ + assert(!(kv_size(s->stack0) == 0 && s->n_pending != 0)); + return kv_pop(s->stack0); +} +/* --- END: Stack operations --- */ + +/* --- BEGIN: memory pool --- */ +typedef struct __mempool_t { + int cnt; // if cnt!=0, then there must be memory leak + kvec_t(bsw2entry_p) pool; +} mempool_t; +inline static bsw2entry_p mp_alloc(mempool_t *mp) +{ + ++mp->cnt; + if (kv_size(mp->pool) == 0) return (bsw2entry_t*)calloc(1, sizeof(bsw2entry_t)); + else return kv_pop(mp->pool); +} +inline static void mp_free(mempool_t *mp, bsw2entry_p e) +{ + --mp->cnt; e->n = 0; + kv_push(bsw2entry_p, mp->pool, e); +} +static void mp_destroy(struct __mempool_t *mp) +{ + int i; + for (i = 0; i != kv_size(mp->pool); ++i) { + free(kv_A(mp->pool, i)->array); + free(kv_A(mp->pool, i)); + } + kv_destroy(mp->pool); + free(mp); +} +/* --- END: memory pool --- */ + +/* --- BEGIN: utilities --- */ +static khash_t(64) *bsw2_connectivity(const bwtl_t *b) +{ + khash_t(64) *h; + uint32_t k, l, cntk[4], cntl[4]; // this is fine + uint64_t x; + khiter_t iter; + int j, ret; + kvec_t(uint64_t) stack; + + kv_init(stack); + h = kh_init(64); + kh_resize(64, h, b->seq_len * 4); + x = b->seq_len; + kv_push(uint64_t, stack, x); + while (kv_size(stack)) { + x = kv_pop(stack); + k = x>>32; l = (uint32_t)x; + bwtl_2occ4(b, k-1, l, cntk, cntl); + for (j = 0; j != 4; ++j) { + k = b->L2[j] + cntk[j] + 1; + l = b->L2[j] + cntl[j]; + if (k > l) continue; + x = (uint64_t)k << 32 | l; + iter = kh_put(64, h, x, &ret); + if (ret) { // if not present + kh_value(h, iter) = 1; + kv_push(uint64_t, stack, x); + } else ++kh_value(h, iter); + } + } + kv_destroy(stack); + //fprintf(stderr, "[bsw2_connectivity] %u nodes in the DAG\n", kh_size(h)); + return h; +} +// pick up top T matches at a node +static void cut_tail(bsw2entry_t *u, int T, bsw2entry_t *aux) +{ + int i, *a, n, x; + if (u->n <= T) return; + if (aux->max < u->n) { + aux->max = u->n; + aux->array = (bsw2cell_t*)realloc(aux->array, aux->max * sizeof(bsw2cell_t)); + } + a = (int*)aux->array; + for (i = n = 0; i != u->n; ++i) + if (u->array[i].ql && u->array[i].G > 0) + a[n++] = -u->array[i].G; + if (n <= T) return; + x = -ks_ksmall(int, n, a, T); + n = 0; + for (i = 0; i < u->n; ++i) { + bsw2cell_t *p = u->array + i; + if (p->G == x) ++n; + if (p->G < x || (p->G == x && n >= T)) { + p->qk = p->ql = 0; p->G = 0; + if (p->ppos >= 0) u->array[p->ppos].cpos[p->pj] = -1; + } + } +} +// remove duplicated cells +static inline void remove_duplicate(bsw2entry_t *u, khash_t(qintv) *hash) +{ + int i, ret, j; + khiter_t k; + qintv_t key; + kh_clear(qintv, hash); + for (i = 0; i != u->n; ++i) { + bsw2cell_t *p = u->array + i; + if (p->ql == 0) continue; + key.k = p->qk; key.l = p->ql; + k = kh_put(qintv, hash, key, &ret); + j = -1; + if (ret == 0) { + if ((uint32_t)kh_value(hash, k) >= p->G) j = i; + else { + j = kh_value(hash, k)>>32; + kh_value(hash, k) = (uint64_t)i<<32 | p->G; + } + } else kh_value(hash, k) = (uint64_t)i<<32 | p->G; + if (j >= 0) { + p = u->array + j; + p->qk = p->ql = 0; p->G = 0; + if (p->ppos >= 0) u->array[p->ppos].cpos[p->pj] = -3; + } + } +} +// merge two entries +static void merge_entry(const bsw2opt_t * __restrict opt, bsw2entry_t *u, bsw2entry_t *v, bwtsw2_t *b) +{ + int i; + if (u->n + v->n >= u->max) { + u->max = u->n + v->n; + u->array = (bsw2cell_t*)realloc(u->array, u->max * sizeof(bsw2cell_t)); + } + for (i = 0; i != v->n; ++i) { + bsw2cell_t *p = v->array + i; + if (p->ppos >= 0) p->ppos += u->n; + if (p->cpos[0] >= 0) p->cpos[0] += u->n; + if (p->cpos[1] >= 0) p->cpos[1] += u->n; + if (p->cpos[2] >= 0) p->cpos[2] += u->n; + if (p->cpos[3] >= 0) p->cpos[3] += u->n; + } + memcpy(u->array + u->n, v->array, v->n * sizeof(bsw2cell_t)); + u->n += v->n; +} + +static inline bsw2cell_t *push_array_p(bsw2entry_t *e) +{ + if (e->n == e->max) { + e->max = e->max? e->max<<1 : 256; + e->array = (bsw2cell_t*)realloc(e->array, sizeof(bsw2cell_t) * e->max); + } + return e->array + e->n; +} + +static inline double time_elapse(const struct rusage *curr, const struct rusage *last) +{ + long t1 = (curr->ru_utime.tv_sec - last->ru_utime.tv_sec) + (curr->ru_stime.tv_sec - last->ru_stime.tv_sec); + long t2 = (curr->ru_utime.tv_usec - last->ru_utime.tv_usec) + (curr->ru_stime.tv_usec - last->ru_stime.tv_usec); + return (double)t1 + t2 * 1e-6; +} +/* --- END: utilities --- */ + +/* --- BEGIN: processing partial hits --- */ +static void save_hits(const bwtl_t *bwt, int thres, bsw2hit_t *hits, bsw2entry_t *u) +{ + int i; + uint32_t k; // this is fine + for (i = 0; i < u->n; ++i) { + bsw2cell_t *p = u->array + i; + if (p->G < thres) continue; + for (k = u->tk; k <= u->tl; ++k) { + int beg, end; + bsw2hit_t *q = 0; + beg = bwt->sa[k]; end = beg + p->tlen; + if (p->G > hits[beg*2].G) { + hits[beg*2+1] = hits[beg*2]; + q = hits + beg * 2; + } else if (p->G > hits[beg*2+1].G) q = hits + beg * 2 + 1; + if (q) { + q->k = p->qk; q->l = p->ql; q->len = p->qlen; q->G = p->G; + q->beg = beg; q->end = end; q->G2 = q->k == q->l? 0 : q->G; + q->flag = q->n_seeds = 0; + } + } + } +} +/* "narrow hits" are node-to-node hits that have a high score and + * are not so repetitive (|SA interval|<=IS). */ +static void save_narrow_hits(const bwtl_t *bwtl, bsw2entry_t *u, bwtsw2_t *b1, int t, int IS) +{ + int i; + for (i = 0; i < u->n; ++i) { + bsw2hit_t *q; + bsw2cell_t *p = u->array + i; + if (p->G >= t && p->ql - p->qk + 1 <= IS) { // good narrow hit + if (b1->max == b1->n) { + b1->max = b1->max? b1->max<<1 : 4; + b1->hits = realloc(b1->hits, b1->max * sizeof(bsw2hit_t)); + } + q = &b1->hits[b1->n++]; + q->k = p->qk; q->l = p->ql; + q->len = p->qlen; + q->G = p->G; q->G2 = 0; + q->beg = bwtl->sa[u->tk]; q->end = q->beg + p->tlen; + q->flag = 0; + // delete p + p->qk = p->ql = 0; p->G = 0; + if (p->ppos >= 0) u->array[p->ppos].cpos[p->pj] = -3; + } + } +} +/* after this, "narrow SA hits" will be expanded and the coordinates + * will be obtained and stored in b->hits[*].k. */ +int bsw2_resolve_duphits(const bntseq_t *bns, const bwt_t *bwt, bwtsw2_t *b, int IS) +{ + int i, j, n, is_rev; + if (b->n == 0) return 0; + if (bwt && bns) { // convert to chromosomal coordinates if requested + int old_n = b->n; + bsw2hit_t *old_hits = b->hits; + for (i = n = 0; i < b->n; ++i) { // compute the memory to allocated + bsw2hit_t *p = old_hits + i; + if (p->l - p->k + 1 <= IS) n += p->l - p->k + 1; + else if (p->G > 0) ++n; + } + b->n = b->max = n; + b->hits = calloc(b->max, sizeof(bsw2hit_t)); + for (i = j = 0; i < old_n; ++i) { + bsw2hit_t *p = old_hits + i; + if (p->l - p->k + 1 <= IS) { // the hit is no so repetitive + bwtint_t k; + if (p->G == 0 && p->k == 0 && p->l == 0 && p->len == 0) continue; + for (k = p->k; k <= p->l; ++k) { + b->hits[j] = *p; + b->hits[j].k = bns_depos(bns, bwt_sa(bwt, k), &is_rev); + b->hits[j].l = 0; + b->hits[j].is_rev = is_rev; + if (is_rev) b->hits[j].k -= p->len - 1; + ++j; + } + } else if (p->G > 0) { + b->hits[j] = *p; + b->hits[j].k = bns_depos(bns, bwt_sa(bwt, p->k), &is_rev); + b->hits[j].l = 0; + b->hits[j].flag |= 1; + b->hits[j].is_rev = is_rev; + if (is_rev) b->hits[j].k -= p->len - 1; + ++j; + } + } + free(old_hits); + } + for (i = j = 0; i < b->n; ++i) // squeeze out empty elements + if (b->hits[i].G) b->hits[j++] = b->hits[i]; + b->n = j; + ks_introsort(hitG, b->n, b->hits); + for (i = 1; i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + for (j = 0; j < i; ++j) { + bsw2hit_t *q = b->hits + j; + int compatible = 1; + if (p->is_rev != q->is_rev) continue; // hits from opposite strands are not duplicates + if (p->l == 0 && q->l == 0) { + int qol = (p->end < q->end? p->end : q->end) - (p->beg > q->beg? p->beg : q->beg); // length of query overlap + if (qol < 0) qol = 0; + if ((float)qol / (p->end - p->beg) > MASK_LEVEL || (float)qol / (q->end - q->beg) > MASK_LEVEL) { + int64_t tol = (int64_t)(p->k + p->len < q->k + q->len? p->k + p->len : q->k + q->len) + - (int64_t)(p->k > q->k? p->k : q->k); // length of target overlap + if ((double)tol / p->len > MASK_LEVEL || (double)tol / q->len > MASK_LEVEL) + compatible = 0; + } + } + if (!compatible) { + p->G = 0; + if (q->G2 < p->G2) q->G2 = p->G2; + break; + } + } + } + n = i; + for (i = j = 0; i < n; ++i) { + if (b->hits[i].G == 0) continue; + if (i != j) b->hits[j++] = b->hits[i]; + else ++j; + } + b->n = j; + return b->n; +} + +int bsw2_resolve_query_overlaps(bwtsw2_t *b, float mask_level) +{ + int i, j, n; + if (b->n == 0) return 0; + ks_introsort(hitG, b->n, b->hits); + { // choose a random one + int G0 = b->hits[0].G; + for (i = 1; i < b->n; ++i) + if (b->hits[i].G != G0) break; + j = (int)(i * drand48()); + if (j) { + bsw2hit_t tmp; + tmp = b->hits[0]; b->hits[0] = b->hits[j]; b->hits[j] = tmp; + } + } + for (i = 1; i < b->n; ++i) { + bsw2hit_t *p = b->hits + i; + int all_compatible = 1; + if (p->G == 0) break; + for (j = 0; j < i; ++j) { + bsw2hit_t *q = b->hits + j; + int64_t tol = 0; + int qol, compatible = 0; + float fol; + if (q->G == 0) continue; + qol = (p->end < q->end? p->end : q->end) - (p->beg > q->beg? p->beg : q->beg); + if (qol < 0) qol = 0; + if (p->l == 0 && q->l == 0) { + tol = (int64_t)(p->k + p->len < q->k + q->len? p->k + p->len : q->k + q->len) + - (p->k > q->k? p->k : q->k); + if (tol < 0) tol = 0; + } + fol = (float)qol / (p->end - p->beg < q->end - q->beg? p->end - p->beg : q->end - q->beg); + if (fol < mask_level || (tol > 0 && qol < p->end - p->beg && qol < q->end - q->beg)) compatible = 1; + if (!compatible) { + if (q->G2 < p->G) q->G2 = p->G; + all_compatible = 0; + } + } + if (!all_compatible) p->G = 0; + } + n = i; + for (i = j = 0; i < n; ++i) { + if (b->hits[i].G == 0) continue; + if (i != j) b->hits[j++] = b->hits[i]; + else ++j; + } + b->n = j; + return j; +} +/* --- END: processing partial hits --- */ + +/* --- BEGIN: global mem pool --- */ +bsw2global_t *bsw2_global_init() +{ + bsw2global_t *pool; + bsw2stack_t *stack; + pool = calloc(1, sizeof(bsw2global_t)); + stack = calloc(1, sizeof(bsw2stack_t)); + stack->pool = (mempool_t*)calloc(1, sizeof(mempool_t)); + pool->stack = (void*)stack; + return pool; +} + +void bsw2_global_destroy(bsw2global_t *pool) +{ + stack_destroy((bsw2stack_t*)pool->stack); + free(pool->aln_mem); + free(pool); +} +/* --- END: global mem pool --- */ + +static inline int fill_cell(const bsw2opt_t *o, int match_score, bsw2cell_t *c[4]) +{ + int G = c[3]? c[3]->G + match_score : MINUS_INF; + if (c[1]) { + c[0]->I = c[1]->I > c[1]->G - o->q? c[1]->I - o->r : c[1]->G - o->qr; + if (c[0]->I > G) G = c[0]->I; + } else c[0]->I = MINUS_INF; + if (c[2]) { + c[0]->D = c[2]->D > c[2]->G - o->q? c[2]->D - o->r : c[2]->G - o->qr; + if (c[0]->D > G) G = c[0]->D; + } else c[0]->D = MINUS_INF; + return(c[0]->G = G); +} + +static void init_bwtsw2(const bwtl_t *target, const bwt_t *query, bsw2stack_t *s) +{ + bsw2entry_t *u; + bsw2cell_t *x; + + u = mp_alloc(s->pool); + u->tk = 0; u->tl = target->seq_len; + x = push_array_p(u); + *x = g_default_cell; + x->G = 0; x->qk = 0; x->ql = query->seq_len; + u->n++; + stack_push0(s, u); +} +/* On return, ret[1] keeps not-so-repetitive hits (narrow SA hits); ret[0] keeps all hits (right?) */ +bwtsw2_t **bsw2_core(const bntseq_t *bns, const bsw2opt_t *opt, const bwtl_t *target, const bwt_t *query, bsw2global_t *pool) +{ + bsw2stack_t *stack = (bsw2stack_t*)pool->stack; + bwtsw2_t *b, *b1, **b_ret; + int i, j, score_mat[16], *heap, heap_size, n_tot = 0; + struct rusage curr, last; + khash_t(qintv) *rhash; + khash_t(64) *chash; + + // initialize connectivity hash (chash) + chash = bsw2_connectivity(target); + // calculate score matrix + for (i = 0; i != 4; ++i) + for (j = 0; j != 4; ++j) + score_mat[i<<2|j] = (i == j)? opt->a : -opt->b; + // initialize other variables + rhash = kh_init(qintv); + init_bwtsw2(target, query, stack); + heap_size = opt->z; + heap = calloc(heap_size, sizeof(int)); + // initialize the return struct + b = (bwtsw2_t*)calloc(1, sizeof(bwtsw2_t)); + b->n = b->max = target->seq_len * 2; + b->hits = calloc(b->max, sizeof(bsw2hit_t)); + b1 = (bwtsw2_t*)calloc(1, sizeof(bwtsw2_t)); + b_ret = calloc(2, sizeof(void*)); + b_ret[0] = b; b_ret[1] = b1; + // initialize timer + getrusage(0, &last); + // the main loop: traversal of the DAG + while (!stack_isempty(stack)) { + int old_n, tj; + bsw2entry_t *v; + uint32_t tcntk[4], tcntl[4]; + bwtint_t k, l; + + v = stack_pop(stack); old_n = v->n; + n_tot += v->n; + + for (i = 0; i < v->n; ++i) { // test max depth and band width + bsw2cell_t *p = v->array + i; + if (p->ql == 0) continue; + if (p->tlen - (int)p->qlen > opt->bw || (int)p->qlen - p->tlen > opt->bw) { + p->qk = p->ql = 0; + if (p->ppos >= 0) v->array[p->ppos].cpos[p->pj] = -5; + } + } + + // get Occ for the DAG + bwtl_2occ4(target, v->tk - 1, v->tl, tcntk, tcntl); + for (tj = 0; tj != 4; ++tj) { // descend to the children + bwtint_t qcntk[4], qcntl[4]; + int qj, *curr_score_mat = score_mat + tj * 4; + khiter_t iter; + bsw2entry_t *u; + + k = target->L2[tj] + tcntk[tj] + 1; + l = target->L2[tj] + tcntl[tj]; + if (k > l) continue; + // update counter + iter = kh_get(64, chash, (uint64_t)k<<32 | l); + --kh_value(chash, iter); + // initialization + u = mp_alloc(stack->pool); + u->tk = k; u->tl = l; + memset(heap, 0, sizeof(int) * opt->z); + // loop through all the nodes in v + for (i = 0; i < v->n; ++i) { + bsw2cell_t *p = v->array + i, *x, *c[4]; // c[0]=>current, c[1]=>I, c[2]=>D, c[3]=>G + int is_added = 0; + if (p->ql == 0) continue; // deleted node + c[0] = x = push_array_p(u); + x->G = MINUS_INF; + p->upos = x->upos = -1; + if (p->ppos >= 0) { // parent has been visited + c[1] = (v->array[p->ppos].upos >= 0)? u->array + v->array[p->ppos].upos : 0; + c[3] = v->array + p->ppos; c[2] = p; + if (fill_cell(opt, curr_score_mat[p->pj], c) > 0) { // then update topology at p and x + x->ppos = v->array[p->ppos].upos; // the parent pos in u + p->upos = u->n++; // the current pos in u + if (x->ppos >= 0) u->array[x->ppos].cpos[p->pj] = p->upos; // the child pos of its parent in u + is_added = 1; + } + } else { + x->D = p->D > p->G - opt->q? p->D - opt->r : p->G - opt->qr; + if (x->D > 0) { + x->G = x->D; + x->I = MINUS_INF; x->ppos = -1; + p->upos = u->n++; + is_added = 1; + } + } + if (is_added) { // x has been added to u->array. fill the remaining variables + x->cpos[0] = x->cpos[1] = x->cpos[2] = x->cpos[3] = -1; + x->pj = p->pj; x->qk = p->qk; x->ql = p->ql; x->qlen = p->qlen; x->tlen = p->tlen + 1; + if (x->G > -heap[0]) { + heap[0] = -x->G; + ks_heapadjust(int, 0, heap_size, heap); + } + } + if ((x->G > opt->qr && x->G >= -heap[0]) || i < old_n) { // good node in u, or in v + if (p->cpos[0] == -1 || p->cpos[1] == -1 || p->cpos[2] == -1 || p->cpos[3] == -1) { + bwt_2occ4(query, p->qk - 1, p->ql, qcntk, qcntl); + for (qj = 0; qj != 4; ++qj) { // descend to the prefix trie + if (p->cpos[qj] != -1) continue; // this node will be visited later + k = query->L2[qj] + qcntk[qj] + 1; + l = query->L2[qj] + qcntl[qj]; + if (k > l) { p->cpos[qj] = -2; continue; } + x = push_array_p(v); + p = v->array + i; // p may not point to the correct position after realloc + x->G = x->I = x->D = MINUS_INF; + x->qk = k; x->ql = l; x->pj = qj; x->qlen = p->qlen + 1; x->ppos = i; x->tlen = p->tlen; + x->cpos[0] = x->cpos[1] = x->cpos[2] = x->cpos[3] = -1; + p->cpos[qj] = v->n++; + } // ~for(qj) + } // ~if(p->cpos[]) + } // ~if + } // ~for(i) + if (u->n) save_hits(target, opt->t, b->hits, u); + { // push u to the stack (or to the pending array) + uint32_t cnt, pos; + cnt = (uint32_t)kh_value(chash, iter); + pos = kh_value(chash, iter)>>32; + if (pos) { // something in the pending array, then merge + bsw2entry_t *w = kv_A(stack->pending, pos-1); + if (u->n) { + if (w->n < u->n) { // swap + w = u; u = kv_A(stack->pending, pos-1); kv_A(stack->pending, pos-1) = w; + } + merge_entry(opt, w, u, b); + } + if (cnt == 0) { // move from pending to stack0 + remove_duplicate(w, rhash); + save_narrow_hits(target, w, b1, opt->t, opt->is); + cut_tail(w, opt->z, u); + stack_push0(stack, w); + kv_A(stack->pending, pos-1) = 0; + --stack->n_pending; + } + mp_free(stack->pool, u); + } else if (cnt) { // the first time + if (u->n) { // push to the pending queue + ++stack->n_pending; + kv_push(bsw2entry_p, stack->pending, u); + kh_value(chash, iter) = (uint64_t)kv_size(stack->pending)<<32 | cnt; + } else mp_free(stack->pool, u); + } else { // cnt == 0, then push to the stack + bsw2entry_t *w = mp_alloc(stack->pool); + save_narrow_hits(target, u, b1, opt->t, opt->is); + cut_tail(u, opt->z, w); + mp_free(stack->pool, w); + stack_push0(stack, u); + } + } + } // ~for(tj) + mp_free(stack->pool, v); + } // while(top) + getrusage(0, &curr); + for (i = 0; i < 2; ++i) + for (j = 0; j < b_ret[i]->n; ++j) + b_ret[i]->hits[j].n_seeds = 0; + bsw2_resolve_duphits(bns, query, b, opt->is); + bsw2_resolve_duphits(bns, query, b1, opt->is); + //fprintf(stderr, "stats: %.3lf sec; %d elems\n", time_elapse(&curr, &last), n_tot); + // free + free(heap); + kh_destroy(qintv, rhash); + kh_destroy(64, chash); + stack->pending.n = stack->stack0.n = 0; + return b_ret; +} diff --git a/bwtsw2_main.c b/bwtsw2_main.c new file mode 100644 index 0000000..19d58ba --- /dev/null +++ b/bwtsw2_main.c @@ -0,0 +1,89 @@ +#include +#include +#include +#include +#include +#include "bwt.h" +#include "bwtsw2.h" +#include "utils.h" +#include "bwa.h" + +int bwa_bwtsw2(int argc, char *argv[]) +{ + bsw2opt_t *opt; + bwaidx_t *idx; + int c; + + opt = bsw2_init_opt(); + srand48(11); + while ((c = getopt(argc, argv, "q:r:a:b:t:T:w:d:z:m:s:c:N:Hf:MI:SG:C")) >= 0) { + switch (c) { + case 'q': opt->q = atoi(optarg); break; + case 'r': opt->r = atoi(optarg); break; + case 'a': opt->a = atoi(optarg); break; + case 'b': opt->b = atoi(optarg); break; + case 'w': opt->bw = atoi(optarg); break; + case 'T': opt->t = atoi(optarg); break; + case 't': opt->n_threads = atoi(optarg); break; + case 'z': opt->z = atoi(optarg); break; + case 's': opt->is = atoi(optarg); break; + case 'm': opt->mask_level = atof(optarg); break; + case 'c': opt->coef = atof(optarg); break; + case 'N': opt->t_seeds = atoi(optarg); break; + case 'M': opt->multi_2nd = 1; break; + case 'H': opt->hard_clip = 1; break; + case 'f': xreopen(optarg, "w", stdout); break; + case 'I': opt->max_ins = atoi(optarg); break; + case 'S': opt->skip_sw = 1; break; + case 'C': opt->cpy_cmt = 1; break; + case 'G': opt->max_chain_gap = atoi(optarg); break; + default: return 1; + } + } + opt->qr = opt->q + opt->r; + + if (optind + 2 > argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa bwasw [options] [query2.fa]\n\n"); + fprintf(stderr, "Options: -a INT score for a match [%d]\n", opt->a); + fprintf(stderr, " -b INT mismatch penalty [%d]\n", opt->b); + fprintf(stderr, " -q INT gap open penalty [%d]\n", opt->q); + fprintf(stderr, " -r INT gap extension penalty [%d]\n", opt->r); + fprintf(stderr, " -w INT band width [%d]\n", opt->bw); + fprintf(stderr, " -m FLOAT mask level [%.2f]\n", opt->mask_level); + fprintf(stderr, "\n"); + fprintf(stderr, " -t INT number of threads [%d]\n", opt->n_threads); + fprintf(stderr, " -f FILE file to output results to instead of stdout\n"); + fprintf(stderr, " -H in SAM output, use hard clipping instead of soft clipping\n"); + fprintf(stderr, " -C copy FASTA/Q comment to SAM output\n"); + fprintf(stderr, " -M mark multi-part alignments as secondary\n"); + fprintf(stderr, " -S skip Smith-Waterman read pairing\n"); + fprintf(stderr, " -I INT ignore pairs with insert >=INT for inferring the size distr [%d]\n", opt->max_ins); + fprintf(stderr, "\n"); + fprintf(stderr, " -T INT score threshold divided by a [%d]\n", opt->t); + fprintf(stderr, " -c FLOAT coefficient of length-threshold adjustment [%.1f]\n", opt->coef); + fprintf(stderr, " -z INT Z-best [%d]\n", opt->z); + fprintf(stderr, " -s INT maximum seeding interval size [%d]\n", opt->is); + fprintf(stderr, " -N INT # seeds to trigger rev aln; 2*INT is also the chaining threshold [%d]\n", opt->t_seeds); + fprintf(stderr, " -G INT maximum gap size during chaining [%d]\n", opt->max_chain_gap); + fprintf(stderr, "\n"); + fprintf(stderr, "Note: For long Illumina, 454 and Sanger reads, assembly contigs, fosmids and\n"); + fprintf(stderr, " BACs, the default setting usually works well. For the current PacBio\n"); + fprintf(stderr, " reads (end of 2010), '-b5 -q2 -r1 -z10' is recommended. One may also\n"); + fprintf(stderr, " increase '-z' for better sensitivity.\n"); + fprintf(stderr, "\n"); + + return 1; + } + + // adjust opt for opt->a + opt->t *= opt->a; + opt->coef *= opt->a; + + if ((idx = bwa_idx_load(argv[optind], BWA_IDX_BWT|BWA_IDX_BNS)) == 0) return 1; + bsw2_aln(opt, idx->bns, idx->bwt, argv[optind+1], optind+2 < argc? argv[optind+2] : 0); + bwa_idx_destroy(idx); + free(opt); + + return 0; +} diff --git a/bwtsw2_pair.c b/bwtsw2_pair.c new file mode 100644 index 0000000..f50b25b --- /dev/null +++ b/bwtsw2_pair.c @@ -0,0 +1,274 @@ +#include +#include +#include +#include +#include "utils.h" +#include "bwt.h" +#include "bntseq.h" +#include "bwtsw2.h" +#include "kstring.h" +#include "ksw.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#define MIN_RATIO 0.8 +#define OUTLIER_BOUND 2.0 +#define MAX_STDDEV 4.0 +#define EXT_STDDEV 4.0 + +typedef struct { + int low, high, failed; + double avg, std; +} bsw2pestat_t; + +bsw2pestat_t bsw2_stat(int n, bwtsw2_t **buf, kstring_t *msg, int max_ins) +{ + int i, k, x, p25, p50, p75, tmp, max_len = 0; + uint64_t *isize; + bsw2pestat_t r; + + memset(&r, 0, sizeof(bsw2pestat_t)); + isize = calloc(n, 8); + for (i = k = 0; i < n; i += 2) { + bsw2hit_t *t[2]; + int l; + if (buf[i] == 0 || buf[i]->n != 1 || buf[i+1]->n != 1) continue; // more than 1 hits + t[0] = &buf[i]->hits[0]; t[1] = &buf[i+1]->hits[0]; + if (t[0]->G2 > 0.8 * t[0]->G) continue; // the best hit is not good enough + if (t[1]->G2 > 0.8 * t[1]->G) continue; // the best hit is not good enough + l = t[0]->k > t[1]->k? t[0]->k - t[1]->k + t[1]->len : t[1]->k - t[0]->k + t[0]->len; + if (l >= max_ins) continue; // skip pairs with excessively large insert + max_len = max_len > t[0]->end - t[0]->beg? max_len : t[0]->end - t[0]->beg; + max_len = max_len > t[1]->end - t[1]->beg? max_len : t[1]->end - t[1]->beg; + isize[k++] = l; + } + ks_introsort_64(k, isize); + p25 = isize[(int)(.25 * k + .499)]; + p50 = isize[(int)(.50 * k + .499)]; + p75 = isize[(int)(.75 * k + .499)]; + ksprintf(msg, "[%s] infer the insert size distribution from %d high-quality pairs.\n", __func__, k); + if (k < 8) { + ksprintf(msg, "[%s] fail to infer the insert size distribution: too few good pairs.\n", __func__); + free(isize); + r.failed = 1; + return r; + } + tmp = (int)(p25 - OUTLIER_BOUND * (p75 - p25) + .499); + r.low = tmp > max_len? tmp : max_len; + if (r.low < 1) r.low = 1; + r.high = (int)(p75 + OUTLIER_BOUND * (p75 - p25) + .499); + if (r.low > r.high) { + ksprintf(msg, "[%s] fail to infer the insert size distribution: upper bound is smaller than max read length.\n", __func__); + free(isize); + r.failed = 1; + return r; + } + ksprintf(msg, "[%s] (25, 50, 75) percentile: (%d, %d, %d)\n", __func__, p25, p50, p75); + ksprintf(msg, "[%s] low and high boundaries for computing mean and std.dev: (%d, %d)\n", __func__, r.low, r.high); + for (i = x = 0, r.avg = 0; i < k; ++i) + if (isize[i] >= r.low && isize[i] <= r.high) + r.avg += isize[i], ++x; + if (x == 0) { + ksprintf(msg, "[%s] fail to infer the insert size distribution: no pairs within boundaries.\n", __func__); + free(isize); + r.failed = 1; + return r; + } + r.avg /= x; + for (i = 0, r.std = 0; i < k; ++i) + if (isize[i] >= r.low && isize[i] <= r.high) + r.std += (isize[i] - r.avg) * (isize[i] - r.avg); + r.std = sqrt(r.std / x); + ksprintf(msg, "[%s] mean and std.dev: (%.2f, %.2f)\n", __func__, r.avg, r.std); + tmp = (int)(p25 - 3. * (p75 - p25) + .499); + r.low = tmp > max_len? tmp : max_len; + if (r.low < 1) r.low = 1; + r.high = (int)(p75 + 3. * (p75 - p25) + .499); + if (r.low > r.avg - MAX_STDDEV * r.std) r.low = (int)(r.avg - MAX_STDDEV * r.std + .499); + r.low = tmp > max_len? tmp : max_len; + if (r.high < r.avg + MAX_STDDEV * r.std) r.high = (int)(r.avg + MAX_STDDEV * r.std + .499); + ksprintf(msg, "[%s] low and high boundaries for proper pairs: (%d, %d)\n", __func__, r.low, r.high); + free(isize); + return r; +} + +typedef struct { + int n_cigar, beg, end, len; + int64_t pos; + uint32_t *cigar; +} pairaux_t; + +extern unsigned char nst_nt4_table[256]; + +void bsw2_pair1(const bsw2opt_t *opt, int64_t l_pac, const uint8_t *pac, const bsw2pestat_t *st, const bsw2hit_t *h, int l_mseq, const char *mseq, bsw2hit_t *a, int8_t g_mat[25]) +{ + extern void seq_reverse(int len, ubyte_t *seq, int is_comp); + int64_t k, beg, end; + uint8_t *seq, *ref; + int i; + // compute the region start and end + a->n_seeds = 1; a->flag |= BSW2_FLAG_MATESW; // before calling this routine, *a has been cleared with memset(0); the flag is set with 1<<6/7 + if (h->is_rev == 0) { + beg = (int64_t)(h->k + st->avg - EXT_STDDEV * st->std - l_mseq + .499); + if (beg < h->k) beg = h->k; + end = (int64_t)(h->k + st->avg + EXT_STDDEV * st->std + .499); + a->is_rev = 1; a->flag |= 16; + } else { + beg = (int64_t)(h->k + h->end - h->beg - st->avg - EXT_STDDEV * st->std + .499); + end = (int64_t)(h->k + h->end - h->beg - st->avg + EXT_STDDEV * st->std + l_mseq + .499); + if (end > h->k + (h->end - h->beg)) end = h->k + (h->end - h->beg); + a->is_rev = 0; + } + if (beg < 1) beg = 1; + if (end > l_pac) end = l_pac; + if (end - beg < l_mseq) return; + // generate the sequence + seq = malloc(l_mseq + (end - beg)); + ref = seq + l_mseq; + for (k = beg; k < end; ++k) + ref[k - beg] = pac[k>>2] >> ((~k&3)<<1) & 0x3; + if (h->is_rev == 0) { + for (i = 0; i < l_mseq; ++i) { // on the reverse strand + int c = nst_nt4_table[(int)mseq[i]]; + seq[l_mseq - 1 - i] = c > 3? 4 : 3 - c; + } + } else { + for (i = 0; i < l_mseq; ++i) // on the forward strand + seq[i] = nst_nt4_table[(int)mseq[i]]; + } + { + int flag = KSW_XSUBO | KSW_XSTART | (l_mseq * g_mat[0] < 250? KSW_XBYTE : 0) | opt->t; + kswr_t aln; + aln = ksw_align(l_mseq, seq, end - beg, ref, 5, g_mat, opt->q, opt->r, flag, 0); + a->G = aln.score; + a->G2 = aln.score2; + if (a->G < opt->t) a->G = 0; + if (a->G2 < opt->t) a->G2 = 0; + if (a->G2) a->flag |= BSW2_FLAG_TANDEM; + a->k = beg + aln.tb; + a->len = aln.te - aln.tb + 1; + a->beg = aln.qb; + a->end = aln.qe + 1; + /* + printf("[Q] "); for (i = 0; i < l_mseq; ++i) putchar("ACGTN"[(int)seq[i]]); putchar('\n'); + printf("[R] "); for (i = 0; i < end - beg; ++i) putchar("ACGTN"[(int)ref[i]]); putchar('\n'); + printf("G=%d,G2=%d,beg=%d,end=%d,k=%lld,len=%d\n", a->G, a->G2, a->beg, a->end, a->k, a->len); + */ + } + if (a->is_rev) i = a->beg, a->beg = l_mseq - a->end, a->end = l_mseq - i; + free(seq); +} + +void bsw2_pair(const bsw2opt_t *opt, int64_t l_pac, const uint8_t *pac, int n, bsw2seq1_t *seq, bwtsw2_t **hits) +{ + extern int bsw2_resolve_duphits(const bntseq_t *bns, const bwt_t *bwt, bwtsw2_t *b, int IS); + bsw2pestat_t pes; + int i, j, k, n_rescued = 0, n_moved = 0, n_fixed = 0; + int8_t g_mat[25]; + kstring_t msg; + memset(&msg, 0, sizeof(kstring_t)); + pes = bsw2_stat(n, hits, &msg, opt->max_ins); + for (i = k = 0; i < 5; ++i) { + for (j = 0; j < 4; ++j) + g_mat[k++] = i == j? opt->a : -opt->b; + g_mat[k++] = 0; + } + for (i = 0; i < n; i += 2) { + bsw2hit_t a[2]; + memset(&a, 0, sizeof(bsw2hit_t) * 2); + a[0].flag = 1<<6; a[1].flag = 1<<7; + for (j = 0; j < 2; ++j) { // set the read1/2 flag + if (hits[i+j] == 0) continue; + for (k = 0; k < hits[i+j]->n; ++k) { + bsw2hit_t *p = &hits[i+j]->hits[k]; + p->flag |= 1<<(6+j); + } + } + if (pes.failed) continue; + if (hits[i] == 0 || hits[i+1] == 0) continue; // one end has excessive N + if (hits[i]->n != 1 && hits[i+1]->n != 1) continue; // no end has exactly one hit + if (hits[i]->n > 1 || hits[i+1]->n > 1) continue; // one read has more than one hit + if (!opt->skip_sw) { + if (hits[i+0]->n == 1) bsw2_pair1(opt, l_pac, pac, &pes, &hits[i+0]->hits[0], seq[i+1].l, seq[i+1].seq, &a[1], g_mat); + if (hits[i+1]->n == 1) bsw2_pair1(opt, l_pac, pac, &pes, &hits[i+1]->hits[0], seq[i+0].l, seq[i+0].seq, &a[0], g_mat); + } // else a[0].G == a[1].G == a[0].G2 == a[1].G2 == 0 + // the following enumerate all possibilities. It is tedious but necessary... + if (hits[i]->n + hits[i+1]->n == 1) { // one end mapped; the other not; + bwtsw2_t *p[2]; + int which; + if (hits[i]->n == 1) p[0] = hits[i], p[1] = hits[i+1], which = 1; + else p[0] = hits[i+1], p[1] = hits[i], which = 0; + if (a[which].G == 0) continue; + a[which].flag |= BSW2_FLAG_RESCUED; + if (p[1]->max == 0) { + p[1]->max = 1; + p[1]->hits = malloc(sizeof(bsw2hit_t)); + } + p[1]->hits[0] = a[which]; + p[1]->n = 1; + p[0]->hits[0].flag |= 2; + p[1]->hits[0].flag |= 2; + ++n_rescued; + } else { // then both ends mapped + int is_fixed = 0; + //fprintf(stderr, "%d; %lld,%lld; %d,%d\n", a[0].is_rev, hits[i]->hits[0].k, a[0].k, hits[i]->hits[0].end, a[0].end); + for (j = 0; j < 2; ++j) { // fix wrong mappings and wrong suboptimal alignment score + bsw2hit_t *p = &hits[i+j]->hits[0]; + if (p->G < a[j].G) { // the orginal mapping is suboptimal + a[j].G2 = a[j].G2 > p->G? a[j].G2 : p->G; // FIXME: reset BSW2_FLAG_TANDEM? + *p = a[j]; + ++n_fixed; + is_fixed = 1; + } else if (p->k != a[j].k && p->G2 < a[j].G) { + p->G2 = a[j].G; + } else if (p->k == a[j].k && p->G2 < a[j].G2) { + p->G2 = a[j].G2; + } + } + if (hits[i]->hits[0].k == a[0].k && hits[i+1]->hits[0].k == a[1].k) { // properly paired and no ends need to be moved + for (j = 0; j < 2; ++j) + hits[i+j]->hits[0].flag |= 2 | (a[j].flag & BSW2_FLAG_TANDEM); + } else if (hits[i]->hits[0].k == a[0].k || hits[i+1]->hits[0].k == a[1].k) { // a tandem match + for (j = 0; j < 2; ++j) { + hits[i+j]->hits[0].flag |= 2; + if (hits[i+j]->hits[0].k != a[j].k) + hits[i+j]->hits[0].flag |= BSW2_FLAG_TANDEM; + } + } else if (!is_fixed && (a[0].G || a[1].G)) { // it is possible to move one end + if (a[0].G && a[1].G) { // now we have two "proper pairs" + int G[2]; + double diff; + G[0] = hits[i]->hits[0].G + a[1].G; + G[1] = hits[i+1]->hits[0].G + a[0].G; + diff = fabs((double)(G[0] - G[1])) / (opt->a + opt->b) / ((hits[i]->hits[0].len + a[1].len + hits[i+1]->hits[0].len + a[0].len) / 2.); + if (diff > 0.05) a[G[0] > G[1]? 0 : 1].G = 0; + } + if (a[0].G == 0 || a[1].G == 0) { // one proper pair only + bsw2hit_t *p[2]; // p[0] points the unchanged hit; p[1] to the hit to be moved + int which, isize; + double dev, diff; + if (a[0].G) p[0] = &hits[i+1]->hits[0], p[1] = &hits[i]->hits[0], which = 0; + else p[0] = &hits[i]->hits[0], p[1] = &hits[i+1]->hits[0], which = 1; + isize = p[0]->is_rev? p[0]->k + p[0]->len - a[which].k : a[which].k + a[which].len - p[0]->k; + dev = fabs(isize - pes.avg) / pes.std; + diff = (double)(p[1]->G - a[which].G) / (opt->a + opt->b) / (p[1]->end - p[1]->beg) * 100.0; + if (diff < dev * 2.) { // then move (heuristic) + a[which].G2 = a[which].G; + p[1][0] = a[which]; + p[1]->flag |= BSW2_FLAG_MOVED | 2; + p[0]->flag |= 2; + ++n_moved; + } + } + } else if (is_fixed) { + hits[i+0]->hits[0].flag |= 2; + hits[i+1]->hits[0].flag |= 2; + } + } + } + ksprintf(&msg, "[%s] #fixed=%d, #rescued=%d, #moved=%d\n", __func__, n_fixed, n_rescued, n_moved); + fputs(msg.s, stderr); + free(msg.s); +} diff --git a/code_of_conduct.md b/code_of_conduct.md new file mode 100644 index 0000000..b7175c1 --- /dev/null +++ b/code_of_conduct.md @@ -0,0 +1,30 @@ +## Contributor Code of Conduct + +As contributors and maintainers of this project, we pledge to respect all +people who contribute through reporting issues, posting feature requests, +updating documentation, submitting pull requests or patches, and other +activities. + +We are committed to making participation in this project a harassment-free +experience for everyone, regardless of level of experience, gender, gender +identity and expression, sexual orientation, disability, personal appearance, +body size, race, age, or religion. + +Examples of unacceptable behavior by participants include the use of sexual +language or imagery, derogatory comments or personal attacks, trolling, public +or private harassment, insults, or other unprofessional conduct. + +Project maintainers have the right and responsibility to remove, edit, or +reject comments, commits, code, wiki edits, issues, and other contributions +that are not aligned to this Code of Conduct. Project maintainers or +contributors who do not follow the Code of Conduct may be removed from the +project team. + +Instances of abusive, harassing, or otherwise unacceptable behavior may be +reported by opening an issue or contacting the maintainer via email. + +This Code of Conduct is adapted from the [Contributor Covenant][cc], [version +1.0.0][v1]. + +[cc]: http://contributor-covenant.org/ +[v1]: http://contributor-covenant.org/version/1/0/0/ diff --git a/debug.c b/debug.c new file mode 100644 index 0000000..0e6b8d0 --- /dev/null +++ b/debug.c @@ -0,0 +1,59 @@ +/********************************************************************************************* + Description: data and files for debugging + Copyright : All right reserved by . + + Author : + Date : 2024/04/09 +***********************************************************************************************/ +#include +#include "debug.h" + +FILE *gf[4] = {0}, + *gfq[4] = {0}, + *gft[4] = {0}, + *gfi[4] = {0}; + +int open_qti_files() +{ + char fn[1024] = {0}; + int i = 0; + for (; i < 4; ++i) + { + sprintf(fn, "./output/q%d.txt", i); + gfq[i] = fopen(fn, "w"); + sprintf(fn, "./output/t%d.txt", i); + gft[i] = fopen(fn, "w"); + sprintf(fn, "./output/i%d.txt", i); + gfi[i] = fopen(fn, "w"); + } + return 0; +} + +int open_debug_files() +{ + char fn[1024] = {0}; + int i = 0; + for (; i < 4; ++i) + { + sprintf(fn, "./output/fp%d.txt", i); + gf[i] = fopen(fn, "w"); + } + return 0; +} + +int close_files() +{ + int i = 0; + for (; i < 4; ++i) + { + if (gf[i] != 0) + fclose(gf[i]); + if (gfq[i] != 0) + fclose(gfq[i]); + if (gft[i] != 0) + fclose(gft[i]); + if (gfi[i] != 0) + fclose(gfi[i]); + } + return 0; +} \ No newline at end of file diff --git a/debug.h b/debug.h new file mode 100644 index 0000000..33440dc --- /dev/null +++ b/debug.h @@ -0,0 +1,28 @@ +/********************************************************************************************* + Description: data and files for debugging + Copyright : All right reserved by . + + Author : + Date : 2024/04/09 +***********************************************************************************************/ +#include + +////////////////// for debug and test ////////////////////////// + +#define DEBUG_FILE_OUTPUT // gfp1-4,debug +// #define COUNT_SEED_LENGTH // seed1, +// #define GET_FULL_MATCH_READ // reads +// #define COUNT_CALC_NUM // BSW +// #define GET_DIFFERENT_EXTENSION_LENGTH // extensionquery,target, +// #define GET_KSW_ALIGN_SEQ +// #define DEBUG_SW_EXTEND // bswdebug + +//////////////////////////////////////////////////////////////// + +extern FILE *gf[4], *gfq[4], *gft[4], *gfi[4]; + +int open_qti_files(); + +int open_debug_files(); + +int close_files(); \ No newline at end of file diff --git a/example.c b/example.c new file mode 100644 index 0000000..4e8494d --- /dev/null +++ b/example.c @@ -0,0 +1,60 @@ +#include +#include +#include +#include +#include +#include "bwamem.h" +#include "kseq.h" // for the FASTA/Q parser +KSEQ_DECLARE(gzFile) + +int main(int argc, char *argv[]) +{ + bwaidx_t *idx; + gzFile fp; + kseq_t *ks; + mem_opt_t *opt; + + if (argc < 3) { + fprintf(stderr, "Usage: bwamem-lite \n"); + return 1; + } + + idx = bwa_idx_load(argv[1], BWA_IDX_ALL); // load the BWA index + if (NULL == idx) { + fprintf(stderr, "Index load failed.\n"); + exit(EXIT_FAILURE); + } + fp = strcmp(argv[2], "-")? gzopen(argv[2], "r") : gzdopen(fileno(stdin), "r"); + if (NULL == fp) { + fprintf(stderr, "Couldn't open %s : %s\n", + strcmp(argv[2], "-") ? argv[2] : "stdin", + errno ? strerror(errno) : "Out of memory"); + exit(EXIT_FAILURE); + } + ks = kseq_init(fp); // initialize the FASTA/Q parser + opt = mem_opt_init(); // initialize the BWA-MEM parameters to the default values + + while (kseq_read(ks) >= 0) { // read one sequence + mem_alnreg_v ar; + int i, k; + ar = mem_align1(opt, idx->bwt, idx->bns, idx->pac, ks->seq.l, ks->seq.s); // get all the hits + for (i = 0; i < ar.n; ++i) { // traverse each hit + mem_aln_t a; + if (ar.a[i].secondary >= 0) continue; // skip secondary alignments + a = mem_reg2aln(opt, idx->bns, idx->pac, ks->seq.l, ks->seq.s, &ar.a[i]); // get forward-strand position and CIGAR + // print alignment + printf("%s\t%c\t%s\t%ld\t%d\t", ks->name.s, "+-"[a.is_rev], idx->bns->anns[a.rid].name, (long)a.pos, a.mapq); + for (k = 0; k < a.n_cigar; ++k) // print CIGAR + printf("%d%c", a.cigar[k]>>4, "MIDSH"[a.cigar[k]&0xf]); + printf("\t%d\n", a.NM); // print edit distance + free(a.cigar); // don't forget to deallocate CIGAR + } + free(ar.a); // and deallocate the hit list + } + + free(opt); + kseq_destroy(ks); + gzclose(fp); + bwa_idx_destroy(idx); + return 0; +} diff --git a/fastmap.c b/fastmap.c new file mode 100644 index 0000000..46dc6c2 --- /dev/null +++ b/fastmap.c @@ -0,0 +1,771 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include "bwa.h" +#include "bwamem.h" +#include "kvec.h" +#include "utils.h" +#include "bntseq.h" +#include "kseq.h" +#include "fmt_idx.h" +#include "yarn.h" +#include "profiling.h" +#include "debug.h" +KSEQ_DECLARE(gzFile) + +extern unsigned char nst_nt4_table[256]; + +void *kopen(const char *fn, int *_fd); +int kclose(void *a); +void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_data, int n_steps); + +typedef struct { + int n_seqs; + int n_sams; + int m_seqs; + int m_sams; + bseq1_t *seqs; + seq_sam_t *sams; +} ktp_data_t; + +typedef struct { + kseq_t *ks, *ks2; + mem_opt_t *opt; + mem_pestat_t *pes0; + int64_t n_processed; + int copy_comment, actual_chunk_size; + bwaidx_t *idx; + mem_worker_t *w; + int data_idx; // pingpong buffer index + ktp_data_t *data; + int wbuf_size; + char *wbuf; + volatile int read_complete; + volatile int calc_complete; + long read_idx; + long calc_idx; + long write_idx; +} ktp_aux_t; + +// read +static inline void *read_data(ktp_aux_t *aux, ktp_data_t *data) +{ + + PROF_START(read); + ktp_data_t *ret = aux->data + aux->data_idx; + aux->data_idx = !aux->data_idx; + int64_t size = 0; + bseq_read(aux->actual_chunk_size, &ret->n_seqs, aux->ks, aux->ks2, aux->copy_comment, &size, &ret->m_seqs, &ret->seqs); + PROF_END(gprof[G_READ], read); + +#if 0 + // + int i; + int64_t ms = 0; + for (i = 0; i < ret->n_seqs; ++i) + { + ms += ret->seqs[i].m_name + ret->seqs[i].m_seq + ret->seqs[i].m_comment + ret->seqs[i].m_qual; + } + fprintf(stderr, "seq size: %ld M\n", ms / 1024 / 1024); +#endif + + if (ret->n_seqs == 0) { + return 0; + } + if (bwa_verbose >= 3) + fprintf(stderr, "[M::%s] read %d sequences (%ld bp)...\n", __func__, ret->n_seqs, (long)size); + return ret; +} + +// calculate +static inline void *calc_data(ktp_aux_t *aux, ktp_data_t *data) +{ + PROF_START(compute); + const mem_opt_t *opt = aux->opt; + if (data->n_sams != data->n_seqs) { + if (data->m_sams < data->m_seqs) { + data->m_sams = data->m_seqs; + data->sams = realloc(data->sams, data->m_sams * sizeof(seq_sam_t)); + memset(data->sams + data->n_sams, 0, (data->m_sams - data->n_sams) * sizeof(seq_sam_t)); + } + data->n_sams = data->n_seqs; + } + if (opt->flag & MEM_F_SMARTPE) { + int i; + fprintf(stderr, "here MEM_F_SMARTPE\n"); + bseq1_t *sep[2]; + seq_sam_t *ss[2]; + int n_sep[2]; + mem_opt_t tmp_opt = *opt; + bseq_classify(data->n_seqs, data->seqs, n_sep, sep); + ss[0] = calloc(0, n_sep[0] * sizeof(seq_sam_t)); + ss[1] = calloc(0, n_sep[1] * sizeof(seq_sam_t)); + if (bwa_verbose >= 3) + fprintf(stderr, "[M::%s] %d single-end sequences; %d paired-end sequences\n", __func__, n_sep[0], n_sep[1]); + if (n_sep[0]) { + tmp_opt.flag &= ~MEM_F_PE; + mem_process_seqs(&tmp_opt, aux->w, aux->n_processed, n_sep[0], sep[0], 0, ss[0]); + for (i = 0; i < n_sep[0]; ++i) + data->sams[sep[0][i].id].sam = ss[0][i].sam; + } + if (n_sep[1]) { + tmp_opt.flag |= MEM_F_PE; + mem_process_seqs(&tmp_opt, aux->w, aux->n_processed + n_sep[0], n_sep[1], sep[1], aux->pes0, ss[1]); + for (i = 0; i < n_sep[1]; ++i) + data->sams[sep[1][i].id].sam = ss[1][i].sam; + } + free(sep[0]); free(sep[1]); + free(ss[0]); free(ss[1]); + } else mem_process_seqs(opt, aux->w, aux->n_processed, data->n_seqs, data->seqs, aux->pes0, data->sams); + aux->n_processed += data->n_seqs; + PROF_END(gprof[G_COMPUTE], compute); + + return data; +} + +// write +static inline void *write_data(ktp_aux_t *aux, ktp_data_t *data) +{ + int i; + PROF_START(write); + // int64_t ms = 0; + int buf_written = 0; + for (i = 0; i < data->n_sams; ++i) + { + const int slen = data->sams[i].sam.l; + if (slen && (buf_written + slen) < aux->wbuf_size) + { + memcpy(&aux->wbuf[buf_written], data->sams[i].sam.s, slen); + buf_written += slen; + } + else if (buf_written > 0) + { + err_fwrite(aux->wbuf, 1, buf_written, stdout); + if ((buf_written + slen) >= aux->wbuf_size) + { + memcpy(&aux->wbuf[0], data->sams[i].sam.s, slen); + buf_written = slen; + } + else + { + buf_written = 0; + } + } + } + if (buf_written > 0) { + err_fwrite(aux->wbuf, 1, buf_written, stdout); + } + + //for (i = 0; i < data->n_sams; ++i) + //{ + // //ms += data->sams[i].sam.m; + // if (data->sams[i].sam.l) + // err_fputs(data->sams[i].sam.s, stdout); + //} + + //fprintf(stderr, "sam size: %ld M\n", ms / 1024 / 1024); + PROF_END(gprof[G_WRITE], write); + return 0; +} + +// io , +static void *process(void *shared, int step, void *_data) +{ + ktp_aux_t *aux = (ktp_aux_t*)shared; + ktp_data_t *data = (ktp_data_t*)_data; + if (step == 0) { + return read_data(aux, data); + } else if (step == 1) { + return calc_data(aux, data); + } else if (step == 2) { + return write_data(aux, data); + } + return 0; +} + +////////////// pipeline +static lock_t *input_have = NULL; +static lock_t *output_have = NULL; + +static void *thread_read(void *data) +{ + ktp_aux_t *aux = (ktp_aux_t *)data; + while (1) + { + PROF_START(w1); + POSSESS(input_have); + WAIT_FOR(input_have, NOT_TO_BE, 0); + RELEASE(input_have); + PROF_END(gprof[G_read_wait_1], w1); + // fprintf(stderr, "start read: %ld\n", aux->read_idx); + if (read_data(aux, aux->data) == 0) { + POSSESS(input_have); + aux->read_complete = 1; + TWIST(input_have, BY, -1); + break; + } + PROF_START(w2); + POSSESS(input_have); + aux->read_idx++; + TWIST(input_have, BY, -1); + PROF_END(gprof[G_read_wait_2], w2); + // fprintf(stderr, "next read: %ld\n", aux->read_idx); + } + return 0; +} + +static void *thread_calc(void *data) +{ + ktp_aux_t *aux = (ktp_aux_t *)data; + int d_idx = 0; + int add_idx = 0; + while (1) + { + // fprintf(stderr, "start calc: %ld\n", aux->calc_idx); + PROF_START(w1); + POSSESS(input_have); + WAIT_FOR(input_have, NOT_TO_BE, 2); + RELEASE(input_have); // ? + + POSSESS(output_have); + WAIT_FOR(output_have, NOT_TO_BE, 2); + RELEASE(output_have); + PROF_END(gprof[G_comp_wait_1], w1); + + if (aux->calc_idx < aux->read_idx) { + calc_data(aux, aux->data + d_idx); + d_idx = !d_idx; + add_idx = 1; + } + if (aux->read_complete) + { + POSSESS(output_have); + if (add_idx) aux->calc_idx ++; + aux->calc_complete = 1; + TWIST(output_have, BY, 1); // + break; // + } + PROF_START(w2); + POSSESS(output_have); + if (add_idx) aux->calc_idx ++; + TWIST(output_have, BY, 1); + + POSSESS(input_have); + TWIST(input_have, BY, 1); + PROF_END(gprof[G_comp_wait_2], w2); + // fprintf(stderr, "next calc: %ld\n", aux->calc_idx); + } + return 0; +} + +static void *thread_write(void *data) +{ + ktp_aux_t *aux = (ktp_aux_t *)data; + int d_idx = 0; + while (1) + { + // fprintf(stderr, "start write: %ld\n", aux->write_idx); + PROF_START(w1); + POSSESS(output_have); + WAIT_FOR(output_have, NOT_TO_BE, 0); + RELEASE(output_have); + PROF_END(gprof[G_write_wait_1], w1); + if (aux->write_idx < aux->calc_idx) { + write_data(aux, aux->data + d_idx); + d_idx = !d_idx; + aux->write_idx++; + } + if (aux->calc_complete) { + if (aux->write_idx < aux->calc_idx) + write_data(aux, aux->data + d_idx); + break; + } + PROF_START(w2); + POSSESS(output_have); + TWIST(output_have, BY, -1); + PROF_END(gprof[G_write_wait_2], w2); + // fprintf(stderr, "next write: %ld\n", aux->write_idx); + } + return 0; +} + +static void new_pipeline(ktp_aux_t *aux) +{ + input_have = NEW_LOCK(2); + output_have = NEW_LOCK(0); + pthread_t tid[3]; + int i; + + pthread_create(&tid[0], 0, thread_read, aux); + pthread_create(&tid[1], 0, thread_calc, aux); + pthread_create(&tid[2], 0, thread_write, aux); + + for (i = 0; i < 3; ++i) pthread_join(tid[i], 0); +} + +////////////// + +static void update_a(mem_opt_t *opt, const mem_opt_t *opt0) +{ + if (opt0->a) { // matching score is changed + if (!opt0->b) opt->b *= opt->a; + if (!opt0->T) opt->T *= opt->a; + if (!opt0->o_del) opt->o_del *= opt->a; + if (!opt0->e_del) opt->e_del *= opt->a; + if (!opt0->o_ins) opt->o_ins *= opt->a; + if (!opt0->e_ins) opt->e_ins *= opt->a; + if (!opt0->zdrop) opt->zdrop *= opt->a; + if (!opt0->pen_clip5) opt->pen_clip5 *= opt->a; + if (!opt0->pen_clip3) opt->pen_clip3 *= opt->a; + if (!opt0->pen_unpaired) opt->pen_unpaired *= opt->a; + } +} + +int main_mem(int argc, char *argv[]) +{ +#ifdef DEBUG_FILE_OUTPUT + open_debug_files(); + // open_debug_files +#endif + +#ifdef SHOW_PERF +#if USE_RDTSC + uint64_t tmp_time = __rdtsc(); + sleep(1); + proc_freq = __rdtsc() - tmp_time; +#else + proc_freq = 1000; +#endif +#endif + + PROF_START(all); + PROF_START(prepare); + mem_opt_t *opt, opt0; + int fd, fd2, i, c, ignore_alt = 0, no_mt_io = 0; + int fixed_chunk_size = -1; + gzFile fp, fp2 = 0; + char *p, *rg_line = 0, *hdr_line = 0; + const char *mode = 0; + void *ko = 0, *ko2 = 0; + mem_pestat_t pes[4]; + ktp_aux_t aux; + int useERT = 0; + + memset(&aux, 0, sizeof(ktp_aux_t)); + memset(pes, 0, 4 * sizeof(mem_pestat_t)); + for (i = 0; i < 4; ++i) pes[i].failed = 1; + + aux.opt = opt = mem_opt_init(); + memset(&opt0, 0, sizeof(mem_opt_t)); + while ((c = getopt(argc, argv, "512qpaMCSPVYjuk:c:v:s:r:t:b:R:A:B:O:E:U:w:L:d:T:Q:D:m:I:N:o:f:W:x:G:h:y:K:X:H:F:z:Z")) >= 0) { + if (c == 'k') opt->min_seed_len = atoi(optarg), opt0.min_seed_len = 1; + else if (c == '1') no_mt_io = 1; + else if (c == '2') no_mt_io = 2; + else if (c == 'x') mode = optarg; + else if (c == 'w') opt->w = atoi(optarg), opt0.w = 1; + else if (c == 'A') opt->a = atoi(optarg), opt0.a = 1; + else if (c == 'B') opt->b = atoi(optarg), opt0.b = 1; + else if (c == 'T') opt->T = atoi(optarg), opt0.T = 1; + else if (c == 'U') opt->pen_unpaired = atoi(optarg), opt0.pen_unpaired = 1; + else if (c == 't') opt->n_threads = atoi(optarg), opt->n_threads = opt->n_threads > 1? opt->n_threads : 1; + else if (c == 'b') opt->batch_size = atoi(optarg) >> 1 << 1, opt->batch_size = opt->batch_size > 1? opt->batch_size : 512; + else if (c == 'P') opt->flag |= MEM_F_NOPAIRING; + else if (c == 'a') opt->flag |= MEM_F_ALL; + else if (c == 'p') opt->flag |= MEM_F_PE | MEM_F_SMARTPE; + else if (c == 'M') opt->flag |= MEM_F_NO_MULTI; + else if (c == 'S') opt->flag |= MEM_F_NO_RESCUE; + else if (c == 'Y') opt->flag |= MEM_F_SOFTCLIP; + else if (c == 'V') opt->flag |= MEM_F_REF_HDR; + else if (c == '5') opt->flag |= MEM_F_PRIMARY5 | MEM_F_KEEP_SUPP_MAPQ; // always apply MEM_F_KEEP_SUPP_MAPQ with -5 + else if (c == 'q') opt->flag |= MEM_F_KEEP_SUPP_MAPQ; + else if (c == 'u') opt->flag |= MEM_F_XB; + else if (c == 'c') opt->max_occ = atoi(optarg), opt0.max_occ = 1; + else if (c == 'd') opt->zdrop = atoi(optarg), opt0.zdrop = 1; + else if (c == 'v') bwa_verbose = atoi(optarg); + else if (c == 'j') ignore_alt = 1; + else if (c == 'r') opt->split_factor = atof(optarg), opt0.split_factor = 1.; + else if (c == 'D') opt->drop_ratio = atof(optarg), opt0.drop_ratio = 1.; + else if (c == 'm') opt->max_matesw = atoi(optarg), opt0.max_matesw = 1; + else if (c == 's') opt->split_width = atoi(optarg), opt0.split_width = 1; + else if (c == 'G') opt->max_chain_gap = atoi(optarg), opt0.max_chain_gap = 1; + else if (c == 'N') opt->max_chain_extend = atoi(optarg), opt0.max_chain_extend = 1; + else if (c == 'o' || c == 'f') xreopen(optarg, "wb", stdout); + else if (c == 'W') opt->min_chain_weight = atoi(optarg), opt0.min_chain_weight = 1; + else if (c == 'y') opt->max_mem_intv = atol(optarg), opt0.max_mem_intv = 1; + else if (c == 'C') aux.copy_comment = 1; + else if (c == 'K') fixed_chunk_size = atoi(optarg); + else if (c == 'X') opt->mask_level = atof(optarg); + else if (c == 'F') bwa_dbg = atoi(optarg); + else if (c == 'h') { + opt0.max_XA_hits = opt0.max_XA_hits_alt = 1; + opt->max_XA_hits = opt->max_XA_hits_alt = strtol(optarg, &p, 10); + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + opt->max_XA_hits_alt = strtol(p+1, &p, 10); + } + else if (c == 'z') opt->XA_drop_ratio = atof(optarg); + else if (c == 'Q') { + opt0.mapQ_coef_len = 1; + opt->mapQ_coef_len = atoi(optarg); + opt->mapQ_coef_fac = opt->mapQ_coef_len > 0? log(opt->mapQ_coef_len) : 0; + } else if (c == 'O') { + opt0.o_del = opt0.o_ins = 1; + opt->o_del = opt->o_ins = strtol(optarg, &p, 10); + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + opt->o_ins = strtol(p+1, &p, 10); + } else if (c == 'E') { + opt0.e_del = opt0.e_ins = 1; + opt->e_del = opt->e_ins = strtol(optarg, &p, 10); + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + opt->e_ins = strtol(p+1, &p, 10); + } else if (c == 'L') { + opt0.pen_clip5 = opt0.pen_clip3 = 1; + opt->pen_clip5 = opt->pen_clip3 = strtol(optarg, &p, 10); + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + opt->pen_clip3 = strtol(p+1, &p, 10); + } else if (c == 'R') { + if ((rg_line = bwa_set_rg(optarg)) == 0) return 1; // FIXME: memory leak + } else if (c == 'H') { + if (optarg[0] != '@') { + FILE *fp; + if ((fp = fopen(optarg, "r")) != 0) { + char *buf; + buf = calloc(1, 0x10000); + while (fgets(buf, 0xffff, fp)) { + i = strlen(buf); + assert(buf[i-1] == '\n'); // a long line + buf[i-1] = 0; + hdr_line = bwa_insert_header(buf, hdr_line); + } + free(buf); + fclose(fp); + } + } else hdr_line = bwa_insert_header(optarg, hdr_line); + } else if (c == 'I') { // specify the insert size distribution + aux.pes0 = pes; + pes[1].failed = 0; + pes[1].avg = strtod(optarg, &p); + pes[1].std = pes[1].avg * .1; + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + pes[1].std = strtod(p+1, &p); + pes[1].high = (int)(pes[1].avg + 4. * pes[1].std + .499); + pes[1].low = (int)(pes[1].avg - 4. * pes[1].std + .499); + if (pes[1].low < 1) pes[1].low = 1; + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + pes[1].high = (int)(strtod(p+1, &p) + .499); + if (*p != 0 && ispunct(*p) && isdigit(p[1])) + pes[1].low = (int)(strtod(p+1, &p) + .499); + if (bwa_verbose >= 3) + fprintf(stderr, "[M::%s] mean insert size: %.3f, stddev: %.3f, max: %d, min: %d\n", + __func__, pes[1].avg, pes[1].std, pes[1].high, pes[1].low); + } + else return 1; + } + + if (rg_line) { + hdr_line = bwa_insert_header(rg_line, hdr_line); + free(rg_line); + } + + if (opt->n_threads < 1) opt->n_threads = 1; + if (opt->batch_size < 1) opt->batch_size = 256; + // fprintf(stderr, "batch_size: %d\n", opt->batch_size); + + if (optind + 1 >= argc || optind + 3 < argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa mem [options] [in2.fq]\n\n"); + fprintf(stderr, "Algorithm options:\n\n"); + fprintf(stderr, " -t INT number of threads [%d]\n", opt->n_threads); + fprintf(stderr, " -b INT batch size of reads to process at one time [%d]\n", opt->batch_size); + fprintf(stderr, " -k INT minimum seed length [%d]\n", opt->min_seed_len); + fprintf(stderr, " -w INT band width for banded alignment [%d]\n", opt->w); + fprintf(stderr, " -d INT off-diagonal X-dropoff [%d]\n", opt->zdrop); + fprintf(stderr, " -r FLOAT look for internal seeds inside a seed longer than {-k} * FLOAT [%g]\n", opt->split_factor); + fprintf(stderr, " -y INT seed occurrence for the 3rd round seeding [%ld]\n", (long)opt->max_mem_intv); +// fprintf(stderr, " -s INT look for internal seeds inside a seed with less than INT occ [%d]\n", opt->split_width); + fprintf(stderr, " -c INT skip seeds with more than INT occurrences [%d]\n", opt->max_occ); + fprintf(stderr, " -D FLOAT drop chains shorter than FLOAT fraction of the longest overlapping chain [%.2f]\n", opt->drop_ratio); + fprintf(stderr, " -W INT discard a chain if seeded bases shorter than INT [0]\n"); + fprintf(stderr, " -m INT perform at most INT rounds of mate rescues for each read [%d]\n", opt->max_matesw); + fprintf(stderr, " -S skip mate rescue\n"); + fprintf(stderr, " -2 read and write in different disks \n"); + fprintf(stderr, " -P skip pairing; mate rescue performed unless -S also in use\n"); + fprintf(stderr, "\nScoring options:\n\n"); + fprintf(stderr, " -A INT score for a sequence match, which scales options -TdBOELU unless overridden [%d]\n", opt->a); + fprintf(stderr, " -B INT penalty for a mismatch [%d]\n", opt->b); + fprintf(stderr, " -O INT[,INT] gap open penalties for deletions and insertions [%d,%d]\n", opt->o_del, opt->o_ins); + fprintf(stderr, " -E INT[,INT] gap extension penalty; a gap of size k cost '{-O} + {-E}*k' [%d,%d]\n", opt->e_del, opt->e_ins); + fprintf(stderr, " -L INT[,INT] penalty for 5'- and 3'-end clipping [%d,%d]\n", opt->pen_clip5, opt->pen_clip3); + fprintf(stderr, " -U INT penalty for an unpaired read pair [%d]\n\n", opt->pen_unpaired); + fprintf(stderr, " -x STR read type. Setting -x changes multiple parameters unless overridden [null]\n"); + fprintf(stderr, " pacbio: -k17 -W40 -r10 -A1 -B1 -O1 -E1 -L0 (PacBio reads to ref)\n"); + fprintf(stderr, " ont2d: -k14 -W20 -r10 -A1 -B1 -O1 -E1 -L0 (Oxford Nanopore 2D-reads to ref)\n"); + fprintf(stderr, " intractg: -B9 -O16 -L5 (intra-species contigs to ref)\n"); + fprintf(stderr, "\nInput/output options:\n\n"); + fprintf(stderr, " -p smart pairing (ignoring in2.fq)\n"); + fprintf(stderr, " -R STR read group header line such as '@RG\\tID:foo\\tSM:bar' [null]\n"); + fprintf(stderr, " -H STR/FILE insert STR to header if it starts with @; or insert lines in FILE [null]\n"); + fprintf(stderr, " -o FILE sam file to output results to [stdout]\n"); + fprintf(stderr, " -j treat ALT contigs as part of the primary assembly (i.e. ignore .alt file)\n"); + fprintf(stderr, " -5 for split alignment, take the alignment with the smallest query (not genomic) coordinate as primary\n"); + fprintf(stderr, " -q don't modify mapQ of supplementary alignments\n"); + fprintf(stderr, " -K INT process INT input bases in each batch regardless of nThreads (for reproducibility) []\n"); + fprintf(stderr, "\n"); + fprintf(stderr, " -v INT verbosity level: 1=error, 2=warning, 3=message, 4+=debugging [%d]\n", bwa_verbose); + fprintf(stderr, " -T INT minimum score to output [%d]\n", opt->T); + fprintf(stderr, " -h INT[,INT] if there are %.2f%% of the max score, output all in XA [%d,%d]\n", + opt->XA_drop_ratio * 100.0, + opt->max_XA_hits, opt->max_XA_hits_alt); + fprintf(stderr, " A second value may be given for alternate sequences.\n"); + fprintf(stderr, " -z FLOAT The fraction of the max score to use with -h [%f].\n", opt->XA_drop_ratio); + fprintf(stderr, " specify the mean, standard deviation (10%% of the mean if absent), max\n"); + fprintf(stderr, " -a output all alignments for SE or unpaired PE\n"); + fprintf(stderr, " -C append FASTA/FASTQ comment to SAM output\n"); + fprintf(stderr, " -V output the reference FASTA header in the XR tag\n"); + fprintf(stderr, " -Y use soft clipping for supplementary alignments\n"); + fprintf(stderr, " -M mark shorter split hits as secondary\n\n"); + fprintf(stderr, " -I FLOAT[,FLOAT[,INT[,INT]]]\n"); + fprintf(stderr, " specify the mean, standard deviation (10%% of the mean if absent), max\n"); + fprintf(stderr, " (4 sigma from the mean if absent) and min of the insert size distribution.\n"); + fprintf(stderr, " FR orientation only. [inferred]\n"); + fprintf(stderr, " -u output XB instead of XA; XB is XA with the alignment score and mapping quality added.\n"); + fprintf(stderr, "\n"); + fprintf(stderr, "Note: Please read the man page for detailed description of the command line and options.\n"); + fprintf(stderr, "\n"); + free(opt); + return 1; + } + + if (mode) { + if (strcmp(mode, "intractg") == 0) { + if (!opt0.o_del) opt->o_del = 16; + if (!opt0.o_ins) opt->o_ins = 16; + if (!opt0.b) opt->b = 9; + if (!opt0.pen_clip5) opt->pen_clip5 = 5; + if (!opt0.pen_clip3) opt->pen_clip3 = 5; + } else if (strcmp(mode, "pacbio") == 0 || strcmp(mode, "pbref") == 0 || strcmp(mode, "ont2d") == 0) { + if (!opt0.o_del) opt->o_del = 1; + if (!opt0.e_del) opt->e_del = 1; + if (!opt0.o_ins) opt->o_ins = 1; + if (!opt0.e_ins) opt->e_ins = 1; + if (!opt0.b) opt->b = 1; + if (opt0.split_factor == 0.) opt->split_factor = 10.; + if (strcmp(mode, "ont2d") == 0) { + if (!opt0.min_chain_weight) opt->min_chain_weight = 20; + if (!opt0.min_seed_len) opt->min_seed_len = 14; + if (!opt0.pen_clip5) opt->pen_clip5 = 0; + if (!opt0.pen_clip3) opt->pen_clip3 = 0; + } else { + if (!opt0.min_chain_weight) opt->min_chain_weight = 40; + if (!opt0.min_seed_len) opt->min_seed_len = 17; + if (!opt0.pen_clip5) opt->pen_clip5 = 0; + if (!opt0.pen_clip3) opt->pen_clip3 = 0; + } + } else { + fprintf(stderr, "[E::%s] unknown read type '%s'\n", __func__, mode); + return 1; // FIXME memory leak + } + } else update_a(opt, &opt0); + bwa_fill_scmat(opt->a, opt->b, opt->mat); + PROF_END(gprof[G_PREPARE], prepare); + + PROF_START(idx); + if (useERT) aux.idx = bwa_ertidx_load_from_shm(argv[optind]); + else aux.idx = bwa_fmtidx_load_from_shm(argv[optind]); + if (aux.idx == 0) { + if (!useERT) { + if ((aux.idx = bwa_idx_load(argv[optind], BWA_IDX_BNS | BWA_IDX_PAC | BWA_IDX_FMT)) == 0) return 1; // FIXME: memory leak + } + else { + if ((aux.idx = bwa_ertidx_load_from_disk(argv[optind])) == 0) return 1; // FIXME: memory leak + } + + } else if (bwa_verbose >= 3) + fprintf(stderr, "[M::%s] load the bwa index from shared memory\n", __func__); + if (ignore_alt) + for (i = 0; i < aux.idx->bns->n_seqs; ++i) + aux.idx->bns->anns[i].is_alt = 0; + PROF_END(gprof[G_LOAD_IDX], idx); + + ko = kopen(argv[optind + 1], &fd); + if (ko == 0) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] fail to open file `%s'.\n", __func__, argv[optind + 1]); + return 1; + } + fp = gzdopen(fd, "r"); + start_async_read(fp); + // stop_async_read(fp); + aux.ks = kseq_init(fp); + if (optind + 2 < argc) { + if (opt->flag&MEM_F_PE) { + if (bwa_verbose >= 2) + fprintf(stderr, "[W::%s] when '-p' is in use, the second query file is ignored.\n", __func__); + } else { + ko2 = kopen(argv[optind + 2], &fd2); + if (ko2 == 0) { + if (bwa_verbose >= 1) fprintf(stderr, "[E::%s] fail to open file `%s'.\n", __func__, argv[optind + 2]); + return 1; + } + fp2 = gzdopen(fd2, "r"); + start_async_read(fp2); + aux.ks2 = kseq_init(fp2); + opt->flag |= MEM_F_PE; + } + } + + //fprintf(stderr, "%ld %ld %ld %ld %ld\n", aux.idx->fmt->L2[0], aux.idx->fmt->L2[1], aux.idx->fmt->L2[2], aux.idx->fmt->L2[3], aux.idx->fmt->L2[4]); + aux.w = init_mem_worker(opt, aux.idx->fmt, aux.idx->ert, aux.idx->bns, aux.idx->pac, useERT); + aux.data = calloc(2, sizeof(ktp_data_t)); + + bwa_print_sam_hdr(aux.idx->bns, hdr_line); + aux.actual_chunk_size = fixed_chunk_size > 0? fixed_chunk_size : opt->chunk_size * opt->n_threads; + + // allocate write buffer + aux.wbuf_size = 16777216; + aux.wbuf = malloc(aux.wbuf_size); + + PROF_START(pipeline); + + if (no_mt_io == 2) new_pipeline(&aux); + else kt_pipeline(no_mt_io? 1 : 2, process, &aux, 3); + + PROF_END(gprof[G_PIPELINE], pipeline); + +// free(hdr_line); +// free(opt); +// bwa_idx_destroy(aux.idx); +// kseq_destroy(aux.ks); + stop_async_read(fp); + err_gzclose(fp); kclose(ko); + if (aux.ks2) { +// kseq_destroy(aux.ks2); + stop_async_read(fp2); + err_gzclose(fp2); kclose(ko2); + } + PROF_END(gprof[G_ALL], all); + +#ifdef SHOW_PERF + display_stats(opt->n_threads); +#endif + +#ifdef SHOW_DATA_PERF + fprintf(stderr, "\n"); + // fprintf(stderr, "full_match: %ld, all: %ld\n", gdat[1], gdat[0]); + fprintf(stderr, "\n"); +#endif + +#ifdef DEBUG_FILE_OUTPUT + close_files(); +#endif + + return 0; +} + +int main_fastmap(int argc, char *argv[]) +{ + int c, i, min_iwidth = 20, min_len = 17, print_seq = 0, min_intv = 1, max_len = INT_MAX; + uint64_t max_intv = 0; + kseq_t *seq; + bwtint_t k; + gzFile fp; + smem_i *itr; + const bwtintv_v *a; + bwaidx_t *idx; + + while ((c = getopt(argc, argv, "w:l:pi:I:L:")) >= 0) { + switch (c) { + case 'p': print_seq = 1; break; + case 'w': min_iwidth = atoi(optarg); break; + case 'l': min_len = atoi(optarg); break; + case 'i': min_intv = atoi(optarg); break; + case 'I': max_intv = atol(optarg); break; + case 'L': max_len = atoi(optarg); break; + default: return 1; + } + } + if (optind + 1 >= argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa fastmap [options] \n\n"); + fprintf(stderr, "Options: -l INT min SMEM length to output [%d]\n", min_len); + fprintf(stderr, " -w INT max interval size to find coordiantes [%d]\n", min_iwidth); + fprintf(stderr, " -i INT min SMEM interval size [%d]\n", min_intv); + fprintf(stderr, " -L INT max MEM length [%d]\n", max_len); + fprintf(stderr, " -I INT stop if MEM is longer than -l with a size less than INT [%ld]\n", (long)max_intv); + fprintf(stderr, "\n"); + return 1; + } + + fp = xzopen(argv[optind + 1], "r"); + seq = kseq_init(fp); + if ((idx = bwa_idx_load(argv[optind], BWA_IDX_BWT|BWA_IDX_BNS)) == 0) return 1; + itr = smem_itr_init(idx->bwt); + smem_config(itr, min_intv, max_len, max_intv); + while (kseq_read(seq) >= 0) { + err_printf("SQ\t%s\t%ld", seq->name.s, seq->seq.l); + if (print_seq) { + err_putchar('\t'); + err_puts(seq->seq.s); + } else err_putchar('\n'); + for (i = 0; i < seq->seq.l; ++i) + seq->seq.s[i] = nst_nt4_table[(int)seq->seq.s[i]]; + smem_set_query(itr, seq->seq.l, (uint8_t*)seq->seq.s); + while ((a = smem_next(itr)) != 0) { + for (i = 0; i < a->n; ++i) { + bwtintv_t *p = &a->a[i]; + if ((uint32_t)p->info - (p->info>>32) < min_len) continue; + err_printf("EM\t%d\t%d\t%ld", (uint32_t)(p->info>>32), (uint32_t)p->info, (long)p->x[2]); + if (p->x[2] <= min_iwidth) { + for (k = 0; k < p->x[2]; ++k) { + bwtint_t pos; + int len, is_rev, ref_id; + len = (uint32_t)p->info - (p->info>>32); + pos = bns_depos(idx->bns, bwt_sa(idx->bwt, p->x[0] + k), &is_rev); + if (is_rev) pos -= len - 1; + bns_cnt_ambi(idx->bns, pos, len, &ref_id); + err_printf("\t%s:%c%ld", idx->bns->anns[ref_id].name, "+-"[is_rev], (long)(pos - idx->bns->anns[ref_id].offset) + 1); + } + } else err_puts("\t*"); + err_putchar('\n'); + } + } + err_puts("//"); + } + + smem_itr_destroy(itr); + bwa_idx_destroy(idx); + kseq_destroy(seq); + err_gzclose(fp); + return 0; +} diff --git a/fmt_idx.c b/fmt_idx.c new file mode 100644 index 0000000..4665acc --- /dev/null +++ b/fmt_idx.c @@ -0,0 +1,1313 @@ +/* +Description: fmt-idxseed(fm-index twice search in one time) + +Copyright : All right reserved by + +Author : +Date : 2023/12/24 +*/ + +#include +#include +#include + +#include "fmt_idx.h" +#include "utils.h" +#include "bntseq.h" +#include "kvec.h" +#include "kstring.h" +#include "debug.h" + +// occ,pattern +void fmt_gen_cnt_occ(FMTIndex *fmt) +{ + // 0-8:aocc,8-16:bocc,16-24:bocc + int i, a, b, ti; + uint32_t oa, ooa, ob, oob; + for (i = 0; i != 256; ++i) // + { + for (a = 0; a < 4; ++a) // ba + { + oa = 0; + ooa = 0; + oa += ((i >> 4 & 3) == a) + ((i & 3) == a); + ooa += ((i >> 4 & 3) > a) + ((i & 3) > a); + for (b = 0; b < 4; ++b) + { + oob = ob = 0; + oob += ((i >> 6 & 3) > b && (i >> 4 & 3) == a) + ((i >> 2 & 3) > b && (i & 3) == a); + ob += ((i >> 6 & 3) == b && (i >> 4 & 3) == a) + ((i >> 2 & 3) == b && (i & 3) == a); + ti = a << 2 | b; + fmt->cnt_occ[ti][i] = ob << 24 | oob << 16 | oa << 8 | ooa; + } + } + } +} + +// fmt-indexcount table,4bwt,0,1,2,3bwtA,C,G,T,pre-bwt +void fmt_gen_cnt_table(uint32_t cnt_table[4][256]) +{ + int i, j, k; + uint32_t x = 0; + for (i = 0; i != 256; ++i) // + { + for (k = 0; k < 4; ++k) // bwt + { + x = 0; // for [A,C,G,T][A,C,G,T] + for (j = 0; j != 4; ++j) // pre-bwt + x |= (((i >> 6 & 3) == j && (i >> 4 & 3) == k) + ((i >> 2 & 3) == j && (i & 3) == k)) << (j << 3); + cnt_table[k][i] = x; + } + } +} + +// fmt +void dump_fmt(const char *fn, const FMTIndex *fmt) +{ + FILE *fp; + fp = xopen(fn, "wb"); + err_fwrite(&fmt->primary, sizeof(bwtint_t), 1, fp); + err_fwrite(&fmt->sec_primary, sizeof(bwtint_t), 1, fp); + err_fwrite(&fmt->sec_bcp, sizeof(uint8_t), 1, fp); + err_fwrite(&fmt->first_base, sizeof(uint8_t), 1, fp); + err_fwrite(&fmt->last_base, sizeof(uint8_t), 1, fp); + err_fwrite(fmt->L2 + 1, sizeof(bwtint_t), 4, fp); + err_fwrite(fmt->bwt, 4, fmt->bwt_size, fp); + err_fflush(fp); + err_fclose(fp); +} + +// fmt +FMTIndex *fmt_restore_fmt(const char *fn) +{ + FMTIndex *fmt; + fmt = (FMTIndex *)calloc(1, sizeof(FMTIndex)); + FILE *fp = xopen(fn, "rb"); + + fseek(fp, 0, SEEK_END); + fmt->bwt_size = (ftell(fp) - sizeof(bwtint_t) * 6 - 3) >> 2; // 32wordsize + fmt->bwt = (uint32_t *)calloc(fmt->bwt_size, 4); + fseek(fp, 0, SEEK_SET); + err_fread_noeof(&fmt->primary, sizeof(bwtint_t), 1, fp); + err_fread_noeof(&fmt->sec_primary, sizeof(bwtint_t), 1, fp); + err_fread_noeof(&fmt->sec_bcp, sizeof(uint8_t), 1, fp); + err_fread_noeof(&fmt->first_base, sizeof(uint8_t), 1, fp); + err_fread_noeof(&fmt->last_base, sizeof(uint8_t), 1, fp); + err_fread_noeof(fmt->L2 + 1, sizeof(bwtint_t), 4, fp); + fread_fix(fp, fmt->bwt_size << 2, fmt->bwt); + fmt->seq_len = fmt->L2[4]; + err_fclose(fp); + fmt_gen_cnt_occ(fmt); // , + return fmt; +} + +// kmer hash +void fmt_dump_kmer_idx(const char *fn, const KmerHash *kh) +{ + FILE *fp; + fp = xopen(fn, "wb"); + err_fwrite(kh->ke10, 1, (1 << (10 << 1)) * sizeof(KmerEntryArr), fp); + err_fwrite(kh->ke11, 1, (1 << (11 << 1)) * sizeof(KmerEntry), fp); + err_fwrite(kh->ke12, 1, (1 << (12 << 1)) * sizeof(KmerEntry), fp); +#if HASH_KMER_LEN > 12 + err_fwrite(kh->ke13, 1, (1 << (13 << 1)) * sizeof(KmerEntry), fp); +#endif +#if HASH_KMER_LEN > 13 + err_fwrite(kh->ke14, 1, (1 << (14 << 1)) * sizeof(KmerEntry), fp); +#endif + err_fflush(fp); + err_fclose(fp); +} + +// kmer hash +KmerHash fmt_restore_kmer_idx(const char *fn) +{ + FILE *fp = xopen(fn, "rb"); + KmerHash khash; + KmerHash *kh = &khash; + int len = 1 << (10 << 1); + kh->ke10 = (KmerEntryArr *)malloc(len * sizeof(KmerEntryArr)); + fread_fix(fp, len * sizeof(KmerEntryArr), kh->ke10); + len = 1 << (11 << 1); + kh->ke11 = (KmerEntry *)malloc(len * sizeof(KmerEntry)); + fread_fix(fp, len * sizeof(KmerEntry), kh->ke11); + len = 1 << (12 << 1); + kh->ke12 = (KmerEntry *)malloc(len * sizeof(KmerEntry)); + fread_fix(fp, len * sizeof(KmerEntry), kh->ke12); +#if HASH_KMER_LEN > 12 + len = 1 << (13 << 1); + kh->ke13 = (KmerEntry *)malloc(len * sizeof(KmerEntry)); + fread_fix(fp, len * sizeof(KmerEntry), kh->ke13); +#endif +#if HASH_KMER_LEN > 13 + len = 1 << (14 << 1); + kh->ke14 = (KmerEntry *)malloc(len * sizeof(KmerEntry)); + fread_fix(fp, len * sizeof(KmerEntry), kh->ke14); +#endif + err_fclose(fp); + return khash; +} + +// KMER_LEN, +void gen_kmer_base(uint8_t **seq_arr, uint64_t *kmer_arr_size, int kmer_len) +{ + uint64_t i; + uint64_t seq_up_val = (1 << (kmer_len << 1)); + *kmer_arr_size = (uint64_t)seq_up_val; + *seq_arr = realloc(*seq_arr, seq_up_val * (uint64_t)kmer_len); + for (i = 0; i < seq_up_val; ++i) + { + const uint64_t base_idx = i * kmer_len; + for (int j = kmer_len - 1; j >= 0; --j) + { + (*seq_arr)[base_idx + kmer_len - 1 - j] = (i >> (j << 1)) & 3; + } + } +} + +uint64_t global_num = 0; + +// fmtseed,, +bwtintv_t fmt_search(FMTIndex *fmt, const uint8_t *q, int qlen) +{ + bwtintv_t ik; + bwtintv_t ok1; + bwtintv_t ok2; + int i, c1, c2, x = 0; + + fmt_set_intv(fmt, q[x], ik); + ik.info = x + 1; + for (i = x + 1; i + 1 < qlen; i += 2) + { + if (q[i] < 4 && q[i + 1] < 4) + { + c1 = 3 - q[i]; + c2 = 3 - q[i + 1]; + fmt_extend2(fmt, &ik, &ok1, &ok2, 0, c1, c2); + ik = ok2; + ik.info = i + 1; + } + else + { + break; + } + } + + if (i < qlen && q[i] < 4) + { // + c1 = 3 - q[i]; + fmt_extend1(fmt, &ik, &ok1, 0, c1); + //if (qlen == 14) fprintf(stderr, "%ld %ld %ld\n", ok1.x[0], ok1.x[1], ok1.x[2]); + //if (qlen == 14) ++global_num; + //if (qlen == 14 && global_num % 10000 == 0) fprintf(stderr, "%ld\n", global_num); + ik = ok1; + ik.info = i + 1; + } + return ik; +} + +// xmer hash +void fmt_create_kmer_index(FMTIndex *fmt) { + uint64_t kmer_arr_size = 0; + uint8_t *seq_arr = 0; + gen_kmer_base(&seq_arr, &kmer_arr_size, 10); + bwtintv_t ik; + uint64_t j; + int i, c1, c2; + int qlen = 10; + bwtint_t tk[4], tl[4]; + KmerHash *kh = &fmt->kmer_hash; + + kh->ke10 = (KmerEntryArr *)malloc((1 << (10 << 1)) * sizeof(KmerEntryArr)); + kh->ke11 = (KmerEntry *)malloc((1 << (11 << 1)) * sizeof(KmerEntry)); + kh->ke12 = (KmerEntry *)malloc((1 << (12 << 1)) * sizeof(KmerEntry)); + kh->ke13 = (KmerEntry *)malloc((1 << (13 << 1)) * sizeof(KmerEntry)); + kh->ke14 = (KmerEntry *)malloc((1 << (14 << 1)) * sizeof(KmerEntry)); + + // 10kmer + for (j = 0; j < kmer_arr_size; ++j) + { + uint8_t *q = &seq_arr[j * 10]; + uint8_t *mem_addr = kh->ke10[j].intv_arr; + fmt_set_intv(fmt, q[0], ik); + kmer_setval_at(mem_addr, ik, 0); + + // + for (i = 1; i + 1 < qlen; i += 2) + { + c1 = 3 - q[i]; + c2 = 3 - q[i + 1]; + + fmt_e2_occ(fmt, ik.x[1] - 1, c1, c2, tk); + fmt_e2_occ(fmt, ik.x[1] - 1 + ik.x[2], c1, c2, tl); + // + ik.x[0] = ik.x[0] + (ik.x[1] <= fmt->primary && ik.x[1] + ik.x[2] - 1 >= fmt->primary) + tl[0] - tk[0]; + ik.x[1] = fmt->L2[c1] + 1 + tk[1]; + ik.x[2] = tl[1] - tk[1]; + kmer_setval_at(mem_addr, ik, i); + + // + ik.x[0] = ik.x[0] + (ik.x[1] <= fmt->primary && ik.x[1] + ik.x[2] - 1 >= fmt->primary) + tl[2] - tk[2]; + ik.x[1] = fmt->L2[c2] + 1 + tk[3]; + ik.x[2] = tl[3] - tk[3]; + kmer_setval_at(mem_addr, ik, i + 1); + } + { // + c1 = 3 - q[i]; + c2 = 3; + fmt_e2_occ(fmt, ik.x[1] - 1, c1, c2, tk); + fmt_e2_occ(fmt, ik.x[1] - 1 + ik.x[2], c1, c2, tl); + // + ik.x[0] = ik.x[0] + (ik.x[1] <= fmt->primary && ik.x[1] + ik.x[2] - 1 >= fmt->primary) + tl[0] - tk[0]; + ik.x[1] = fmt->L2[c1] + 1 + tk[1]; + ik.x[2] = tl[1] - tk[1]; + kmer_setval_at(mem_addr, ik, i); + } + } + // 11kmer + gen_kmer_base(&seq_arr, &kmer_arr_size, 11); + for (j = 0; j < kmer_arr_size; ++j) + { + bwtintv_t p = fmt_search(fmt, &seq_arr[j * 11], 11); + kmer_setval_at(fmt->kmer_hash.ke11[j].intv_arr, p, 0); + } + + // 12kmer + gen_kmer_base(&seq_arr, &kmer_arr_size, 12); + for (j = 0; j < kmer_arr_size; ++j) + { + bwtintv_t p = fmt_search(fmt, &seq_arr[j * 12], 12); + kmer_setval_at(fmt->kmer_hash.ke12[j].intv_arr, p, 0); + } + gen_kmer_base(&seq_arr, &kmer_arr_size, 13); + for (j = 0; j < kmer_arr_size; ++j) + { + bwtintv_t p = fmt_search(fmt, &seq_arr[j * 13], 13); + kmer_setval_at(fmt->kmer_hash.ke13[j].intv_arr, p, 0); + } + + // 14kmer + gen_kmer_base(&seq_arr, &kmer_arr_size, 14); + //fprintf(stderr, "14-size:%ld\n", kmer_arr_size); + for (j = 0; j < kmer_arr_size; ++j) + { + //if (j % 10000 == 0) fprintf(stderr, "arr_size: %ld, %ld\n", j, kmer_arr_size); + bwtintv_t p = fmt_search(fmt, &seq_arr[j * 14], 14); + kmer_setval_at(fmt->kmer_hash.ke14[j].intv_arr, p, 0); + } + free(seq_arr); +} + +// sa +void fmt_restore_sa(const char *fn, FMTIndex *fmt) +{ + char skipped[256]; + FILE *fp; + bwtint_t primary; + fp = xopen(fn, "rb"); + err_fread_noeof(&primary, sizeof(bwtint_t), 1, fp); + xassert(primary == fmt->primary, "SA-BWT inconsistency: primary is not the same."); + err_fread_noeof(skipped, sizeof(bwtint_t), 4, fp); // skip + err_fread_noeof(&fmt->sa_intv, sizeof(bwtint_t), 1, fp); + err_fread_noeof(&primary, sizeof(bwtint_t), 1, fp); + xassert(primary == fmt->seq_len, "SA-BWT inconsistency: seq_len is not the same."); + fmt->n_sa = (fmt->seq_len + fmt->sa_intv) / fmt->sa_intv; + fmt->sa = (uint8_t *)malloc(SA_BYTES(fmt->n_sa)); + fread_fix(fp, SA_BYTES(fmt->n_sa), fmt->sa); + err_fclose(fp); +} + +// interval-bwtfmt-index +FMTIndex *create_fmt_from_bwt(bwt_t *bwt) +{ + // FILE *fmt_out = fopen("fmt.txt", "w"); + FMTIndex *fmt = (FMTIndex *)calloc(1, sizeof(FMTIndex)); + fmt_gen_cnt_occ(fmt); + + bwtint_t i, j, k, m, n, n_occ, cnt[4], cnt2[4]; + uint32_t c[4], c2[16]; /*cbwt,c2pre-bwtbwt,AA..TT*/ + uint32_t *buf; /* fmtbwt */ + +#ifdef FMT_MID_INTERVAL + // check point + uint32_t mc[4] = {0}; + uint32_t cnt_table[4][256]; // 4cnt_table,0,1,2,3, + fmt_gen_cnt_table(cnt_table); +#endif + + fmt->seq_len = bwt->seq_len; // bwt,$,bwt matrix1 + for (i = 0; i < 5; ++i) + fmt->L2[i] = bwt->L2[i]; // + fmt->primary = bwt->primary; // $,bwt matrix + + n_occ = (bwt->seq_len + FMT_OCC_INTERVAL - 1) / FMT_OCC_INTERVAL + 1; // check point + fmt->bwt_size = (fmt->seq_len * 2 + 15) >> 4; // + fmt->bwt_size += n_occ * 20; // A,C,G,TAA,AC.....TG,TT20 + +#ifdef FMT_MID_INTERVAL + uint32_t s1; + bwtint_t mn_occ = (bwt->seq_len >> FMT_OCC_INTV_SHIFT) * (FMT_OCC_INTERVAL / FMT_MID_INTERVAL - 1); + bwtint_t last_seq_len = bwt->seq_len % FMT_OCC_INTERVAL; + mn_occ += (last_seq_len + FMT_MID_INTERVAL - 1) / FMT_MID_INTERVAL - 1; + fmt->bwt_size += mn_occ * 4; + i = 0; +#endif + + buf = (uint32_t *)calloc(fmt->bwt_size, 4); // fmt + c[0] = c[1] = c[2] = c[3] = 0; + // c2,ACGT,1occ + for (i = 0; i < 4; ++i) + { + bwtint_t before_first_line = fmt->L2[i]; + bwt_occ4(bwt, before_first_line, cnt); + for (j = i * 4, k = 0; k < 4; ++j, ++k) + c2[j] = cnt[k]; + } + // kbuf + for (i = k = 0; i < bwt->seq_len; ++i) + { + // occ + if (i % FMT_OCC_INTERVAL == 0) + { + memcpy(buf + k, c, sizeof(uint32_t) * 4); // bwt strocc + k += 4; + memcpy(buf + k, c2, sizeof(uint32_t) * 16); // pre-bwt:bwtocc + k += 16; +#ifdef FMT_MID_INTERVAL + mc[0] = mc[1] = mc[2] = mc[3] = 0; +#endif + } + // 328(pre-bwt)8(bwt) + if (i % 16 == 0) // 3216,16,16 + { + uint32_t pre_bwt_16_seq = 0; // 16pre-bwt + uint32_t *bwt_addr = bwt_occ_intv(bwt, i) + 8;//4; // 48occuint32uint64,bwti,bwt-cp(check point)4uint32_t(8uint32_t)occ + int offset = (i % OCC_INTERVAL) / 16; // OCC_INTERVAL,16uint32, + uint32_t bwt_16_seq = *(bwt_addr + offset); // 16 + for (j = 0; j < 16; ++j) // bwt, + { + bwtint_t cur_str_line = i + j; // bwt str + if (cur_str_line < bwt->seq_len) // bwt str(bwt strbwt matrix1,bwt str$) + { + uint8_t bwt_base = bwt_B0(bwt, cur_str_line); // bwt + // (bwt matrix) + bwtint_t cur_mtx_line = cur_str_line; + if (cur_str_line >= bwt->primary) // bwt$,,$,seq,bwt matrix + cur_mtx_line += 1; + bwt_occ4(bwt, cur_mtx_line, cnt); // bwt-checkpointocc + for (m = 0; m < 4; ++m) + c[m] = (uint32_t)cnt[m]; // mcur_bwt_mtx_line(),bwtocc + + cnt[bwt_base] -= 1; // cur_bwt_mtx_line(),bwt_occ4(bwt, cur_bwt_mtx_line-1, cnt) + bwtint_t bwt_base_mtx_line = bwt->L2[bwt_base] + 1 + cnt[bwt_base]; // bwt_basebwt matrix(LF) + + bwt_occ4(bwt, bwt_base_mtx_line, cnt2); // bwt_base_mtx_lineocc + for (n = 0; n < 4; ++n) + { + int c2_idx = bwt_base << 2 | n; // bwt base + c2[c2_idx] = (uint32_t)cnt2[n]; // pre-bwt:bwt + } + bwtint_t bwt_base_str_line = bwt_base_mtx_line; // bwt-str + if (bwt_base_str_line >= bwt->primary) // base_linebwt str,$,1 + bwt_base_str_line -= 1; // bwt($) + uint32_t pre_bwt_base = bwt_B0(bwt, bwt_base_str_line); // bwtpre-bwt + // ,bwt_basebwt matrix,$,bwt_base, + // pre_bwt_baseprimarybwt base,$, + if (bwt_base_mtx_line == bwt->primary) + { + // sec_bcp + fmt->sec_bcp = pre_bwt_base << 2 | bwt_base; // $A + fmt->sec_primary = cur_mtx_line; // pre-bwt base$(bwt-matrix) + fmt->first_base = bwt_base; // + fmt->last_base = pre_bwt_base; // $(primarybwt base) + } + // pre-bwt + pre_bwt_16_seq = pre_bwt_16_seq | (pre_bwt_base << (15 - j) * 2); // uint32_t + } + else + break; + } + // bwtpre_bwt + uint32_t pre_and_bwt_seq = 0; + uint32_t pre_and_bwt_seq_2 = 0; + for (m = 0; m < 8; ++m) + { + int lshift_bit = 30 - 2 * m; + pre_and_bwt_seq |= (((pre_bwt_16_seq & (3 << lshift_bit)) >> (m * 2)) | ((bwt_16_seq & (3 << lshift_bit)) >> ((m * 2) + 2))); + } + buf[k++] = pre_and_bwt_seq; + + if (j > 8) + { + for (m = 8; m > 0; --m) + { + int lshift_bit = 2 * m - 2; + pre_and_bwt_seq_2 |= (((pre_bwt_16_seq & (3 << lshift_bit)) << (m * 2)) | ((bwt_16_seq & (3 << lshift_bit)) << (m * 2 - 2))); + } + +#ifdef FMT_MID_INTERVAL // 8+8mid interval occ + s1 = pre_and_bwt_seq; + for (m = 0; m < 4; ++m) + mc[m] += cnt_table[m][s1 & 0xff] + cnt_table[m][s1 >> 8 & 0xff] + cnt_table[m][s1 >> 16 & 0xff] + cnt_table[m][s1 >> 24]; +#endif + +#if FMT_MID_INTERVAL == 8 // mid interval8, + for (m = 0; m < 4; ++m) + buf[k++] = mc[m]; +#endif + + buf[k++] = pre_and_bwt_seq_2; + +#ifdef FMT_MID_INTERVAL + s1 = pre_and_bwt_seq_2; + for (m = 0; m < 4; ++m) + mc[m] += cnt_table[m][s1 & 0xff] + cnt_table[m][s1 >> 8 & 0xff] + cnt_table[m][s1 >> 16 & 0xff] + cnt_table[m][s1 >> 24]; + + if ((i + 16) % FMT_OCC_INTERVAL != 0 && j == 16 && ((i + 16) & FMT_MID_INTV_MASK) == 0) + for (m = 0; m < 4; ++m) + buf[k++] = mc[m]; +#endif + } + } + } + // the last element + memcpy(buf + k, c, sizeof(uint32_t) * 4); + k += 4; + memcpy(buf + k, c2, sizeof(uint32_t) * 16); + k += 16; + xassert(k == fmt->bwt_size, "inconsistent fmt_size"); + // update fmt + fmt->bwt = buf; + return fmt; +} + +// ,bwt basebpre-bwt strocc +inline void fmt_e2_occ(const FMTIndex *fmt, bwtint_t k, int b1, int b2, bwtint_t cnt[4]) +{ + uint32_t x = 0; + uint32_t *p, *q, tmp; + bwtint_t str_line = k, cp_line = k & (~FMT_OCC_INTV_MASK); // cp = check point + int i, ti = b1 << 2 | b2; + cnt[0] = 0; + cnt[1] = 0; + cnt[2] = 0; + if (k == (bwtint_t)(-1)) + { + p = fmt->bwt + 4 + b1 * 4; + for (i = b2 + 1; i < 4; ++i) + cnt[2] += p[i]; + cnt[3] = p[b2]; + return; + } + k -= (k >= fmt->primary); // kbwtbwt($,$,1) + p = fmt_occ_intv(fmt, k); + // fprintf(stderr, "k: %ld\n", k); + for (i = b1 + 1; i < 4; ++i) + cnt[0] += p[i]; // b1occ + cnt[1] = p[b1]; // b1occ + q = p + 4 + b1 * 4; + for (i = b2 + 1; i < 4; ++i) + cnt[2] += q[i]; // b2occ + cnt[3] = q[b2]; // b2occ + p += 20; + + // mid interval + int mk = k % FMT_OCC_INTERVAL; + int n_mintv = mk >> FMT_MID_INTV_SHIFT; + if (n_mintv > 0) // mid interval + { + p += n_mintv * (4 + (FMT_MID_INTERVAL >> 3)) - 4; // mid interval check point,A C G T + q = p + b1; + for (i = b1 + 1; i < 4; ++i) + x += p[i]; // b1occ + cnt[0] += __fmt_mid_sum(x); + x = *q; + cnt[1] += __fmt_mid_sum(x); // b1occ + for (i = 3; i > b2; --i) + cnt[2] += x >> (i << 3) & 0xff; // b2occ + cnt[3] += x >> (b2 << 3) & 0xff; // b2occ + x = 0; + p += 4; + } + uint32_t *end = p + ((k >> 3) - ((k & ~FMT_MID_INTV_MASK) >> 3)); + for (; p < end; ++p) + { + x += __fmt_occ_e2_aux2(fmt, ti, *p); + } + + tmp = *p & ~((1U << ((~k & 7) << 2)) - 1); + x += __fmt_occ_e2_aux2(fmt, ti, tmp); + + if (b1 == 0) + { + x -= (~k & 7) << 8; + if (b2 == 0) + x -= (~k & 7) << 24; + } + // second_primary, + if (b1 == fmt->first_base && cp_line < fmt->sec_primary && str_line >= fmt->sec_primary) + { + if (b2 < fmt->last_base) + cnt[2] -= 1; + else if (b2 == fmt->last_base) + cnt[3] -= 1; + } + cnt[0] += x & 0xff; + cnt[1] += x >> 8 & 0xff; + cnt[2] += x >> 16 & 0xff; + cnt[3] += x >> 24 & 0xff; +} + +// ,bwt basebpre-bwt strocc +inline void fmt_direct_e2_occ(const FMTIndex *fmt, bwtint_t k, int b1, int b2, bwtint_t cnt[4]) +{ + uint32_t x = 0; + uint32_t *p, *q, tmp; + bwtint_t str_line = k, cp_line = k & (~FMT_OCC_INTV_MASK); // cp = check point + int ti = b1 << 2 | b2; + if (k == (bwtint_t)(-1)) + { + p = fmt->bwt + 4 + b1 * 4; + cnt[3] = p[b2]; + return; + } + k -= (k >= fmt->primary); // kbwtbwt($,$,1) + p = fmt_occ_intv(fmt, k); + q = p + 4 + b1 * 4; + cnt[3] = q[b2]; // b2occ + p += 20; + + // mid interval + int mk = k % FMT_OCC_INTERVAL; + int n_mintv = mk >> FMT_MID_INTV_SHIFT; + if (n_mintv > 0) // mid interval + { + p += n_mintv * (4 + (FMT_MID_INTERVAL >> 3)) - 4; // mid interval check point,A C G T + q = p + b1; + x = *q; + cnt[3] += x >> (b2 << 3) & 0xff; // b2occ + x = 0; + p += 4; + } + uint32_t *end = p + ((k >> 3) - ((k & ~FMT_MID_INTV_MASK) >> 3)); + for (; p < end; ++p) + { + x += __fmt_occ_e2_aux2(fmt, ti, *p); + } + tmp = *p & ~((1U << ((~k & 7) << 2)) - 1); + x += __fmt_occ_e2_aux2(fmt, ti, tmp); + if (b1 == 0) + { + x -= (~k & 7) << 8; + if (b2 == 0) + x -= (~k & 7) << 24; + } + // second_primary, + if (b1 == fmt->first_base && cp_line < fmt->sec_primary && str_line >= fmt->sec_primary && b2 == fmt->last_base) + cnt[3] -= 1; + cnt[3] += x >> 24 & 0xff; +} + +inline void fmt_direct2_e2_occ(const FMTIndex *fmt, bwtint_t k, int b1, int b2, bwtint_t cnt[4]) +{ + uint32_t x = 0; + uint32_t *p, *q, tmp; + bwtint_t str_line = k, cp_line = k & (~FMT_OCC_INTV_MASK); // cp = check point + int ti = b1 << 2 | b2; + cnt[1] = 0; + if (k == (bwtint_t)(-1)) + { + p = fmt->bwt + 4 + b1 * 4; + cnt[3] = p[b2]; + return; + } + k -= (k >= fmt->primary); // kbwtbwt($,$,1) + p = fmt_occ_intv(fmt, k); + cnt[1] = p[b1]; // b1occ + q = p + 4 + b1 * 4; + cnt[3] = q[b2]; // b2occ + p += 20; + + // mid interval + int mk = k % FMT_OCC_INTERVAL; + int n_mintv = mk >> FMT_MID_INTV_SHIFT; + if (n_mintv > 0) // mid interval + { + p += n_mintv * (4 + (FMT_MID_INTERVAL >> 3)) - 4; // mid interval check point,A C G T + q = p + b1; + x = *q; + cnt[1] += __fmt_mid_sum(x); // b1occ + cnt[3] += x >> (b2 << 3) & 0xff; // b2occ + x = 0; + p += 4; + } + uint32_t *end = p + ((k >> 3) - ((k & ~FMT_MID_INTV_MASK) >> 3)); + for (; p < end; ++p) + { + x += __fmt_occ_e2_aux2(fmt, ti, *p); + } + tmp = *p & ~((1U << ((~k & 7) << 2)) - 1); + x += __fmt_occ_e2_aux2(fmt, ti, tmp); + if (b1 == 0) + { + x -= (~k & 7) << 8; + if (b2 == 0) + x -= (~k & 7) << 24; + } + // second_primary, + if (b1 == fmt->first_base && cp_line < fmt->sec_primary && str_line >= fmt->sec_primary && b2 == fmt->last_base) + cnt[3] -= 1; + cnt[1] += x >> 8 & 0xff; + cnt[3] += x >> 24 & 0xff; +} + +// +inline void fmt_extend2(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok1, bwtintv_t *ok2, int is_back, int b1, int b2) +{ + bwtint_t tk[4], tl[4]; + bwtintv_t intv = {0}; + // tkk,tll + fmt_e2_occ(fmt, ik->x[!is_back] - 1, b1, b2, tk); + fmt_e2_occ(fmt, ik->x[!is_back] - 1 + ik->x[2], b1, b2, tl); + // + intv.x[!is_back] = fmt->L2[b1] + 1 + tk[1]; + intv.x[is_back] = ik->x[is_back] + (ik->x[!is_back] <= fmt->primary && ik->x[!is_back] + ik->x[2] - 1 >= fmt->primary) + tl[0] - tk[0]; + intv.x[2] = tl[1] - tk[1]; + *ok1 = intv; + // + intv.x[is_back] = intv.x[is_back] + (intv.x[!is_back] <= fmt->primary && intv.x[!is_back] + intv.x[2] - 1 >= fmt->primary) + tl[2] - tk[2]; + intv.x[!is_back] = fmt->L2[b2] + 1 + tk[3]; + intv.x[2] = tl[3] - tk[3]; + *ok2 = intv; +} + +// +inline void fmt_direct_extend2(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok1, bwtintv_t *ok2, int is_back, int b1, int b2) +{ + bwtint_t tk[4], tl[4]; + // tkk,tll + fmt_direct_e2_occ(fmt, ik->x[!is_back] - 1, b1, b2, tk); + fmt_direct_e2_occ(fmt, ik->x[!is_back] - 1 + ik->x[2], b1, b2, tl); + ok2->x[!is_back] = fmt->L2[b2] + 1 + tk[3]; + ok2->x[2] = tl[3] - tk[3]; + ok2->x[is_back] = 0; +} + +// +inline void fmt_direct2_extend2(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok1, bwtintv_t *ok2, int is_back, int b1, int b2) +{ + bwtint_t tk[4], tl[4]; + // tkk,tll + fmt_direct2_e2_occ(fmt, ik->x[!is_back] - 1, b1, b2, tk); + fmt_direct2_e2_occ(fmt, ik->x[!is_back] - 1 + ik->x[2], b1, b2, tl); + ok1->x[!is_back] = fmt->L2[b1] + 1 + tk[1]; + ok1->x[2] = tl[1] - tk[1]; + ok1->x[is_back] = 0; + ok2->x[!is_back] = fmt->L2[b2] + 1 + tk[3]; + ok2->x[2] = tl[3] - tk[3]; + ok2->x[is_back] = 0; +} + +// +inline void fmt_extend1(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok, int is_back, int b1) +{ + bwtint_t tk[4], tl[4]; + int b2 = 3; // ,T,,b2 + // tkk,tll + fmt_e2_occ(fmt, ik->x[!is_back] - 1, b1, b2, tk); + fmt_e2_occ(fmt, ik->x[!is_back] - 1 + ik->x[2], b1, b2, tl); + // + ok->x[!is_back] = fmt->L2[b1] + 1 + tk[1]; + ok->x[2] = tl[1] - tk[1]; + // + ok->x[is_back] = ik->x[is_back] + (ik->x[!is_back] <= fmt->primary && ik->x[!is_back] + ik->x[2] - 1 >= fmt->primary) + tl[0] - tk[0]; +} +inline void fmt_direct_extend1(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok, int is_back, int b1) +{ + bwtint_t tk[4], tl[4]; + int b2 = 3; // ,T,,b2 + // tkk,tll + fmt_direct2_e2_occ(fmt, ik->x[!is_back] - 1, b1, b2, tk); + fmt_direct2_e2_occ(fmt, ik->x[!is_back] - 1 + ik->x[2], b1, b2, tl); + // + ok->x[!is_back] = fmt->L2[b1] + 1 + tk[1]; + ok->x[2] = tl[1] - tk[1]; +} + +// +static void direct_extend(const FMTIndex *fmt, int len, const uint8_t *q, int left_pos, int right_pos, bwtint_t mtx_line, bwtint_t ref_pos, bwtintv_t *mt, int mtidx) +{ +#define PAC_BASE(pac, l) ((pac)[(l) >> 2] >> ((~(l) & 3) << 1) & 3) +#define EXTEND_BASE_LOOP(qcond, rcond, qstep, rstep) \ + while (k != qcond && r != rcond) \ + { \ + const int base = PAC_BASE(fmt->pac, r); \ + if (q[k] != base) \ + break; \ + k += qstep; \ + r += rstep; \ + } +#define EXTEND_BASE_LOOP_COMP(qcond, rcond, qstep, rstep) \ + while (k != qcond && r != rcond) \ + { \ + const int base = 3 - PAC_BASE(fmt->pac, r); \ + if (q[k] != base) \ + break; \ + k += qstep; \ + r += rstep; \ + } + + int k; + int64_t r, rp; + mt->num_match = 1; + // rp = fmt_sa(fmt, mtx_line); + rp = ref_pos; + r = rp >= fmt->l_pac ? (fmt->l_pac << 1) - 1 - rp : rp; + k = right_pos; + if (rp < fmt->l_pac) // + { + // + r += right_pos - left_pos; + EXTEND_BASE_LOOP(len, fmt->l_pac, 1, 1); + mt->rm[mtidx].qe = k; + mt->rm[mtidx].reverse = 0; + // ,x + r -= k - left_pos + 1; + k = left_pos - 1; + EXTEND_BASE_LOOP(-1, -1, -1, -1); + mt->rm[mtidx].qs = k + 1; + mt->rm[mtidx].rs = r + 1; + } + else // + { + r -= right_pos - left_pos; + EXTEND_BASE_LOOP_COMP(len, -1, 1, -1); + mt->rm[mtidx].qe = k; + mt->rm[mtidx].reverse = 1; + // x + r += k - left_pos + 1; + k = left_pos - 1; + EXTEND_BASE_LOOP_COMP(-1, fmt->l_pac, -1, 1); + mt->rm[mtidx].qs = k + 1; + mt->rm[mtidx].rs = r - 1; + } + mt->info = mt->rm[mtidx].qs; + mt->info = mt->info << 32 | mt->rm[mtidx].qe; + mt->x[2] = 1; +} + +static inline void fmt_reverse_intvs(bwtintv_v *p) +{ + if (p->n > 1) + { + int j; + for (j = 0; j < p->n >> 1; ++j) + { + bwtintv_t tmp = p->a[p->n - 1 - j]; + p->a[p->n - 1 - j] = p->a[j]; + p->a[j] = tmp; + } + } +} + +int fmt_smem_forward(const FMTIndex *fmt, int len, const uint8_t *q, int x, int min_intv, int min_seed_len, bwtintv_v *mem) +{ + int i, ret, kmer_len; + bwtintv_t ik = {0}, ok1 = {0}, ok2 = {0}; + bwtintv_t mt = {0}; + uint32_t qbit = 0; + mem->n = 0; + if (q[x] > 3) return x + 1; + + if (min_intv < 1) min_intv = 1; // the interval size should be at least 1 + + qbit = build_forward_kmer(&q[x], len - x, HASH_KMER_LEN, &kmer_len); + bwt_kmer_get(&fmt->kmer_hash, &ik, qbit, kmer_len-1); // + ik.info = x + kmer_len; + +// check change of the interval size and whether the interval size is too small to be extended further +#define PUSH_VAL_AND_SKIP_FORWARD(iv) \ + do \ + { \ + kv_push(bwtintv_t, *mem, iv); \ + goto fmt_smem_forward_end; \ + } while (0) + + if (kmer_len != HASH_KMER_LEN) // N + PUSH_VAL_AND_SKIP_FORWARD(ik); + + // kmer + for (i = (int)ik.info; i + 1 < len; i += 2) + { // forward search + if (q[i] < 4 && q[i + 1] < 4) + { + fmt_extend2(fmt, &ik, &ok1, &ok2, 0, 3 - q[i], 3 - q[i + 1]); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1), 0, 2); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1 + ok2.x[2]), 0, 2); + +#if 1 + if (min_intv == 1 && ok2.x[2] == min_intv) + { + direct_extend(fmt, len, q, x, i + 2, ok2.x[0], fmt_sa(fmt, ok2.x[0]), &mt, 0); + kv_push(bwtintv_t, *mem, mt); + ret = (uint32_t)mt.info; + goto fmt_smem_forward_end; + } +#endif + if (ok2.x[2] < min_intv) { + if (ok1.x[2] < min_intv) { + PUSH_VAL_AND_SKIP_FORWARD(ik); + } else { + ok1.info = i + 1; + PUSH_VAL_AND_SKIP_FORWARD(ok1); + } + } else { + ik = ok2; + ik.info = i + 2; + } + } + else if (q[i] < 4) // q[i+1] >= 4 + { + fmt_extend1(fmt, &ik, &ok1, 0, 3 - q[i]); + if (ok1.x[2] < min_intv) { + PUSH_VAL_AND_SKIP_FORWARD(ik); + } else { + ok1.info = i + 1; + PUSH_VAL_AND_SKIP_FORWARD(ok1); + } + } + else // q[i] >= 4 + { + PUSH_VAL_AND_SKIP_FORWARD(ik); + } + } + for (; i == len - 1; ++i) // + { + if (q[i] < 4) + { + fmt_extend1(fmt, &ik, &ok1, 0, 3 - q[i]); + if (ok1.x[2] < min_intv) { + PUSH_VAL_AND_SKIP_FORWARD(ik); + } else { + ok1.info = i + 1; + PUSH_VAL_AND_SKIP_FORWARD(ok1); + } + } + else + PUSH_VAL_AND_SKIP_FORWARD(ik); + } + +fmt_smem_forward_end: + if (mem->n == 0) + kv_push(bwtintv_t, *mem, ik); + ret = mem->a[0].info; + mem->a[0].info |= (uint64_t)(x) << 32; + if (mt.num_match == 0) + ret = (uint32_t)mem->a[0].info; // this will be the returned value, + return ret; +} + +// smem(seed)(lm: long_smem) +int fmt_smem(const FMTIndex *fmt, int len, const uint8_t *q, int x, int min_intv, int min_seed_len, bwtintv_t *lm, bwtintv_v *mem, bwtintv_v *tmpvec) +{ + if (x == 0 || q[x - 1] > 3) + return fmt_smem_forward(fmt, len, q, x, min_intv, min_seed_len, mem); + + // int flag = 0; + int i, j, ret, kmer_len; + bwtintv_t ik = {0}, ok1 = {0}, ok2 = {0}; + bwtintv_t mt = {0}; + bwtintv_v *curr; + uint32_t qbit = 0; + mem->n = 0; + if (q[x] > 3) return x + 1; + + if (min_intv < 1) min_intv = 1; // the interval size should be at least 1 + curr = tmpvec; // use the temporary vector if provided + + qbit = build_forward_kmer(&q[x], len - x, HASH_KMER_LEN, &kmer_len); + bwt_kmer_get(&fmt->kmer_hash, &ik, qbit, 0); // + ik.info = x + 1; +// check change of the interval size and whether the interval size is too small to be extended further +#define CHECK_INTV_CHANGE(iv, ov, end_pos) \ + if (ov.x[2] != iv.x[2]) \ + { \ + kv_push(bwtintv_t, *curr, iv); \ + if (ov.x[2] < min_intv) \ + break; \ + } \ + iv = ov; \ + iv.info = end_pos + +#define PUSH_VAL_AND_SKIP(iv) \ + do \ + { \ + kv_push(bwtintv_t, *curr, iv); \ + goto backward_search; \ + } while (0) + + // kmer + for (curr->n = 0, j = 1; j < kmer_len; ++j) + { + bwt_kmer_get(&fmt->kmer_hash, &ok1, qbit, j); + CHECK_INTV_CHANGE(ik, ok1, x + j + 1); + } + if (kmer_len != HASH_KMER_LEN) // N + PUSH_VAL_AND_SKIP(ik); + + // kmer + for (i = (int)ik.info; i + 1 < len; i += 2) + { // forward search + if (q[i] < 4 && q[i + 1] < 4) + { + fmt_extend2(fmt, &ik, &ok1, &ok2, 0, 3 - q[i], 3 - q[i + 1]); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1), 0, 2); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1 + ok2.x[2]), 0, 2); + CHECK_INTV_CHANGE(ik, ok1, i + 1); + CHECK_INTV_CHANGE(ik, ok2, i + 2); +#if 1 + // + if (min_intv == 1 && ok2.x[2] == min_intv) + { + direct_extend(fmt, len, q, x, i + 2, ok2.x[0], fmt_sa(fmt, ok2.x[0]), & mt, 0); + kv_push(bwtintv_t, *mem, mt); // min_seed_len + ret = (uint32_t)mt.info; + if (mt.rm[0].qs == 0 || q[mt.rm[0].qs - 1] > 3) + goto fmt_smem_end; + goto backward_search; + } +#endif + } + else if (q[i] < 4) // q[i+1] >= 4 + { + fmt_extend1(fmt, &ik, &ok1, 0, 3 - q[i]); + CHECK_INTV_CHANGE(ik, ok1, i + 1); + PUSH_VAL_AND_SKIP(ik); + } + else // q[i] >= 4 + { + PUSH_VAL_AND_SKIP(ik); + } + } + for (; i == len - 1; ++i) // + { + if (q[i] < 4) + { + fmt_extend1(fmt, &ik, &ok1, 0, 3 - q[i]); + CHECK_INTV_CHANGE(ik, ok1, i + 1); + } + else + PUSH_VAL_AND_SKIP(ik); + } + if (i == len) + kv_push(bwtintv_t, *curr, ik); // push the last interval if we reach the end + +backward_search: + fmt_reverse_intvs(curr); // s.t. smaller intervals (i.e. longer matches) visited first + if (mt.num_match == 0) + ret = curr->a[0].info; // this will be the returned value, + else + ret = (uint32_t)mt.info; + // , +#define CHECK_ADD_MEM(pos, intv, mem) \ + if (((int)((intv).info) - (pos) >= min_seed_len) && (mem->n == 0 || (pos) < mem->a[mem->n - 1].info >> 32)) \ + { \ + (intv).info |= (uint64_t)(pos) << 32; \ + kv_push(bwtintv_t, *mem, (intv)); \ + } + +#define CHECK_INTV_ADD_MEM(ok, pos, intv, mem) \ + if (ok.x[2] < min_intv) \ + { \ + CHECK_ADD_MEM(pos, intv, mem); \ + break; \ + } + + int last_kmer_start = 0; + for (j = 0; j < curr->n; ++j) + { + bwtintv_t *p = &curr->a[j]; // + if (p->info - x < HASH_KMER_LEN) + { + if (last_kmer_start && kmer_len == HASH_KMER_LEN && p->info == last_kmer_start && p->info - kmer_len > 0 && q[p->info - kmer_len] < 4) + qbit = ((qbit << 2) | (3 - q[p->info - kmer_len])) & ((1L << (kmer_len << 1)) - 1); // kmer + else + qbit = build_backward_kmer(q, p->info - 1, HASH_KMER_LEN, &kmer_len); // kmer + last_kmer_start = p->info - 1; + i = 1; + do + { + bwt_kmer_get(&fmt->kmer_hash, &ik, qbit, kmer_len - i++); + } while (ik.x[2] < min_intv); + if (i > 2) + continue; + p->x[0] = ik.x[1]; + p->x[1] = ik.x[0]; + p->x[2] = ik.x[2]; + i = p->info - (kmer_len - i + 3); + } + else + { + i = x - 1; + } + for (; i > 0; i -= 2) + { + if (q[i] < 4 && q[i - 1] < 4) // + { + fmt_direct2_extend2(fmt, p, &ok1, &ok2, 1, q[i], q[i - 1]); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[0] - 1), 0, 2); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[0] - 1 + ok2.x[2]), 0, 2); + CHECK_INTV_ADD_MEM(ok1, i + 1, *p, mem); + ok1.info = p->info; + CHECK_INTV_ADD_MEM(ok2, i, ok1, mem); + ok2.info = p->info; + *p = ok2; + } + else if (q[i] < 4) // + { + fmt_direct_extend1(fmt, p, &ok1, 1, q[i]); + CHECK_INTV_ADD_MEM(ok1, i + 1, *p, mem); + ok1.info = p->info; + CHECK_ADD_MEM(i, ok1, mem); + goto fmt_smem_end; + } + else + { // + CHECK_ADD_MEM(i + 1, *p, mem); + goto fmt_smem_end; + } + } + for (; i == 0; --i) + { // + if (q[i] < 4) + { + fmt_direct_extend1(fmt, p, &ok1, 1, q[i]); + CHECK_INTV_ADD_MEM(ok1, i + 1, *p, mem); + ok1.info = p->info; + *p = ok1; + } + else + { + CHECK_ADD_MEM(i + 1, *p, mem); + goto fmt_smem_end; + } + } + if (i == -1) + { + CHECK_ADD_MEM(i + 1, *p, mem); + goto fmt_smem_end; + } + } + +fmt_smem_end: + fmt_reverse_intvs(mem); // s.t. sorted by the start coordinate + return ret; +} + +int fmt_seed_strategy1(const FMTIndex *fmt, int len, const uint8_t *q, int x, int min_len, int max_intv, bwtintv_t *mem) +{ + int i, kmer_len, first_extend_len; + bwtintv_t ik = {0}, ok1 = {0}, ok2 = {0}; + uint64_t qbit; + memset(mem, 0, sizeof(bwtintv_t)); + if (q[x] > 3) + return x + 1; + if (len - x <= min_len) + return len; + + qbit = build_forward_kmer(&q[x], len - x, HASH_KMER_LEN, &kmer_len); + bwt_kmer_get(&fmt->kmer_hash, &ik, qbit, kmer_len - 1); // + ik.info = x + kmer_len; + +#define COND_SET_RETURN(iv, ov, start_pos, end_pos, max_intv, min_len) \ + if (iv.x[2] < max_intv && end_pos - start_pos >= min_len) \ + { \ + (ov) = (iv); \ + (ov).info = (uint64_t)start_pos << 32 | (end_pos + 1); \ + return end_pos + 1; \ + } +#if 1 + + first_extend_len = x + min_len + 1; + first_extend_len = MIN(len, first_extend_len); + for (i = (int)ik.info; i + 1 < first_extend_len; i += 2) + { + if (q[i] < 4 && q[i + 1] < 4) + { + fmt_extend2(fmt, &ik, &ok1, &ok2, 0, 3 - q[i], 3 - q[i + 1]); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1), 0, 2); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1 + ok2.x[2]), 0, 2); + ik = ok2; + } + else if (q[i] < 4) + return i + 2; + else + return i + 1; + } + COND_SET_RETURN(ik, *mem, x, i - 1, max_intv, min_len); + for (; i + 1 < len; i += 2) +#else + for (i = (int)ik.info; i + 1 < len; i += 2) +#endif + { // forward search + if (q[i] < 4 && q[i + 1] < 4) + { + fmt_extend2(fmt, &ik, &ok1, &ok2, 0, 3 - q[i], 3 - q[i + 1]); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1), 0, 2); + __builtin_prefetch(fmt_occ_intv(fmt, ok2.x[1] - 1 + ok2.x[2]), 0, 2); + COND_SET_RETURN(ok1, *mem, x, i, max_intv, min_len); + COND_SET_RETURN(ok2, *mem, x, i + 1, max_intv, min_len); + ik = ok2; + } + else if (q[i] < 4) // q[i+1] >= 4 + { + fmt_extend1(fmt, &ik, &ok1, 0, 3 - q[i]); + COND_SET_RETURN(ok1, *mem, x, i, max_intv, min_len); + return i + 2; + } + else // q[i] >= 4 + { + return i + 1; + } + } + if (i == len - 1 && q[i] < 4) + { + fmt_extend1(fmt, &ik, &ok1, 0, 3 - q[i]); + COND_SET_RETURN(ok1, *mem, x, i, max_intv, min_len); + } + return len; +} + +// kbwt str +inline static void fmt_get_previous_base(const FMTIndex *fmt, bwtint_t k, uint8_t *b1, uint8_t *b2) +{ + uint32_t *p; + uint8_t base2; + // ,check point + p = fmt_occ_intv(fmt, k); // check point + p += 20; // bwt + // ,mid check point + int mk = k & FMT_OCC_INTV_MASK; + int n_mintv = mk >> FMT_MID_INTV_SHIFT; + p += n_mintv * (4 + (FMT_MID_INTERVAL >> 3)); // midbwt + // ,uint32_t + p += (k & FMT_MID_INTV_MASK) >> 3; // uint32_t8(8bwt) + // , + base2 = *p >> ((~(k) & 0x7) << 2) & 0xf; + *b2 = base2 >> 2 & 3; + *b1 = base2 & 3; +} + +inline static void fmt_previous_line(const FMTIndex *fmt, bwtint_t k, bwtint_t *k1, bwtint_t *k2) +{ + uint8_t b1, b2; + uint32_t x = 0; + bwtint_t cnt[4]; + k = k - (k >= fmt->primary); // kbwtbwt($,$,1) + uint32_t *p, *pocc, *ptocc, tmp; + uint8_t base2; + bwtint_t str_line = k, cp_line = k & (~FMT_OCC_INTV_MASK); + // ,check point + pocc = fmt_occ_intv(fmt, k); // check point + p = pocc + 20; // bwt + // ,mid check point + int mk = k & FMT_OCC_INTV_MASK; + int n_mintv = mk >> FMT_MID_INTV_SHIFT; + p += n_mintv * (4 + (FMT_MID_INTERVAL >> 3)); // midbwt + ptocc = p; + // ,uint32_t + p += (k & FMT_MID_INTV_MASK) >> 3; // uint32_t8(8bwt) + // , + base2 = *p >> ((~(k) & 0x7) << 2) & 0xf; + b2 = base2 >> 2 & 3; + b1 = base2 & 3; + + cnt[1] = pocc[b1]; + cnt[3] = (pocc + 4 + b1 * 4)[b2]; + if (n_mintv > 0) { + ptocc -= 4; + x = *(ptocc + b1); + cnt[1] += __fmt_mid_sum(x); + cnt[3] += x >> (b2 << 3) & 0xff; + x = 0; + ptocc += 4; + } + + uint32_t *end = ptocc + ((k >> 3) - ((k & ~FMT_MID_INTV_MASK) >> 3)); + int ti = b1 << 2 | b2; + for (; ptocc < end; ++ptocc) + { + x += __fmt_occ_e2_aux2(fmt, ti, *ptocc); + } + + tmp = *ptocc & ~((1U << ((~k & 7) << 2)) - 1); + x += __fmt_occ_e2_aux2(fmt, ti, tmp); + + if (b1 == 0) + { + x -= (~k & 7) << 8; + if (b2 == 0) + x -= (~k & 7) << 24; + } + if (b1 == fmt->first_base && b2 == fmt->last_base && cp_line < fmt->sec_primary && str_line >= fmt->sec_primary) + { + cnt[3] -= 1; + } + cnt[1] += x >> 8 & 0xff; + cnt[3] += x >> 24 & 0xff; + + *k1 = fmt->L2[b1] + cnt[1]; + *k2 = fmt->L2[b2] + cnt[3]; +} + +bwtint_t fmt_sa(const FMTIndex *fmt, bwtint_t k) +{ + bwtint_t sa = 0, mask = fmt->sa_intv - 1; + bwtint_t k1, k2; + while (k & mask) + { + ++sa; + fmt_previous_line(fmt, k, &k1, &k2); + __builtin_prefetch(fmt_occ_intv(fmt, k2), 0, 2); + if (!(k1 & mask)) + { + k = k1; + break; + } + ++sa; + if (!(k2 & mask)) + { + k = k2; + break; + } + k = k2; + } + sa += bwt_get_sa(fmt->sa, k / fmt->sa_intv); + return sa; +} + +bwtint_t fmt_sa_offset(const FMTIndex *fmt, bwtint_t k) +{ + bwtint_t sa = 0, mask = fmt->sa_intv - 1; + bwtint_t k1, k2; + while (k & mask) + { + ++sa; + fmt_previous_line(fmt, k, &k1, &k2); + __builtin_prefetch(fmt_occ_intv(fmt, k2), 0, 2); + if (!(k1 & mask)) + { + k = k1; + break; + } + ++sa; + if (!(k2 & mask)) + { + k = k2; + break; + } + k = k2; + } + sa = (sa << 48) | (k / fmt->sa_intv); + return sa; +} \ No newline at end of file diff --git a/fmt_idx.h b/fmt_idx.h new file mode 100644 index 0000000..a7f598b --- /dev/null +++ b/fmt_idx.h @@ -0,0 +1,121 @@ +/* +Description: fmt-idxseed (fm-index twice extend in one search step) + +Copyright : All right reserved by + +Author : +Date : 2023/12/24 +*/ +#ifndef FMT_INDEX_H_ +#define FMT_INDEX_H_ + +#include +#include +#include "bwt.h" +#include "utils.h" + +#define FMT_OCC_INTV_SHIFT 8 +#define FMT_OCC_INTERVAL (1 << FMT_OCC_INTV_SHIFT) +#define FMT_OCC_INTV_MASK (FMT_OCC_INTERVAL - 1) + +#define FMT_MID_INTV_SHIFT 6 +#define FMT_MID_INTERVAL (1 << FMT_MID_INTV_SHIFT) +#define FMT_MID_INTV_MASK (FMT_MID_INTERVAL - 1) + +// c(), +#define fmt_set_intv(fmt, c, ik) ((ik).x[0] = (fmt)->L2[(int)(c)] + 1, (ik).x[2] = (fmt)->L2[(int)(c) + 1] - (fmt)->L2[(int)(c)], (ik).x[1] = (fmt)->L2[3 - (c)] + 1, (ik).info = 0) +// k(bwt str($))check point occ(kOCC_INTERVAL) + +#if FMT_MID_INTERVAL == 8 +#define fmt_occ_intv(b, k) ((b)->bwt + (k) / FMT_OCC_INTERVAL * (FMT_OCC_INTERVAL / 8 + 144)) +#elif FMT_MID_INTERVAL == 16 +#define fmt_occ_intv(b, k) ((b)->bwt + (k) / FMT_OCC_INTERVAL * (FMT_OCC_INTERVAL / 8 + 80)) +#elif FMT_MID_INTERVAL == 32 +//#define fmt_occ_intv(b, k) ((b)->bwt + (k) / FMT_OCC_INTERVAL * (FMT_OCC_INTERVAL / 8 + 48)) +#define fmt_occ_intv(b, k) ((b)->bwt + ((k) >> 8) * 80) +#elif FMT_MID_INTERVAL == 64 +//#define fmt_occ_intv(b, k) ((b)->bwt + (k) / FMT_OCC_INTERVAL * (FMT_OCC_INTERVAL / 8 + 32)) +#define fmt_occ_intv(b, k) ((b)->bwt + ((k) >> 8 << 6)) +#elif FMT_MID_INTERVAL == 128 +#define fmt_occ_intv(b, k) ((b)->bwt + (k) / FMT_OCC_INTERVAL * (FMT_OCC_INTERVAL / 8 + 24)) +#else +#define fmt_occ_intv(b, k) ((b)->bwt + (k) / FMT_OCC_INTERVAL * (FMT_OCC_INTERVAL / 8 + 20)) +#endif + +// valbwt basebpre-bwtT G C A(32(8bit)),occocc +#define __fmt_occ_e2_aux2(fmt, b, val) \ + ((fmt)->cnt_occ[(b)][(val) & 0xff] + (fmt)->cnt_occ[b][(val) >> 8 & 0xff] + (fmt)->cnt_occ[b][(val) >> 16 & 0xff] + (fmt)->cnt_occ[b][(val) >> 24]) + +#define __fmt_mid_sum(x) \ + ((x) >> 24 & 0xff) + ((x) >> 16 & 0xff) + ((x) >> 8 & 0xff) + ((x) & 0xff) + +// sa +#define SA_INTV 4 + +// fm-index, extend twice in one search step (one memory access) +typedef struct +{ + bwtint_t primary; // S^{-1}(0), or the primary index of BWT + bwtint_t sec_primary; // second primary line + bwtint_t L2[5]; // C(), cumulative count + bwtint_t seq_len; // sequence length + bwtint_t bwt_size; // size of bwt, about seq_len/4 + uint32_t *bwt; // BWT + // occurance array, separated to two parts + uint32_t cnt_occ[16][256]; // 16-24b()occ,8-16bocc,0-8aocc,ba + uint8_t sec_bcp; // base couple for sec primary line, AA=>0, AC=>1 ... TT=>15 + uint8_t first_base; // 2bitint,0,1,2,3 + uint8_t last_base; // dollarbase + // ref pac + bwtint_t l_pac; // + uint8_t *pac; // 2bit + // kmerfmt + KmerHash kmer_hash; + // suffix array + int sa_intv; + bwtint_t n_sa; + uint8_t *sa; +} FMTIndex; + +// fmt +void dump_fmt(const char *fn, const FMTIndex *fmt); +// fmt +FMTIndex *fmt_restore_fmt(const char *fn); +void fmt_create_kmer_index(FMTIndex *fmt); +// kmer hash +void fmt_dump_kmer_idx(const char *fn, const KmerHash *kh); +// kmer hash +KmerHash fmt_restore_kmer_idx(const char *fn); +// sa +void fmt_restore_sa(const char *fn, FMTIndex *fmt); +// interval-bwtfmt-index +FMTIndex *create_fmt_from_bwt(bwt_t *bwt); +// ,bwt basebpre-bwt strocc +void fmt_direct_e2_occ(const FMTIndex *fmt, bwtint_t k, int b1, int b2, bwtint_t cnt[4]); +void fmt_direct2_e2_occ(const FMTIndex *fmt, bwtint_t k, int b1, int b2, bwtint_t cnt[4]); +void fmt_e2_occ(const FMTIndex *fmt, bwtint_t k, int b1, int b2, bwtint_t cnt[4]); +// +void fmt_direct2_extend2(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok1, bwtintv_t *ok2, int is_back, int b1, int b2); +void fmt_direct_extend2(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok1, bwtintv_t *ok2, int is_back, int b1, int b2); +void fmt_extend2(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok1, bwtintv_t *ok2, int is_back, int b1, int b2); +// +void fmt_direct_extend1(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok, int is_back, int b1); +void fmt_extend1(const FMTIndex *fmt, bwtintv_t *ik, bwtintv_t *ok, int is_back, int b1); +// KMER_LEN, +// void gen_all_seq(char **seq_arr, int kmer_len); +// kmerposfmt +void kmer_setval_at(uint8_t *mem_addr, bwtintv_t ik, int pos); +// kmerfmt +void kmer_getval_at(uint8_t *mem_addr, bwtintv_t *ok, int pos); +void fmt_kmer_get(const FMTIndex *fmt, bwtintv_t *ok, uint32_t qbit, int pos); +// smem(seed) +int fmt_smem(const FMTIndex *fmt, int len, const uint8_t *q, int x, int min_intv, int min_seed_len, bwtintv_t *lm, bwtintv_v *mem, bwtintv_v *tmpvec); +int fmt_smem_2(const FMTIndex *fmt, int len, const uint8_t *q, int x, int min_intv, int min_seed_len, bwtintv_t *lm, bwtintv_v *mem, bwtintv_v *tmpvec, uint32_v qev); + +int fmt_seed_strategy1(const FMTIndex *fmt, int len, const uint8_t *q, int x, int min_len, int max_intv, bwtintv_t *mem); + +bwtint_t fmt_sa(const FMTIndex *fmt, bwtint_t k); +bwtint_t fmt_sa_offset(const FMTIndex *fmt, bwtint_t k); + +void fmt_gen_cnt_occ(FMTIndex *fmt); +#endif \ No newline at end of file diff --git a/h.txt b/h.txt new file mode 100644 index 0000000..15afcbd --- /dev/null +++ b/h.txt @@ -0,0 +1,100 @@ +90,93c90,93 +< SRR25735653.1 83 1 241798514 60 151M = 241798512 -153 TTTATCTCCACAATACTTTTCCTTCTCCACTGATTCCTCTACATCAGTTACTTCTAGTGAAATCTCTGTATCACTTTTCTGAGTGTGTTTTGCAGGCATTTCGTCGCTATTAAAATACGATAACTGGCTTTCTTCAGGTAATGCAGAATCC FFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:20 RG:Z:normal +< SRR25735653.1 163 1 241798512 60 151M = 241798514 153 GTTTTATCTCCACAATACTTTTCCTTCTCCACTGATTCCTCTACATCAGTTACTTCTAGTGAAATCTCTGTATCACTTTTCTGAGTGTGTTTTGCAGGCATTTCGTCGCTATTAAAATACGATAACTGGCTTTCTTCAGGTAATGCAGAAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:20 RG:Z:normal +< SRR25735653.2 99 1 63327641 60 151M = 63327689 199 TTTTAAACTTTTCAGAATCAAATTATGATTAAAGCTGCTATTATAAACATCCATGTGCAGGATTTTATGTGGACATAAATTTTCAACTCATTTGGGTAAACCTTTAATATATTGTTAATTTGATACTCTTTAAATACTTAAATAAACTCAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:32 RG:Z:normal +< SRR25735653.2 147 1 63327689 60 151M = 63327641 -199 ATCCATGTGCAGGATTTTATGTGGACATAAATTTTCAACTCATTTGGGTAAACCTTTAATATATTGTTAATTTGATACTCTTTAAATACTTAAATAAACTCAGCAAAGTTTGGAAAATAATTCTCCAAGCCTGAATCAATAAATATTGTGC FFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:23 RG:Z:normal +--- +> SRR25735653.1 83 1 241798514 60 151M = 241798512 -153 TTTATCTCCACAATACTTTTCCTTCTCCACTGATTCCTCTACATCAGTTACTTCTAGTGAAATCTCTGTATCACTTTTCTGAGTGTGTTTTGCAGGCATTTCGTCGCTATTAAAATACGATAACTGGCTTTCTTCAGGTAATGCAGAATCC FFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.1 163 1 241798512 60 151M = 241798514 153 GTTTTATCTCCACAATACTTTTCCTTCTCCACTGATTCCTCTACATCAGTTACTTCTAGTGAAATCTCTGTATCACTTTTCTGAGTGTGTTTTGCAGGCATTTCGTCGCTATTAAAATACGATAACTGGCTTTCTTCAGGTAATGCAGAAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.2 99 1 63327641 60 151M = 63327689 199 TTTTAAACTTTTCAGAATCAAATTATGATTAAAGCTGCTATTATAAACATCCATGTGCAGGATTTTATGTGGACATAAATTTTCAACTCATTTGGGTAAACCTTTAATATATTGTTAATTTGATACTCTTTAAATACTTAAATAAACTCAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFF:FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.2 147 1 63327689 60 151M = 63327641 -199 ATCCATGTGCAGGATTTTATGTGGACATAAATTTTCAACTCATTTGGGTAAACCTTTAATATATTGTTAATTTGATACTCTTTAAATACTTAAATAAACTCAGCAAAGTTTGGAAAATAATTCTCCAAGCCTGAATCAATAAATATTGTGC FFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +96c96 +< SRR25735653.4 99 10 105139338 60 151M = 105139421 234 AAAAATGTTGGCTCTTTTGACTTGTAGGTATTTTTTGGTTTATTAAAAGAACCAGAAATTGAGGTACCTTTGGATGACGAGGATGAAGAGGGAGAAAATGAAGAAGGAAAACCTAAAAAGAAGAAGCCTAAAAAAGATAGTATTGGATCCA FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFF:FF:FFF:FF::FFF,FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:20 RG:Z:normal +--- +> SRR25735653.4 99 10 105139338 60 151M = 105139421 234 AAAAATGTTGGCTCTTTTGACTTGTAGGTATTTTTTGGTTTATTAAAAGAACCAGAAATTGAGGTACCTTTGGATGACGAGGATGAAGAGGGAGAAAATGAAGAAGGAAAACCTAAAAAGAAGAAGCCTAAAAAAGATAGTATTGGATCCA FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFF:FF:FFF:FF::FFF,FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +99c99 +< SRR25735653.5 163 7 100610140 60 150M = 100610191 201 CCCAGCCTCCATTCCAGAATCCCTCCCCGACCCCCACCAGGGCAGGGAGGGGGCTGGGCTCGGATCAGCAGTGACCTCCCTGTCAGCCCAAACCAGTGGCTCCGCGTTCCCGTCCCTCACTGTGACTCTGACAGGTGCACATCAAGAGAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFF:FFF NM:i:0 MD:Z:150 MC:Z:150M AS:i:150 XS:i:24 RG:Z:normal +--- +> SRR25735653.5 163 7 100610140 60 150M = 100610191 201 CCCAGCCTCCATTCCAGAATCCCTCCCCGACCCCCACCAGGGCAGGGAGGGGGCTGGGCTCGGATCAGCAGTGACCTCCCTGTCAGCCCAAACCAGTGGCTCCGCGTTCCCGTCCCTCACTGTGACTCTGACAGGTGCACATCAAGAGAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFF:FFF NM:i:0 MD:Z:150 MC:Z:150M AS:i:150 XS:i:0 RG:Z:normal +102,107c102,107 +< SRR25735653.7 83 19 58290978 60 98M = 58290978 -98 AGAAAGGCCTTATGAGTGCAGTGACTGTGGGAAATCCTTTGCTGAAAACTCCAGCCTTATTAAACACTTGAGAGTTCACACTGGAGAAAGGCCATATG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:98 MC:Z:98M AS:i:98 XS:i:69 RG:Z:normal +< SRR25735653.7 163 19 58290978 60 98M = 58290978 98 AGAAAGGCCTTATGAGTGCAGTGACTGTGGGAAATCCTTTGCTGAAAACTCCAGCCTTATTAAACACTTGAGAGTTCACACTGGAGAAAGGCCATATG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:98 MC:Z:98M AS:i:98 XS:i:25 RG:Z:normal +< SRR25735653.8 99 3 151162990 60 151M = 151163045 206 GCTTACTTCTGGCTTTTTGCCTTTTTCAGCAATTTCTGAGTATGGTTTGTGCCAAAATTGGTTTTCTGCCCAGGGAGATGGAGTTAATTTAGAATTCTGTGATTTAACTGTTGTTAGTGCTGGCATGGGAGTAGAATGTAACAGATTAGAG FFFFFFFF,F:F:FFFFF:F:FFFFF::,FF:FFF,FFFFFFFFFFFF:FFF:,FFFFFFF:FFFFFFF:F,F:FF:F,:FFFFFFFFF,FFFFFF:FFF:FFFFFFF:FFFFFFFFFF:FFFF,FFFFFFFFFFFFF,FF:FFFFFF:FF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:20 RG:Z:normal +< SRR25735653.8 147 3 151163045 60 151M = 151162990 -206 AATTGGTTTTCTGCCCAGGGAGATGGAGTTAATTTAGAATTCTGTGATTTAACTGTTGTTAGTGCTGGCATGGGAGTAGAATGTAACAGATTAGAGTAGATGAAGTGAGTGGTTCCAATTGTGAACTTGGCATTTGGGTGAACCTTGGGGG FFFFFF,,FFF:FFF:FFFFFFFFF:F,FFFFFFFF:FFFFFFFF:F:,FFFFFFFFFFFFF:FFFFFFF:FFFFF:FFFFFFFFFFFFFFFFFF:FFFF:FFFFFFF:::F:FFFF,FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:20 RG:Z:normal +< SRR25735653.9 83 17 20331951 60 139M = 20331951 -139 AAAATAAACTGTCAAGTAGTAAGAAGAACTTGGATGCCAGCAAAGAGAATGGGGCTGGGCAGATCTGTGAGCTGGCTGACGCCTTGAGCCGAGGGCATATGCGGTGGGGGCAGCCAACCAGAGCTGGTCACTCCTCAGG FFFFFFFFFFFFFFFF,FFFFFF::FFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:139 MC:Z:139M AS:i:139 XS:i:126 RG:Z:normal XA:Z:17,-16703391,107M2D32M,3;17,-5073900,104M1I34M,3;17,+18418821,34M1I104M,3; +< SRR25735653.9 163 17 20331951 60 139M = 20331951 139 AAAATAAACTGTCAAGTAGTAAGAAGAACTTGGATGCCAGCAAAGAGAATGGGGCTGGGCAGATCTGTGAGCTGGCTGACGCCTTGAGCCGAGGGCATATGCGGTGGGGGCAGCCAACCAGAGCTGGTCACTCCTCAGG FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:139 MC:Z:139M AS:i:139 XS:i:126 RG:Z:normal XA:Z:17,+16703391,107M2D32M,3;17,+5073900,104M1I34M,3; +--- +> SRR25735653.7 83 19 58290978 60 98M = 58290978 -98 AGAAAGGCCTTATGAGTGCAGTGACTGTGGGAAATCCTTTGCTGAAAACTCCAGCCTTATTAAACACTTGAGAGTTCACACTGGAGAAAGGCCATATG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:98 MC:Z:98M AS:i:98 XS:i:0 RG:Z:normal +> SRR25735653.7 163 19 58290978 60 98M = 58290978 98 AGAAAGGCCTTATGAGTGCAGTGACTGTGGGAAATCCTTTGCTGAAAACTCCAGCCTTATTAAACACTTGAGAGTTCACACTGGAGAAAGGCCATATG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:98 MC:Z:98M AS:i:98 XS:i:0 RG:Z:normal +> SRR25735653.8 99 3 151162990 60 151M = 151163045 206 GCTTACTTCTGGCTTTTTGCCTTTTTCAGCAATTTCTGAGTATGGTTTGTGCCAAAATTGGTTTTCTGCCCAGGGAGATGGAGTTAATTTAGAATTCTGTGATTTAACTGTTGTTAGTGCTGGCATGGGAGTAGAATGTAACAGATTAGAG FFFFFFFF,F:F:FFFFF:F:FFFFF::,FF:FFF,FFFFFFFFFFFF:FFF:,FFFFFFF:FFFFFFF:F,F:FF:F,:FFFFFFFFF,FFFFFF:FFF:FFFFFFF:FFFFFFFFFF:FFFF,FFFFFFFFFFFFF,FF:FFFFFF:FF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.8 147 3 151163045 60 151M = 151162990 -206 AATTGGTTTTCTGCCCAGGGAGATGGAGTTAATTTAGAATTCTGTGATTTAACTGTTGTTAGTGCTGGCATGGGAGTAGAATGTAACAGATTAGAGTAGATGAAGTGAGTGGTTCCAATTGTGAACTTGGCATTTGGGTGAACCTTGGGGG FFFFFF,,FFF:FFF:FFFFFFFFF:F,FFFFFFFF:FFFFFFFF:F:,FFFFFFFFFFFFF:FFFFFFF:FFFFF:FFFFFFFFFFFFFFFFFF:FFFF:FFFFFFF:::F:FFFF,FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.9 83 17 20331951 60 139M = 20331951 -139 AAAATAAACTGTCAAGTAGTAAGAAGAACTTGGATGCCAGCAAAGAGAATGGGGCTGGGCAGATCTGTGAGCTGGCTGACGCCTTGAGCCGAGGGCATATGCGGTGGGGGCAGCCAACCAGAGCTGGTCACTCCTCAGG FFFFFFFFFFFFFFFF,FFFFFF::FFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:139 MC:Z:139M AS:i:139 XS:i:0 RG:Z:normal +> SRR25735653.9 163 17 20331951 60 139M = 20331951 139 AAAATAAACTGTCAAGTAGTAAGAAGAACTTGGATGCCAGCAAAGAGAATGGGGCTGGGCAGATCTGTGAGCTGGCTGACGCCTTGAGCCGAGGGCATATGCGGTGGGGGCAGCCAACCAGAGCTGGTCACTCCTCAGG FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:139 MC:Z:139M AS:i:139 XS:i:0 RG:Z:normal +114c114 +< SRR25735653.13 99 22 40415144 60 150M = 40415157 164 TGCCTCACCAGTGCCTTTCCCCACCCAGGTCATTGCTGTGGTCATGGACCTCTTCACTGATGGTGATATCTTTCAAGACATTGTGGATGCTGCCTGTAAGCGCCGGGTCCCAGTGTACATCATCCTGGACGAGGCAGGAGTGAAGTATTT FFFFFFFFFFF:FFFFFFFFFF:FFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFF::FFFFFFFFF,FF:FFFFFFF:FFF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:20 RG:Z:normal +--- +> SRR25735653.13 99 22 40415144 60 150M = 40415157 164 TGCCTCACCAGTGCCTTTCCCCACCCAGGTCATTGCTGTGGTCATGGACCTCTTCACTGATGGTGATATCTTTCAAGACATTGTGGATGCTGCCTGTAAGCGCCGGGTCCCAGTGTACATCATCCTGGACGAGGCAGGAGTGAAGTATTT FFFFFFFFFFF:FFFFFFFFFF:FFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFF::FFFFFFFFF,FF:FFFFFFF:FFF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:0 RG:Z:normal +119c119 +< SRR25735653.15 147 16 11219932 60 151M = 11219904 -179 ACCAGGGGCGCCGGGGCAGCAGCGACCCCACAGTGCAGCGCTCCGTGTTTGCATCGGTGGACAAGGTGCCAGGTGAGCCAGCCCCCCGCCCTGCGCCACAGCTCGTTCATCATGGTGGGCGTTCAAGGTCTTTCTCTCTGTGGAGCCTGTG FFF:FFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:19 RG:Z:normal +--- +> SRR25735653.15 147 16 11219932 60 151M = 11219904 -179 ACCAGGGGCGCCGGGGCAGCAGCGACCCCACAGTGCAGCGCTCCGTGTTTGCATCGGTGGACAAGGTGCCAGGTGAGCCAGCCCCCCGCCCTGCGCCACAGCTCGTTCATCATGGTGGGCGTTCAAGGTCTTTCTCTCTGTGGAGCCTGTG FFF:FFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +122c122 +< SRR25735653.17 99 11 121352543 60 150M = 121352583 191 CCTCCTCCCCAGCTCCTCCCCTAGTACACAGATACCTATAGGCAGGCTTCATCTCCTCCTCCCCAGCTCCTCCCCTAGTGCACAGATACCTATAGGCAGGCTTCATCTCCTCCTCCCGAGCTCCTCCCCTAGTGCACAGATACCTATAGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF,FF:FFFFFFFFFFFFFFFFFFFF:F:FFF:FFFFFFFFFFF:FFFFFFFFFFF,FFFFFFF, NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:135 RG:Z:normal XA:Z:11,+121351685,150M,3; +--- +> SRR25735653.17 99 11 121352543 60 150M = 121352583 191 CCTCCTCCCCAGCTCCTCCCCTAGTACACAGATACCTATAGGCAGGCTTCATCTCCTCCTCCCCAGCTCCTCCCCTAGTGCACAGATACCTATAGGCAGGCTTCATCTCCTCCTCCCGAGCTCCTCCCCTAGTGCACAGATACCTATAGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF,FF:FFFFFFFFFFFFFFFFFFFF:F:FFF:FFFFFFFFFFF:FFFFFFFFFFF,FFFFFFF, NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:0 RG:Z:normal +128c128 +< SRR25735653.20 99 15 43941265 60 151M = 43941314 200 CCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGAACTCACGGACGACAACTT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF,:,FFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:136 RG:Z:normal XA:Z:15,+44038682,131M9D20M,9; +--- +> SRR25735653.20 99 15 43941265 60 151M = 43941314 200 CCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGAACTCACGGACGACAACTT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF,:,FFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +133,135c133,135 +< SRR25735653.22 147 2 109380546 60 150M = 109380285 -411 TAAAAACTGGTGAGGAAGATGAAGAAGAATTCTTTTGCAACCGCGCGAAATTGTTTCGTTTCGATGTAGAATCCAAAGAATGGAAAGAACGTGGGATTGGCAATGTAAAAATACTGAGGCATAAAACATCTGGTAAAATTCGCCTTCTAA FFFFFFFFF:FFF,FFFFFFFF:FFFF,F:FFF::::FFFFF:FF:FFFFFFFFFFFFFFFF:F,FFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:19 RG:Z:normal +< SRR25735653.23 99 2 105706301 60 151M = 105706354 202 CTATATGTGGGATCTTTTGTGATATAACTCTAATTGCATGGCTAATTAAAAAGAGAATATATGTGATATTTTAACAGAGACGTGATTGGCAGCAGATGGCTGATTAAGGAGGAACTAGAAGAAATGTTAGTGGAAAAACTGTCAGATCTAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF:FFFFFFFFF,FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:F NM:i:0 MD:Z:151 MC:Z:149M AS:i:151 XS:i:20 RG:Z:normal +< SRR25735653.23 147 2 105706354 60 149M = 105706301 -202 AGAATATATGTGATATTTTAACAGAGACGTGATTGGCAGCAGATGGCTGATTAAGGAGGAACTAGAAGAAATGTTAGTGGAAAAACTGTCAGATCTAGATGTGAGTAATTAATCTTTTTAATTTAAGGGGACCTATGCAATAAGAATAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:149 MC:Z:151M AS:i:149 XS:i:19 RG:Z:normal +--- +> SRR25735653.22 147 2 109380546 60 150M = 109380285 -411 TAAAAACTGGTGAGGAAGATGAAGAAGAATTCTTTTGCAACCGCGCGAAATTGTTTCGTTTCGATGTAGAATCCAAAGAATGGAAAGAACGTGGGATTGGCAATGTAAAAATACTGAGGCATAAAACATCTGGTAAAATTCGCCTTCTAA FFFFFFFFF:FFF,FFFFFFFF:FFFF,F:FFF::::FFFFF:FF:FFFFFFFFFFFFFFFF:F,FFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:0 RG:Z:normal +> SRR25735653.23 99 2 105706301 60 151M = 105706354 202 CTATATGTGGGATCTTTTGTGATATAACTCTAATTGCATGGCTAATTAAAAAGAGAATATATGTGATATTTTAACAGAGACGTGATTGGCAGCAGATGGCTGATTAAGGAGGAACTAGAAGAAATGTTAGTGGAAAAACTGTCAGATCTAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFF:FFFFFFFFF,FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:F NM:i:0 MD:Z:151 MC:Z:149M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.23 147 2 105706354 60 149M = 105706301 -202 AGAATATATGTGATATTTTAACAGAGACGTGATTGGCAGCAGATGGCTGATTAAGGAGGAACTAGAAGAAATGTTAGTGGAAAAACTGTCAGATCTAGATGTGAGTAATTAATCTTTTTAATTTAAGGGGACCTATGCAATAAGAATAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFF:FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:149 MC:Z:151M AS:i:149 XS:i:0 RG:Z:normal +140,141c140,141 +< SRR25735653.26 99 X 65409474 60 151M = 65409529 206 ATTTGGCTGTCCTTTCCTAATCCTGATATTTTCTTTGGGTTTTCTTTTGCAGCAATCAATGGCTTTGTTTTTGGGAATTTACCTGAGCTGAACATGTGTGCACAGAAACGTGTGGCCTGGCACTTGTTTGGCATGGGCAATGAAATTGATG FFFFFFFFFF:F:FFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:F:FFFFFFF:FFFFFFFFFF:F:F:F:,FF:FFFFFFF,FFF:FF:FFFFFF,:FFF:FFF:F:FFFFFFFFFFFFFFF,:F::FFF:FFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:20 RG:Z:normal +< SRR25735653.26 147 X 65409529 60 151M = 65409474 -206 TCAATGGCTTTGTTTTTGGGAATTTACCTGAGCTGAACATGTGTGCACAGAAACGTGTGGCCTGGCACTTGTTTGGCATGGGCAATGAAATTGATGTCCACACAGCATTTTTCCATGGACAGATGCTGACTACCCGTGGACACCACACTGA FFFF:FFFFFFFFFFF::,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FF:FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:19 RG:Z:normal +--- +> SRR25735653.26 99 X 65409474 60 151M = 65409529 206 ATTTGGCTGTCCTTTCCTAATCCTGATATTTTCTTTGGGTTTTCTTTTGCAGCAATCAATGGCTTTGTTTTTGGGAATTTACCTGAGCTGAACATGTGTGCACAGAAACGTGTGGCCTGGCACTTGTTTGGCATGGGCAATGAAATTGATG FFFFFFFFFF:F:FFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:F:FFFFFFF:FFFFFFFFFF:F:F:F:,FF:FFFFFFF,FFF:FF:FFFFFF,:FFF:FFF:F:FFFFFFFFFFFFFFF,:F::FFF:FFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.26 147 X 65409529 60 151M = 65409474 -206 TCAATGGCTTTGTTTTTGGGAATTTACCTGAGCTGAACATGTGTGCACAGAAACGTGTGGCCTGGCACTTGTTTGGCATGGGCAATGAAATTGATGTCCACACAGCATTTTTCCATGGACAGATGCTGACTACCCGTGGACACCACACTGA FFFF:FFFFFFFFFFF::,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FF:FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +144,146c144,146 +< SRR25735653.28 99 1 89734991 60 151M = 89735039 199 GATGGTGACTGTGTGAATGGACAGAAGGGTTTGGCAGAGCTTTGCTGGTACCACTCACCCTTGTTCTTCCCAGCCAGCTTGTTCATCAGGTAGGATTTGCCAGTGCGATAGAGGCCCACAATCGCTACCACAACTACAGGTTGCGTAATGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFF:F:FFFFFF:FFFFFFFFFF:FFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:69 RG:Z:normal +< SRR25735653.28 147 1 89735039 60 151M = 89734991 -199 TACCACTCACCCTTGTTCTTCCCAGCCAGCTTGTTCATCAGGTAGGATTTGCCAGTGCGATAGAGGCCCACAATCGCTACCACAACTACAGGTTGCGTAATGGCAGACAGGATCTCCAAAGCTTCCTGATTAACCTTCAGCTGCTCATTAA FFFFFFFFFFFFFFFFFF,FFF:FFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFF:FFFFF:FFFFF:FFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:67 RG:Z:normal +< SRR25735653.29 83 20 2816202 60 150M = 2816152 -200 GGCCCCCCCATTCTCCGCACATGGTAGGGGCTGTTAGGAACATAGCGTGGCATCCCCCGGTGGACCACTGGGCCCCAGTGCTGACCATGGGGATTAGGGCCAGGGATTGGAGGTGGCAGAGGGCCAGGCACAAAGTTCACTCCAGGGCCA FFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:150M AS:i:150 XS:i:20 RG:Z:normal +--- +> SRR25735653.28 99 1 89734991 60 151M = 89735039 199 GATGGTGACTGTGTGAATGGACAGAAGGGTTTGGCAGAGCTTTGCTGGTACCACTCACCCTTGTTCTTCCCAGCCAGCTTGTTCATCAGGTAGGATTTGCCAGTGCGATAGAGGCCCACAATCGCTACCACAACTACAGGTTGCGTAATGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFF,FFFFFFFFFFFFFFFFFF:FFFFF:F:FFFFFF:FFFFFFFFFF:FFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.28 147 1 89735039 60 151M = 89734991 -199 TACCACTCACCCTTGTTCTTCCCAGCCAGCTTGTTCATCAGGTAGGATTTGCCAGTGCGATAGAGGCCCACAATCGCTACCACAACTACAGGTTGCGTAATGGCAGACAGGATCTCCAAAGCTTCCTGATTAACCTTCAGCTGCTCATTAA FFFFFFFFFFFFFFFFFF,FFF:FFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:FFF:FFFFF:FFFFF:FFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.29 83 20 2816202 60 150M = 2816152 -200 GGCCCCCCCATTCTCCGCACATGGTAGGGGCTGTTAGGAACATAGCGTGGCATCCCCCGGTGGACCACTGGGCCCCAGTGCTGACCATGGGGATTAGGGCCAGGGATTGGAGGTGGCAGAGGGCCAGGCACAAAGTTCACTCCAGGGCCA FFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:150M AS:i:150 XS:i:0 RG:Z:normal +150c150 +< SRR25735653.31 83 10 28821773 60 150M = 28821699 -224 CCCGGAGCCCCTGAGATCAGCCTCGAGCAGGCGCCCGAGCGAGACTATCCCTAAACGGGAACGGCGGTGGCCGACTCGCGAGTGAGGAAAAGAAGGAAAGGGCAGACTGGTCGCGAAGAGAAGATCCAGGCCTCAGAGGAGGAGAAAGGC FFFF:FFFFFFF,FFFFFFFFF,FFFFFFFFFFFFFF,F:FF,FFFFFFF:,FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:150M AS:i:150 XS:i:22 RG:Z:normal +--- +> SRR25735653.31 83 10 28821773 60 150M = 28821699 -224 CCCGGAGCCCCTGAGATCAGCCTCGAGCAGGCGCCCGAGCGAGACTATCCCTAAACGGGAACGGCGGTGGCCGACTCGCGAGTGAGGAAAAGAAGGAAAGGGCAGACTGGTCGCGAAGAGAAGATCCAGGCCTCAGAGGAGGAGAAAGGC FFFF:FFFFFFF,FFFFFFFFF,FFFFFFFFFFFFFF,F:FF,FFFFFFF:,FFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:150M AS:i:150 XS:i:0 RG:Z:normal +152c152 +< SRR25735653.32 99 11 3047947 60 151M = 3048185 389 GGCACCAGCTTCCCATAGGAGTGCTTCTCGCTAGAAGCAAACTTCGCTGTATCAAAGTAGACAGACCCATTGGAGACATAGCTGGAAAACAGAAAAGGAATTGGGTGGGTGCATCTAACAGACCCGAAAGTGTGTCAGCAGGATGACAGTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:21 RG:Z:normal +--- +> SRR25735653.32 99 11 3047947 60 151M = 3048185 389 GGCACCAGCTTCCCATAGGAGTGCTTCTCGCTAGAAGCAAACTTCGCTGTATCAAAGTAGACAGACCCATTGGAGACATAGCTGGAAAACAGAAAAGGAATTGGGTGGGTGCATCTAACAGACCCGAAAGTGTGTCAGCAGGATGACAGTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +160c160 +< SRR25735653.36 83 19 43990219 60 150M = 43990131 -238 ACCTGCCACACATGGAGATGACCATCATCCGGTCATGGGAACAGGAACTGGTCCTCTGCAGTTCCCTTTCCCTTGCCAAGCCCAGGACAATTTTCTGTTCAATTGGAGGAGAGGAAAGGGTCAGATGTAAGAAAGGGCATAGGTCAGGGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:20 RG:Z:normal +--- +> SRR25735653.36 83 19 43990219 60 150M = 43990131 -238 ACCTGCCACACATGGAGATGACCATCATCCGGTCATGGGAACAGGAACTGGTCCTCTGCAGTTCCCTTTCCCTTGCCAAGCCCAGGACAATTTTCTGTTCAATTGGAGGAGAGGAAAGGGTCAGATGTAAGAAAGGGCATAGGTCAGGGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:0 RG:Z:normal +162,164c162,164 +< SRR25735653.37 83 11 121414318 60 104M = 121414318 -104 GTGTATGGCCTCCTCACAGAACCTGGGGAGAAGAGCACTGTCTTCACCATCTTTGGCTCGAACAAAGAGAATGTCCACAGCTGGCTGATCCTCCAGGTCAATGC F:FFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:104 MC:Z:104M AS:i:104 XS:i:19 RG:Z:normal +< SRR25735653.37 163 11 121414318 60 104M = 121414318 104 GTGTATGGCCTCCTCACAGAACCTGGGGAGAAGAGCACTGTCTTCACCATCTTTGGCTCGAACAAAGAGAATGTCCACAGCTGGCTGATCCTCCAGGTCAATGC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:104 MC:Z:104M AS:i:104 XS:i:19 RG:Z:normal +< SRR25735653.38 83 X 79940928 60 151M = 79940882 -197 TCAATATGTCTTTTAAGAGACTACCAGGCCTACCTCAGAAAGAGATGAATCTTGTTGTCTTTCTGGAACAACAGACTCTGAGGATTCTCCCTCTTGCTCCTGATGACCCTATTAGGGTGAAGAACATATACTGGTTTCCAGACAACTATAA FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFF:FFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:21 RG:Z:normal +--- +> SRR25735653.37 83 11 121414318 60 104M = 121414318 -104 GTGTATGGCCTCCTCACAGAACCTGGGGAGAAGAGCACTGTCTTCACCATCTTTGGCTCGAACAAAGAGAATGTCCACAGCTGGCTGATCCTCCAGGTCAATGC F:FFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:104 MC:Z:104M AS:i:104 XS:i:0 RG:Z:normal +> SRR25735653.37 163 11 121414318 60 104M = 121414318 104 GTGTATGGCCTCCTCACAGAACCTGGGGAGAAGAGCACTGTCTTCACCATCTTTGGCTCGAACAAAGAGAATGTCCACAGCTGGCTGATCCTCCAGGTCAATGC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:104 MC:Z:104M AS:i:104 XS:i:0 RG:Z:normal +> SRR25735653.38 83 X 79940928 60 151M = 79940882 -197 TCAATATGTCTTTTAAGAGACTACCAGGCCTACCTCAGAAAGAGATGAATCTTGTTGTCTTTCTGGAACAACAGACTCTGAGGATTCTCCCTCTTGCTCCTGATGACCCTATTAGGGTGAAGAACATATACTGGTTTCCAGACAACTATAA FFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFF:FFFF:FFFFFFFFFFFFFFFF NM:i:0 MD:Z:151 MC:Z:151M AS:i:151 XS:i:0 RG:Z:normal +167,171c167,171 +< SRR25735653.39 147 18 29111133 60 126M = 29111133 -126 AGCATGGATAGATCAAGCAAAGGCCAAATAATTGGAAATTTTCAAGCTTTTGATGAGGACACTGGACTACCAGCCCATGCAAGGTAAGAGAGAGTGACACGTGTATTTCTTTATTTTAAATTATTT F,FFFFFFFFFFFFFFFFFF:F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:126 MC:Z:126M AS:i:126 XS:i:20 RG:Z:normal +< SRR25735653.40 99 17 35388821 60 151M = 35388901 230 GTTCTGGAGTTTGTTAACTCACTGAATGTGTTTCCTCTCCTAGGTTAATAGTTACTAATGTTGCTGCCTGTTGCTTCCTGCTTTATTTAGGTTTCATGTCCTTAGCAAGCTACTGAGTTTCATGGCACCTATTGACCATACTACAATGAAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFF:FFFF:FFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFF:FFFFFFFF NM:i:0 MD:Z:151 MC:Z:150M AS:i:151 XS:i:19 RG:Z:normal +< SRR25735653.40 147 17 35388901 60 150M = 35388821 -230 CTTTATTTAGGTTTCATGTCCTTAGCAAGCTACTGAGTTTCATGGCACCTATTGACCATACTACAATGAATGATGATGCCAGGTGAGTAATAGATTAATTATGTGTCTCAAATGGCTTCATGACAGCCTGATATTGACCTGCTCTACAGC FFFFFFF:FFFFFF,FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:21 RG:Z:normal +< SRR25735653.41 83 14 69814599 60 111M = 69814599 -111 GCTGTTCAGTGACCACCTCATCCAGCAGCAGGGGAAGTGCCTGGCTGCCACCTCCACCTTAATGTCCTCCCCTGGATCCCCAGTCATACTGCAGATGTGCAACCCTAGAGA FFFF:FFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:111 MC:Z:111M AS:i:111 XS:i:19 RG:Z:normal +< SRR25735653.41 163 14 69814599 60 111M = 69814599 111 GCTGTTCAGTGACCACCTCATCCAGCAGCAGGGGAAGTGCCTGGCTGCCACCTCCACCTTAATGTCCTCCCCTGGATCCCCAGTCATACTGCAGATGTGCAACCCTAGAGA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:111 MC:Z:111M AS:i:111 XS:i:19 RG:Z:normal +--- +> SRR25735653.39 147 18 29111133 60 126M = 29111133 -126 AGCATGGATAGATCAAGCAAAGGCCAAATAATTGGAAATTTTCAAGCTTTTGATGAGGACACTGGACTACCAGCCCATGCAAGGTAAGAGAGAGTGACACGTGTATTTCTTTATTTTAAATTATTT F,FFFFFFFFFFFFFFFFFF:F:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:126 MC:Z:126M AS:i:126 XS:i:0 RG:Z:normal +> SRR25735653.40 99 17 35388821 60 151M = 35388901 230 GTTCTGGAGTTTGTTAACTCACTGAATGTGTTTCCTCTCCTAGGTTAATAGTTACTAATGTTGCTGCCTGTTGCTTCCTGCTTTATTTAGGTTTCATGTCCTTAGCAAGCTACTGAGTTTCATGGCACCTATTGACCATACTACAATGAAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFF:FFFF:FFFF:FFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFF:FFFFFF:FFFFFFFF NM:i:0 MD:Z:151 MC:Z:150M AS:i:151 XS:i:0 RG:Z:normal +> SRR25735653.40 147 17 35388901 60 150M = 35388821 -230 CTTTATTTAGGTTTCATGTCCTTAGCAAGCTACTGAGTTTCATGGCACCTATTGACCATACTACAATGAATGATGATGCCAGGTGAGTAATAGATTAATTATGTGTCTCAAATGGCTTCATGACAGCCTGATATTGACCTGCTCTACAGC FFFFFFF:FFFFFF,FFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NM:i:0 MD:Z:150 MC:Z:151M AS:i:150 XS:i:0 RG:Z:normal diff --git a/is.c b/is.c new file mode 100644 index 0000000..46f1772 --- /dev/null +++ b/is.c @@ -0,0 +1,223 @@ +/* + * sais.c for sais-lite + * Copyright (c) 2008 Yuta Mori All Rights Reserved. + * + * Permission is hereby granted, free of charge, to any person + * obtaining a copy of this software and associated documentation + * files (the "Software"), to deal in the Software without + * restriction, including without limitation the rights to use, + * copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the + * Software is furnished to do so, subject to the following + * conditions: + * + * The above copyright notice and this permission notice shall be + * included in all copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + * EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES + * OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + * NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT + * HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, + * WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING + * FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR + * OTHER DEALINGS IN THE SOFTWARE. + */ + +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef unsigned char ubyte_t; +#define chr(i) (cs == sizeof(int) ? ((const int *)T)[i]:((const unsigned char *)T)[i]) + +/* find the start or end of each bucket */ +static void getCounts(const unsigned char *T, int *C, int n, int k, int cs) +{ + int i; + for (i = 0; i < k; ++i) C[i] = 0; + for (i = 0; i < n; ++i) ++C[chr(i)]; +} +static void getBuckets(const int *C, int *B, int k, int end) +{ + int i, sum = 0; + if (end) { + for (i = 0; i < k; ++i) { + sum += C[i]; + B[i] = sum; + } + } else { + for (i = 0; i < k; ++i) { + sum += C[i]; + B[i] = sum - C[i]; + } + } +} + +/* compute SA */ +static void induceSA(const unsigned char *T, int *SA, int *C, int *B, int n, int k, int cs) +{ + int *b, i, j; + int c0, c1; + /* compute SAl */ + if (C == B) getCounts(T, C, n, k, cs); + getBuckets(C, B, k, 0); /* find starts of buckets */ + j = n - 1; + b = SA + B[c1 = chr(j)]; + *b++ = ((0 < j) && (chr(j - 1) < c1)) ? ~j : j; + for (i = 0; i < n; ++i) { + j = SA[i], SA[i] = ~j; + if (0 < j) { + --j; + if ((c0 = chr(j)) != c1) { + B[c1] = b - SA; + b = SA + B[c1 = c0]; + } + *b++ = ((0 < j) && (chr(j - 1) < c1)) ? ~j : j; + } + } + /* compute SAs */ + if (C == B) getCounts(T, C, n, k, cs); + getBuckets(C, B, k, 1); /* find ends of buckets */ + for (i = n - 1, b = SA + B[c1 = 0]; 0 <= i; --i) { + if (0 < (j = SA[i])) { + --j; + if ((c0 = chr(j)) != c1) { + B[c1] = b - SA; + b = SA + B[c1 = c0]; + } + *--b = ((j == 0) || (chr(j - 1) > c1)) ? ~j : j; + } else SA[i] = ~j; + } +} + +/* + * find the suffix array SA of T[0..n-1] in {0..k-1}^n use a working + * space (excluding T and SA) of at most 2n+O(1) for a constant alphabet + */ +static int sais_main(const unsigned char *T, int *SA, int fs, int n, int k, int cs) +{ + int *C, *B, *RA; + int i, j, c, m, p, q, plen, qlen, name; + int c0, c1; + int diff; + + /* stage 1: reduce the problem by at least 1/2 sort all the + * S-substrings */ + if (k <= fs) { + C = SA + n; + B = (k <= (fs - k)) ? C + k : C; + } else if ((C = B = (int *) malloc(k * sizeof(int))) == NULL) return -2; + getCounts(T, C, n, k, cs); + getBuckets(C, B, k, 1); /* find ends of buckets */ + for (i = 0; i < n; ++i) SA[i] = 0; + for (i = n - 2, c = 0, c1 = chr(n - 1); 0 <= i; --i, c1 = c0) { + if ((c0 = chr(i)) < (c1 + c)) c = 1; + else if (c != 0) SA[--B[c1]] = i + 1, c = 0; + } + induceSA(T, SA, C, B, n, k, cs); + if (fs < k) free(C); + /* compact all the sorted substrings into the first m items of SA + * 2*m must be not larger than n (proveable) */ + for (i = 0, m = 0; i < n; ++i) { + p = SA[i]; + if ((0 < p) && (chr(p - 1) > (c0 = chr(p)))) { + for (j = p + 1; (j < n) && (c0 == (c1 = chr(j))); ++j); + if ((j < n) && (c0 < c1)) SA[m++] = p; + } + } + for (i = m; i < n; ++i) SA[i] = 0; /* init the name array buffer */ + /* store the length of all substrings */ + for (i = n - 2, j = n, c = 0, c1 = chr(n - 1); 0 <= i; --i, c1 = c0) { + if ((c0 = chr(i)) < (c1 + c)) c = 1; + else if (c != 0) { + SA[m + ((i + 1) >> 1)] = j - i - 1; + j = i + 1; + c = 0; + } + } + /* find the lexicographic names of all substrings */ + for (i = 0, name = 0, q = n, qlen = 0; i < m; ++i) { + p = SA[i], plen = SA[m + (p >> 1)], diff = 1; + if (plen == qlen) { + for (j = 0; (j < plen) && (chr(p + j) == chr(q + j)); j++); + if (j == plen) diff = 0; + } + if (diff != 0) ++name, q = p, qlen = plen; + SA[m + (p >> 1)] = name; + } + + /* stage 2: solve the reduced problem recurse if names are not yet + * unique */ + if (name < m) { + RA = SA + n + fs - m; + for (i = n - 1, j = m - 1; m <= i; --i) { + if (SA[i] != 0) RA[j--] = SA[i] - 1; + } + if (sais_main((unsigned char *) RA, SA, fs + n - m * 2, m, name, sizeof(int)) != 0) return -2; + for (i = n - 2, j = m - 1, c = 0, c1 = chr(n - 1); 0 <= i; --i, c1 = c0) { + if ((c0 = chr(i)) < (c1 + c)) c = 1; + else if (c != 0) RA[j--] = i + 1, c = 0; /* get p1 */ + } + for (i = 0; i < m; ++i) SA[i] = RA[SA[i]]; /* get index */ + } + /* stage 3: induce the result for the original problem */ + if (k <= fs) { + C = SA + n; + B = (k <= (fs - k)) ? C + k : C; + } else if ((C = B = (int *) malloc(k * sizeof(int))) == NULL) return -2; + /* put all left-most S characters into their buckets */ + getCounts(T, C, n, k, cs); + getBuckets(C, B, k, 1); /* find ends of buckets */ + for (i = m; i < n; ++i) SA[i] = 0; /* init SA[m..n-1] */ + for (i = m - 1; 0 <= i; --i) { + j = SA[i], SA[i] = 0; + SA[--B[chr(j)]] = j; + } + induceSA(T, SA, C, B, n, k, cs); + if (fs < k) free(C); + return 0; +} + +/** + * Constructs the suffix array of a given string. + * @param T[0..n-1] The input string. + * @param SA[0..n] The output array of suffixes. + * @param n The length of the given string. + * @return 0 if no error occurred + */ +int is_sa(const ubyte_t *T, int *SA, int n) +{ + if ((T == NULL) || (SA == NULL) || (n < 0)) return -1; + SA[0] = n; + if (n <= 1) { + if (n == 1) SA[1] = 0; + return 0; + } + return sais_main(T, SA+1, 0, n, 256, 1); +} + +/** + * Constructs the burrows-wheeler transformed string of a given string. + * @param T[0..n-1] The input string. + * @param n The length of the given string. + * @return The primary index if no error occurred, -1 or -2 otherwise. + */ +int is_bwt(ubyte_t *T, int n) +{ + int *SA, i, primary = 0; + SA = (int*)calloc(n+1, sizeof(int)); + + if (is_sa(T, SA, n)) return -1; + + for (i = 0; i <= n; ++i) { + if (SA[i] == 0) primary = i; + else SA[i] = T[SA[i] - 1]; + } + for (i = 0; i < primary; ++i) T[i] = SA[i]; + for (; i < n; ++i) T[i] = SA[i + 1]; + free(SA); + return primary; +} diff --git a/kbtree.h b/kbtree.h new file mode 100644 index 0000000..5e21b57 --- /dev/null +++ b/kbtree.h @@ -0,0 +1,388 @@ +/*- + * Copyright 1997-1999, 2001, John-Mark Gurney. + * 2008-2009, Attractive Chaos + * + * Redistribution and use in source and binary forms, with or without + * modification, are permitted provided that the following conditions + * are met: + * + * 1. Redistributions of source code must retain the above copyright + * notice, this list of conditions and the following disclaimer. + * 2. Redistributions in binary form must reproduce the above copyright + * notice, this list of conditions and the following disclaimer in the + * documentation and/or other materials provided with the distribution. + * + * THIS SOFTWARE IS PROVIDED BY THE AUTHOR AND CONTRIBUTORS ``AS IS'' AND + * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE + * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE + * ARE DISCLAIMED. IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE + * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL + * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS + * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) + * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STR + * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY + * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF + * SUCH DAMAGE. + */ + +#ifndef __AC_KBTREE_H +#define __AC_KBTREE_H + +#include +#include +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef struct { + int32_t is_internal:1, n:31; +} kbnode_t; + +#define __KB_KEY(type, x) ((type*)((char*)x + 4)) +#define __KB_PTR(btr, x) ((kbnode_t**)((char*)x + btr->off_ptr)) + +#define __KB_TREE_T(name) \ + typedef struct { \ + kbnode_t *root; \ + int off_key, off_ptr, ilen, elen; \ + int n, t; \ + int n_keys, n_nodes; \ + } kbtree_##name##_t; + +#define __KB_INIT(name, key_t) \ + kbtree_##name##_t *kb_init_##name(int size) \ + { \ + kbtree_##name##_t *b; \ + b = (kbtree_##name##_t*)calloc(1, sizeof(kbtree_##name##_t)); \ + b->t = ((size - 4 - sizeof(void*)) / (sizeof(void*) + sizeof(key_t)) + 1) >> 1; \ + if (b->t < 2) { \ + free(b); return 0; \ + } \ + b->n = 2 * b->t - 1; \ + b->off_ptr = 4 + b->n * sizeof(key_t); \ + b->ilen = (4 + sizeof(void*) + b->n * (sizeof(void*) + sizeof(key_t)) + 3) >> 2 << 2; \ + b->elen = (b->off_ptr + 3) >> 2 << 2; \ + b->root = (kbnode_t*)calloc(1, b->ilen); \ + ++b->n_nodes; \ + return b; \ + } + +#define __kb_destroy(b) do { \ + int i, max = 8; \ + kbnode_t *x, **top, **stack = 0; \ + if (b) { \ + top = stack = (kbnode_t**)calloc(max, sizeof(kbnode_t*)); \ + *top++ = (b)->root; \ + while (top != stack) { \ + x = *--top; \ + if (x == 0 || x->is_internal == 0) { free(x); continue; } \ + for (i = 0; i <= x->n; ++i) \ + if (__KB_PTR(b, x)[i]) { \ + if (top - stack == max) { \ + max <<= 1; \ + stack = (kbnode_t**)realloc(stack, max * sizeof(kbnode_t*)); \ + top = stack + (max>>1); \ + } \ + *top++ = __KB_PTR(b, x)[i]; \ + } \ + free(x); \ + } \ + } \ + free(b); free(stack); \ + } while (0) + +#define __kb_get_first(key_t, b, ret) do { \ + kbnode_t *__x = (b)->root; \ + while (__KB_PTR(b, __x)[0] != 0) \ + __x = __KB_PTR(b, __x)[0]; \ + (ret) = __KB_KEY(key_t, __x)[0]; \ + } while (0) + +#define __KB_GET_AUX0(name, key_t, __cmp) \ + static inline int __kb_get_aux_##name(const kbnode_t * __restrict x, const key_t * __restrict k, int *r) \ + { \ + int tr, *rr, begin, end, n = x->n >> 1; \ + if (x->n == 0) return -1; \ + if (__cmp(*k, __KB_KEY(key_t, x)[n]) < 0) { \ + begin = 0; end = n; \ + } else { begin = n; end = x->n - 1; } \ + rr = r? r : &tr; \ + n = end; \ + while (n >= begin && (*rr = __cmp(*k, __KB_KEY(key_t, x)[n])) < 0) --n; \ + return n; \ + } + +#define __KB_GET_AUX1(name, key_t, __cmp) \ + static inline int __kb_getp_aux_##name(const kbnode_t * __restrict x, const key_t * __restrict k, int *r) \ + { \ + int tr, *rr, begin = 0, end = x->n; \ + if (x->n == 0) return -1; \ + rr = r? r : &tr; \ + while (begin < end) { \ + int mid = (begin + end) >> 1; \ + if (__cmp(__KB_KEY(key_t, x)[mid], *k) < 0) begin = mid + 1; \ + else end = mid; \ + } \ + if (begin == x->n) { *rr = 1; return x->n - 1; } \ + if ((*rr = __cmp(*k, __KB_KEY(key_t, x)[begin])) < 0) --begin; \ + return begin; \ + } + +#define __KB_GET(name, key_t) \ + static key_t *kb_getp_##name(kbtree_##name##_t *b, const key_t * __restrict k) \ + { \ + int i, r = 0; \ + kbnode_t *x = b->root; \ + while (x) { \ + i = __kb_getp_aux_##name(x, k, &r); \ + if (i >= 0 && r == 0) return &__KB_KEY(key_t, x)[i]; \ + if (x->is_internal == 0) return 0; \ + x = __KB_PTR(b, x)[i + 1]; \ + } \ + return 0; \ + } \ + static inline key_t *kb_get_##name(kbtree_##name##_t *b, const key_t k) \ + { \ + return kb_getp_##name(b, &k); \ + } + +#define __KB_INTERVAL(name, key_t) \ + static void kb_intervalp_##name(kbtree_##name##_t *b, const key_t * __restrict k, key_t **lower, key_t **upper) \ + { \ + int i, r = 0; \ + kbnode_t *x = b->root; \ + *lower = *upper = 0; \ + while (x) { \ + i = __kb_getp_aux_##name(x, k, &r); \ + if (i >= 0 && r == 0) { \ + *lower = *upper = &__KB_KEY(key_t, x)[i]; \ + return; \ + } \ + if (i >= 0) *lower = &__KB_KEY(key_t, x)[i]; \ + if (i < x->n - 1) *upper = &__KB_KEY(key_t, x)[i + 1]; \ + if (x->is_internal == 0) return; \ + x = __KB_PTR(b, x)[i + 1]; \ + } \ + } \ + static inline void kb_interval_##name(kbtree_##name##_t *b, const key_t k, key_t **lower, key_t **upper) \ + { \ + kb_intervalp_##name(b, &k, lower, upper); \ + } + +#define __KB_PUT(name, key_t, __cmp) \ + /* x must be an internal node */ \ + static void __kb_split_##name(kbtree_##name##_t *b, kbnode_t *x, int i, kbnode_t *y) \ + { \ + kbnode_t *z; \ + z = (kbnode_t*)calloc(1, y->is_internal? b->ilen : b->elen); \ + ++b->n_nodes; \ + z->is_internal = y->is_internal; \ + z->n = b->t - 1; \ + memcpy(__KB_KEY(key_t, z), __KB_KEY(key_t, y) + b->t, sizeof(key_t) * (b->t - 1)); \ + if (y->is_internal) memcpy(__KB_PTR(b, z), __KB_PTR(b, y) + b->t, sizeof(void*) * b->t); \ + y->n = b->t - 1; \ + memmove(__KB_PTR(b, x) + i + 2, __KB_PTR(b, x) + i + 1, sizeof(void*) * (x->n - i)); \ + __KB_PTR(b, x)[i + 1] = z; \ + memmove(__KB_KEY(key_t, x) + i + 1, __KB_KEY(key_t, x) + i, sizeof(key_t) * (x->n - i)); \ + __KB_KEY(key_t, x)[i] = __KB_KEY(key_t, y)[b->t - 1]; \ + ++x->n; \ + } \ + static void __kb_putp_aux_##name(kbtree_##name##_t *b, kbnode_t *x, const key_t * __restrict k) \ + { \ + int i = x->n - 1; \ + if (x->is_internal == 0) { \ + i = __kb_getp_aux_##name(x, k, 0); \ + if (i != x->n - 1) \ + memmove(__KB_KEY(key_t, x) + i + 2, __KB_KEY(key_t, x) + i + 1, (x->n - i - 1) * sizeof(key_t)); \ + __KB_KEY(key_t, x)[i + 1] = *k; \ + ++x->n; \ + } else { \ + i = __kb_getp_aux_##name(x, k, 0) + 1; \ + if (__KB_PTR(b, x)[i]->n == 2 * b->t - 1) { \ + __kb_split_##name(b, x, i, __KB_PTR(b, x)[i]); \ + if (__cmp(*k, __KB_KEY(key_t, x)[i]) > 0) ++i; \ + } \ + __kb_putp_aux_##name(b, __KB_PTR(b, x)[i], k); \ + } \ + } \ + static void kb_putp_##name(kbtree_##name##_t *b, const key_t * __restrict k) \ + { \ + kbnode_t *r, *s; \ + ++b->n_keys; \ + r = b->root; \ + if (r->n == 2 * b->t - 1) { \ + ++b->n_nodes; \ + s = (kbnode_t*)calloc(1, b->ilen); \ + b->root = s; s->is_internal = 1; s->n = 0; \ + __KB_PTR(b, s)[0] = r; \ + __kb_split_##name(b, s, 0, r); \ + r = s; \ + } \ + __kb_putp_aux_##name(b, r, k); \ + } \ + static inline void kb_put_##name(kbtree_##name##_t *b, const key_t k) \ + { \ + kb_putp_##name(b, &k); \ + } + + +#define __KB_DEL(name, key_t) \ + static key_t __kb_delp_aux_##name(kbtree_##name##_t *b, kbnode_t *x, const key_t * __restrict k, int s) \ + { \ + int yn, zn, i, r = 0; \ + kbnode_t *xp, *y, *z; \ + key_t kp; \ + if (x == 0) return *k; \ + if (s) { /* s can only be 0, 1 or 2 */ \ + r = x->is_internal == 0? 0 : s == 1? 1 : -1; \ + i = s == 1? x->n - 1 : -1; \ + } else i = __kb_getp_aux_##name(x, k, &r); \ + if (x->is_internal == 0) { \ + if (s == 2) ++i; \ + kp = __KB_KEY(key_t, x)[i]; \ + memmove(__KB_KEY(key_t, x) + i, __KB_KEY(key_t, x) + i + 1, (x->n - i - 1) * sizeof(key_t)); \ + --x->n; \ + return kp; \ + } \ + if (r == 0) { \ + if ((yn = __KB_PTR(b, x)[i]->n) >= b->t) { \ + xp = __KB_PTR(b, x)[i]; \ + kp = __KB_KEY(key_t, x)[i]; \ + __KB_KEY(key_t, x)[i] = __kb_delp_aux_##name(b, xp, 0, 1); \ + return kp; \ + } else if ((zn = __KB_PTR(b, x)[i + 1]->n) >= b->t) { \ + xp = __KB_PTR(b, x)[i + 1]; \ + kp = __KB_KEY(key_t, x)[i]; \ + __KB_KEY(key_t, x)[i] = __kb_delp_aux_##name(b, xp, 0, 2); \ + return kp; \ + } else if (yn == b->t - 1 && zn == b->t - 1) { \ + y = __KB_PTR(b, x)[i]; z = __KB_PTR(b, x)[i + 1]; \ + __KB_KEY(key_t, y)[y->n++] = *k; \ + memmove(__KB_KEY(key_t, y) + y->n, __KB_KEY(key_t, z), z->n * sizeof(key_t)); \ + if (y->is_internal) memmove(__KB_PTR(b, y) + y->n, __KB_PTR(b, z), (z->n + 1) * sizeof(void*)); \ + y->n += z->n; \ + memmove(__KB_KEY(key_t, x) + i, __KB_KEY(key_t, x) + i + 1, (x->n - i - 1) * sizeof(key_t)); \ + memmove(__KB_PTR(b, x) + i + 1, __KB_PTR(b, x) + i + 2, (x->n - i - 1) * sizeof(void*)); \ + --x->n; \ + free(z); \ + return __kb_delp_aux_##name(b, y, k, s); \ + } \ + } \ + ++i; \ + if ((xp = __KB_PTR(b, x)[i])->n == b->t - 1) { \ + if (i > 0 && (y = __KB_PTR(b, x)[i - 1])->n >= b->t) { \ + memmove(__KB_KEY(key_t, xp) + 1, __KB_KEY(key_t, xp), xp->n * sizeof(key_t)); \ + if (xp->is_internal) memmove(__KB_PTR(b, xp) + 1, __KB_PTR(b, xp), (xp->n + 1) * sizeof(void*)); \ + __KB_KEY(key_t, xp)[0] = __KB_KEY(key_t, x)[i - 1]; \ + __KB_KEY(key_t, x)[i - 1] = __KB_KEY(key_t, y)[y->n - 1]; \ + if (xp->is_internal) __KB_PTR(b, xp)[0] = __KB_PTR(b, y)[y->n]; \ + --y->n; ++xp->n; \ + } else if (i < x->n && (y = __KB_PTR(b, x)[i + 1])->n >= b->t) { \ + __KB_KEY(key_t, xp)[xp->n++] = __KB_KEY(key_t, x)[i]; \ + __KB_KEY(key_t, x)[i] = __KB_KEY(key_t, y)[0]; \ + if (xp->is_internal) __KB_PTR(b, xp)[xp->n] = __KB_PTR(b, y)[0]; \ + --y->n; \ + memmove(__KB_KEY(key_t, y), __KB_KEY(key_t, y) + 1, y->n * sizeof(key_t)); \ + if (y->is_internal) memmove(__KB_PTR(b, y), __KB_PTR(b, y) + 1, (y->n + 1) * sizeof(void*)); \ + } else if (i > 0 && (y = __KB_PTR(b, x)[i - 1])->n == b->t - 1) { \ + __KB_KEY(key_t, y)[y->n++] = __KB_KEY(key_t, x)[i - 1]; \ + memmove(__KB_KEY(key_t, y) + y->n, __KB_KEY(key_t, xp), xp->n * sizeof(key_t)); \ + if (y->is_internal) memmove(__KB_PTR(b, y) + y->n, __KB_PTR(b, xp), (xp->n + 1) * sizeof(void*)); \ + y->n += xp->n; \ + memmove(__KB_KEY(key_t, x) + i - 1, __KB_KEY(key_t, x) + i, (x->n - i) * sizeof(key_t)); \ + memmove(__KB_PTR(b, x) + i, __KB_PTR(b, x) + i + 1, (x->n - i) * sizeof(void*)); \ + --x->n; \ + free(xp); \ + xp = y; \ + } else if (i < x->n && (y = __KB_PTR(b, x)[i + 1])->n == b->t - 1) { \ + __KB_KEY(key_t, xp)[xp->n++] = __KB_KEY(key_t, x)[i]; \ + memmove(__KB_KEY(key_t, xp) + xp->n, __KB_KEY(key_t, y), y->n * sizeof(key_t)); \ + if (xp->is_internal) memmove(__KB_PTR(b, xp) + xp->n, __KB_PTR(b, y), (y->n + 1) * sizeof(void*)); \ + xp->n += y->n; \ + memmove(__KB_KEY(key_t, x) + i, __KB_KEY(key_t, x) + i + 1, (x->n - i - 1) * sizeof(key_t)); \ + memmove(__KB_PTR(b, x) + i + 1, __KB_PTR(b, x) + i + 2, (x->n - i - 1) * sizeof(void*)); \ + --x->n; \ + free(y); \ + } \ + } \ + return __kb_delp_aux_##name(b, xp, k, s); \ + } \ + static key_t kb_delp_##name(kbtree_##name##_t *b, const key_t * __restrict k) \ + { \ + kbnode_t *x; \ + key_t ret; \ + ret = __kb_delp_aux_##name(b, b->root, k, 0); \ + --b->n_keys; \ + if (b->root->n == 0 && b->root->is_internal) { \ + --b->n_nodes; \ + x = b->root; \ + b->root = __KB_PTR(b, x)[0]; \ + free(x); \ + } \ + return ret; \ + } \ + static inline key_t kb_del_##name(kbtree_##name##_t *b, const key_t k) \ + { \ + return kb_delp_##name(b, &k); \ + } + +typedef struct { + kbnode_t *x; + int i; +} __kbstack_t; + +#define __kb_traverse(key_t, b, __func) do { \ + int __kmax = 8; \ + __kbstack_t *__kstack, *__kp; \ + __kp = __kstack = (__kbstack_t*)calloc(__kmax, sizeof(__kbstack_t)); \ + __kp->x = (b)->root; __kp->i = 0; \ + for (;;) { \ + while (__kp->x && __kp->i <= __kp->x->n) { \ + if (__kp - __kstack == __kmax - 1) { \ + __kmax <<= 1; \ + __kstack = (__kbstack_t*)realloc(__kstack, __kmax * sizeof(__kbstack_t)); \ + __kp = __kstack + (__kmax>>1) - 1; \ + } \ + (__kp+1)->i = 0; (__kp+1)->x = __kp->x->is_internal? __KB_PTR(b, __kp->x)[__kp->i] : 0; \ + ++__kp; \ + } \ + --__kp; \ + if (__kp >= __kstack) { \ + if (__kp->x && __kp->i < __kp->x->n) __func(&__KB_KEY(key_t, __kp->x)[__kp->i]); \ + ++__kp->i; \ + } else break; \ + } \ + free(__kstack); \ + } while (0) + +#define KBTREE_INIT(name, key_t, __cmp) \ + __KB_TREE_T(name) \ + __KB_INIT(name, key_t) \ + __KB_GET_AUX1(name, key_t, __cmp) \ + __KB_GET(name, key_t) \ + __KB_INTERVAL(name, key_t) \ + __KB_PUT(name, key_t, __cmp) \ + __KB_DEL(name, key_t) + +#define KB_DEFAULT_SIZE 512 + +#define kbtree_t(name) kbtree_##name##_t +#define kb_init(name, s) kb_init_##name(s) +#define kb_destroy(name, b) __kb_destroy(b) +#define kb_get(name, b, k) kb_get_##name(b, k) +#define kb_put(name, b, k) kb_put_##name(b, k) +#define kb_del(name, b, k) kb_del_##name(b, k) +#define kb_interval(name, b, k, l, u) kb_interval_##name(b, k, l, u) +#define kb_getp(name, b, k) kb_getp_##name(b, k) +#define kb_putp(name, b, k) kb_putp_##name(b, k) +#define kb_delp(name, b, k) kb_delp_##name(b, k) +#define kb_intervalp(name, b, k, l, u) kb_intervalp_##name(b, k, l, u) + +#define kb_size(b) ((b)->n_keys) + +#define kb_generic_cmp(a, b) (((b) < (a)) - ((a) < (b))) +#define kb_str_cmp(a, b) strcmp(a, b) + +#endif diff --git a/khash.h b/khash.h new file mode 100644 index 0000000..12e5542 --- /dev/null +++ b/khash.h @@ -0,0 +1,614 @@ +/* The MIT License + + Copyright (c) 2008, 2009, 2011 by Attractive Chaos + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* + An example: + +#include "khash.h" +KHASH_MAP_INIT_INT(32, char) +int main() { + int ret, is_missing; + khiter_t k; + khash_t(32) *h = kh_init(32); + k = kh_put(32, h, 5, &ret); + kh_value(h, k) = 10; + k = kh_get(32, h, 10); + is_missing = (k == kh_end(h)); + k = kh_get(32, h, 5); + kh_del(32, h, k); + for (k = kh_begin(h); k != kh_end(h); ++k) + if (kh_exist(h, k)) kh_value(h, k) = 1; + kh_destroy(32, h); + return 0; +} +*/ + +/* + 2011-12-29 (0.2.7): + + * Minor code clean up; no actual effect. + + 2011-09-16 (0.2.6): + + * The capacity is a power of 2. This seems to dramatically improve the + speed for simple keys. Thank Zilong Tan for the suggestion. Reference: + + - http://code.google.com/p/ulib/ + - http://nothings.org/computer/judy/ + + * Allow to optionally use linear probing which usually has better + performance for random input. Double hashing is still the default as it + is more robust to certain non-random input. + + * Added Wang's integer hash function (not used by default). This hash + function is more robust to certain non-random input. + + 2011-02-14 (0.2.5): + + * Allow to declare global functions. + + 2009-09-26 (0.2.4): + + * Improve portability + + 2008-09-19 (0.2.3): + + * Corrected the example + * Improved interfaces + + 2008-09-11 (0.2.2): + + * Improved speed a little in kh_put() + + 2008-09-10 (0.2.1): + + * Added kh_clear() + * Fixed a compiling error + + 2008-09-02 (0.2.0): + + * Changed to token concatenation which increases flexibility. + + 2008-08-31 (0.1.2): + + * Fixed a bug in kh_get(), which has not been tested previously. + + 2008-08-31 (0.1.1): + + * Added destructor +*/ + + +#ifndef __AC_KHASH_H +#define __AC_KHASH_H + +/*! + @header + + Generic hash table library. + */ + +#define AC_VERSION_KHASH_H "0.2.6" + +#include +#include +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +/* compipler specific configuration */ + +#if UINT_MAX == 0xffffffffu +typedef unsigned int khint32_t; +#elif ULONG_MAX == 0xffffffffu +typedef unsigned long khint32_t; +#endif + +#if ULONG_MAX == ULLONG_MAX +typedef unsigned long khint64_t; +#else +typedef unsigned long long khint64_t; +#endif + +#ifdef _MSC_VER +#define kh_inline __inline +#else +#define kh_inline inline +#endif + +typedef khint32_t khint_t; +typedef khint_t khiter_t; + +#define __ac_isempty(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&2) +#define __ac_isdel(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&1) +#define __ac_iseither(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&3) +#define __ac_set_isdel_false(flag, i) (flag[i>>4]&=~(1ul<<((i&0xfU)<<1))) +#define __ac_set_isempty_false(flag, i) (flag[i>>4]&=~(2ul<<((i&0xfU)<<1))) +#define __ac_set_isboth_false(flag, i) (flag[i>>4]&=~(3ul<<((i&0xfU)<<1))) +#define __ac_set_isdel_true(flag, i) (flag[i>>4]|=1ul<<((i&0xfU)<<1)) + +#ifdef KHASH_LINEAR +#define __ac_inc(k, m) 1 +#else +#define __ac_inc(k, m) (((k)>>3 ^ (k)<<3) | 1) & (m) +#endif + +#define __ac_fsize(m) ((m) < 16? 1 : (m)>>4) + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +#ifndef kcalloc +#define kcalloc(N,Z) calloc(N,Z) +#endif +#ifndef kmalloc +#define kmalloc(Z) malloc(Z) +#endif +#ifndef krealloc +#define krealloc(P,Z) realloc(P,Z) +#endif +#ifndef kfree +#define kfree(P) free(P) +#endif + +static const double __ac_HASH_UPPER = 0.77; + +#define __KHASH_TYPE(name, khkey_t, khval_t) \ + typedef struct { \ + khint_t n_buckets, size, n_occupied, upper_bound; \ + khint32_t *flags; \ + khkey_t *keys; \ + khval_t *vals; \ + } kh_##name##_t; + +#define __KHASH_PROTOTYPES(name, khkey_t, khval_t) \ + extern kh_##name##_t *kh_init_##name(void); \ + extern void kh_destroy_##name(kh_##name##_t *h); \ + extern void kh_clear_##name(kh_##name##_t *h); \ + extern khint_t kh_get_##name(const kh_##name##_t *h, khkey_t key); \ + extern int kh_resize_##name(kh_##name##_t *h, khint_t new_n_buckets); \ + extern khint_t kh_put_##name(kh_##name##_t *h, khkey_t key, int *ret); \ + extern void kh_del_##name(kh_##name##_t *h, khint_t x); + +#define __KHASH_IMPL(name, SCOPE, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \ + SCOPE kh_##name##_t *kh_init_##name(void) { \ + return (kh_##name##_t*)kcalloc(1, sizeof(kh_##name##_t)); \ + } \ + SCOPE void kh_destroy_##name(kh_##name##_t *h) \ + { \ + if (h) { \ + kfree((void *)h->keys); kfree(h->flags); \ + kfree((void *)h->vals); \ + kfree(h); \ + } \ + } \ + SCOPE void kh_clear_##name(kh_##name##_t *h) \ + { \ + if (h && h->flags) { \ + memset(h->flags, 0xaa, __ac_fsize(h->n_buckets) * sizeof(khint32_t)); \ + h->size = h->n_occupied = 0; \ + } \ + } \ + SCOPE khint_t kh_get_##name(const kh_##name##_t *h, khkey_t key) \ + { \ + if (h->n_buckets) { \ + khint_t inc, k, i, last, mask; \ + mask = h->n_buckets - 1; \ + k = __hash_func(key); i = k & mask; \ + inc = __ac_inc(k, mask); last = i; /* inc==1 for linear probing */ \ + while (!__ac_isempty(h->flags, i) && (__ac_isdel(h->flags, i) || !__hash_equal(h->keys[i], key))) { \ + i = (i + inc) & mask; \ + if (i == last) return h->n_buckets; \ + } \ + return __ac_iseither(h->flags, i)? h->n_buckets : i; \ + } else return 0; \ + } \ + SCOPE int kh_resize_##name(kh_##name##_t *h, khint_t new_n_buckets) \ + { /* This function uses 0.25*n_bucktes bytes of working space instead of [sizeof(key_t+val_t)+.25]*n_buckets. */ \ + khint32_t *new_flags = 0; \ + khint_t j = 1; \ + { \ + kroundup32(new_n_buckets); \ + if (new_n_buckets < 4) new_n_buckets = 4; \ + if (h->size >= (khint_t)(new_n_buckets * __ac_HASH_UPPER + 0.5)) j = 0; /* requested size is too small */ \ + else { /* hash table size to be changed (shrink or expand); rehash */ \ + new_flags = (khint32_t*)kmalloc(__ac_fsize(new_n_buckets) * sizeof(khint32_t)); \ + if (!new_flags) return -1; \ + memset(new_flags, 0xaa, __ac_fsize(new_n_buckets) * sizeof(khint32_t)); \ + if (h->n_buckets < new_n_buckets) { /* expand */ \ + khkey_t *new_keys = (khkey_t*)krealloc((void *)h->keys, new_n_buckets * sizeof(khkey_t)); \ + if (!new_keys) return -1; \ + h->keys = new_keys; \ + if (kh_is_map) { \ + khval_t *new_vals = (khval_t*)krealloc((void *)h->vals, new_n_buckets * sizeof(khval_t)); \ + if (!new_vals) return -1; \ + h->vals = new_vals; \ + } \ + } /* otherwise shrink */ \ + } \ + } \ + if (j) { /* rehashing is needed */ \ + for (j = 0; j != h->n_buckets; ++j) { \ + if (__ac_iseither(h->flags, j) == 0) { \ + khkey_t key = h->keys[j]; \ + khval_t val; \ + khint_t new_mask; \ + new_mask = new_n_buckets - 1; \ + if (kh_is_map) val = h->vals[j]; \ + __ac_set_isdel_true(h->flags, j); \ + while (1) { /* kick-out process; sort of like in Cuckoo hashing */ \ + khint_t inc, k, i; \ + k = __hash_func(key); \ + i = k & new_mask; \ + inc = __ac_inc(k, new_mask); \ + while (!__ac_isempty(new_flags, i)) i = (i + inc) & new_mask; \ + __ac_set_isempty_false(new_flags, i); \ + if (i < h->n_buckets && __ac_iseither(h->flags, i) == 0) { /* kick out the existing element */ \ + { khkey_t tmp = h->keys[i]; h->keys[i] = key; key = tmp; } \ + if (kh_is_map) { khval_t tmp = h->vals[i]; h->vals[i] = val; val = tmp; } \ + __ac_set_isdel_true(h->flags, i); /* mark it as deleted in the old hash table */ \ + } else { /* write the element and jump out of the loop */ \ + h->keys[i] = key; \ + if (kh_is_map) h->vals[i] = val; \ + break; \ + } \ + } \ + } \ + } \ + if (h->n_buckets > new_n_buckets) { /* shrink the hash table */ \ + h->keys = (khkey_t*)krealloc((void *)h->keys, new_n_buckets * sizeof(khkey_t)); \ + if (kh_is_map) h->vals = (khval_t*)krealloc((void *)h->vals, new_n_buckets * sizeof(khval_t)); \ + } \ + kfree(h->flags); /* free the working space */ \ + h->flags = new_flags; \ + h->n_buckets = new_n_buckets; \ + h->n_occupied = h->size; \ + h->upper_bound = (khint_t)(h->n_buckets * __ac_HASH_UPPER + 0.5); \ + } \ + return 0; \ + } \ + SCOPE khint_t kh_put_##name(kh_##name##_t *h, khkey_t key, int *ret) \ + { \ + khint_t x; \ + if (h->n_occupied >= h->upper_bound) { /* update the hash table */ \ + if (h->n_buckets > (h->size<<1)) { \ + if (kh_resize_##name(h, h->n_buckets - 1) < 0) { /* clear "deleted" elements */ \ + *ret = -1; return h->n_buckets; \ + } \ + } else if (kh_resize_##name(h, h->n_buckets + 1) < 0) { /* expand the hash table */ \ + *ret = -1; return h->n_buckets; \ + } \ + } /* TODO: to implement automatically shrinking; resize() already support shrinking */ \ + { \ + khint_t inc, k, i, site, last, mask = h->n_buckets - 1; \ + x = site = h->n_buckets; k = __hash_func(key); i = k & mask; \ + if (__ac_isempty(h->flags, i)) x = i; /* for speed up */ \ + else { \ + inc = __ac_inc(k, mask); last = i; \ + while (!__ac_isempty(h->flags, i) && (__ac_isdel(h->flags, i) || !__hash_equal(h->keys[i], key))) { \ + if (__ac_isdel(h->flags, i)) site = i; \ + i = (i + inc) & mask; \ + if (i == last) { x = site; break; } \ + } \ + if (x == h->n_buckets) { \ + if (__ac_isempty(h->flags, i) && site != h->n_buckets) x = site; \ + else x = i; \ + } \ + } \ + } \ + if (__ac_isempty(h->flags, x)) { /* not present at all */ \ + h->keys[x] = key; \ + __ac_set_isboth_false(h->flags, x); \ + ++h->size; ++h->n_occupied; \ + *ret = 1; \ + } else if (__ac_isdel(h->flags, x)) { /* deleted */ \ + h->keys[x] = key; \ + __ac_set_isboth_false(h->flags, x); \ + ++h->size; \ + *ret = 2; \ + } else *ret = 0; /* Don't touch h->keys[x] if present and not deleted */ \ + return x; \ + } \ + SCOPE void kh_del_##name(kh_##name##_t *h, khint_t x) \ + { \ + if (x != h->n_buckets && !__ac_iseither(h->flags, x)) { \ + __ac_set_isdel_true(h->flags, x); \ + --h->size; \ + } \ + } + +#define KHASH_DECLARE(name, khkey_t, khval_t) \ + __KHASH_TYPE(name, khkey_t, khval_t) \ + __KHASH_PROTOTYPES(name, khkey_t, khval_t) + +#define KHASH_INIT2(name, SCOPE, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \ + __KHASH_TYPE(name, khkey_t, khval_t) \ + __KHASH_IMPL(name, SCOPE, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) + +#define KHASH_INIT(name, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \ + KHASH_INIT2(name, static kh_inline, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) + +/* --- BEGIN OF HASH FUNCTIONS --- */ + +/*! @function + @abstract Integer hash function + @param key The integer [khint32_t] + @return The hash value [khint_t] + */ +#define kh_int_hash_func(key) (khint32_t)(key) +/*! @function + @abstract Integer comparison function + */ +#define kh_int_hash_equal(a, b) ((a) == (b)) +/*! @function + @abstract 64-bit integer hash function + @param key The integer [khint64_t] + @return The hash value [khint_t] + */ +#define kh_int64_hash_func(key) (khint32_t)((key)>>33^(key)^(key)<<11) +/*! @function + @abstract 64-bit integer comparison function + */ +#define kh_int64_hash_equal(a, b) ((a) == (b)) +/*! @function + @abstract const char* hash function + @param s Pointer to a null terminated string + @return The hash value + */ +static kh_inline khint_t __ac_X31_hash_string(const char *s) +{ + khint_t h = (khint_t)*s; + if (h) for (++s ; *s; ++s) h = (h << 5) - h + (khint_t)*s; + return h; +} +/*! @function + @abstract Another interface to const char* hash function + @param key Pointer to a null terminated string [const char*] + @return The hash value [khint_t] + */ +#define kh_str_hash_func(key) __ac_X31_hash_string(key) +/*! @function + @abstract Const char* comparison function + */ +#define kh_str_hash_equal(a, b) (strcmp(a, b) == 0) + +static kh_inline khint_t __ac_Wang_hash(khint_t key) +{ + key += ~(key << 15); + key ^= (key >> 10); + key += (key << 3); + key ^= (key >> 6); + key += ~(key << 11); + key ^= (key >> 16); + return key; +} +#define kh_int_hash_func2(k) __ac_Wang_hash((khint_t)key) + +/* --- END OF HASH FUNCTIONS --- */ + +/* Other convenient macros... */ + +/*! + @abstract Type of the hash table. + @param name Name of the hash table [symbol] + */ +#define khash_t(name) kh_##name##_t + +/*! @function + @abstract Initiate a hash table. + @param name Name of the hash table [symbol] + @return Pointer to the hash table [khash_t(name)*] + */ +#define kh_init(name) kh_init_##name() + +/*! @function + @abstract Destroy a hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + */ +#define kh_destroy(name, h) kh_destroy_##name(h) + +/*! @function + @abstract Reset a hash table without deallocating memory. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + */ +#define kh_clear(name, h) kh_clear_##name(h) + +/*! @function + @abstract Resize a hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param s New size [khint_t] + */ +#define kh_resize(name, h, s) kh_resize_##name(h, s) + +/*! @function + @abstract Insert a key to the hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param k Key [type of keys] + @param r Extra return code: 0 if the key is present in the hash table; + 1 if the bucket is empty (never used); 2 if the element in + the bucket has been deleted [int*] + @return Iterator to the inserted element [khint_t] + */ +#define kh_put(name, h, k, r) kh_put_##name(h, k, r) + +/*! @function + @abstract Retrieve a key from the hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param k Key [type of keys] + @return Iterator to the found element, or kh_end(h) is the element is absent [khint_t] + */ +#define kh_get(name, h, k) kh_get_##name(h, k) + +/*! @function + @abstract Remove a key from the hash table. + @param name Name of the hash table [symbol] + @param h Pointer to the hash table [khash_t(name)*] + @param k Iterator to the element to be deleted [khint_t] + */ +#define kh_del(name, h, k) kh_del_##name(h, k) + +/*! @function + @abstract Test whether a bucket contains data. + @param h Pointer to the hash table [khash_t(name)*] + @param x Iterator to the bucket [khint_t] + @return 1 if containing data; 0 otherwise [int] + */ +#define kh_exist(h, x) (!__ac_iseither((h)->flags, (x))) + +/*! @function + @abstract Get key given an iterator + @param h Pointer to the hash table [khash_t(name)*] + @param x Iterator to the bucket [khint_t] + @return Key [type of keys] + */ +#define kh_key(h, x) ((h)->keys[x]) + +/*! @function + @abstract Get value given an iterator + @param h Pointer to the hash table [khash_t(name)*] + @param x Iterator to the bucket [khint_t] + @return Value [type of values] + @discussion For hash sets, calling this results in segfault. + */ +#define kh_val(h, x) ((h)->vals[x]) + +/*! @function + @abstract Alias of kh_val() + */ +#define kh_value(h, x) ((h)->vals[x]) + +/*! @function + @abstract Get the start iterator + @param h Pointer to the hash table [khash_t(name)*] + @return The start iterator [khint_t] + */ +#define kh_begin(h) (khint_t)(0) + +/*! @function + @abstract Get the end iterator + @param h Pointer to the hash table [khash_t(name)*] + @return The end iterator [khint_t] + */ +#define kh_end(h) ((h)->n_buckets) + +/*! @function + @abstract Get the number of elements in the hash table + @param h Pointer to the hash table [khash_t(name)*] + @return Number of elements in the hash table [khint_t] + */ +#define kh_size(h) ((h)->size) + +/*! @function + @abstract Get the number of buckets in the hash table + @param h Pointer to the hash table [khash_t(name)*] + @return Number of buckets in the hash table [khint_t] + */ +#define kh_n_buckets(h) ((h)->n_buckets) + +/*! @function + @abstract Iterate over the entries in the hash table + @param h Pointer to the hash table [khash_t(name)*] + @param kvar Variable to which key will be assigned + @param vvar Variable to which value will be assigned + @param code Block of code to execute + */ +#define kh_foreach(h, kvar, vvar, code) { khint_t __i; \ + for (__i = kh_begin(h); __i != kh_end(h); ++__i) { \ + if (!kh_exist(h,__i)) continue; \ + (kvar) = kh_key(h,__i); \ + (vvar) = kh_val(h,__i); \ + code; \ + } } + +/*! @function + @abstract Iterate over the values in the hash table + @param h Pointer to the hash table [khash_t(name)*] + @param vvar Variable to which value will be assigned + @param code Block of code to execute + */ +#define kh_foreach_value(h, vvar, code) { khint_t __i; \ + for (__i = kh_begin(h); __i != kh_end(h); ++__i) { \ + if (!kh_exist(h,__i)) continue; \ + (vvar) = kh_val(h,__i); \ + code; \ + } } + +/* More conenient interfaces */ + +/*! @function + @abstract Instantiate a hash set containing integer keys + @param name Name of the hash table [symbol] + */ +#define KHASH_SET_INIT_INT(name) \ + KHASH_INIT(name, khint32_t, char, 0, kh_int_hash_func, kh_int_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing integer keys + @param name Name of the hash table [symbol] + @param khval_t Type of values [type] + */ +#define KHASH_MAP_INIT_INT(name, khval_t) \ + KHASH_INIT(name, khint32_t, khval_t, 1, kh_int_hash_func, kh_int_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing 64-bit integer keys + @param name Name of the hash table [symbol] + */ +#define KHASH_SET_INIT_INT64(name) \ + KHASH_INIT(name, khint64_t, char, 0, kh_int64_hash_func, kh_int64_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing 64-bit integer keys + @param name Name of the hash table [symbol] + @param khval_t Type of values [type] + */ +#define KHASH_MAP_INIT_INT64(name, khval_t) \ + KHASH_INIT(name, khint64_t, khval_t, 1, kh_int64_hash_func, kh_int64_hash_equal) + +typedef const char *kh_cstr_t; +/*! @function + @abstract Instantiate a hash map containing const char* keys + @param name Name of the hash table [symbol] + */ +#define KHASH_SET_INIT_STR(name) \ + KHASH_INIT(name, kh_cstr_t, char, 0, kh_str_hash_func, kh_str_hash_equal) + +/*! @function + @abstract Instantiate a hash map containing const char* keys + @param name Name of the hash table [symbol] + @param khval_t Type of values [type] + */ +#define KHASH_MAP_INIT_STR(name, khval_t) \ + KHASH_INIT(name, kh_cstr_t, khval_t, 1, kh_str_hash_func, kh_str_hash_equal) + +#endif /* __AC_KHASH_H */ diff --git a/kopen.c b/kopen.c new file mode 100644 index 0000000..d238226 --- /dev/null +++ b/kopen.c @@ -0,0 +1,374 @@ +#include +#include +#include +#include +#include +#include +#include +#include +#include +#include +#ifndef _WIN32 +#include +#include +#include +#endif + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#ifdef _WIN32 +#define _KO_NO_NET +#endif + +#ifndef _KO_NO_NET +static int socket_wait(int fd, int is_read) +{ + fd_set fds, *fdr = 0, *fdw = 0; + struct timeval tv; + int ret; + tv.tv_sec = 5; tv.tv_usec = 0; // 5 seconds time out + FD_ZERO(&fds); + FD_SET(fd, &fds); + if (is_read) fdr = &fds; + else fdw = &fds; + ret = select(fd+1, fdr, fdw, 0, &tv); + if (ret == -1) perror("select"); + return ret; +} + +static int socket_connect(const char *host, const char *port) +{ +#define __err_connect(func) do { perror(func); freeaddrinfo(res); return -1; } while (0) + + int on = 1, fd; + struct linger lng = { 0, 0 }; + struct addrinfo hints, *res = 0; + memset(&hints, 0, sizeof(struct addrinfo)); + hints.ai_family = AF_UNSPEC; + hints.ai_socktype = SOCK_STREAM; + if (getaddrinfo(host, port, &hints, &res) != 0) __err_connect("getaddrinfo"); + if ((fd = socket(res->ai_family, res->ai_socktype, res->ai_protocol)) == -1) __err_connect("socket"); + if (setsockopt(fd, SOL_SOCKET, SO_REUSEADDR, &on, sizeof(on)) == -1) __err_connect("setsockopt"); + if (setsockopt(fd, SOL_SOCKET, SO_LINGER, &lng, sizeof(lng)) == -1) __err_connect("setsockopt"); + if (connect(fd, res->ai_addr, res->ai_addrlen) != 0) __err_connect("connect"); + freeaddrinfo(res); + return fd; +#undef __err_connect +} + +static int write_bytes(int fd, const char *buf, size_t len) +{ + ssize_t bytes; + do { + bytes = write(fd, buf, len); + if (bytes >= 0) { + len -= bytes; + } else if (errno != EAGAIN && errno != EWOULDBLOCK && errno != EINTR) { + return -1; + } + } while (len > 0); + + return 0; +} + +static int http_open(const char *fn) +{ + char *p, *proxy, *q, *http_host, *host, *port, *path, *buf; + int fd, ret, l; + ssize_t bytes = 0, bufsz = 0x10000; + + /* parse URL; adapted from khttp_parse_url() in knetfile.c */ + if (strstr(fn, "http://") != fn) return 0; + // set ->http_host + for (p = (char*)fn + 7; *p && *p != '/'; ++p); + l = p - fn - 7; + http_host = calloc(l + 1, 1); + strncpy(http_host, fn + 7, l); + http_host[l] = 0; + for (q = http_host; *q && *q != ':'; ++q); + if (*q == ':') *q++ = 0; + // get http_proxy + proxy = getenv("http_proxy"); + // set host, port and path + if (proxy == 0) { + host = strdup(http_host); // when there is no proxy, server name is identical to http_host name. + port = strdup(*q? q : "80"); + path = strdup(*p? p : "/"); + } else { + host = (strstr(proxy, "http://") == proxy)? strdup(proxy + 7) : strdup(proxy); + for (q = host; *q && *q != ':'; ++q); + if (*q == ':') *q++ = 0; + port = strdup(*q? q : "80"); + path = strdup(fn); + } + + /* connect; adapted from khttp_connect() in knetfile.c */ + l = 0; + fd = socket_connect(host, port); + buf = calloc(bufsz, 1); // FIXME: I am lazy... But in principle, 64KB should be large enough. + l += snprintf(buf + l, bufsz, "GET %s HTTP/1.0\r\nHost: %s\r\n\r\n", + path, http_host); + if (write_bytes(fd, buf, l) != 0) { + close(fd); + fd = -1; + goto out; + } + l = 0; + retry: + while (l < bufsz && (bytes = read(fd, buf + l, 1)) > 0) { // read HTTP header; FIXME: bad efficiency + if (buf[l] == '\n' && l >= 3) + if (strncmp(buf + l - 3, "\r\n\r\n", 4) == 0) break; + ++l; + } + if (bytes < 0 && (errno == EAGAIN || errno == EWOULDBLOCK || errno == EINTR)) goto retry; + + buf[l] = 0; + if (bytes < 0 || l < 14) { // prematured header + close(fd); + fd = -1; + goto out; + } + ret = strtol(buf + 8, &p, 0); // HTTP return code + if (ret != 200) { + close(fd); + fd = -1; + } + out: + free(buf); free(http_host); free(host); free(port); free(path); + return fd; +} + +typedef struct { + int max_response, ctrl_fd; + char *response; +} ftpaux_t; + +static int kftp_get_response(ftpaux_t *aux) +{ + unsigned char c; + int n = 0; + char *p; + if (socket_wait(aux->ctrl_fd, 1) <= 0) return 0; + while (read(aux->ctrl_fd, &c, 1)) { // FIXME: this is *VERY BAD* for unbuffered I/O + if (n >= aux->max_response) { + aux->max_response = aux->max_response? aux->max_response<<1 : 256; + aux->response = realloc(aux->response, aux->max_response); + } + aux->response[n++] = c; + if (c == '\n') { + if (n >= 4 && isdigit(aux->response[0]) && isdigit(aux->response[1]) && isdigit(aux->response[2]) + && aux->response[3] != '-') break; + n = 0; + continue; + } + } + if (n < 2) return -1; + aux->response[n-2] = 0; + return strtol(aux->response, &p, 0); +} + +static int kftp_send_cmd(ftpaux_t *aux, const char *cmd, int is_get) +{ + if (socket_wait(aux->ctrl_fd, 0) <= 0) return -1; // socket is not ready for writing + if (write_bytes(aux->ctrl_fd, cmd, strlen(cmd)) != 0) return -1; + return is_get? kftp_get_response(aux) : 0; +} + +static int ftp_open(const char *fn) +{ + char *p, *host = 0, *port = 0, *retr = 0; + char host2[80], port2[10]; + int v[6], l, fd = -1, ret, pasv_port, pasv_ip[4]; + ftpaux_t aux; + + /* parse URL */ + if (strstr(fn, "ftp://") != fn) return 0; + for (p = (char*)fn + 6; *p && *p != '/'; ++p); + if (*p != '/') return 0; + l = p - fn - 6; + port = strdup("21"); + host = calloc(l + 1, 1); + strncpy(host, fn + 6, l); + retr = calloc(strlen(p) + 8, 1); + sprintf(retr, "RETR %s\r\n", p); + + /* connect to ctrl */ + memset(&aux, 0, sizeof(ftpaux_t)); + aux.ctrl_fd = socket_connect(host, port); + if (aux.ctrl_fd == -1) goto ftp_open_end; /* fail to connect ctrl */ + + /* connect to the data stream */ + kftp_get_response(&aux); + kftp_send_cmd(&aux, "USER anonymous\r\n", 1); + kftp_send_cmd(&aux, "PASS kopen@\r\n", 1); + kftp_send_cmd(&aux, "TYPE I\r\n", 1); + kftp_send_cmd(&aux, "PASV\r\n", 1); + for (p = aux.response; *p && *p != '('; ++p); + if (*p != '(') goto ftp_open_end; + ++p; + sscanf(p, "%d,%d,%d,%d,%d,%d", &v[0], &v[1], &v[2], &v[3], &v[4], &v[5]); + memcpy(pasv_ip, v, 4 * sizeof(int)); + pasv_port = (v[4]<<8&0xff00) + v[5]; + kftp_send_cmd(&aux, retr, 0); + sprintf(host2, "%d.%d.%d.%d", pasv_ip[0], pasv_ip[1], pasv_ip[2], pasv_ip[3]); + sprintf(port2, "%d", pasv_port); + fd = socket_connect(host2, port2); + if (fd == -1) goto ftp_open_end; + ret = kftp_get_response(&aux); + if (ret != 150) { + close(fd); + fd = -1; + } + close(aux.ctrl_fd); + +ftp_open_end: + free(host); free(port); free(retr); free(aux.response); + return fd; +} +#endif /* !defined(_KO_NO_NET) */ + +static char **cmd2argv(const char *cmd) +{ + int i, beg, end, argc; + char **argv, *str; + end = strlen(cmd); + for (i = end - 1; i >= 0; --i) + if (!isspace(cmd[i])) break; + end = i + 1; + for (beg = 0; beg < end; ++beg) + if (!isspace(cmd[beg])) break; + if (beg == end) return 0; + for (i = beg + 1, argc = 0; i < end; ++i) + if (isspace(cmd[i]) && !isspace(cmd[i-1])) + ++argc; + argv = (char**)calloc(argc + 2, sizeof(void*)); + argv[0] = str = (char*)calloc(end - beg + 1, 1); + strncpy(argv[0], cmd + beg, end - beg); + for (i = argc = 1; i < end - beg; ++i) + if (isspace(str[i])) str[i] = 0; + else if (str[i] && str[i-1] == 0) argv[argc++] = &str[i]; + return argv; +} + +#define KO_STDIN 1 +#define KO_FILE 2 +#define KO_PIPE 3 +#define KO_HTTP 4 +#define KO_FTP 5 + +typedef struct { + int type, fd; + pid_t pid; +} koaux_t; + +void *kopen(const char *fn, int *_fd) +{ + koaux_t *aux = 0; + *_fd = -1; + if (strstr(fn, "http://") == fn) { + aux = calloc(1, sizeof(koaux_t)); + aux->type = KO_HTTP; + aux->fd = http_open(fn); + } else if (strstr(fn, "ftp://") == fn) { + aux = calloc(1, sizeof(koaux_t)); + aux->type = KO_FTP; + aux->fd = ftp_open(fn); + } else if (strcmp(fn, "-") == 0) { + aux = calloc(1, sizeof(koaux_t)); + aux->type = KO_STDIN; + aux->fd = STDIN_FILENO; + } else { + const char *p, *q; + for (p = fn; *p; ++p) + if (!isspace(*p)) break; + if (*p == '<') { // pipe open + int need_shell, pfd[2]; + pid_t pid; + // a simple check to see if we need to invoke a shell; not always working + for (q = p + 1; *q; ++q) + if (ispunct(*q) && *q != '.' && *q != '_' && *q != '-' && *q != ':') + break; + need_shell = (*q != 0); + if (pipe(pfd) != 0) return 0; + pid = vfork(); + if (pid == -1) { /* vfork() error */ + close(pfd[0]); close(pfd[1]); + return 0; + } + if (pid == 0) { /* the child process */ + char **argv; /* FIXME: I do not know if this will lead to a memory leak */ + close(pfd[0]); + dup2(pfd[1], STDOUT_FILENO); + close(pfd[1]); + if (!need_shell) { + argv = cmd2argv(p + 1); + execvp(argv[0], argv); + free(argv[0]); free(argv); + } else execl("/bin/sh", "sh", "-c", p + 1, NULL); + exit(1); + } else { /* parent process */ + close(pfd[1]); + aux = calloc(1, sizeof(koaux_t)); + aux->type = KO_PIPE; + aux->fd = pfd[0]; + aux->pid = pid; + } + } else { +#ifdef _WIN32 + *_fd = open(fn, O_RDONLY | O_BINARY); +#else + *_fd = open(fn, O_RDONLY); +#endif + if (*_fd >= 0) { + aux = calloc(1, sizeof(koaux_t)); + aux->type = KO_FILE; + aux->fd = *_fd; + } + } + } + if (aux) *_fd = aux->fd; + return aux; +} + +int kclose(void *a) +{ + koaux_t *aux = (koaux_t*)a; + if (aux->type == KO_PIPE) { + int status; + pid_t pid; + pid = waitpid(aux->pid, &status, WNOHANG); + if (pid != aux->pid) kill(aux->pid, 15); + } + free(aux); + return 0; +} + +#ifdef _KO_MAIN +#define BUF_SIZE 0x10000 +int main(int argc, char *argv[]) +{ + void *x; + int l, fd; + unsigned char buf[BUF_SIZE]; + FILE *fp; + if (argc == 1) { + fprintf(stderr, "Usage: kopen \n"); + return 1; + } + x = kopen(argv[1], &fd); + fp = fdopen(fd, "r"); + if (fp == 0) { + fprintf(stderr, "ERROR: fail to open the input\n"); + return 1; + } + do { + if ((l = fread(buf, 1, BUF_SIZE, fp)) != 0) + fwrite(buf, 1, l, stdout); + } while (l == BUF_SIZE); + fclose(fp); + kclose(x); + return 0; +} +#endif diff --git a/kseq.h b/kseq.h new file mode 100644 index 0000000..2107f80 --- /dev/null +++ b/kseq.h @@ -0,0 +1,239 @@ +/* The MIT License + + Copyright (c) 2008, 2009, 2011 Attractive Chaos + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* Last Modified: 05MAR2012 */ + +#ifndef AC_KSEQ_H +#define AC_KSEQ_H + +#include +#include +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#define KS_SEP_SPACE 0 // isspace(): \t, \n, \v, \f, \r +#define KS_SEP_TAB 1 // isspace() && !' ' +#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows) +#define KS_SEP_MAX 2 + +#define __KS_TYPE(type_t) \ + typedef struct __kstream_t { \ + unsigned char *buf; \ + int begin, end, is_eof; \ + type_t f; \ + } kstream_t; + +#define ks_eof(ks) ((ks)->is_eof && (ks)->begin >= (ks)->end) +#define ks_rewind(ks) ((ks)->is_eof = (ks)->begin = (ks)->end = 0) + +#define __KS_BASIC(type_t, __bufsize) \ + static inline kstream_t *ks_init(type_t f) \ + { \ + kstream_t *ks = (kstream_t*)calloc(1, sizeof(kstream_t)); \ + ks->f = f; \ + ks->buf = (unsigned char*)malloc(__bufsize); \ + return ks; \ + } \ + static inline void ks_destroy(kstream_t *ks) \ + { \ + if (ks) { \ + free(ks->buf); \ + free(ks); \ + } \ + } + +#define __KS_GETC(__read, __bufsize) \ + static inline int ks_getc(kstream_t *ks) \ + { \ + if (ks->is_eof && ks->begin >= ks->end) return -1; \ + if (ks->begin >= ks->end) { \ + ks->begin = 0; \ + ks->end = __read(ks->f, ks->buf, __bufsize); \ + if (ks->end == 0) { ks->is_eof = 1; return -1;} \ + } \ + return (int)ks->buf[ks->begin++]; \ + } + +#ifndef KSTRING_T +#define KSTRING_T kstring_t +typedef struct __kstring_t { + size_t l, m; + char *s; +} kstring_t; +#endif + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +#define __KS_GETUNTIL(__read, __bufsize) \ + static int ks_getuntil2(kstream_t *ks, int delimiter, kstring_t *str, int *dret, int append) \ + { \ + int gotany = 0; \ + if (dret) *dret = 0; \ + str->l = append? str->l : 0; \ + for (;;) { \ + int i; \ + if (ks->begin >= ks->end) { \ + if (!ks->is_eof) { \ + ks->begin = 0; \ + ks->end = __read(ks->f, ks->buf, __bufsize); \ + if (ks->end == 0) { ks->is_eof = 1; break; } \ + } else break; \ + } \ + if (delimiter == KS_SEP_LINE) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (ks->buf[i] == '\n') break; \ + } else if (delimiter > KS_SEP_MAX) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (ks->buf[i] == delimiter) break; \ + } else if (delimiter == KS_SEP_SPACE) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (isspace(ks->buf[i])) break; \ + } else if (delimiter == KS_SEP_TAB) { \ + for (i = ks->begin; i < ks->end; ++i) \ + if (isspace(ks->buf[i]) && ks->buf[i] != ' ') break; \ + } else i = 0; /* never come to here! */ \ + if (str->m - str->l < (size_t)(i - ks->begin + 1)) { \ + str->m = str->l + (i - ks->begin) + 1; \ + kroundup32(str->m); \ + str->s = (char*)realloc(str->s, str->m); \ + } \ + gotany = 1; \ + memcpy(str->s + str->l, ks->buf + ks->begin, i - ks->begin); \ + str->l = str->l + (i - ks->begin); \ + ks->begin = i + 1; \ + if (i < ks->end) { \ + if (dret) *dret = ks->buf[i]; \ + break; \ + } \ + } \ + if (!gotany && ks_eof(ks)) return -1; \ + if (str->s == 0) { \ + str->m = 1; \ + str->s = (char*)calloc(1, 1); \ + } else if (delimiter == KS_SEP_LINE && str->l > 1 && str->s[str->l-1] == '\r') --str->l; \ + str->s[str->l] = '\0'; \ + return str->l; \ + } \ + static inline int ks_getuntil(kstream_t *ks, int delimiter, kstring_t *str, int *dret) \ + { return ks_getuntil2(ks, delimiter, str, dret, 0); } + +#define KSTREAM_INIT(type_t, __read, __bufsize) \ + __KS_TYPE(type_t) \ + __KS_BASIC(type_t, __bufsize) \ + __KS_GETC(__read, __bufsize) \ + __KS_GETUNTIL(__read, __bufsize) + +#define kseq_rewind(ks) ((ks)->last_char = (ks)->f->is_eof = (ks)->f->begin = (ks)->f->end = 0) + +#define __KSEQ_BASIC(SCOPE, type_t) \ + SCOPE kseq_t *kseq_init(type_t fd) \ + { \ + kseq_t *s = (kseq_t*)calloc(1, sizeof(kseq_t)); \ + s->f = ks_init(fd); \ + return s; \ + } \ + SCOPE void kseq_destroy(kseq_t *ks) \ + { \ + if (!ks) return; \ + free(ks->name.s); free(ks->comment.s); free(ks->seq.s); free(ks->qual.s); \ + ks_destroy(ks->f); \ + free(ks); \ + } + +/* Return value: + >=0 length of the sequence (normal) + -1 end-of-file + -2 truncated quality string + */ +#define __KSEQ_READ(SCOPE) \ + SCOPE int kseq_read(kseq_t *seq) \ + { \ + int c; \ + kstream_t *ks = seq->f; \ + if (seq->last_char == 0) { /* then jump to the next header line */ \ + while ((c = ks_getc(ks)) != -1 && c != '>' && c != '@'); \ + if (c == -1) return -1; /* end of file */ \ + seq->last_char = c; \ + } /* else: the first header char has been read in the previous call */ \ + seq->comment.l = seq->seq.l = seq->qual.l = 0; /* reset all members */ \ + if (ks_getuntil(ks, 0, &seq->name, &c) < 0) return -1; /* normal exit: EOF */ \ + if (c != '\n') ks_getuntil(ks, KS_SEP_LINE, &seq->comment, 0); /* read FASTA/Q comment */ \ + if (seq->seq.s == 0) { /* we can do this in the loop below, but that is slower */ \ + seq->seq.m = 256; \ + seq->seq.s = (char*)malloc(seq->seq.m); \ + } \ + while ((c = ks_getc(ks)) != -1 && c != '>' && c != '+' && c != '@') { \ + if (c == '\n') continue; /* skip empty lines */ \ + seq->seq.s[seq->seq.l++] = c; /* this is safe: we always have enough space for 1 char */ \ + ks_getuntil2(ks, KS_SEP_LINE, &seq->seq, 0, 1); /* read the rest of the line */ \ + } \ + if (c == '>' || c == '@') seq->last_char = c; /* the first header char has been read */ \ + if (seq->seq.l + 1 >= seq->seq.m) { /* seq->seq.s[seq->seq.l] below may be out of boundary */ \ + seq->seq.m = seq->seq.l + 2; \ + kroundup32(seq->seq.m); /* rounded to the next closest 2^k */ \ + seq->seq.s = (char*)realloc(seq->seq.s, seq->seq.m); \ + } \ + seq->seq.s[seq->seq.l] = 0; /* null terminated string */ \ + if (c != '+') return seq->seq.l; /* FASTA */ \ + if (seq->qual.m < seq->seq.m) { /* allocate memory for qual in case insufficient */ \ + seq->qual.m = seq->seq.m; \ + seq->qual.s = (char*)realloc(seq->qual.s, seq->qual.m); \ + } \ + while ((c = ks_getc(ks)) != -1 && c != '\n'); /* skip the rest of '+' line */ \ + if (c == -1) return -2; /* error: no quality string */ \ + while (ks_getuntil2(ks, KS_SEP_LINE, &seq->qual, 0, 1) >= 0 && seq->qual.l < seq->seq.l); \ + seq->last_char = 0; /* we have not come to the next header line */ \ + if (seq->seq.l != seq->qual.l) return -2; /* error: qual string is of a different length */ \ + return seq->seq.l; \ + } + +#define __KSEQ_TYPE(type_t) \ + typedef struct { \ + kstring_t name, comment, seq, qual; \ + int last_char; \ + kstream_t *f; \ + } kseq_t; + +#define KSEQ_INIT2(SCOPE, type_t, __read) \ + KSTREAM_INIT(type_t, __read, 16777216) /* 16384 */ \ + __KSEQ_TYPE(type_t) \ + __KSEQ_BASIC(SCOPE, type_t) \ + __KSEQ_READ(SCOPE) + +#define KSEQ_INIT(type_t, __read) KSEQ_INIT2(static, type_t, __read) + +#define KSEQ_DECLARE(type_t) \ + __KS_TYPE(type_t) \ + __KSEQ_TYPE(type_t) \ + extern kseq_t *kseq_init(type_t fd); \ + void kseq_destroy(kseq_t *ks); \ + int kseq_read(kseq_t *seq); + +#endif diff --git a/ksort.h b/ksort.h new file mode 100644 index 0000000..5851b0d --- /dev/null +++ b/ksort.h @@ -0,0 +1,273 @@ +/* The MIT License + + Copyright (c) 2008, by Attractive Chaos + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* + 2008-11-16 (0.1.4): + + * Fixed a bug in introsort() that happens in rare cases. + + 2008-11-05 (0.1.3): + + * Fixed a bug in introsort() for complex comparisons. + + * Fixed a bug in mergesort(). The previous version is not stable. + + 2008-09-15 (0.1.2): + + * Accelerated introsort. On my Mac (not on another Linux machine), + my implementation is as fast as std::sort on random input. + + * Added combsort and in introsort, switch to combsort if the + recursion is too deep. + + 2008-09-13 (0.1.1): + + * Added k-small algorithm + + 2008-09-05 (0.1.0): + + * Initial version + +*/ + +#ifndef AC_KSORT_H +#define AC_KSORT_H + +#include +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +typedef struct { + void *left, *right; + int depth; +} ks_isort_stack_t; + +#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; } + +#define KSORT_INIT(name, type_t, __sort_lt) \ + void ks_mergesort_##name(size_t n, type_t array[], type_t temp[]) \ + { \ + type_t *a2[2], *a, *b; \ + int curr, shift; \ + \ + a2[0] = array; \ + a2[1] = temp? temp : (type_t*)malloc(sizeof(type_t) * n); \ + for (curr = 0, shift = 0; (1ul<> 1) - 1; i != (size_t)(-1); --i) \ + ks_heapadjust_##name(i, lsize, l); \ + } \ + void ks_heapsort_##name(size_t lsize, type_t l[]) \ + { \ + size_t i; \ + for (i = lsize - 1; i > 0; --i) { \ + type_t tmp; \ + tmp = *l; *l = l[i]; l[i] = tmp; ks_heapadjust_##name(0, i, l); \ + } \ + } \ + static inline void __ks_insertsort_##name(type_t *s, type_t *t) \ + { \ + type_t *i, *j, swap_tmp; \ + for (i = s + 1; i < t; ++i) \ + for (j = i; j > s && __sort_lt(*j, *(j-1)); --j) { \ + swap_tmp = *j; *j = *(j-1); *(j-1) = swap_tmp; \ + } \ + } \ + void ks_combsort_##name(size_t n, type_t a[]) \ + { \ + const double shrink_factor = 1.2473309501039786540366528676643; \ + int do_swap; \ + size_t gap = n; \ + type_t tmp, *i, *j; \ + do { \ + if (gap > 2) { \ + gap = (size_t)(gap / shrink_factor); \ + if (gap == 9 || gap == 10) gap = 11; \ + } \ + do_swap = 0; \ + for (i = a; i < a + n - gap; ++i) { \ + j = i + gap; \ + if (__sort_lt(*j, *i)) { \ + tmp = *i; *i = *j; *j = tmp; \ + do_swap = 1; \ + } \ + } \ + } while (do_swap || gap > 2); \ + if (gap != 1) __ks_insertsort_##name(a, a + n); \ + } \ + void ks_introsort_##name(size_t n, type_t a[]) \ + { \ + int d; \ + ks_isort_stack_t *top, *stack; \ + type_t rp, swap_tmp; \ + type_t *s, *t, *i, *j, *k; \ + \ + if (n < 1) return; \ + else if (n == 2) { \ + if (__sort_lt(a[1], a[0])) { swap_tmp = a[0]; a[0] = a[1]; a[1] = swap_tmp; } \ + return; \ + } \ + for (d = 2; 1ul<>1) + 1; \ + if (__sort_lt(*k, *i)) { \ + if (__sort_lt(*k, *j)) k = j; \ + } else k = __sort_lt(*j, *i)? i : j; \ + rp = *k; \ + if (k != t) { swap_tmp = *k; *k = *t; *t = swap_tmp; } \ + for (;;) { \ + do ++i; while (__sort_lt(*i, rp)); \ + do --j; while (i <= j && __sort_lt(rp, *j)); \ + if (j <= i) break; \ + swap_tmp = *i; *i = *j; *j = swap_tmp; \ + } \ + swap_tmp = *i; *i = *t; *t = swap_tmp; \ + if (i-s > t-i) { \ + if (i-s > 16) { top->left = s; top->right = i-1; top->depth = d; ++top; } \ + s = t-i > 16? i+1 : t; \ + } else { \ + if (t-i > 16) { top->left = i+1; top->right = t; top->depth = d; ++top; } \ + t = i-s > 16? i-1 : s; \ + } \ + } else { \ + if (top == stack) { \ + free(stack); \ + __ks_insertsort_##name(a, a+n); \ + return; \ + } else { --top; s = (type_t*)top->left; t = (type_t*)top->right; d = top->depth; } \ + } \ + } \ + } \ + /* This function is adapted from: http://ndevilla.free.fr/median/ */ \ + /* 0 <= kk < n */ \ + type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk) \ + { \ + type_t *low, *high, *k, *ll, *hh, *mid; \ + low = arr; high = arr + n - 1; k = arr + kk; \ + for (;;) { \ + if (high <= low) return *k; \ + if (high == low + 1) { \ + if (__sort_lt(*high, *low)) KSORT_SWAP(type_t, *low, *high); \ + return *k; \ + } \ + mid = low + (high - low) / 2; \ + if (__sort_lt(*high, *mid)) KSORT_SWAP(type_t, *mid, *high); \ + if (__sort_lt(*high, *low)) KSORT_SWAP(type_t, *low, *high); \ + if (__sort_lt(*low, *mid)) KSORT_SWAP(type_t, *mid, *low); \ + KSORT_SWAP(type_t, *mid, *(low+1)); \ + ll = low + 1; hh = high; \ + for (;;) { \ + do ++ll; while (__sort_lt(*ll, *low)); \ + do --hh; while (__sort_lt(*low, *hh)); \ + if (hh < ll) break; \ + KSORT_SWAP(type_t, *ll, *hh); \ + } \ + KSORT_SWAP(type_t, *low, *hh); \ + if (hh <= k) low = ll; \ + if (hh >= k) high = hh - 1; \ + } \ + } + +#define ks_mergesort(name, n, a, t) ks_mergesort_##name(n, a, t) +#define ks_introsort(name, n, a) ks_introsort_##name(n, a) +#define ks_combsort(name, n, a) ks_combsort_##name(n, a) +#define ks_heapsort(name, n, a) ks_heapsort_##name(n, a) +#define ks_heapmake(name, n, a) ks_heapmake_##name(n, a) +#define ks_heapadjust(name, i, n, a) ks_heapadjust_##name(i, n, a) +#define ks_ksmall(name, n, a, k) ks_ksmall_##name(n, a, k) + +#define ks_lt_generic(a, b) ((a) < (b)) +#define ks_lt_str(a, b) (strcmp((a), (b)) < 0) + +typedef const char *ksstr_t; + +#define KSORT_INIT_GENERIC(type_t) KSORT_INIT(type_t, type_t, ks_lt_generic) +#define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str) + +#endif diff --git a/kstring.c b/kstring.c new file mode 100644 index 0000000..2871310 --- /dev/null +++ b/kstring.c @@ -0,0 +1,39 @@ +#include +#include +#include "kstring.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +int ksprintf(kstring_t *s, const char *fmt, ...) +{ + va_list ap; + int l; + va_start(ap, fmt); + l = vsnprintf(s->s + s->l, s->m - s->l, fmt, ap); + va_end(ap); + if (l + 1 > s->m - s->l) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + va_start(ap, fmt); + l = vsnprintf(s->s + s->l, s->m - s->l, fmt, ap); + } + va_end(ap); + s->l += l; + return l; +} + +#ifdef KSTRING_MAIN +#include +int main() +{ + kstring_t *s; + s = (kstring_t*)calloc(1, sizeof(kstring_t)); + ksprintf(s, "abcdefg: %d", 100); + printf("%s\n", s->s); + free(s); + return 0; +} +#endif diff --git a/kstring.h b/kstring.h new file mode 100644 index 0000000..fe7fa95 --- /dev/null +++ b/kstring.h @@ -0,0 +1,115 @@ +#ifndef KSTRING_H +#define KSTRING_H + +#include +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#ifndef kroundup32 +#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) +#endif + +#ifndef KSTRING_T +#define KSTRING_T kstring_t +typedef struct __kstring_t { + size_t l, m; + char *s; +} kstring_t; +#endif + +static inline void ks_resize(kstring_t *s, size_t size) +{ + if (s->m < size) { + s->m = size; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } +} + +static inline int kputsn(const char *p, int l, kstring_t *s) +{ + if (s->l + l + 1 >= s->m) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + memcpy(s->s + s->l, p, l); + s->l += l; + s->s[s->l] = 0; + return l; +} + +static inline int kputs(const char *p, kstring_t *s) +{ + return kputsn(p, strlen(p), s); +} + +static inline int kputc(int c, kstring_t *s) +{ + if (s->l + 1 >= s->m) { + s->m = s->l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + s->s[s->l++] = c; + s->s[s->l] = 0; + return c; +} + +static inline int kputw(int c, kstring_t *s) +{ + char buf[16]; + int l, x; + if (c == 0) return kputc('0', s); + for (l = 0, x = c < 0? -c : c; x > 0; x /= 10) buf[l++] = x%10 + '0'; + if (c < 0) buf[l++] = '-'; + if (s->l + l + 1 >= s->m) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + for (x = l - 1; x >= 0; --x) s->s[s->l++] = buf[x]; + s->s[s->l] = 0; + return 0; +} + +static inline int kputuw(unsigned c, kstring_t *s) +{ + char buf[16]; + int l, i; + unsigned x; + if (c == 0) return kputc('0', s); + for (l = 0, x = c; x > 0; x /= 10) buf[l++] = x%10 + '0'; + if (s->l + l + 1 >= s->m) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i]; + s->s[s->l] = 0; + return 0; +} + +static inline int kputl(long c, kstring_t *s) +{ + char buf[32]; + long l, x; + if (c == 0) return kputc('0', s); + for (l = 0, x = c < 0? -c : c; x > 0; x /= 10) buf[l++] = x%10 + '0'; + if (c < 0) buf[l++] = '-'; + if (s->l + l + 1 >= s->m) { + s->m = s->l + l + 2; + kroundup32(s->m); + s->s = (char*)realloc(s->s, s->m); + } + for (x = l - 1; x >= 0; --x) s->s[s->l++] = buf[x]; + s->s[s->l] = 0; + return 0; +} + +int ksprintf(kstring_t *s, const char *fmt, ...); + +#endif diff --git a/ksw.c b/ksw.c new file mode 100644 index 0000000..b16dcb8 --- /dev/null +++ b/ksw.c @@ -0,0 +1,789 @@ +/* The MIT License + + Copyright (c) 2011 by Attractive Chaos + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +#include +#include +#include +#if defined __SSE2__ +#include +#elif defined __ARM_NEON +#include "neon_sse.h" +#else +#include "scalar_sse.h" +#endif +#include "ksw.h" + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif +#include "profiling.h" + +const kswr_t g_defr = { 0, -1, -1, -1, -1, -1, -1 }; + +struct _kswq_t { + int qlen, slen; + uint8_t shift, mdiff, max, size; + __m128i *qp, *H0, *H1, *E, *Hmax; +}; + +/** + * Initialize the query data structure + * + * @param size Number of bytes used to store a score; valid valures are 1 or 2 + * @param qlen Length of the query sequence + * @param query Query sequence + * @param m Size of the alphabet + * @param mat Scoring matrix in a one-dimension array + * + * @return Query data structure + */ +kswq_t *ksw_qinit(int size, int qlen, const uint8_t *query, int m, const int8_t *mat) +{ + kswq_t *q; + int slen, a, tmp, p; + + size = size > 1? 2 : 1; + p = 8 * (3 - size); // # values per __m128i + slen = (qlen + p - 1) / p; // segmented length + q = (kswq_t*)malloc(sizeof(kswq_t) + 256 + 16 * slen * (m + 4)); // a single block of memory + q->qp = (__m128i*)(((size_t)q + sizeof(kswq_t) + 15) >> 4 << 4); // align memory + q->H0 = q->qp + slen * m; + q->H1 = q->H0 + slen; + q->E = q->H1 + slen; + q->Hmax = q->E + slen; + q->slen = slen; q->qlen = qlen; q->size = size; + // compute shift + tmp = m * m; + for (a = 0, q->shift = 127, q->mdiff = 0; a < tmp; ++a) { // find the minimum and maximum score + if (mat[a] < (int8_t)q->shift) q->shift = mat[a]; + if (mat[a] > (int8_t)q->mdiff) q->mdiff = mat[a]; + } + q->max = q->mdiff; + q->shift = 256 - q->shift; // NB: q->shift is uint8_t + q->mdiff += q->shift; // this is the difference between the min and max scores + // An example: p=8, qlen=19, slen=3 and segmentation: + // {{0,3,6,9,12,15,18,-1},{1,4,7,10,13,16,-1,-1},{2,5,8,11,14,17,-1,-1}} + if (size == 1) { + int8_t *t = (int8_t*)q->qp; + for (a = 0; a < m; ++a) { + int i, k, nlen = slen * p; + const int8_t *ma = mat + a * m; + for (i = 0; i < slen; ++i) + for (k = i; k < nlen; k += slen) // p iterations + *t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift; + } + } else { + int16_t *t = (int16_t*)q->qp; + for (a = 0; a < m; ++a) { + int i, k, nlen = slen * p; + const int8_t *ma = mat + a * m; + for (i = 0; i < slen; ++i) + for (k = i; k < nlen; k += slen) // p iterations + *t++ = (k >= qlen? 0 : ma[query[k]]); + } + } + return q; +} + +#if defined __ARM_NEON +// This macro implicitly uses each function's `zero` local variable +#define _mm_slli_si128(a, n) (vextq_u8(zero, (a), 16 - (n))) +#endif + +kswr_t ksw_u8(kswq_t *q, int tlen, const uint8_t *target, int _o_del, int _e_del, int _o_ins, int _e_ins, int xtra) // the first gap costs -(_o+_e) +{ + int slen, i, m_b, n_b, te = -1, gmax = 0, minsc, endsc; + uint64_t *b; + __m128i zero, oe_del, e_del, oe_ins, e_ins, shift, *H0, *H1, *E, *Hmax; + kswr_t r; + +#if defined __SSE2__ +#define __max_16(ret, xx) do { \ + (xx) = _mm_max_epu8((xx), _mm_srli_si128((xx), 8)); \ + (xx) = _mm_max_epu8((xx), _mm_srli_si128((xx), 4)); \ + (xx) = _mm_max_epu8((xx), _mm_srli_si128((xx), 2)); \ + (xx) = _mm_max_epu8((xx), _mm_srli_si128((xx), 1)); \ + (ret) = _mm_extract_epi16((xx), 0) & 0x00ff; \ + } while (0) + +// Given entries with arbitrary values, return whether they are all 0x00 +#define allzero_16(xx) (_mm_movemask_epi8(_mm_cmpeq_epi8((xx), zero)) == 0xffff) + +#elif defined __ARM_NEON +#define __max_16(ret, xx) (ret) = vmaxvq_u8((xx)) +#define allzero_16(xx) (vmaxvq_u8((xx)) == 0) + +#else +#define __max_16(ret, xx) (ret) = m128i_max_u8((xx)) +#define allzero_16(xx) (m128i_allzero((xx))) +#endif + + // initialization + r = g_defr; + minsc = (xtra&KSW_XSUBO)? xtra&0xffff : 0x10000; + endsc = (xtra&KSW_XSTOP)? xtra&0xffff : 0x10000; + m_b = n_b = 0; b = 0; + zero = _mm_set1_epi32(0); + oe_del = _mm_set1_epi8(_o_del + _e_del); + e_del = _mm_set1_epi8(_e_del); + oe_ins = _mm_set1_epi8(_o_ins + _e_ins); + e_ins = _mm_set1_epi8(_e_ins); + shift = _mm_set1_epi8(q->shift); + H0 = q->H0; H1 = q->H1; E = q->E; Hmax = q->Hmax; + slen = q->slen; + for (i = 0; i < slen; ++i) { + _mm_store_si128(E + i, zero); + _mm_store_si128(H0 + i, zero); + _mm_store_si128(Hmax + i, zero); + } + // the core loop +// PROF_START(loop); + for (i = 0; i < tlen; ++i) { + int j, k, imax; + __m128i e, h, t, f = zero, max = zero, *S = q->qp + target[i] * slen; // s is the 1st score vector + h = _mm_load_si128(H0 + slen - 1); // h={2,5,8,11,14,17,-1,-1} in the above example + h = _mm_slli_si128(h, 1); // h=H(i-1,-1); << instead of >> because x64 is little-endian + for (j = 0; LIKELY(j < slen); ++j) { + /* SW cells are computed in the following order: + * H(i,j) = max{H(i-1,j-1)+S(i,j), E(i,j), F(i,j)} + * E(i+1,j) = max{H(i,j)-q, E(i,j)-r} + * F(i,j+1) = max{H(i,j)-q, F(i,j)-r} + */ + // compute H'(i,j); note that at the beginning, h=H'(i-1,j-1) + h = _mm_adds_epu8(h, _mm_load_si128(S + j)); + h = _mm_subs_epu8(h, shift); // h=H'(i-1,j-1)+S(i,j) + e = _mm_load_si128(E + j); // e=E'(i,j) + h = _mm_max_epu8(h, e); + h = _mm_max_epu8(h, f); // h=H'(i,j) + max = _mm_max_epu8(max, h); // set max + _mm_store_si128(H1 + j, h); // save to H'(i,j) + // now compute E'(i+1,j) + e = _mm_subs_epu8(e, e_del); // e=E'(i,j) - e_del + t = _mm_subs_epu8(h, oe_del); // h=H'(i,j) - o_del - e_del + e = _mm_max_epu8(e, t); // e=E'(i+1,j) + _mm_store_si128(E + j, e); // save to E'(i+1,j) + // now compute F'(i,j+1) + f = _mm_subs_epu8(f, e_ins); + t = _mm_subs_epu8(h, oe_ins); // h=H'(i,j) - o_ins - e_ins + f = _mm_max_epu8(f, t); + // get H'(i-1,j) and prepare for the next j + h = _mm_load_si128(H0 + j); // h=H'(i-1,j) + } + // NB: we do not need to set E(i,j) as we disallow adjecent insertion and then deletion + for (k = 0; LIKELY(k < 16); ++k) { // this block mimics SWPS3; NB: H(i,j) updated in the lazy-F loop cannot exceed max + f = _mm_slli_si128(f, 1); + for (j = 0; LIKELY(j < slen); ++j) { + h = _mm_load_si128(H1 + j); + h = _mm_max_epu8(h, f); // h=H'(i,j) + _mm_store_si128(H1 + j, h); + h = _mm_subs_epu8(h, oe_ins); + f = _mm_subs_epu8(f, e_ins); + if (UNLIKELY(allzero_16(_mm_subs_epu8(f, h)))) goto end_loop16; + } + } +end_loop16: + //int k;for (k=0;k<16;++k)printf("%d ", ((uint8_t*)&max)[k]);printf("\n"); + __max_16(imax, max); // imax is the maximum number in max + if (imax >= minsc) { // write the b array; this condition adds branching unfornately + if (n_b == 0 || (int32_t)b[n_b-1] + 1 != i) { // then append + if (n_b == m_b) { + m_b = m_b? m_b<<1 : 8; + b = (uint64_t*)realloc(b, 8 * m_b); + } + b[n_b++] = (uint64_t)imax<<32 | i; + } else if ((int)(b[n_b-1]>>32) < imax) b[n_b-1] = (uint64_t)imax<<32 | i; // modify the last + } + if (imax > gmax) { + gmax = imax; te = i; // te is the end position on the target + for (j = 0; LIKELY(j < slen); ++j) // keep the H1 vector + _mm_store_si128(Hmax + j, _mm_load_si128(H1 + j)); + if (gmax + q->shift >= 255 || gmax >= endsc) break; + } + S = H1; H1 = H0; H0 = S; // swap H0 and H1 + } +// PROF_END(gprof[G_KSW_LOOP], loop); +// PROF_START(end_loop); + r.score = gmax + q->shift < 255? gmax : 255; + r.te = te; + if (r.score != 255) { // get a->qe, the end of query match; find the 2nd best score + int max = -1, tmp, low, high, qlen = slen * 16; + uint8_t *t = (uint8_t*)Hmax; + for (i = 0; i < qlen; ++i, ++t) + if ((int)*t > max) max = *t, r.qe = i / 16 + i % 16 * slen; + else if ((int)*t == max && (tmp = i / 16 + i % 16 * slen) < r.qe) r.qe = tmp; + //printf("%d,%d\n", max, gmax); + if (b) { + i = (r.score + q->max - 1) / q->max; + low = te - i; high = te + i; + for (i = 0; i < n_b; ++i) { + int e = (int32_t)b[i]; + if ((e < low || e > high) && (int)(b[i]>>32) > r.score2) + r.score2 = b[i]>>32, r.te2 = e; + } + } + } + free(b); +// PROF_END(gprof[G_KSW_END_LOOP], end_loop); + return r; +} + +kswr_t ksw_i16(kswq_t *q, int tlen, const uint8_t *target, int _o_del, int _e_del, int _o_ins, int _e_ins, int xtra) // the first gap costs -(_o+_e) +{ + int slen, i, m_b, n_b, te = -1, gmax = 0, minsc, endsc; + uint64_t *b; + __m128i zero, oe_del, e_del, oe_ins, e_ins, *H0, *H1, *E, *Hmax; + kswr_t r; + +#if defined __SSE2__ +#define __max_8(ret, xx) do { \ + (xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 8)); \ + (xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 4)); \ + (xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 2)); \ + (ret) = _mm_extract_epi16((xx), 0); \ + } while (0) + +// Given entries all either 0x0000 or 0xffff, return whether they are all 0x0000 +#define allzero_0f_8(xx) (!_mm_movemask_epi8((xx))) + +#elif defined __ARM_NEON +#define __max_8(ret, xx) (ret) = vmaxvq_s16(vreinterpretq_s16_u8((xx))) +#define allzero_0f_8(xx) (vmaxvq_u16(vreinterpretq_u16_u8((xx))) == 0) + +#else +#define __max_8(ret, xx) (ret) = m128i_max_s16((xx)) +#define allzero_0f_8(xx) (m128i_allzero((xx))) +#endif + + // initialization + r = g_defr; + minsc = (xtra&KSW_XSUBO)? xtra&0xffff : 0x10000; + endsc = (xtra&KSW_XSTOP)? xtra&0xffff : 0x10000; + m_b = n_b = 0; b = 0; + zero = _mm_set1_epi32(0); + oe_del = _mm_set1_epi16(_o_del + _e_del); + e_del = _mm_set1_epi16(_e_del); + oe_ins = _mm_set1_epi16(_o_ins + _e_ins); + e_ins = _mm_set1_epi16(_e_ins); + H0 = q->H0; H1 = q->H1; E = q->E; Hmax = q->Hmax; + slen = q->slen; + for (i = 0; i < slen; ++i) { + _mm_store_si128(E + i, zero); + _mm_store_si128(H0 + i, zero); + _mm_store_si128(Hmax + i, zero); + } + // the core loop + PROF_START(loop); + for (i = 0; i < tlen; ++i) { + int j, k, imax; + __m128i e, t, h, f = zero, max = zero, *S = q->qp + target[i] * slen; // s is the 1st score vector + h = _mm_load_si128(H0 + slen - 1); // h={2,5,8,11,14,17,-1,-1} in the above example + h = _mm_slli_si128(h, 2); + for (j = 0; LIKELY(j < slen); ++j) { + h = _mm_adds_epi16(h, _mm_load_si128(S++)); + e = _mm_load_si128(E + j); + h = _mm_max_epi16(h, e); + h = _mm_max_epi16(h, f); + max = _mm_max_epi16(max, h); + _mm_store_si128(H1 + j, h); + e = _mm_subs_epu16(e, e_del); + t = _mm_subs_epu16(h, oe_del); + e = _mm_max_epi16(e, t); + _mm_store_si128(E + j, e); + f = _mm_subs_epu16(f, e_ins); + t = _mm_subs_epu16(h, oe_ins); + f = _mm_max_epi16(f, t); + h = _mm_load_si128(H0 + j); + } + for (k = 0; LIKELY(k < 16); ++k) { + f = _mm_slli_si128(f, 2); + for (j = 0; LIKELY(j < slen); ++j) { + h = _mm_load_si128(H1 + j); + h = _mm_max_epi16(h, f); + _mm_store_si128(H1 + j, h); + h = _mm_subs_epu16(h, oe_ins); + f = _mm_subs_epu16(f, e_ins); + if(UNLIKELY(allzero_0f_8(_mm_cmpgt_epi16(f, h)))) goto end_loop8; + } + } +end_loop8: + __max_8(imax, max); + if (imax >= minsc) { + if (n_b == 0 || (int32_t)b[n_b-1] + 1 != i) { + if (n_b == m_b) { + m_b = m_b? m_b<<1 : 8; + b = (uint64_t*)realloc(b, 8 * m_b); + } + b[n_b++] = (uint64_t)imax<<32 | i; + } else if ((int)(b[n_b-1]>>32) < imax) b[n_b-1] = (uint64_t)imax<<32 | i; // modify the last + } + if (imax > gmax) { + gmax = imax; te = i; + for (j = 0; LIKELY(j < slen); ++j) + _mm_store_si128(Hmax + j, _mm_load_si128(H1 + j)); + if (gmax >= endsc) break; + } + S = H1; H1 = H0; H0 = S; + + } + PROF_END(gprof[G_KSW_LOOP], loop); + r.score = gmax; r.te = te; + { + int max = -1, tmp, low, high, qlen = slen * 8; + uint16_t *t = (uint16_t*)Hmax; + for (i = 0, r.qe = -1; i < qlen; ++i, ++t) + if ((int)*t > max) max = *t, r.qe = i / 8 + i % 8 * slen; + else if ((int)*t == max && (tmp = i / 8 + i % 8 * slen) < r.qe) r.qe = tmp; + if (b) { + i = (r.score + q->max - 1) / q->max; + low = te - i; high = te + i; + for (i = 0; i < n_b; ++i) { + int e = (int32_t)b[i]; + if ((e < low || e > high) && (int)(b[i]>>32) > r.score2) + r.score2 = b[i]>>32, r.te2 = e; + } + } + } + free(b); + return r; +} + +static inline void revseq(int l, uint8_t *s) +{ + int i, t; + for (i = 0; i < l>>1; ++i) + t = s[i], s[i] = s[l - 1 - i], s[l - 1 - i] = t; +} + +static void write_query_target_sequence(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int fnum) +{ +#ifdef DEBUG_FILE_OUTPUT + // ,query.fa,target.fa,,info.txt,h0,qlen,tlen + FILE *query_f = gfq[fnum], + *target_f = gft[fnum], + *info_f = gfi[fnum]; + const char seq_map[5] = {'A', 'C', 'G', 'T', 'N'}; + int i; + // query + for (i = 0; i < qlen; ++i) + fprintf(query_f, "%c", seq_map[query[i]]); + fprintf(query_f, "\n"); + // target + for (i = 0; i < tlen; ++i) + fprintf(target_f, "%c", seq_map[target[i]]); + fprintf(target_f, "\n"); + // + fprintf(info_f, "%-8d%-8d\n", qlen, tlen); +#endif +} + +kswr_t ksw_align2(int qlen, uint8_t *query, int tlen, uint8_t *target, int m, const int8_t *mat, int o_del, int e_del, int o_ins, int e_ins, int xtra, kswq_t **qry) +{ + int size; + kswq_t *q; + kswr_t r, rr; + kswr_t (*func)(kswq_t*, int, const uint8_t*, int, int, int, int, int); +#ifdef GET_KSW_ALIGN_SEQ + write_query_target_sequence(qlen, query, tlen, target, 0); +#endif + q = (qry && *qry)? *qry : ksw_qinit((xtra&KSW_XBYTE)? 1 : 2, qlen, query, m, mat); + //q = (qry && *qry) ? *qry : ksw_qinit(2, qlen, query, m, mat); + //fprintf(stderr, "%d %d\n", tlen, qlen); + if (qry && *qry == 0) *qry = q; + func = q->size == 2? ksw_i16 : ksw_u8; + size = q->size; + r = func(q, tlen, target, o_del, e_del, o_ins, e_ins, xtra); + //fprintf(gf[0], "%d %d %d %d %d %d %d\n", r.score, r.qb, r.qe, r.tb, r.te, r.score2, r.te2); + //fprintf(gf[0], "%d %d %d %d %d\n", r.score, r.qb, r.qe, r.tb, r.te); + if (qry == 0) free(q); + if ((xtra&KSW_XSTART) == 0 || ((xtra&KSW_XSUBO) && r.score < (xtra&0xffff))) return r; + revseq(r.qe + 1, query); revseq(r.te + 1, target); // +1 because qe/te points to the exact end, not the position after the end + q = ksw_qinit(size, r.qe + 1, query, m, mat); + rr = func(q, tlen, target, o_del, e_del, o_ins, e_ins, KSW_XSTOP | r.score); + revseq(r.qe + 1, query); revseq(r.te + 1, target); + free(q); + if (r.score == rr.score) + r.tb = r.te - rr.te, r.qb = r.qe - rr.qe; + return r; +} + +kswr_t ksw_align(int qlen, uint8_t *query, int tlen, uint8_t *target, int m, const int8_t *mat, int gapo, int gape, int xtra, kswq_t **qry) +{ + return ksw_align2(qlen, query, tlen, target, m, mat, gapo, gape, gapo, gape, xtra, qry); +} + +/******************** + *** SW extension *** + ********************/ + +typedef struct { + int32_t h, e; +} eh_t; + +int ksw_extend2(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int m, const int8_t *mat, int o_del, int e_del, int o_ins, int e_ins, int w, int end_bonus, int zdrop, int h0, int *_qle, int *_tle, int *_gtle, int *_gscore, int *_max_off, buf_t *buf) +{ + eh_t *eh; // score array + int8_t *qp; // query profile + int i, j, k, oe_del = o_del + e_del, oe_ins = o_ins + e_ins, beg, end, max, max_i, max_j, max_ins, max_del, max_ie, gscore, max_off; + int mem_size = qlen * m + (qlen + 1) * 8; + assert(h0 > 0); + // allocate memory + if (mem_size > buf->m) { + buf->m = mem_size; + buf->addr = realloc(buf->addr, mem_size); + } + //qp = malloc(qlen * m); + //eh = calloc(qlen + 1, 8); + qp = (int8_t*)buf->addr; + eh = (eh_t*)(buf->addr + qlen * m); + memset(eh, 0, (qlen + 1) * 8); + + // generate the query profile + for (k = i = 0; k < m; ++k) { + const int8_t *p = &mat[k * m]; + for (j = 0; j < qlen; ++j) qp[i++] = p[query[j]]; + } + // fill the first row + eh[0].h = h0; eh[1].h = h0 > oe_ins? h0 - oe_ins : 0; + for (j = 2; j <= qlen && eh[j-1].h > e_ins; ++j) + eh[j].h = eh[j-1].h - e_ins; + // adjust $w if it is too large + k = m * m; + for (i = 0, max = 0; i < k; ++i) // get the max score + max = max > mat[i]? max : mat[i]; + max_ins = (int)((double)(qlen * max + end_bonus - o_ins) / e_ins + 1.); + max_ins = max_ins > 1? max_ins : 1; + w = w < max_ins? w : max_ins; + max_del = (int)((double)(qlen * max + end_bonus - o_del) / e_del + 1.); + max_del = max_del > 1? max_del : 1; + w = w < max_del? w : max_del; // TODO: is this necessary? + // DP loop + max = h0, max_i = max_j = -1; max_ie = -1, gscore = -1; + max_off = 0; + beg = 0, end = qlen; + for (i = 0; LIKELY(i < tlen); ++i) { + int t, f = 0, h1, m = 0, mj = -1; + int8_t *q = &qp[target[i] * qlen]; + // apply the band and the constraint (if provided) + if (beg < i - w) beg = i - w; + if (end > i + w + 1) end = i + w + 1; + if (end > qlen) end = qlen; + // compute the first column + if (beg == 0) { + h1 = h0 - (o_del + e_del * (i + 1)); + if (h1 < 0) h1 = 0; + } else h1 = 0; + for (j = beg; LIKELY(j < end); ++j) { + // At the beginning of the loop: eh[j] = { H(i-1,j-1), E(i,j) }, f = F(i,j) and h1 = H(i,j-1) + // Similar to SSE2-SW, cells are computed in the following order: + // H(i,j) = max{H(i-1,j-1)+S(i,j), E(i,j), F(i,j)} + // E(i+1,j) = max{H(i,j)-gapo, E(i,j)} - gape + // F(i,j+1) = max{H(i,j)-gapo, F(i,j)} - gape + eh_t *p = &eh[j]; + int h, M = p->h, e = p->e; // get H(i-1,j-1) and E(i-1,j) + p->h = h1; // set H(i,j-1) for the next row + M = M? M + q[j] : 0;// separating H and M to disallow a cigar like "100M3I3D20M" + h = M > e? M : e; // e and f are guaranteed to be non-negative, so h>=0 even if M<0 + h = h > f? h : f; + h1 = h; // save H(i,j) to h1 for the next column + mj = m > h? mj : j; // record the position where max score is achieved + m = m > h? m : h; // m is stored at eh[mj+1] + t = M - oe_del; + t = t > 0? t : 0; + e -= e_del; + e = e > t? e : t; // computed E(i+1,j) + p->e = e; // save E(i+1,j) for the next row + t = M - oe_ins; + t = t > 0? t : 0; + f -= e_ins; + f = f > t? f : t; // computed F(i,j+1) + } + eh[end].h = h1; eh[end].e = 0; + if (j == qlen) { + max_ie = gscore > h1? max_ie : i; + gscore = gscore > h1? gscore : h1; + } + if (m == 0) break; + if (m > max) { + max = m, max_i = i, max_j = mj; + max_off = max_off > abs(mj - i)? max_off : abs(mj - i); + } else if (zdrop > 0) { + if (i - max_i > mj - max_j) { + if (max - m - ((i - max_i) - (mj - max_j)) * e_del > zdrop) break; + } else { + if (max - m - ((mj - max_j) - (i - max_i)) * e_ins > zdrop) break; + } + } + // update beg and end for the next round + for (j = beg; LIKELY(j < end) && eh[j].h == 0 && eh[j].e == 0; ++j); + beg = j; + for (j = end; LIKELY(j >= beg) && eh[j].h == 0 && eh[j].e == 0; --j); + end = j + 2 < qlen? j + 2 : qlen; + //beg = 0; end = qlen; // uncomment this line for debugging + } + // free(eh); free(qp); + if (_qle) *_qle = max_j + 1; + if (_tle) *_tle = max_i + 1; + if (_gtle) *_gtle = max_ie + 1; + if (_gscore) *_gscore = gscore; + if (_max_off) *_max_off = max_off; + return max; +} + +int ksw_extend(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int m, const int8_t *mat, int gapo, int gape, int w, int end_bonus, int zdrop, int h0, int *qle, int *tle, int *gtle, int *gscore, int *max_off, buf_t *buf) +{ + if (buf == 0) buf = calloc(1, sizeof(buf_t)); + return ksw_extend2(qlen, query, tlen, target, m, mat, gapo, gape, gapo, gape, w, end_bonus, zdrop, h0, qle, tle, gtle, gscore, max_off, buf); + free(buf->addr); + free(buf); +} + +/******************** + * Global alignment * + ********************/ + +#define MINUS_INF -0x40000000 + +static inline uint32_t *push_cigar(int *n_cigar, int *m_cigar, uint32_t *cigar, int op, int len) +{ + if (*n_cigar == 0 || op != (cigar[(*n_cigar) - 1]&0xf)) { + if (*n_cigar == *m_cigar) { + *m_cigar = *m_cigar? (*m_cigar)<<1 : 4; + cigar = realloc(cigar, (*m_cigar) << 2); + } + cigar[(*n_cigar)++] = len<<4 | op; + } else cigar[(*n_cigar)-1] += len<<4; + return cigar; +} + +int ksw_global2(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int m, const int8_t *mat, int o_del, int e_del, int o_ins, int e_ins, int w, int *n_cigar_, uint32_t **cigar_) +{ + eh_t *eh; + int8_t *qp; // query profile + int i, j, k, oe_del = o_del + e_del, oe_ins = o_ins + e_ins, score, n_col; + uint8_t *z; // backtrack matrix; in each cell: f<<4|e<<2|h; in principle, we can halve the memory, but backtrack will be a little more complex + if (n_cigar_) *n_cigar_ = 0; + // allocate memory + n_col = qlen < 2*w+1? qlen : 2*w+1; // maximum #columns of the backtrack matrix + z = n_cigar_ && cigar_? malloc((long)n_col * tlen) : 0; + qp = malloc(qlen * m); + eh = calloc(qlen + 1, 8); + // generate the query profile + for (k = i = 0; k < m; ++k) { + const int8_t *p = &mat[k * m]; + for (j = 0; j < qlen; ++j) qp[i++] = p[query[j]]; + } + // fill the first row + eh[0].h = 0; eh[0].e = MINUS_INF; + for (j = 1; j <= qlen && j <= w; ++j) + eh[j].h = -(o_ins + e_ins * j), eh[j].e = MINUS_INF; + for (; j <= qlen; ++j) eh[j].h = eh[j].e = MINUS_INF; // everything is -inf outside the band + // DP loop + for (i = 0; LIKELY(i < tlen); ++i) { // target sequence is in the outer loop + int32_t f = MINUS_INF, h1, beg, end, t; + int8_t *q = &qp[target[i] * qlen]; + beg = i > w? i - w : 0; + end = i + w + 1 < qlen? i + w + 1 : qlen; // only loop through [beg,end) of the query sequence + h1 = beg == 0? -(o_del + e_del * (i + 1)) : MINUS_INF; + if (n_cigar_ && cigar_) { + uint8_t *zi = &z[(long)i * n_col]; + for (j = beg; LIKELY(j < end); ++j) { + // At the beginning of the loop: eh[j] = { H(i-1,j-1), E(i,j) }, f = F(i,j) and h1 = H(i,j-1) + // Cells are computed in the following order: + // M(i,j) = H(i-1,j-1) + S(i,j) + // H(i,j) = max{M(i,j), E(i,j), F(i,j)} + // E(i+1,j) = max{M(i,j)-gapo, E(i,j)} - gape + // F(i,j+1) = max{M(i,j)-gapo, F(i,j)} - gape + // We have to separate M(i,j); otherwise the direction may not be recorded correctly. + // However, a CIGAR like "10M3I3D10M" allowed by local() is disallowed by global(). + // Such a CIGAR may occur, in theory, if mismatch_penalty > 2*gap_ext_penalty + 2*gap_open_penalty/k. + // In practice, this should happen very rarely given a reasonable scoring system. + eh_t *p = &eh[j]; + int32_t h, m = p->h, e = p->e; + uint8_t d; // direction + p->h = h1; + m += q[j]; + d = m >= e? 0 : 1; + h = m >= e? m : e; + d = h >= f? d : 2; + h = h >= f? h : f; + h1 = h; + t = m - oe_del; + e -= e_del; + d |= e > t? 1<<2 : 0; + e = e > t? e : t; + p->e = e; + t = m - oe_ins; + f -= e_ins; + d |= f > t? 2<<4 : 0; // if we want to halve the memory, use one bit only, instead of two + f = f > t? f : t; + zi[j - beg] = d; // z[i,j] keeps h for the current cell and e/f for the next cell + } + } else { + for (j = beg; LIKELY(j < end); ++j) { + eh_t *p = &eh[j]; + int32_t h, m = p->h, e = p->e; + p->h = h1; + m += q[j]; + h = m >= e? m : e; + h = h >= f? h : f; + h1 = h; + t = m - oe_del; + e -= e_del; + e = e > t? e : t; + p->e = e; + t = m - oe_ins; + f -= e_ins; + f = f > t? f : t; + } + } + eh[end].h = h1; eh[end].e = MINUS_INF; + } + score = eh[qlen].h; + if (n_cigar_ && cigar_) { // backtrack + int n_cigar = 0, m_cigar = 0, which = 0; + uint32_t *cigar = 0, tmp; + i = tlen - 1; k = (i + w + 1 < qlen? i + w + 1 : qlen) - 1; // (i,k) points to the last cell + while (i >= 0 && k >= 0) { + which = z[(long)i * n_col + (k - (i > w? i - w : 0))] >> (which<<1) & 3; + if (which == 0) cigar = push_cigar(&n_cigar, &m_cigar, cigar, 0, 1), --i, --k; + else if (which == 1) cigar = push_cigar(&n_cigar, &m_cigar, cigar, 2, 1), --i; + else cigar = push_cigar(&n_cigar, &m_cigar, cigar, 1, 1), --k; + } + if (i >= 0) cigar = push_cigar(&n_cigar, &m_cigar, cigar, 2, i + 1); + if (k >= 0) cigar = push_cigar(&n_cigar, &m_cigar, cigar, 1, k + 1); + for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR + tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp; + *n_cigar_ = n_cigar, *cigar_ = cigar; + } + free(eh); free(qp); free(z); + return score; +} + +int ksw_global(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int m, const int8_t *mat, int gapo, int gape, int w, int *n_cigar_, uint32_t **cigar_) +{ + return ksw_global2(qlen, query, tlen, target, m, mat, gapo, gape, gapo, gape, w, n_cigar_, cigar_); +} + +/******************************************* + * Main function (not compiled by default) * + *******************************************/ + +#ifdef _KSW_MAIN + +#include +#include +#include +#include "kseq.h" +KSEQ_INIT(gzFile, err_gzread) + +unsigned char seq_nt4_table[256] = { + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, + 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4 +}; + +int main(int argc, char *argv[]) +{ + int c, sa = 1, sb = 3, i, j, k, forward_only = 0, max_rseq = 0; + int8_t mat[25]; + int gapo = 5, gape = 2, minsc = 0, xtra = KSW_XSTART; + uint8_t *rseq = 0; + gzFile fpt, fpq; + kseq_t *kst, *ksq; + + // parse command line + while ((c = getopt(argc, argv, "a:b:q:r:ft:1")) >= 0) { + switch (c) { + case 'a': sa = atoi(optarg); break; + case 'b': sb = atoi(optarg); break; + case 'q': gapo = atoi(optarg); break; + case 'r': gape = atoi(optarg); break; + case 't': minsc = atoi(optarg); break; + case 'f': forward_only = 1; break; + case '1': xtra |= KSW_XBYTE; break; + } + } + if (optind + 2 > argc) { + fprintf(stderr, "Usage: ksw [-1] [-f] [-a%d] [-b%d] [-q%d] [-r%d] [-t%d] \n", sa, sb, gapo, gape, minsc); + return 1; + } + if (minsc > 0xffff) minsc = 0xffff; + xtra |= KSW_XSUBO | minsc; + // initialize scoring matrix + for (i = k = 0; i < 4; ++i) { + for (j = 0; j < 4; ++j) + mat[k++] = i == j? sa : -sb; + mat[k++] = 0; // ambiguous base + } + for (j = 0; j < 5; ++j) mat[k++] = 0; + // open file + fpt = xzopen(argv[optind], "r"); kst = kseq_init(fpt); + fpq = xzopen(argv[optind+1], "r"); ksq = kseq_init(fpq); + // all-pair alignment + while (kseq_read(ksq) > 0) { + kswq_t *q[2] = {0, 0}; + kswr_t r; + for (i = 0; i < (int)ksq->seq.l; ++i) ksq->seq.s[i] = seq_nt4_table[(int)ksq->seq.s[i]]; + if (!forward_only) { // reverse + if ((int)ksq->seq.m > max_rseq) { + max_rseq = ksq->seq.m; + rseq = (uint8_t*)realloc(rseq, max_rseq); + } + for (i = 0, j = ksq->seq.l - 1; i < (int)ksq->seq.l; ++i, --j) + rseq[j] = ksq->seq.s[i] == 4? 4 : 3 - ksq->seq.s[i]; + } + gzrewind(fpt); kseq_rewind(kst); + while (kseq_read(kst) > 0) { + for (i = 0; i < (int)kst->seq.l; ++i) kst->seq.s[i] = seq_nt4_table[(int)kst->seq.s[i]]; + r = ksw_align(ksq->seq.l, (uint8_t*)ksq->seq.s, kst->seq.l, (uint8_t*)kst->seq.s, 5, mat, gapo, gape, xtra, &q[0]); + if (r.score >= minsc) + err_printf("%s\t%d\t%d\t%s\t%d\t%d\t%d\t%d\t%d\n", kst->name.s, r.tb, r.te+1, ksq->name.s, r.qb, r.qe+1, r.score, r.score2, r.te2); + if (rseq) { + r = ksw_align(ksq->seq.l, rseq, kst->seq.l, (uint8_t*)kst->seq.s, 5, mat, gapo, gape, xtra, &q[1]); + if (r.score >= minsc) + err_printf("%s\t%d\t%d\t%s\t%d\t%d\t%d\t%d\t%d\n", kst->name.s, r.tb, r.te+1, ksq->name.s, (int)ksq->seq.l - r.qb, (int)ksq->seq.l - 1 - r.qe, r.score, r.score2, r.te2); + } + } + free(q[0]); free(q[1]); + } + free(rseq); + kseq_destroy(kst); err_gzclose(fpt); + kseq_destroy(ksq); err_gzclose(fpq); + return 0; +} +#endif diff --git a/ksw.h b/ksw.h new file mode 100644 index 0000000..c14caa8 --- /dev/null +++ b/ksw.h @@ -0,0 +1,117 @@ +#ifndef __AC_KSW_H +#define __AC_KSW_H + +#include +#include "utils.h" + +#define KSW_XBYTE 0x10000 +#define KSW_XSTOP 0x20000 +#define KSW_XSUBO 0x40000 +#define KSW_XSTART 0x80000 + +struct _kswq_t; +typedef struct _kswq_t kswq_t; + +typedef struct { + int score; // best score + int te, qe; // target end and query end + int score2, te2; // second best score and ending position on the target + int tb, qb; // target start and query start +} kswr_t; + +#ifdef __cplusplus +extern "C" { +#endif + + /** + * Aligning two sequences + * + * @param qlen length of the query sequence (typically =0, *gscore keeps the best score such that + * the entire query sequence is aligned; *gtle keeps the position on the + * target where *gscore is achieved. Returning *gscore and *gtle helps the + * caller to decide whether an end-to-end hit or a partial hit is preferred. + * + * The first 9 parameters are identical to those in ksw_global() + * + * @param h0 alignment score of upstream sequences + * @param _qle (out) length of the query in the alignment + * @param _tle (out) length of the target in the alignment + * @param _gtle (out) length of the target if query is fully aligned + * @param _gscore (out) score of the best end-to-end alignment; negative if not found + * + * @return best semi-local alignment score + */ + int ksw_extend(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int m, const int8_t *mat, int gapo, int gape, int w, int end_bonus, int zdrop, int h0, int *qle, int *tle, int *gtle, int *gscore, int *max_off, buf_t *buf); + int ksw_extend2(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int m, const int8_t *mat, int o_del, int e_del, int o_ins, int e_ins, int w, int end_bonus, int zdrop, int h0, int *qle, int *tle, int *gtle, int *gscore, int *max_off, buf_t *buf); + int ksw_extend2_avx2(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int is_left, int m, const int8_t *mat, int o_del, int e_del, + int o_ins, int e_ins, int a, int b, int w, int end_bonus, int zdrop, int h0, int *_qle, int *_tle, int *_gtle, int *_gscore, int *_max_off, buf_t *buf); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/ksw_align_avx2.c b/ksw_align_avx2.c new file mode 100644 index 0000000..7ccdcaa --- /dev/null +++ b/ksw_align_avx2.c @@ -0,0 +1,75 @@ +#include +#include +#include +#include +#include +#include +#include +#include "utils.h" +#include "ksw.h" + +// static const kswr_t g_defr = { 0, -1, -1, -1, -1, -1, -1 }; + +typedef struct _kswq_t { + int qlen, slen; + uint8_t shift, mdiff, max, size; + __m256i *qp, *H0, *H1, *E, *Hmax; +} kswq_t; + +/** + * Initialize the query data structure + * + * @param size Number of bytes used to store a score; valid valures are 1 or 2 + * @param qlen Length of the query sequence + * @param query Query sequence + * @param m Size of the alphabet (ACGTN) + * @param mat Scoring matrix in a one-dimension array + * + * @return Query data structure + */ +kswq_t *ksw_qinit_avx2(int size, int qlen, const uint8_t *query, int m, const int8_t *mat) +{ + kswq_t *q; + int slen, a, tmp, p; + size = size > 1 ? 2 : 1; + p = 16 * (3 - size); // # values per __m256i + slen = (qlen + p - 1) / p; // segmented length + q = (kswq_t *)malloc(sizeof(kswq_t) + 512 + 32 * slen * (m + 4)); // a single block of memory + q->qp = (__m256i *)(((size_t)q + sizeof(kswq_t) + 31) >> 5 << 5); // align memory + q->H0 = q->qp + slen * m; + q->H1 = q->H0 + slen; + q->E = q->H1 + slen; + q->Hmax = q->E + slen; + q->slen = slen; q->qlen = qlen; q->size = size; + // compute shift + tmp = m * m; + for (a = 0, q->shift = 127, q->mdiff = 0; a < tmp; ++a) { // find the minimum and maximum score + if (mat[a] < (int8_t)q->shift) q->shift = mat[a]; + if (mat[a] > (int8_t)q->mdiff) q->mdiff = mat[a]; + } + q->max = q->mdiff; + q->shift = 256 - q->shift; // NB: q->shift is uint8_t + q->mdiff += q->shift; // this is the difference between the min and max scores + // An example: p=8, qlen=19, slen=3 and segmentation: + // {{0,3,6,9,12,15,18,-1},{1,4,7,10,13,16,-1,-1},{2,5,8,11,14,17,-1,-1}} + if (size == 1) { + int8_t *t = (int8_t*)q->qp; + for (a = 0; a < m; ++a) { + int i, k, nlen = slen * p; + const int8_t *ma = mat + a * m; + for (i = 0; i < slen; ++i) + for (k = i; k < nlen; k += slen) // p iterations + *t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift; + } + } else { + int16_t *t = (int16_t*)q->qp; + for (a = 0; a < m; ++a) { + int i, k, nlen = slen * p; + const int8_t *ma = mat + a * m; + for (i = 0; i < slen; ++i) + for (k = i; k < nlen; k += slen) // p iterations + *t++ = (k >= qlen? 0 : ma[query[k]]); + } + } + return q; +} \ No newline at end of file diff --git a/ksw_extend2_avx2.c b/ksw_extend2_avx2.c new file mode 100644 index 0000000..d06a647 --- /dev/null +++ b/ksw_extend2_avx2.c @@ -0,0 +1,826 @@ +#include +#include +#include +#include +#include +#include +#include +#include "utils.h" +#include "debug.h" +#include "profiling.h" + +#define ELIMINATE_DIFF_1 +// #define ELIMINATE_DIFF_3 + +#define NO_VAL -1 + +#define SIMD_WIDTH 16 + +extern int ksw_extend2_avx2_u8(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int is_left, int m, const int8_t *mat, int o_del, int e_del, + int o_ins, int e_ins, int a, int b, int w, int end_bonus, int zdrop, int h0, int *_qle, int *_tle, int *_gtle, int *_gscore, int *_max_off, buf_t *buf); + +int ksw_extend2_origin(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int is_left, int m, const int8_t *mat, int o_del, int e_del, + int o_ins, int e_ins, int w, int end_bonus, int zdrop, int h0, int *_qle, int *_tle, int *_gtle, int *_gscore, int *_max_off); + +static const uint16_t h_vec_int_mask[SIMD_WIDTH][SIMD_WIDTH] = { + {0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0}, + {0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff, 0xffff} +}; + +#define permute_mask _MM_SHUFFLE(0, 1, 2, 3) + +// +#define SIMD_INIT \ + int oe_del = o_del + e_del, oe_ins = o_ins + e_ins; \ + __m256i zero_vec; \ + __m256i max_vec; \ + __m256i oe_del_vec; \ + __m256i oe_ins_vec; \ + __m256i e_del_vec; \ + __m256i e_ins_vec; \ + __m256i h_vec_mask[SIMD_WIDTH]; \ + zero_vec = _mm256_setzero_si256(); \ + oe_del_vec = _mm256_set1_epi16(-oe_del); \ + oe_ins_vec = _mm256_set1_epi16(-oe_ins); \ + e_del_vec = _mm256_set1_epi16(-e_del); \ + e_ins_vec = _mm256_set1_epi16(-e_ins); \ + __m256i match_sc_vec = _mm256_set1_epi16(a); \ + __m256i mis_sc_vec = _mm256_set1_epi16(-b); \ + __m256i amb_sc_vec = _mm256_set1_epi16(-1); \ + __m256i amb_vec = _mm256_set1_epi16(4); \ + for (i=0; i 0 && m >= max) { \ + more_num++; \ + for(j=beg, i=iend; j<=end; j+=SIMD_WIDTH, i-=SIMD_WIDTH) { \ + /*calc_num += 16;*/ \ + __m256i h2_vec = _mm256_loadu_si256((__m256i*) (&hA2[j])); \ + __m256i vcmp = _mm256_cmpeq_epi16(h2_vec, max_vec); \ + uint32_t mask = _mm256_movemask_epi8(vcmp); \ + if (mask > 0) { \ + int pos = SIMD_WIDTH - 1 - (( __builtin_clz(mask)) >> 1); \ + mj = j - 1 + pos; \ + mi = i - 1 - pos; \ + /*if (m >= max) fprintf(stderr, "%d %d %d %d %d %d %d\n", iend, beg, mi, mj, mask, pos, m);*/ \ + } \ + } \ + } else not_more_num++; + +// , +#define SWAP_DATA_POINTER \ + int16_t * tmp=hA0; \ + hA0 = hA1; hA1 = hA2; hA2 = tmp; \ + tmp = eA1; eA1 = eA2; eA2 = tmp; \ + tmp = fA1; fA1 = fA2; fA2 = tmp; \ + tmp = mA1; mA1 = mA2; mA2 = tmp; + +static void write_query_target_sequence(int qlen, const uint8_t *query, int tlen, const uint8_t *target, int h0, int fnum) +{ +#ifdef DEBUG_FILE_OUTPUT + // ,query.fa,target.fa,,info.txt,h0,qlen,tlen + FILE *query_f = gfq[fnum], + *target_f = gft[fnum], + *info_f = gfi[fnum]; + const char seq_map[5] = {'A', 'C', 'G', 'T', 'N'}; + int i; + // query + for (i = 0; i < qlen; ++i) + fprintf(query_f, "%c", seq_map[query[i]]); + fprintf(query_f, "\n"); + // target + for (i = 0; i < tlen; ++i) + fprintf(target_f, "%c", seq_map[target[i]]); + fprintf(target_f, "\n"); + // + fprintf(info_f, "%-8d%-8d%-8d\n", qlen, tlen, h0); +#endif +} + +int ksw_extend2_avx2(int qlen, // query length query + const uint8_t *query, // read + int tlen, // target length reference + const uint8_t *target, // reference + int is_left, // + int m, // (5) + const int8_t *mat, // querytarget m*m + int o_del, // deletion + int e_del, // deletion extension + int o_ins, // insertion + int e_ins, // insertion extensionSIMD_BTYES + int a, // match + int b, // mismatch() + int w, // ,w =100 beg + int end_bonus, + int zdrop, + int h0, // seed(query) + int *_qle, // query + int *_tle, // reference + int *_gtle, // querytarget + int *_gscore, // query + int *_max_off, // queryreference + buf_t *buf) // +{ +// return ksw_extend2_origin(qlen, query, tlen, target, is_left, m, mat, o_del, e_del, o_ins, e_ins, w, end_bonus, zdrop, h0, _qle, _tle, _gtle, _gscore, _max_off); + +#ifdef DEBUG_FILE_OUTPUT + //fprintf(gf[0], "%d\n", qlen); +#ifdef GET_DIFFERENT_EXTENSION_LENGTH + if (qlen <= 30) { + write_query_target_sequence(qlen, query, tlen, target, h0, 0); + } else if (qlen < 60) { + write_query_target_sequence(qlen, query, tlen, target, h0, 1); + } else if (qlen < 90) { + write_query_target_sequence(qlen, query, tlen, target, h0, 2); + } else { + write_query_target_sequence(qlen, query, tlen, target, h0, 3); + } +#endif +#endif + + if (qlen * a + h0 < 255) return ksw_extend2_avx2_u8(qlen, query, tlen, target, is_left, m, mat, o_del, e_del, o_ins, e_ins, a, b, w, end_bonus, zdrop, h0, _qle, _tle, _gtle, _gscore, _max_off, buf); + + int16_t *mA,*hA, *eA, *fA, *mA1, *mA2, *hA0, *hA1, *eA1, *fA1, *hA2, *eA2, *fA2; // hA0colH,H E F M + int16_t *seq, *ref; + uint8_t *mem; + int16_t *qtmem, *vmem; + int seq_size = qlen + SIMD_WIDTH, ref_size = tlen + SIMD_WIDTH; + int i, ibeg, D, j, k, beg, end, max, max_i, max_j, max_ins, max_del, max_ie, gscore, max_off; + int Dloop = tlen + qlen; // + int span, beg1, end1; // + int col_size = qlen + 2 + SIMD_WIDTH; + int val_mem_size = (col_size * 9 * 2 + 31) >> 5 << 5; // 32 + int mem_size = (seq_size + ref_size) * 2 + val_mem_size; + + SIMD_INIT; // simd + + assert(h0 > 0); + + // allocate memory + //mem = malloc(mem_size); + + if (buf->m < mem_size) { + buf->m = mem_size; + buf->addr = realloc(buf->addr, mem_size); + } + mem = buf->addr; + + qtmem = (int16_t *)&mem[0]; + seq=&qtmem[0]; ref=&qtmem[seq_size]; + if (is_left) { + for (i=0; i>1); i+=SIMD_WIDTH) { + _mm256_storeu_si256((__m256i*)&vmem[i], zero_vec); + } + hA = &vmem[0]; + mA = &vmem[col_size * 3]; + eA = &vmem[col_size * 5]; + fA = &vmem[col_size * 7]; + + hA0 = &hA[0]; hA1 = &hA[col_size]; hA2 = &hA1[col_size]; + mA1 = &mA[0]; mA2 = &mA[col_size]; + eA1 = &eA[0]; eA2 = &eA[col_size]; + fA1 = &fA[0]; fA2 = &fA[col_size]; + + // adjust $w if it is too large + k = m * m; + // get the max score + for (i = 0, max = 0; i < k; ++i) max = max > mat[i]? max : mat[i]; + max_ins = (int)((double)(qlen * max + end_bonus - o_ins) / e_ins + 1.); + max_ins = max_ins > 1? max_ins : 1; + w = w < max_ins? w : max_ins; + max_del = (int)((double)(qlen * max + end_bonus - o_del) / e_del + 1.); + max_del = max_del > 1? max_del : 1; + w = w < max_del? w : max_del; // TODO: is this necessary? + if (tlen < qlen) w = MIN(tlen - 1, w); + + // DP loop + max = h0, max_i = max_j = -1; max_ie = -1, gscore = -1;; + max_off = 0; + beg = 1; end = qlen; + // init h0 + hA0[0] = h0; // + + if (qlen == 0 || tlen == 0) Dloop = 0; // + if (w >= qlen) { max_ie = 0; gscore = 0; } + + int m_last=0; + int iend; + +#ifdef ELIMINATE_DIFF_1 + int midx = 1, icheck = 0, checkspecial = 1; + int m3 = 0, m2 = 0, m1 = 0; + //int marr[10] = {0}; + //int marr[b]; memset(marr, 0, 4 * b); +#endif + + //int print_flag = 0; //(qlen == 64 && tlen == 123); +#ifdef DEBUG_SW_EXTEND + int dii, djj; + int16_t ins[tlen + 1][qlen + 2]; + int16_t del[tlen + 1][qlen + 2]; + int16_t score[tlen + 1][qlen + 2]; + for (dii = 0; dii <= tlen; ++dii) + { + for (djj = 0; djj <= qlen; ++djj) + { + ins[dii][djj] = del[dii][djj] = score[dii][djj] = NO_VAL; + } + } + for (dii = 1; dii <= tlen; ++dii) + { + del[dii][0] = MAX(0, h0 - o_del - e_del * dii); + score[dii][0] = del[dii][0]; + } + for (djj = 1; djj <= qlen; ++djj) + { + ins[0][djj] = MAX(0, h0 - o_ins - e_ins * djj); + score[0][djj] = ins[0][djj]; + } + ins[0][0] = del[0][0] = score[0][0] = h0; +#endif + + for (D = 1; LIKELY(D < Dloop); ++D) { + // ! tlen ,, qlen + if (D > tlen) { + span = MIN(Dloop-D, w); + beg1 = MAX(D-tlen+1, ((D-w) / 2) + 1); + } else { + span = MIN(D-1, w); + beg1 = MAX(1, ((D-w) / 2) + 1); + } + end1 = MIN(qlen, beg1+span); + + if (beg < beg1) beg = beg1; + if (end > end1) end = end1; + if (beg > end) break; // ,,hA2,hA0,bug + + iend = D - (beg - 1); // ref, + span = end - beg; + ibeg = iend - span - 1; // 0ref + + // + int m = 0, mj = -1, mi = -1; + max_vec = zero_vec; + //if (print_flag) + //{ + //fprintf(stderr, "D: %d, iend: %d, jbeg: %d\n", D, iend, beg); + //} + // + // f (insert) + if (ibeg == 0) { hA1[end] = MAX(0, h0 - (o_ins + e_ins * end)); m = hA1[end];} + // + if (beg == 1) { hA1[0] = MAX(0, h0 - (o_del + e_del * iend)); } + else if (D & 1) { + hA1[beg - 1] = 0; + hA2[beg - 1] = 0; + } + + for (j=beg, i=iend; j<=end+1-SIMD_WIDTH; j+=SIMD_WIDTH, i-=SIMD_WIDTH) { + // + SIMD_LOAD; + // seq, + SIMD_CMP_SEQ; + // + SIMD_COMPUTE; + //calc_num += 16; + // + SIMD_STORE; + } + // + if (j <= end) { + // + SIMD_LOAD; + // seq, + SIMD_CMP_SEQ; + // + SIMD_COMPUTE; + //calc_num += 16; + // + SIMD_REMOVE_EXTRA; + // + SIMD_STORE; + } + + SIMD_FIND_MAX; + +#ifdef ELIMINATE_DIFF_1 +// BSW() +#if 0 + if (hA1[0] < b && checkspecial) { + int mi; + if (hA1[0] == b - 1) { + icheck = iend + 1; + } + for (mi = 0; mi < b - 1; ++mi) { + if (midx - mi > 0) + marr[mi] = MAX(marr[mi], hA2[midx - mi]); + } + midx += 1; + if (ibeg > icheck) + { + int stopCalc = 0; + for (mi = 0; mi < b - 1; ++mi) + { + stopCalc |= !marr[mi]; + } + if (stopCalc) + break; + else + checkspecial = 0; + } + } +#else + if (hA1[0] < 4 && checkspecial) { // b == 4 + if (hA1[0] == 3) { + icheck = iend + 1; + } else if (midx == 2) { + m2 = MAX(m2, hA2[midx - 1]); + } else { + m2 = MAX(m2, hA2[midx - 1]); + m1 = MAX(m1, hA2[midx - 2]); + } + m3 = MAX(m3, hA2[midx]); + midx += 1; + if (ibeg > icheck) + { + if (!m1 || !m2 || !m3) + break; + else + checkspecial = 0; + } + + //if (print_flag) { + //fprintf(stderr, "jbeg: %d, ibeg: %d, iend: %d, icheck: %d, score: %d %d %d, j: %d\n", beg, ibeg, iend, icheck, hA2[midx + 1], hA2[midx + 2], hA2[midx + 3], midx); + //if (midx > 2) fprintf(stderr, "%d, %d, %d\n", hA2[midx-1], hA2[midx-2], hA2[midx-3]); + //fprintf(stderr, "jbeg: %d, ibeg: %d, iend: %d, icheck: %d, hA1: %d, score: %d %d %d, j: %d\n", beg, ibeg, iend, icheck, hA1[0], m1, m2, m3, midx); + //} + } +#endif +#endif + +#ifdef DEBUG_SW_EXTEND + for (djj = beg; djj <= end; ++djj) + { + dii = D - djj + 1; + ins[dii][djj] = fA2[djj]; + del[dii][djj] = eA2[djj]; + score[dii][djj] = hA2[djj]; + } + //if (print_flag) + //{ + //fprintf(stderr, "score: %d %d %d\n", hA2[beg], hA2[beg+1], hA2[beg+2]); + //} +#endif + + // j + j = end + 1; + + if (j == qlen + 1) { + max_ie = gscore > hA2[qlen] ? max_ie : ibeg; + gscore = gscore > hA2[qlen] ? gscore : hA2[qlen]; + } + if (m == 0 && m_last==0) break; // , + //if (m == 0 && m_last < 2) break; + if (m > max) { + max = m, max_i = mi, max_j = mj; + max_off = max_off > abs(mj - mi) ? max_off : abs(mj - mi); + } else if (m == max && max_i >= mi && mj > max_j) { + max_i = mi, max_j = mj; + max_off = max_off > abs(mj - mi) ? max_off : abs(mj - mi); + } + else if (zdrop > 0 && mi > -1) { + if (mi - max_i > mj - max_j) { + if (max - m - ((mi - max_i) - (mj - max_j)) * e_del > zdrop) break; + } else { + if (max - m - ((mj - max_j) - (mi - max_i)) * e_ins > zdrop) break; + } + } + + // + for (j = beg; LIKELY(j <= end); ++j) { int has_val = hA1[j-1] | hA2[j]; if (has_val) break; } + beg = j; + for (j = end+1; LIKELY(j >= beg); --j) { int has_val = hA1[j-1] | hA2[j]; if (has_val) break; else hA0[j-1]=0; } + end = j + 1 <= qlen? j + 1 : qlen; + + m_last = m; + // swap m, h, e, f + SWAP_DATA_POINTER; + } + +#ifdef DEBUG_FILE_OUTPUT +#ifdef DEBUG_SW_EXTEND + fprintf(gf[0], "qlen: %d, tlen: %d, h0: %d, w: %d, mi: %d, mj: %d, mie: %d, max_off: %d, score: %d, max: %d\n", qlen, tlen, h0, w, max_i + 1, max_j + 1, max_ie + 1, max_off, gscore, max); + fprintf(gf[1], "qlen: %d, tlen: %d, h0: %d, w: %d, mi: %d, mj: %d, mie: %d, max_off: %d, score: %d, max: %d\n", qlen, tlen, h0, w, max_i + 1, max_j + 1, max_ie + 1, max_off, gscore, max); + fprintf(gf[2], "qlen: %d, tlen: %d, h0: %d, w: %d, mi: %d, mj: %d, mie: %d, max_off: %d, score: %d, max: %d\n", qlen, tlen, h0, w, max_i + 1, max_j + 1, max_ie + 1, max_off, gscore, max); + + fprintf(gf[0], "%-4d", -1); + fprintf(gf[1], "%-4d", -1); + fprintf(gf[2], "%-4d", -1); + fprintf(gf[0], "%-4d", -1); + fprintf(gf[1], "%-4d", -1); + fprintf(gf[2], "%-4d", -1); + for (djj = 0; djj < qlen; ++djj) { + fprintf(gf[0], "%-4c", "ACGTN"[query[djj]]); + fprintf(gf[1], "%-4c", "ACGTN"[query[djj]]); + fprintf(gf[2], "%-4c", "ACGTN"[query[djj]]); + } + fprintf(gf[0], "\n"); + fprintf(gf[1], "\n"); + fprintf(gf[2], "\n"); + for (dii = 0; dii <= tlen; ++dii) + { + if (dii > 0) { + fprintf(gf[0], "%-4c", "ACGTN"[target[dii - 1]]); + fprintf(gf[1], "%-4c", "ACGTN"[target[dii - 1]]); + fprintf(gf[2], "%-4c", "ACGTN"[target[dii - 1]]); + } else { + fprintf(gf[0], "%-4d", -1); + fprintf(gf[1], "%-4d", -1); + fprintf(gf[2], "%-4d", -1); + } + for (djj = 0; djj <= qlen; ++djj) + { + fprintf(gf[0], "%-4d", score[dii][djj]); + fprintf(gf[1], "%-4d", ins[dii][djj]); + fprintf(gf[2], "%-4d", del[dii][djj]); + } + fprintf(gf[0], "\n"); + fprintf(gf[1], "\n"); + fprintf(gf[2], "\n"); + } +#endif +#endif + // if (max > h0) + // more_num++; + // else + // not_more_num++; + // free(mem); + if (_qle) *_qle = max_j + 1; + if (_tle) *_tle = max_i + 1; + if (_gtle) *_gtle = max_ie + 1; + if (_gscore) *_gscore = gscore; + if (_max_off) *_max_off = max_off; + return max; +} + +typedef struct { + int32_t h, e; +} eh_t; + +int ksw_extend2_origin(int qlen, // query length query + const uint8_t *query, // read + int tlen, // target length reference + const uint8_t *target, // reference + int is_left, // + int m, // (5) + const int8_t *mat, // querytarget m*m + int o_del, // deletion + int e_del, // deletion extension + int o_ins, // insertion + int e_ins, // insertion extension + int w, // ,w =100 beg + int end_bonus, + int zdrop, + int h0, // seed(query) + int *_qle, // query + int *_tle, // reference + int *_gtle, // querytarget + int *_gscore, // query + int *_max_off) // queryreference +{ + eh_t *eh; // score array + int8_t *qp; // query profile + int i, j, k, oe_del = o_del + e_del, oe_ins = o_ins + e_ins, beg, end, max, max_i, max_j, max_ins, max_del, max_ie, gscore, max_off; + uint8_t *qmem, *ref, *seq; + assert(h0 > 0); + // allocate memory + qp = malloc(qlen * m); + eh = calloc(qlen + 1, 8); + qmem = malloc(qlen + tlen); + seq=(uint8_t*)&qmem[0]; ref=(uint8_t*)&qmem[qlen]; + if (is_left) { + for (i=0; i oe_ins? h0 - oe_ins : 0; + for (j = 2; j <= qlen && eh[j-1].h > e_ins; ++j) + eh[j].h = eh[j-1].h - e_ins; + // adjust $w if it is too large + k = m * m; + for (i = 0, max = 0; i < k; ++i) // get the max score + max = max > mat[i]? max : mat[i]; + max_ins = (int)((double)(qlen * max + end_bonus - o_ins) / e_ins + 1.); + max_ins = max_ins > 1? max_ins : 1; + w = w < max_ins? w : max_ins; + max_del = (int)((double)(qlen * max + end_bonus - o_del) / e_del + 1.); + max_del = max_del > 1? max_del : 1; + w = w < max_del? w : max_del; // TODO: is this necessary? + //fprintf(stderr, "%d\n", w); + // DP loop + max = h0, max_i = max_j = -1; max_ie = -1, gscore = -1; + max_off = 0; + beg = 0, end = qlen; + + //int print_flag = 0; //(qlen == 116 && tlen == 241); + //fprintf(stderr, "%d %d %d\n", print_flag, qlen, tlen); +#ifdef DEBUG_SW_EXTEND + int dii, djj; + int16_t ins[tlen + 1][qlen + 2]; + int16_t del[tlen + 1][qlen + 2]; + int16_t score[tlen + 1][qlen + 2]; + for (dii = 0; dii <= tlen; ++dii) + { + for (djj = 0; djj <= qlen; ++djj) + { + ins[dii][djj] = del[dii][djj] = score[dii][djj] = NO_VAL; + } + } + for (dii = 1; dii <= tlen; ++dii) + { + del[dii][0] = MAX(0, h0 - o_del - e_del * dii); + score[dii][0] = del[dii][0]; + } + for (djj = 1; djj <= qlen; ++djj) + { + ins[0][djj] = MAX(0, h0 - o_ins - e_ins * djj); + score[0][djj] = ins[0][djj]; + } + ins[0][0] = del[0][0] = score[0][0] = h0; +#endif + +#ifdef DEBUG_FILE_OUTPUT +#ifdef COUNT_CALC_NUM + int bsw_cal_num = 0; + int real_cal_num = 0; + for (i = 0; i < tlen; ++i) + { + int beg = MAX(0, i - w); + int end = MIN(qlen, i + w + 1); + if (beg >= end) break; + bsw_cal_num += end - beg; + } + fprintf(gf[0], "start\n%d\n", bsw_cal_num); +#endif +#endif + +#ifdef ELIMINATE_DIFF_3 + int prun_end = qlen; // for test diff_3 +#endif + + for (i = 0; LIKELY(i < tlen); ++i) { + int t, f = 0, h1, m = 0, mj = -1; + int8_t *q = &qp[ref[i] * qlen]; + // apply the band and the constraint (if provided) + if (beg < i - w) beg = i - w; + if (end > i + w + 1) end = i + w + 1; + if (end > qlen) end = qlen; // + // compute the first column + if (beg == 0) { + h1 = h0 - (o_del + e_del * (i + 1)); + if (h1 < 0) h1 = 0; + } else h1 = 0; + //m = h1; // VP-BSW() + for (j = beg; LIKELY(j < end); ++j) { + //calc_num++; + +#ifdef DEBUG_FILE_OUTPUT +#ifdef COUNT_CALC_NUM + real_cal_num++; +#endif +#endif + +#ifdef DEBUG_SW_EXTEND + ins[i+1][j+1] = f; +#endif + // At the beginning of the loop: eh[j] = { H(i-1,j-1), E(i,j) }, f = F(i,j) and h1 = H(i,j-1) + // Similar to SSE2-SW, cells are computed in the following order: + // H(i,j) = max{H(i-1,j-1)+S(i,j), E(i,j), F(i,j)} + // E(i+1,j) = max{H(i,j)-gapo, E(i,j)} - gape + // F(i,j+1) = max{H(i,j)-gapo, F(i,j)} - gape + eh_t *p = &eh[j]; + int h, M = p->h, e = p->e; // get H(i-1,j-1) and E(i-1,j) + p->h = h1; // set H(i,j-1) for the next row + M = M? M + q[j] : 0;// separating H and M to disallow a cigar like "100M3I3D20M",0,swnw + h = M > e? M : e; // e and f are guaranteed to be non-negative, so h>=0 even if M<0 + h = h > f? h : f; +#ifdef ELIMINATE_DIFF_3 + if (j >= prun_end && h==0) break; // for test diff_3 +#endif + h1 = h; // save H(i,j) to h1 for the next column + +#ifdef DEBUG_SW_EXTEND + score[i+1][j+1] = h; +#endif + mj = m > h? mj : j; // record the position where max score is achieved + m = m > h? m : h; // m is stored at eh[mj+1] + t = M - oe_del; + t = t > 0? t : 0; + e -= e_del; +#ifdef DEBUG_SW_EXTEND + del[i + 1][j + 1] = e; +#endif + e = e > t? e : t; // computed E(i+1,j) + +#ifdef DEBUG_SW_EXTEND +// del[i+1][j+1] = e; +#endif + p->e = e; // save E(i+1,j) for the next row + t = M - oe_ins; + t = t > 0? t : 0; + f -= e_ins; + f = f > t? f : t; // computed F(i,j+1) + } + eh[end].h = h1; eh[end].e = 0; + if (j == qlen) { + max_ie = gscore > h1? max_ie : i; + gscore = gscore > h1? gscore : h1; + } + if (m == 0) break; + if (m > max) { + max = m, max_i = i, max_j = mj; + max_off = max_off > abs(mj - i)? max_off : abs(mj - i); + //fprintf(stderr, "%d %d %d %d\n", i, mj, max_off, m); + } else if (zdrop > 0) { + if (i - max_i > mj - max_j) { + if (max - m - ((i - max_i) - (mj - max_j)) * e_del > zdrop) break; + } else { + if (max - m - ((mj - max_j) - (i - max_i)) * e_ins > zdrop) break; + } + } + // update beg and end for the next round + for (j = beg; LIKELY(j < end) && eh[j].h == 0 && eh[j].e == 0; ++j); // f(insert score) + beg = j; + for (j = end; LIKELY(j >= beg) && eh[j].h == 0 && eh[j].e == 0; --j); +#ifdef ELIMINATE_DIFF_3 + prun_end = j + 2 < qlen ? j + 2 : qlen; end = qlen; // for test diff_3 +#else + end = j + 2 < qlen? j + 2 : qlen; +#endif + // beg = 0; end = qlen; // uncomment this line for debugging + // if (print_flag) { + // fprintf(stderr, "beg: %d; end: %d\n", beg, end); + // } + } +#ifdef DEBUG_FILE_OUTPUT +#ifdef DEBUG_SW_EXTEND + fprintf(gf[0], "qlen: %d, tlen: %d, h0: %d, w: %d, mi: %d, mj: %d, mie: %d, max_off: %d, score: %d, max: %d\n", qlen, tlen, h0, w, max_i + 1, max_j + 1, max_ie + 1, max_off, gscore, max); + fprintf(gf[1], "qlen: %d, tlen: %d, h0: %d, w: %d, mi: %d, mj: %d, mie: %d, max_off: %d, score: %d, max: %d\n", qlen, tlen, h0, w, max_i + 1, max_j + 1, max_ie + 1, max_off, gscore, max); + fprintf(gf[2], "qlen: %d, tlen: %d, h0: %d, w: %d, mi: %d, mj: %d, mie: %d, max_off: %d, score: %d, max: %d\n", qlen, tlen, h0, w, max_i + 1, max_j + 1, max_ie + 1, max_off, gscore, max); + + fprintf(gf[0], "%-4d", -1); + fprintf(gf[1], "%-4d", -1); + fprintf(gf[2], "%-4d", -1); + fprintf(gf[0], "%-4d", -1); + fprintf(gf[1], "%-4d", -1); + fprintf(gf[2], "%-4d", -1); + for (djj = 0; djj < qlen; ++djj) + { + fprintf(gf[0], "%-4c", "ACGTN"[query[djj]]); + fprintf(gf[1], "%-4c", "ACGTN"[query[djj]]); + fprintf(gf[2], "%-4c", "ACGTN"[query[djj]]); + } + fprintf(gf[0], "\n"); + fprintf(gf[1], "\n"); + fprintf(gf[2], "\n"); + for (dii = 0; dii <= tlen; ++dii) + { + if (dii > 0) + { + fprintf(gf[0], "%-4c", "ACGTN"[target[dii - 1]]); + fprintf(gf[1], "%-4c", "ACGTN"[target[dii - 1]]); + fprintf(gf[2], "%-4c", "ACGTN"[target[dii - 1]]); + } + else + { + fprintf(gf[0], "%-4d", -1); + fprintf(gf[1], "%-4d", -1); + fprintf(gf[2], "%-4d", -1); + } + for (djj = 0; djj <= qlen; ++djj) + { + fprintf(gf[0], "%-4d", score[dii][djj]); + fprintf(gf[1], "%-4d", ins[dii][djj]); + fprintf(gf[2], "%-4d", del[dii][djj]); + } + fprintf(gf[0], "\n"); + fprintf(gf[1], "\n"); + fprintf(gf[2], "\n"); + } +#endif +#endif + +#ifdef DEBUG_FILE_OUTPUT +#ifdef COUNT_CALC_NUM + fprintf(gf[0], "%d\nend\n", real_cal_num); +#endif +#endif + + free(eh); free(qp); free(qmem); + if (_qle) *_qle = max_j + 1; + if (_tle) *_tle = max_i + 1; + if (_gtle) *_gtle = max_ie + 1; + if (_gscore) *_gscore = gscore; + if (_max_off) *_max_off = max_off; + return max; +} diff --git a/ksw_extend2_avx2_u8.c b/ksw_extend2_avx2_u8.c new file mode 100644 index 0000000..45037af --- /dev/null +++ b/ksw_extend2_avx2_u8.c @@ -0,0 +1,430 @@ +#include +#include +#include +#include +#include +#include +#include "utils.h" + +#define ELIMINATE_DIFF_1 + +#define SIMD_WIDTH 32 + +static const uint8_t h_vec_int_mask[SIMD_WIDTH][SIMD_WIDTH] = { + {0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0}, + {0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff} +}; + +//static const uint8_t reverse_mask[SIMD_WIDTH] = {7,6,5,4,3,2,1,0,15,14,13,12,11,10,9,8,7,6,5,4,3,2,1,0,15,14,13,12,11,10,9,8}; +#define permute_mask _MM_SHUFFLE(0, 1, 2, 3) +//const int permute_mask = _MM_SHUFFLE(0, 1, 2, 3); +// +#define SIMD_INIT \ + int oe_del = o_del + e_del, oe_ins = o_ins + e_ins; \ + __m256i zero_vec; \ + __m256i max_vec; \ + __m256i oe_del_vec; \ + __m256i oe_ins_vec; \ + __m256i e_del_vec; \ + __m256i e_ins_vec; \ + __m256i h_vec_mask[SIMD_WIDTH]; \ + zero_vec = _mm256_setzero_si256(); \ + oe_del_vec = _mm256_set1_epi8(oe_del); \ + oe_ins_vec = _mm256_set1_epi8(oe_ins); \ + e_del_vec = _mm256_set1_epi8(e_del); \ + e_ins_vec = _mm256_set1_epi8(e_ins); \ + __m256i match_sc_vec = _mm256_set1_epi8(a); \ + __m256i mis_sc_vec = _mm256_set1_epi8(b); \ + __m256i amb_sc_vec = _mm256_set1_epi8(1); \ + __m256i amb_vec = _mm256_set1_epi8(4); \ + for (i=0; i 0 && m >= max) { \ + for(j=beg, i=iend; j<=end; j+=SIMD_WIDTH, i-=SIMD_WIDTH) { \ + __m256i h2_vec = _mm256_loadu_si256((__m256i*) (&hA2[j])); \ + __m256i vcmp = _mm256_cmpeq_epi8(h2_vec, max_vec); \ + uint32_t mask = _mm256_movemask_epi8(vcmp); \ + if (mask > 0) { \ + int pos = SIMD_WIDTH - 1 - __builtin_clz(mask); \ + mj = j - 1 + pos; \ + mi = i - 1 - pos; \ + } \ + } \ + } + +// , +#define SWAP_DATA_POINTER \ + uint8_t * tmp=hA0; \ + hA0 = hA1; hA1 = hA2; hA2 = tmp; \ + tmp = eA1; eA1 = eA2; eA2 = tmp; \ + tmp = fA1; fA1 = fA2; fA2 = tmp; \ + tmp = mA1; mA1 = mA2; mA2 = tmp; + + +int ksw_extend2_avx2_u8(int qlen, // query length query + const uint8_t *query, // read + int tlen, // target length reference + const uint8_t *target, // reference + int is_left, // + int m, // (5) + const int8_t *mat, // querytarget m*m + int o_del, // deletion + int e_del, // deletion extension + int o_ins, // insertion + int e_ins, // insertion extension + int a, // match + int b, // mismatch() + int w, // ,w =100 beg + int end_bonus, + int zdrop, + int h0, // seed(query) + int *_qle, // query + int *_tle, // reference + int *_gtle, // querytarget + int *_gscore, // query + int *_max_off, // queryreference + buf_t *buf) // +{ + uint8_t *mA,*hA, *eA, *fA, *mA1, *mA2, *hA0, *hA1, *eA1, *fA1, *hA2, *eA2, *fA2; // hA0colH,H E F M + uint8_t *seq, *ref; + uint8_t *mem, *qtmem, *vmem; + int seq_size = qlen + SIMD_WIDTH, ref_size = tlen + SIMD_WIDTH; + int i, ibeg, D, j, k, beg, end, max, max_i, max_j, max_ins, max_del, max_ie, gscore, max_off; + int Dloop = tlen + qlen; // + int span, beg1, end1; // + int col_size = qlen + 2 + SIMD_WIDTH; + int val_mem_size = (col_size * 9 + 31) >> 5 << 5; // 32 + int mem_size = seq_size + ref_size + val_mem_size; + + SIMD_INIT; // simd + + assert(h0 > 0); + + // allocate memory + //mem = malloc(mem_size); + if (buf->m < mem_size) { + buf->m = mem_size; + buf->addr = realloc(buf->addr, mem_size); + } + mem = buf->addr; + + qtmem = &mem[0]; + seq=(uint8_t*)&qtmem[0]; ref=(uint8_t*)&qtmem[seq_size]; + if (is_left) { + for (i=0; i mat[i]? max : mat[i]; + max_ins = (int)((double)(qlen * max + end_bonus - o_ins) / e_ins + 1.); + max_ins = max_ins > 1? max_ins : 1; + w = w < max_ins? w : max_ins; + max_del = (int)((double)(qlen * max + end_bonus - o_del) / e_del + 1.); + max_del = max_del > 1? max_del : 1; + w = w < max_del? w : max_del; // TODO: is this necessary? + if (tlen < qlen) w = MIN(tlen - 1, w); + + // DP loop + max = h0, max_i = max_j = -1; max_ie = -1, gscore = -1;; + max_off = 0; + beg = 1; end = qlen; + // init h0 + hA0[0] = h0; // + + if (qlen == 0 || tlen == 0) Dloop = 0; // + if (w >= qlen) { max_ie = 0; gscore = 0; } + + int m_last=0; + int iend; +#ifdef ELIMINATE_DIFF_1 + int midx = 1, icheck = 0, checkspecial = 1; + int m3 = 0, m2 = 0, m1 = 0; + // int marr[10] = {0}; + // int marr[b]; memset(marr, 0, 4 * b); +#endif + for (D = 1; LIKELY(D < Dloop); ++D) { + // ! tlen ,, qlen + if (D > tlen) { + span = MIN(Dloop-D, w); + beg1 = MAX(D-tlen+1, ((D-w) / 2) + 1); + } else { + span = MIN(D-1, w); + beg1 = MAX(1, ((D-w) / 2) + 1); + } + end1 = MIN(qlen, beg1+span); + + if (beg < beg1) beg = beg1; + if (end > end1) end = end1; + if (beg > end) break; // ,,hA2,hA0,bug + + iend = D - (beg - 1); // ref, + span = end - beg; + ibeg = iend - span - 1; // 0ref + + // + int m = 0, mj = -1, mi = -1; + max_vec = zero_vec; + + // + // f (insert) + if (ibeg == 0) { hA1[end] = MAX(0, h0 - (o_ins + e_ins * end)); m = hA1[end]; } + // + if (beg == 1) { hA1[0] = MAX(0, h0 - (o_del + e_del * iend)); } + else if (D & 1) { + hA1[beg - 1] = 0; + hA2[beg - 1] = 0; + } + + for (j=beg, i=iend; j<=end+1-SIMD_WIDTH; j+=SIMD_WIDTH, i-=SIMD_WIDTH) { + // + SIMD_LOAD; + // seq, + SIMD_CMP_SEQ; + // + SIMD_COMPUTE; + //calc_num += 32; + // + SIMD_STORE; + } + // + if (j <= end) { + // + SIMD_LOAD; + // seq, + SIMD_CMP_SEQ; + // + SIMD_COMPUTE; + //calc_num += 32; + // + SIMD_REMOVE_EXTRA; + // + SIMD_STORE; + } + + SIMD_FIND_MAX; + +#ifdef ELIMINATE_DIFF_1 +#if 0 + if (hA1[0] < b && checkspecial) { + int mi; + if (hA1[0] == b - 1) { + icheck = iend + 1; + } + for (mi = 0; mi < b - 1; ++mi) { + if (midx - mi > 0) + marr[mi] = MAX(marr[mi], hA2[midx - mi]); + } + midx += 1; + if (ibeg > icheck) + { + int stopCalc = 0; + for (mi = 0; mi < b - 1; ++mi) + { + stopCalc |= !marr[mi]; + } + if (stopCalc) + break; + else + checkspecial = 0; + } + } +#else + if (hA1[0] < 4 && checkspecial) + { // b == 4 + if (hA1[0] == 3) + { + icheck = iend + 1; + } + else if (midx == 2) + { + m2 = MAX(m2, hA2[midx - 1]); + } + else + { + m2 = MAX(m2, hA2[midx - 1]); + m1 = MAX(m1, hA2[midx - 2]); + } + m3 = MAX(m3, hA2[midx]); + midx += 1; + if (ibeg > icheck) + { + if (!m1 || !m2 || !m3) + break; + else + checkspecial = 0; + } + } +#endif +#endif + + // j + j = end + 1; + + if (j == qlen + 1) { + max_ie = gscore > hA2[qlen] ? max_ie : ibeg; + gscore = gscore > hA2[qlen] ? gscore : hA2[qlen]; + } + if (m == 0 && m_last==0) break; // , + if (m > max) { + max = m, max_i = mi, max_j = mj; + max_off = max_off > abs(mj - mi)? max_off : abs(mj - mi); + } + else if (m == max && max_i >= mi && mj > max_j) { + max_i = mi, max_j = mj; + max_off = max_off > abs(mj - mi) ? max_off : abs(mj - mi); + } + else if (zdrop > 0 && mi > -1) { + if (mi - max_i > mj - max_j) { + if (max - m - ((mi - max_i) - (mj - max_j)) * e_del > zdrop) break; + } else { + if (max - m - ((mj - max_j) - (mi - max_i)) * e_ins > zdrop) break; + } + } + + // + for (j = beg; LIKELY(j <= end); ++j) { int has_val = hA1[j-1] | hA2[j]; if (has_val) break; } + beg = j; + for (j = end+1; LIKELY(j >= beg); --j) { int has_val = hA1[j-1] | hA2[j]; if (has_val) break; else hA0[j-1]=0; } + end = j + 1 <= qlen? j + 1 : qlen; + + m_last = m; + // swap m, h, e, f + SWAP_DATA_POINTER; + } + + //free(mem); + if (_qle) *_qle = max_j + 1; + if (_tle) *_tle = max_i + 1; + if (_gtle) *_gtle = max_ie + 1; + if (_gscore) *_gscore = gscore; + if (_max_off) *_max_off = max_off; + return max; +} diff --git a/kthread.c b/kthread.c new file mode 100644 index 0000000..780de19 --- /dev/null +++ b/kthread.c @@ -0,0 +1,147 @@ +#include +#include +#include +#include + +/************ + * kt_for() * + ************/ + +struct kt_for_t; + +typedef struct { + struct kt_for_t *t; + long i; +} ktf_worker_t; + +typedef struct kt_for_t { + int n_threads; + long n; + ktf_worker_t *w; + void (*func)(void*,long,int); + void *data; +} kt_for_t; + +static inline long steal_work(kt_for_t *t) +{ + int i, min_i = -1; + long k, min = LONG_MAX; + for (i = 0; i < t->n_threads; ++i) + if (min > t->w[i].i) min = t->w[i].i, min_i = i; + k = __sync_fetch_and_add(&t->w[min_i].i, t->n_threads); + return k >= t->n? -1 : k; +} + +static void *ktf_worker(void *data) +{ + ktf_worker_t *w = (ktf_worker_t*)data; + long i; + for (;;) { + i = __sync_fetch_and_add(&w->i, w->t->n_threads); + if (i >= w->t->n) break; + w->t->func(w->t->data, i, w - w->t->w); + } + while ((i = steal_work(w->t)) >= 0) + w->t->func(w->t->data, i, w - w->t->w); + pthread_exit(0); +} + +void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n) +{ + int i; + kt_for_t t; + pthread_t *tid; + t.func = func, t.data = data, t.n_threads = n_threads, t.n = n; + t.w = (ktf_worker_t*)alloca(n_threads * sizeof(ktf_worker_t)); + tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t)); + for (i = 0; i < n_threads; ++i) + t.w[i].t = &t, t.w[i].i = i; + for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]); + for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0); +} + +/***************** + * kt_pipeline() * + *****************/ + +struct ktp_t; + +typedef struct { + struct ktp_t *pl; + int64_t index; + int step; + void *data; +} ktp_worker_t; + +typedef struct ktp_t { + void *shared; + void *(*func)(void*, int, void*); + int64_t index; + int n_workers, n_steps; + ktp_worker_t *workers; + pthread_mutex_t mutex; + pthread_cond_t cv; +} ktp_t; + +static void *ktp_worker(void *data) +{ + ktp_worker_t *w = (ktp_worker_t*)data; + ktp_t *p = w->pl; + while (w->step < p->n_steps) { + // test whether we can kick off the job with this worker + pthread_mutex_lock(&p->mutex); + for (;;) { + int i; + // test whether another worker is doing the same step + for (i = 0; i < p->n_workers; ++i) { + if (w == &p->workers[i]) continue; // ignore itself + if (p->workers[i].step <= w->step && p->workers[i].index < w->index) + break; + } + if (i == p->n_workers) break; // no workers with smaller indices are doing w->step or the previous steps + pthread_cond_wait(&p->cv, &p->mutex); + } + pthread_mutex_unlock(&p->mutex); + + // working on w->step + w->data = p->func(p->shared, w->step, w->step? w->data : 0); // for the first step, input is NULL + + // update step and let other workers know + pthread_mutex_lock(&p->mutex); + w->step = w->step == p->n_steps - 1 || w->data? (w->step + 1) % p->n_steps : p->n_steps; + if (w->step == 0) w->index = p->index++; + pthread_cond_broadcast(&p->cv); + pthread_mutex_unlock(&p->mutex); + } + pthread_exit(0); +} + +void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_data, int n_steps) +{ + ktp_t aux; + pthread_t *tid; + int i; + + if (n_threads < 1) n_threads = 1; + aux.n_workers = n_threads; + aux.n_steps = n_steps; + aux.func = func; + aux.shared = shared_data; + aux.index = 0; + pthread_mutex_init(&aux.mutex, 0); + pthread_cond_init(&aux.cv, 0); + + aux.workers = (ktp_worker_t*)alloca(n_threads * sizeof(ktp_worker_t)); + for (i = 0; i < n_threads; ++i) { + ktp_worker_t *w = &aux.workers[i]; + w->step = 0; w->pl = &aux; w->data = 0; + w->index = aux.index++; + } + + tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t)); + for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]); + for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0); + + pthread_mutex_destroy(&aux.mutex); + pthread_cond_destroy(&aux.cv); +} diff --git a/kvec.h b/kvec.h new file mode 100644 index 0000000..83ad483 --- /dev/null +++ b/kvec.h @@ -0,0 +1,94 @@ +/* The MIT License + + Copyright (c) 2008, by Attractive Chaos + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ + +/* + An example: + +#include "kvec.h" +int main() { + kvec_t(int) array; + kv_init(array); + kv_push(int, array, 10); // append + kv_a(int, array, 20) = 5; // dynamic + kv_A(array, 20) = 4; // static + kv_destroy(array); + return 0; +} +*/ + +/* + 2008-09-22 (0.1.0): + + * The initial version. + +*/ + +#ifndef AC_KVEC_H +#define AC_KVEC_H + +#include + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#define kv_roundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) + +#define kvec_t(type) struct { size_t n, m; type *a; } +#define kv_init(v) ((v).n = (v).m = 0, (v).a = 0) +#define kv_destroy(v) free((v).a) +#define kv_A(v, i) ((v).a[(i)]) +#define kv_pop(v) ((v).a[--(v).n]) +#define kv_size(v) ((v).n) +#define kv_max(v) ((v).m) + +#define kv_resize(type, v, s) ((v).m = (s), (v).a = (type*)realloc((v).a, sizeof(type) * (v).m)) + +#define kv_copy(type, v1, v0) do { \ + if ((v1).m < (v0).n) kv_resize(type, v1, (v0).n); \ + (v1).n = (v0).n; \ + memcpy((v1).a, (v0).a, sizeof(type) * (v0).n); \ + } while (0) \ + +#define kv_push(type, v, x) do { \ + if ((v).n == (v).m) { \ + (v).m = (v).m? (v).m<<1 : 2; \ + (v).a = (type*)realloc((v).a, sizeof(type) * (v).m); \ + } \ + (v).a[(v).n++] = (x); \ + } while (0) + +#define kv_pushp(type, v) ((((v).n == (v).m)? \ + ((v).m = ((v).m? (v).m<<1 : 2), \ + (v).a = (type*)realloc((v).a, sizeof(type) * (v).m), 0) \ + : 0), &(v).a[(v).n++]) + +#define kv_a(type, v, i) (((v).m <= (size_t)(i)? \ + ((v).m = (v).n = (i) + 1, kv_roundup32((v).m), \ + (v).a = (type*)realloc((v).a, sizeof(type) * (v).m), 0) \ + : (v).n <= (size_t)(i)? (v).n = (i) + 1 \ + : 0), (v).a[(i)]) + +#endif diff --git a/main.c b/main.c new file mode 100644 index 0000000..32ea59b --- /dev/null +++ b/main.c @@ -0,0 +1,142 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#include +#include +#include "kstring.h" +#include "utils.h" + +#ifndef PACKAGE_VERSION +#define PACKAGE_VERSION "v1.0-0.7.17" +#endif + +int bwa_fa2pac(int argc, char *argv[]); +int bwa_pac2bwt(int argc, char *argv[]); +int bwa_pac2bref(int argc, char *argv[]); +int bwa_bwtupdate(int argc, char *argv[]); +int bwa_bwt2sa(int argc, char *argv[]); +int bwa_bwt2bytesa(int argc, char *argv[]); +int bwa_bwt2fmt(int argc, char *argv[]); +int bwa_build_kmer(int argc, char *argv[]); +int bwa_index(int argc, char *argv[]); +int bwt_bwtgen_main(int argc, char *argv[]); + +int bwa_aln(int argc, char *argv[]); +int bwa_sai2sam_se(int argc, char *argv[]); +int bwa_sai2sam_pe(int argc, char *argv[]); + +int bwa_bwtsw2(int argc, char *argv[]); + +int main_fastmap(int argc, char *argv[]); +int main_mem(int argc, char *argv[]); +int main_shm(int argc, char *argv[]); + +int main_pemerge(int argc, char *argv[]); +int main_maxk(int argc, char *argv[]); + +static int usage() +{ + fprintf(stderr, "\n"); + fprintf(stderr, "Program: fast-bwa-mem (alignment via Burrows-Wheeler transformation)\n"); + fprintf(stderr, "Version: %s\n", PACKAGE_VERSION); + fprintf(stderr, "Contact: Heng Li (for bwa)\n\n"); + fprintf(stderr, "Usage: fastbwa [options]\n\n"); + fprintf(stderr, "Command: index index sequences in the FASTA format\n"); + fprintf(stderr, " mem BWA-MEM algorithm\n"); + fprintf(stderr, " fastmap identify super-maximal exact matches\n"); + fprintf(stderr, " pemerge merge overlapping paired ends (EXPERIMENTAL)\n"); + fprintf(stderr, " aln gapped/ungapped alignment\n"); + fprintf(stderr, " samse generate alignment (single ended)\n"); + fprintf(stderr, " sampe generate alignment (paired ended)\n"); + fprintf(stderr, " bwasw BWA-SW for long queries (DEPRECATED)\n"); + fprintf(stderr, "\n"); + fprintf(stderr, " shm manage indices in shared memory\n"); + fprintf(stderr, " fa2pac convert FASTA to PAC format\n"); + fprintf(stderr, " pac2bwt generate BWT from PAC\n"); + fprintf(stderr, " pac2bwtgen alternative algorithm for generating BWT\n"); + fprintf(stderr, " pac2bref generate binary reference from PAC\n"); + fprintf(stderr, " bwtupdate update .bwt to the new format\n"); + fprintf(stderr, " bwt2sa generate SA from BWT and Occ\n"); + fprintf(stderr, " bwt2bytesa generate SA(using byte array) from BWT and Occ\n"); + fprintf(stderr, " bwt2fmt generate FMT-Index from BWT\n"); + fprintf(stderr, " buildkmer generate kmer index from FMT\n"); + fprintf(stderr, "\n"); + fprintf(stderr, +"Note: To use BWA, you need to first index the genome with `bwa index'.\n" +" There are three alignment algorithms in BWA: `mem', `bwasw', and\n" +" `aln/samse/sampe'. If you are not sure which to use, try `bwa mem'\n" +" first. Please `man ./bwa.1' for the manual.\n\n"); + return 1; +} + +int main(int argc, char *argv[]) +{ + extern char *bwa_pg; + int i, ret; + double t_real; + kstring_t pg = {0,0,0}; + t_real = realtime(); + ksprintf(&pg, "@PG\tID:bwa\tPN:bwa\tVN:%s\tCL:%s", PACKAGE_VERSION, argv[0]); + for (i = 1; i < argc; ++i) ksprintf(&pg, " %s", argv[i]); + bwa_pg = pg.s; + if (argc < 2) return usage(); + if (strcmp(argv[1], "fa2pac") == 0) ret = bwa_fa2pac(argc-1, argv+1); + else if (strcmp(argv[1], "pac2bwt") == 0) ret = bwa_pac2bwt(argc-1, argv+1); + else if (strcmp(argv[1], "pac2bwtgen") == 0) ret = bwt_bwtgen_main(argc-1, argv+1); + else if (strcmp(argv[1], "pac2bref") == 0) ret = bwa_pac2bref(argc-1, argv+1); + else if (strcmp(argv[1], "bwtupdate") == 0) ret = bwa_bwtupdate(argc-1, argv+1); + else if (strcmp(argv[1], "bwt2sa") == 0) ret = bwa_bwt2sa(argc-1, argv+1); + else if (strcmp(argv[1], "bwt2bytesa") == 0) ret = bwa_bwt2bytesa(argc-1, argv+1); + else if (strcmp(argv[1], "bwt2fmt") == 0) ret = bwa_bwt2fmt(argc-1, argv+1); + else if (strcmp(argv[1], "buildkmer") == 0) ret = bwa_build_kmer(argc - 1, argv + 1); + else if (strcmp(argv[1], "index") == 0) ret = bwa_index(argc-1, argv+1); + else if (strcmp(argv[1], "aln") == 0) ret = bwa_aln(argc-1, argv+1); + else if (strcmp(argv[1], "samse") == 0) ret = bwa_sai2sam_se(argc-1, argv+1); + else if (strcmp(argv[1], "sampe") == 0) ret = bwa_sai2sam_pe(argc-1, argv+1); + else if (strcmp(argv[1], "bwtsw2") == 0) ret = bwa_bwtsw2(argc-1, argv+1); + else if (strcmp(argv[1], "dbwtsw") == 0) ret = bwa_bwtsw2(argc-1, argv+1); + else if (strcmp(argv[1], "bwasw") == 0) ret = bwa_bwtsw2(argc-1, argv+1); + else if (strcmp(argv[1], "fastmap") == 0) ret = main_fastmap(argc-1, argv+1); + else if (strcmp(argv[1], "mem") == 0) ret = main_mem(argc-1, argv+1); + else if (strcmp(argv[1], "shm") == 0) ret = main_shm(argc-1, argv+1); + else if (strcmp(argv[1], "pemerge") == 0) ret = main_pemerge(argc-1, argv+1); + else if (strcmp(argv[1], "maxk") == 0) ret = main_maxk(argc-1, argv+1); + else { + fprintf(stderr, "[main] unrecognized command '%s'\n", argv[1]); + return 1; + } + err_fflush(stdout); + err_fclose(stdout); + if (ret == 0) { + fprintf(stderr, "[%s] Version: %s\n", __func__, PACKAGE_VERSION); + fprintf(stderr, "[%s] CMD:", __func__); + for (i = 0; i < argc; ++i) + fprintf(stderr, " %s", argv[i]); + fprintf(stderr, "\n[%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - t_real, cputime()); + } + free(bwa_pg); + return ret; +} diff --git a/malloc_wrap.c b/malloc_wrap.c new file mode 100644 index 0000000..6165e04 --- /dev/null +++ b/malloc_wrap.c @@ -0,0 +1,57 @@ +#include +#include +#include +#include +#ifdef USE_MALLOC_WRAPPERS +/* Don't wrap ourselves */ +# undef USE_MALLOC_WRAPPERS +#endif +#include "malloc_wrap.h" + +void *wrap_calloc(size_t nmemb, size_t size, + const char *file, unsigned int line, const char *func) { + void *p = calloc(nmemb, size); + if (NULL == p) { + fprintf(stderr, + "[%s] Failed to allocate %zu bytes at %s line %u: %s\n", + func, nmemb * size, file, line, strerror(errno)); + exit(EXIT_FAILURE); + } + return p; +} + +void *wrap_malloc(size_t size, + const char *file, unsigned int line, const char *func) { + void *p = malloc(size); + if (NULL == p) { + fprintf(stderr, + "[%s] Failed to allocate %zu bytes at %s line %u: %s\n", + func, size, file, line, strerror(errno)); + exit(EXIT_FAILURE); + } + return p; +} + +void *wrap_realloc(void *ptr, size_t size, + const char *file, unsigned int line, const char *func) { + void *p = realloc(ptr, size); + if (NULL == p) { + fprintf(stderr, + "[%s] Failed to allocate %zu bytes at %s line %u: %s\n", + func, size, file, line, strerror(errno)); + exit(EXIT_FAILURE); + } + return p; +} + +char *wrap_strdup(const char *s, + const char *file, unsigned int line, const char *func) { + char *p = strdup(s); + if (NULL == p) { + fprintf(stderr, + "[%s] Failed to allocate %zu bytes at %s line %u: %s\n", + func, strlen(s), file, line, strerror(errno)); + exit(EXIT_FAILURE); + } + return p; +} diff --git a/malloc_wrap.h b/malloc_wrap.h new file mode 100644 index 0000000..a55876a --- /dev/null +++ b/malloc_wrap.h @@ -0,0 +1,47 @@ +#ifndef MALLOC_WRAP_H +#define MALLOC_WRAP_H + +#include /* Avoid breaking the usual definitions */ +#include + +#ifdef __cplusplus +extern "C" { +#endif + + void *wrap_calloc(size_t nmemb, size_t size, + const char *file, unsigned int line, const char *func); + void *wrap_malloc(size_t size, + const char *file, unsigned int line, const char *func); + void *wrap_realloc(void *ptr, size_t size, + const char *file, unsigned int line, const char *func); + char *wrap_strdup(const char *s, + const char *file, unsigned int line, const char *func); + +#ifdef __cplusplus +} +#endif + +#ifdef USE_MALLOC_WRAPPERS +# ifdef calloc +# undef calloc +# endif +# define calloc(n, s) wrap_calloc( (n), (s), __FILE__, __LINE__, __func__) + +# ifdef malloc +# undef malloc +# endif +# define malloc(s) wrap_malloc( (s), __FILE__, __LINE__, __func__) + +# ifdef realloc +# undef realloc +# endif +# define realloc(p, s) wrap_realloc((p), (s), __FILE__, __LINE__, __func__) + +# ifdef strdup +# undef strdup +# endif +# define strdup(s) wrap_strdup( (s), __FILE__, __LINE__, __func__) + +#endif /* USE_MALLOC_WRAPPERS */ + +#endif /* MALLOC_WRAP_H */ diff --git a/maxk.c b/maxk.c new file mode 100644 index 0000000..8c86dc7 --- /dev/null +++ b/maxk.c @@ -0,0 +1,67 @@ +#include +#include +#include +#include +#include +#include +#include "bwa.h" +#include "bwamem.h" +#include "kseq.h" +KSEQ_DECLARE(gzFile) + +int main_maxk(int argc, char *argv[]) +{ + int i, c, self = 0, max_len = 0; + uint8_t *cnt = 0; + uint64_t hist[256]; + bwt_t *bwt; + kseq_t *ks; + smem_i *itr; + gzFile fp; + + while ((c = getopt(argc, argv, "s")) >= 0) { + if (c == 's') self = 1; + } + if (optind + 2 > argc) { + fprintf(stderr, "Usage: fastbwa maxk [-s] \n"); + return 1; + } + fp = strcmp(argv[optind+1], "-")? gzopen(argv[optind+1], "rb") : gzdopen(fileno(stdin), "rb"); + ks = kseq_init(fp); + bwt = bwt_restore_bwt(argv[optind]); + itr = smem_itr_init(bwt); + if (self) smem_config(itr, 2, INT_MAX, 0); + memset(hist, 0, 8 * 256); + + while (kseq_read(ks) >= 0) { + const bwtintv_v *a; + if (ks->seq.l > max_len) { + max_len = ks->seq.l; + kroundup32(max_len); + cnt = realloc(cnt, max_len); + } + memset(cnt, 0, ks->seq.l); + for (i = 0; i < ks->seq.l; ++i) + ks->seq.s[i] = nst_nt4_table[(int)ks->seq.s[i]]; + smem_set_query(itr, ks->seq.l, (uint8_t*)ks->seq.s); + while ((a = smem_next(itr)) != 0) { + for (i = 0; i < a->n; ++i) { + bwtintv_t *p = &a->a[i]; + int j, l, start = p->info>>32, end = (uint32_t)p->info; + l = end - start < 255? end - start : 255; + for (j = start; j < end; ++j) + cnt[j] = cnt[j] > l? cnt[j] : l; + } + } + for (i = 0; i < ks->seq.l; ++i) ++hist[cnt[i]]; + } + for (i = 0; i < 256; ++i) + printf("%d\t%lld\n", i, (long long)hist[i]); + free(cnt); + + smem_itr_destroy(itr); + bwt_destroy(bwt); + kseq_destroy(ks); + gzclose(fp); + return 0; +} diff --git a/neon_sse.h b/neon_sse.h new file mode 100644 index 0000000..bd55f8b --- /dev/null +++ b/neon_sse.h @@ -0,0 +1,33 @@ +#ifndef NEON_SSE_H +#define NEON_SSE_H + +#include + +typedef uint8x16_t __m128i; + +static inline __m128i _mm_load_si128(const __m128i *ptr) { return vld1q_u8((const uint8_t *) ptr); } +static inline __m128i _mm_set1_epi32(int n) { return vreinterpretq_u8_s32(vdupq_n_s32(n)); } +static inline void _mm_store_si128(__m128i *ptr, __m128i a) { vst1q_u8((uint8_t *) ptr, a); } + +static inline __m128i _mm_adds_epu8(__m128i a, __m128i b) { return vqaddq_u8(a, b); } +static inline __m128i _mm_max_epu8(__m128i a, __m128i b) { return vmaxq_u8(a, b); } +static inline __m128i _mm_set1_epi8(int8_t n) { return vreinterpretq_u8_s8(vdupq_n_s8(n)); } +static inline __m128i _mm_subs_epu8(__m128i a, __m128i b) { return vqsubq_u8(a, b); } + +#define M128I(a) vreinterpretq_u8_s16((a)) +#define UM128I(a) vreinterpretq_u8_u16((a)) +#define S16(a) vreinterpretq_s16_u8((a)) +#define U16(a) vreinterpretq_u16_u8((a)) + +static inline __m128i _mm_adds_epi16(__m128i a, __m128i b) { return M128I(vqaddq_s16(S16(a), S16(b))); } +static inline __m128i _mm_cmpgt_epi16(__m128i a, __m128i b) { return UM128I(vcgtq_s16(S16(a), S16(b))); } +static inline __m128i _mm_max_epi16(__m128i a, __m128i b) { return M128I(vmaxq_s16(S16(a), S16(b))); } +static inline __m128i _mm_set1_epi16(int16_t n) { return vreinterpretq_u8_s16(vdupq_n_s16(n)); } +static inline __m128i _mm_subs_epu16(__m128i a, __m128i b) { return UM128I(vqsubq_u16(U16(a), U16(b))); } + +#undef M128I +#undef UM128I +#undef S16 +#undef U16 + +#endif diff --git a/pemerge.c b/pemerge.c new file mode 100644 index 0000000..ca42aca --- /dev/null +++ b/pemerge.c @@ -0,0 +1,293 @@ +#include +#include +#include +#include +#include +#include +#include +#include "ksw.h" +#include "kseq.h" +#include "kstring.h" +#include "bwa.h" +#include "utils.h" +KSEQ_DECLARE(gzFile) + +#ifdef USE_MALLOC_WRAPPERS +# include "malloc_wrap.h" +#endif + +#define MAX_SCORE_RATIO 0.9f +#define MAX_ERR 8 + +static const char *err_msg[MAX_ERR+1] = { + "successful merges", + "low-scoring pairs", + "pairs where the best SW alignment is not an overlap (long left end)", + "pairs where the best SW alignment is not an overlap (long right end)", + "pairs with large 2nd best SW score", + "pairs with gapped overlap", + "pairs where the end-to-end alignment is inconsistent with SW", + "pairs potentially with tandem overlaps", + "pairs with high sum of errors" +}; + +typedef struct { + int a, b, q, r, w; + int q_def, q_thres; + int T; + int chunk_size; + int n_threads; + int flag; // bit 1: print merged; 2: print unmerged + int8_t mat[25]; +} pem_opt_t; + +pem_opt_t *pem_opt_init() +{ + pem_opt_t *opt; + opt = calloc(1, sizeof(pem_opt_t)); + opt->a = 5; opt->b = 4; opt->q = 2, opt->r = 17; opt->w = 20; + opt->T = opt->a * 10; + opt->q_def = 20; + opt->q_thres = 70; + opt->chunk_size = 10000000; + opt->n_threads = 1; + opt->flag = 3; + bwa_fill_scmat(opt->a, opt->b, opt->mat); + return opt; +} + +int bwa_pemerge(const pem_opt_t *opt, bseq1_t x[2]) +{ + uint8_t *s[2], *q[2], *seq, *qual; + int i, xtra, l, l_seq, sum_q, ret = 0; + kswr_t r; + + s[0] = malloc(x[0].l_seq); q[0] = malloc(x[0].l_seq); + s[1] = malloc(x[1].l_seq); q[1] = malloc(x[1].l_seq); + for (i = 0; i < x[0].l_seq; ++i) { + int c = x[0].seq[i]; + s[0][i] = c < 0 || c > 127? 4 : c <= 4? c : nst_nt4_table[c]; + q[0][i] = x[0].qual? x[0].qual[i] - 33 : opt->q_def; + } + for (i = 0; i < x[1].l_seq; ++i) { + int c = x[1].seq[x[1].l_seq - 1 - i]; + c = c < 0 || c > 127? 4 : c < 4? c : nst_nt4_table[c]; + s[1][i] = c < 4? 3 - c : 4; + q[1][i] = x[1].qual? x[1].qual[x[1].l_seq - 1 - i] - 33 : opt->q_def; + } + + xtra = KSW_XSTART | KSW_XSUBO; + r = ksw_align(x[1].l_seq, s[1], x[0].l_seq, s[0], 5, opt->mat, opt->q, opt->r, xtra, 0); + ++r.qe; ++r.te; // change to the half-close-half-open coordinates + + if (r.score < opt->T) { ret = -1; goto pem_ret; } // poor alignment + if (r.tb < r.qb) { ret = -2; goto pem_ret; } // no enough space for the left end + if (x[0].l_seq - r.te > x[1].l_seq - r.qe) { ret = -3; goto pem_ret; } // no enough space for the right end + if ((double)r.score2 / r.score >= MAX_SCORE_RATIO) { ret = -4; goto pem_ret; } // the second best score is too large + if (r.qe - r.qb != r.te - r.tb) { ret = -5; goto pem_ret; } // we do not allow gaps + + { // test tandem match; O(n^2) + int max_m, max_m2, min_l, max_l, max_l2; + max_m = max_m2 = 0; max_l = max_l2 = 0; + min_l = x[0].l_seq < x[1].l_seq? x[0].l_seq : x[1].l_seq; + for (l = 1; l < min_l; ++l) { + int m = 0, o = x[0].l_seq - l; + uint8_t *s0o = &s[0][o], *s1 = s[1]; + for (i = 0; i < l; ++i) // TODO: in principle, this can be done with SSE2. It is the bottleneck! + m += opt->mat[(s1[i]<<2) + s1[i] + s0o[i]]; // equivalent to s[1][i]*5 + s[0][o+i] + if (m > max_m) max_m2 = max_m, max_m = m, max_l2 = max_l, max_l = l; + else if (m > max_m2) max_m2 = m, max_l2 = l; + } + if (max_m < opt->T || max_l != x[0].l_seq - (r.tb - r.qb)) { ret = -6; goto pem_ret; } + if (max_l2 < max_l && max_m2 >= opt->T && (double)(max_m2 + (max_l - max_l2) * opt->a) / max_m >= MAX_SCORE_RATIO) { + ret = -7; goto pem_ret; + } + if (max_l2 > max_l && (double)max_m2 / max_m >= MAX_SCORE_RATIO) { ret = -7; goto pem_ret; } + } + + l = x[0].l_seq - (r.tb - r.qb); // length to merge + l_seq = x[0].l_seq + x[1].l_seq - l; + seq = malloc(l_seq + 1); + qual = malloc(l_seq + 1); + memcpy(seq, s[0], x[0].l_seq); memcpy(seq + x[0].l_seq, &s[1][l], x[1].l_seq - l); + memcpy(qual, q[0], x[0].l_seq); memcpy(qual + x[0].l_seq, &q[1][l], x[1].l_seq - l); + for (i = 0, sum_q = 0; i < l; ++i) { + int k = x[0].l_seq - l + i; + if (s[0][k] == 4) { // ambiguous + seq[k] = s[1][i]; + qual[k] = q[1][i]; + } else if (s[1][i] == 4) { // do nothing + } else if (s[0][k] == s[1][i]) { + qual[k] = qual[k] > q[1][i]? qual[k] : q[1][i]; + } else { // s[0][k] != s[1][i] and neither is N + int qq = q[0][k] < q[1][i]? q[0][k] : q[1][i]; + sum_q += qq >= 3? qq<<1 : 1; + seq[k] = q[0][k] > q[1][i]? s[0][k] : s[1][i]; + qual[k] = abs((int)q[0][k] - (int)q[1][i]); + } + } + if (sum_q>>1 > opt->q_thres) { // too many mismatches + free(seq); free(qual); + ret = -8; goto pem_ret; + } + + for (i = 0; i < l_seq; ++i) seq[i] = "ACGTN"[(int)seq[i]], qual[i] += 33; + seq[l_seq] = qual[l_seq] = 0; + + free(x[1].name); free(x[1].seq); free(x[1].qual); free(x[1].comment); + memset(&x[1], 0, sizeof(bseq1_t)); + free(x[0].seq); free(x[0].qual); + x[0].l_seq = l_seq; x[0].seq = (char*)seq; x[0].qual = (char*)qual; + +pem_ret: + free(s[0]); free(s[1]); free(q[0]); free(q[1]); + return ret; +} + +static inline void print_bseq(const bseq1_t *s, int rn) +{ + err_putchar(s->qual? '@' : '>'); + err_fputs(s->name, stdout); + if (rn == 1 || rn == 2) { + err_putchar('/'); err_putchar('0' + rn); err_putchar('\n'); + } else err_puts(" merged"); + err_puts(s->seq); + if (s->qual) { + err_puts("+"); err_puts(s->qual); + } +} + +typedef struct { + int n, start; + bseq1_t *seqs; + int64_t cnt[MAX_ERR+1]; + const pem_opt_t *opt; +} worker_t; + +void *worker(void *data) +{ + worker_t *w = (worker_t*)data; + int i; + for (i = w->start; i < w->n>>1; i += w->opt->n_threads) + ++w->cnt[-bwa_pemerge(w->opt, &w->seqs[i<<1])]; + return 0; +} + +static void process_seqs(const pem_opt_t *opt, int n_, bseq1_t *seqs, int64_t cnt[MAX_ERR+1]) +{ + int i, j, n = n_>>1<<1; + worker_t *w; + + w = calloc(opt->n_threads, sizeof(worker_t)); + for (i = 0; i < opt->n_threads; ++i) { + worker_t *p = &w[i]; + p->start = i; p->n = n; + p->opt = opt; + p->seqs = seqs; + } + if (opt->n_threads == 1) { + worker(w); + } else { + pthread_t *tid; + tid = (pthread_t*)calloc(opt->n_threads, sizeof(pthread_t)); + for (i = 0; i < opt->n_threads; ++i) pthread_create(&tid[i], 0, worker, &w[i]); + for (i = 0; i < opt->n_threads; ++i) pthread_join(tid[i], 0); + free(tid); + } + for (i = 0; i < opt->n_threads; ++i) { + worker_t *p = &w[i]; + for (j = 0; j <= MAX_ERR; ++j) cnt[j] += p->cnt[j]; + } + free(w); + for (i = 0; i < n>>1; ++i) { + if (seqs[i<<1|1].l_seq != 0) { + if (opt->flag&2) { + print_bseq(&seqs[i<<1|0], 1); + print_bseq(&seqs[i<<1|1], 2); + } + } else if (opt->flag&1) + print_bseq(&seqs[i<<1|0], 0); + } + for (i = 0; i < n; ++i) { + bseq1_t *s = &seqs[i]; + free(s->name); free(s->seq); free(s->qual); free(s->comment); + } +} + +int main_pemerge(int argc, char *argv[]) +{ + int c, flag = 0, i, n, m = 0, min_ovlp = 10; + int64_t cnt[MAX_ERR + 1], seq_size = 0; + bseq1_t *bseq = 0; + gzFile fp, fp2 = 0; + kseq_t *ks, *ks2 = 0; + pem_opt_t *opt; + + opt = pem_opt_init(); + while ((c = getopt(argc, argv, "muQ:t:T:")) >= 0) { + if (c == 'm') flag |= 1; + else if (c == 'u') flag |= 2; + else if (c == 'Q') opt->q_thres = atoi(optarg); + else if (c == 't') opt->n_threads = atoi(optarg); + else if (c == 'T') min_ovlp = atoi(optarg); + else return 1; + } + if (flag == 0) flag = 3; + opt->flag = flag; + opt->T = opt->a * min_ovlp; + + if (optind == argc) { + fprintf(stderr, "\n"); + fprintf(stderr, "Usage: fastbwa pemerge [-mu] [read2.fq]\n\n"); + fprintf(stderr, "Options: -m output merged reads only\n"); + fprintf(stderr, " -u output unmerged reads only\n"); + fprintf(stderr, " -t INT number of threads [%d]\n", opt->n_threads); + fprintf(stderr, " -T INT minimum end overlap [%d]\n", min_ovlp); + fprintf(stderr, " -Q INT max sum of errors [%d]\n", opt->q_thres); + fprintf(stderr, "\n"); + free(opt); + return 1; + } + + fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r"); + if (NULL == fp) { + fprintf(stderr, "Couldn't open %s : %s\n", + strcmp(argv[optind], "-") ? argv[optind] : "stdin", + errno ? strerror(errno) : "Out of memory"); + exit(EXIT_FAILURE); + } + ks = kseq_init(fp); + if (optind + 1 < argc) { + fp2 = strcmp(argv[optind+1], "-")? gzopen(argv[optind+1], "r") : gzdopen(fileno(stdin), "r"); + if (NULL == fp) { + fprintf(stderr, "Couldn't open %s : %s\n", + strcmp(argv[optind+1], "-") ? argv[optind+1] : "stdin", + errno ? strerror(errno) : "Out of memory"); + exit(EXIT_FAILURE); + } + ks2 = kseq_init(fp2); + } + + memset(cnt, 0, 8 * (MAX_ERR+1)); + bseq_read(opt->n_threads * opt->chunk_size, &n, ks, ks2, 1, &seq_size, &m, &bseq); + while (n > 0) { + process_seqs(opt, n, bseq, cnt); + bseq_read(opt->n_threads * opt->chunk_size, &n, ks, ks2, 1, &seq_size, &m, &bseq); + } + if (bseq != 0) free(bseq); + + fprintf(stderr, "%12ld %s\n", (long)cnt[0], err_msg[0]); + for (i = 1; i <= MAX_ERR; ++i) + fprintf(stderr, "%12ld %s\n", (long)cnt[i], err_msg[i]); + kseq_destroy(ks); + err_gzclose(fp); + if (ks2) { + kseq_destroy(ks2); + err_gzclose(fp2); + } + free(opt); + + err_fflush(stdout); + + return 0; +} diff --git a/profiling.c b/profiling.c new file mode 100644 index 0000000..4c0d7f3 --- /dev/null +++ b/profiling.c @@ -0,0 +1,130 @@ +/* +Description: profiling related data + +Copyright : All right reserved by + +Author : +Date : 2024/04/06 +*/ + +#include +#include "utils.h" +#include "profiling.h" + +uint64_t calc_num = 0; +uint64_t more_num = 0; +uint64_t not_more_num = 0; + +#ifdef SHOW_PERF +uint64_t tprof[LIM_THREAD_PROF_TYPE][LIM_THREAD] = {0}; +uint64_t proc_freq = 1000; +uint64_t gprof[LIM_GLOBAL_PROF_TYPE] = {0}; +#endif + +#ifdef SHOW_DATA_PERF +/* +tdat[0]: read nums +tdat[1]: seed-1 full match nums +*/ +int64_t tdat[LIM_THREAD_DATA_TYPE][LIM_THREAD] = {0}; +int64_t gdat[LIM_GLOBAL_DATA_TYPE] = {0}; + +#endif + +int find_opt(uint64_t *a, int len, double *max, double *min, double *avg) +{ + int i = 0; + uint64_t umax = 0, umin = UINT64_MAX, uavg = 0; + for (i = 0; i < len; i++) + { + if (a[i] > umax) umax = a[i]; + if (a[i] < umin) umin = a[i]; + uavg += a[i]; + } + *avg = uavg * 1.0 / len / proc_freq; + *max = umax * 1.0 / proc_freq; + *min = umin * 1.0 / proc_freq; + return 1; +} + +int display_stats(int nthreads) +{ +#ifdef SHOW_PERF + double avg, max, min; + + fprintf(stderr, "[steps in main_mem]\n"); + fprintf(stderr, "time_parse_arg: %0.2lf s\n", gprof[G_PREPARE] * 1.0 / proc_freq); + fprintf(stderr, "time_load_idx: %0.2lf s\n", gprof[G_LOAD_IDX] * 1.0 / proc_freq); + fprintf(stderr, "time_pipeline: %0.2lf s\n", gprof[G_PIPELINE] * 1.0 / proc_freq); + fprintf(stderr, "time_all: %0.2lf s\n", gprof[G_ALL] * 1.0 / proc_freq); + + fprintf(stderr, "\n[steps in pipeline]\n"); + fprintf(stderr, "time_read: %0.2lf s\n", gprof[G_READ] * 1.0 / proc_freq); + fprintf(stderr, "time_compute: %0.2lf s\n", gprof[G_COMPUTE] * 1.0 / proc_freq); + fprintf(stderr, "time_write: %0.2lf s\n", gprof[G_WRITE] * 1.0 / proc_freq); + + fprintf(stderr, "\n[steps in mem_process_seqs]\n"); + fprintf(stderr, "time_mem_prepare: %0.2lf s\n", gprof[G_MEM_PREPARE] * 1.0 / proc_freq); + fprintf(stderr, "time_mem_kernel: %0.2lf s\n", gprof[G_MEM_KERNEL] * 1.0 / proc_freq); + fprintf(stderr, "time_mem_pestat: %0.2lf s\n", gprof[G_MEM_PESTAT] * 1.0 / proc_freq); + fprintf(stderr, "time_mem_sam: %0.2lf s\n", gprof[G_MEM_SAM] * 1.0 / proc_freq); + + fprintf(stderr, "\n[steps in kernel]\n"); + find_opt(tprof[T_SEED_ALL], nthreads, &max, &min, &avg); + fprintf(stderr, "time_seed_all: %0.2lf (%0.2lf, %0.2lf) s\n", avg, max, min); + find_opt(tprof[T_CHAIN_ALL], nthreads, &max, &min, &avg); + fprintf(stderr, "time_chain_all: %0.2lf (%0.2lf, %0.2lf) s\n", avg, max, min); + find_opt(tprof[T_ALN_ALL], nthreads, &max, &min, &avg); + fprintf(stderr, "time_aln_all: %0.2lf (%0.2lf, %0.2lf) s\n", avg, max, min); + find_opt(tprof[T_INS_SIZE], nthreads, &max, &min, &avg); + fprintf(stderr, "time_ins_size_all: %0.2lf (%0.2lf, %0.2lf) s\n", avg, max, min); + + fprintf(stderr, "\n[steps in seeding]\n"); + find_opt(tprof[T_SEED_1], nthreads, &max, &min, &avg); + fprintf(stderr, "time_seed_1: %0.2lf s\n", avg); + find_opt(tprof[T_SEED_2], nthreads, &max, &min, &avg); + fprintf(stderr, "time_seed_2: %0.2lf s\n", avg); + find_opt(tprof[T_SEED_3], nthreads, &max, &min, &avg); + fprintf(stderr, "time_seed_3: %0.2lf s\n", avg); + + fprintf(stderr, "\n[steps in chain]\n"); + find_opt(tprof[T_GEN_CHAIN], nthreads, &max, &min, &avg); + fprintf(stderr, "time_gen_chain: %0.2lf s\n", avg); + find_opt(tprof[T_FLT_CHAIN], nthreads, &max, &min, &avg); + fprintf(stderr, "time_flt_chain: %0.2lf s\n", avg); + find_opt(tprof[T_FLT_CHANNED_SEEDS], nthreads, &max, &min, &avg); + fprintf(stderr, "time_flt_chained_seeds: %0.2lf s\n", avg); + find_opt(tprof[T_SAL], nthreads, &max, &min, &avg); + fprintf(stderr, "time_sal: %0.2lf s\n", avg); + find_opt(tprof[T_BSW], nthreads, &max, &min, &avg); + fprintf(stderr, "time_bsw: %0.2lf s\n", avg); + + fprintf(stderr, "\n[steps in gen sam]\n"); + find_opt(tprof[T_SAM_MATESW], nthreads, &max, &min, &avg); + fprintf(stderr, "time_mate_sw: %0.2lf s\n", avg); + find_opt(tprof[T_SAM_REG2ALN], nthreads, &max, &min, &avg); + fprintf(stderr, "time_reg2aln: %0.2lf s\n", avg); + + fprintf(stderr, "time_ksw_loop: %0.2lf s\n", gprof[G_KSW_LOOP] * 1.0 / proc_freq); + fprintf(stderr, "time_ksw_end_loop: %0.2lf s\n", gprof[G_KSW_END_LOOP] * 1.0 / proc_freq); + + fprintf(stderr, "parse seq: %0.2lf s\n", gprof[G_parse_seq] * 1.0 / proc_freq); + fprintf(stderr, "read seq: %0.2lf s\n", gprof[G_read_seq] * 1.0 / proc_freq); + +// fprintf(stderr, "read_wait_1: %0.2lf s\n", gprof[G_read_wait_1] * 1.0 / proc_freq); +// fprintf(stderr, "read_wait_2: %0.2lf s\n", gprof[G_read_wait_2] * 1.0 / proc_freq); +// fprintf(stderr, "comp_wait_1: %0.2lf s\n", gprof[G_comp_wait_1] * 1.0 / proc_freq); +// fprintf(stderr, "comp_wait_2: %0.2lf s\n", gprof[G_comp_wait_2] * 1.0 / proc_freq); +// fprintf(stderr, "write_wait_1: %0.2lf s\n", gprof[G_write_wait_1] * 1.0 / proc_freq); +// fprintf(stderr, "write_wait_2: %0.2lf s\n", gprof[G_write_wait_2] * 1.0 / proc_freq); + + // fprintf(stderr, "real_cal num: %ld\n", calc_num); + + fprintf(stderr, "more num: %ld\n", more_num); + fprintf(stderr, "no more num: %ld\n", not_more_num); + + fprintf(stderr, "\n"); +#endif + + return 1; +} \ No newline at end of file diff --git a/profiling.h b/profiling.h new file mode 100644 index 0000000..dd4f826 --- /dev/null +++ b/profiling.h @@ -0,0 +1,104 @@ +/* +Description: profiling related data + +Copyright : All right reserved by + +Author : +Date : 2024/04/06 +*/ +#ifndef PROFILING_H_ +#define PROFILING_H_ + +#include + +#define USE_RDTSC 1 + +#define LIM_THREAD 128 +#define LIM_THREAD_PROF_TYPE 128 +#define LIM_GLOBAL_PROF_TYPE 128 +#define LIM_THREAD_DATA_TYPE 128 +#define LIM_GLOBAL_DATA_TYPE 128 + +#ifdef SHOW_PERF +extern uint64_t proc_freq; +extern uint64_t tprof[LIM_THREAD_PROF_TYPE][LIM_THREAD]; +extern uint64_t gprof[LIM_GLOBAL_PROF_TYPE]; +#endif + +#ifdef SHOW_DATA_PERF +extern int64_t tdat[LIM_THREAD_DATA_TYPE][LIM_THREAD]; +extern int64_t gdat[LIM_GLOBAL_DATA_TYPE]; +#endif + +#ifdef SHOW_PERF +#if USE_RDTSC +#define PROF_START(tmp_time) const uint64_t prof_tmp_##tmp_time = __rdtsc() +#define PROF_END(result, tmp_time) result += __rdtsc() - prof_tmp_##tmp_time +#else +#define PROF_START(tmp_time) uint64_t prof_tmp_##tmp_time = realtime_msec() +#define PROF_END(result, tmp_time) result += realtime_msec() - prof_tmp_##tmp_time +#endif +#else +#define PROF_START(tmp_time) +#define PROF_END(result, tmp_time) +#endif + +extern uint64_t calc_num; +extern uint64_t more_num; +extern uint64_t not_more_num; + +// GLOBAL +enum { + G_ALL = 0, + G_PIPELINE, + G_READ, + G_WRITE, + G_COMPUTE, + G_PREPARE, + G_LOAD_IDX, + G_MEM_PREPARE, + G_MEM_KERNEL, + G_MEM_PESTAT, + G_MEM_SAM, + G_KSW_LOOP, + G_KSW_END_LOOP, + G_parse_seq, + G_read_seq, + G_read_wait_1, + G_read_wait_2, + G_comp_wait_1, + G_comp_wait_2, + G_write_wait_1, + G_write_wait_2 +}; + +// THREAD +enum +{ + T_SEED_ALL = 0, + T_CHAIN_ALL, + T_ALN_ALL, + T_INS_SIZE, + T_SEED_1, + T_SEED_2, + T_SEED_3, + T_SAL, + T_GEN_CHAIN, + T_FLT_CHAIN, + T_FLT_CHANNED_SEEDS, + T_READ_SA, + T_BSW, + T_BSW_ALL, + T_SAM_MATESW, + T_SAM_REG2ALN, + T_SEED_3_1, + T_SEED_3_2, + T_SEED_3_3, + T_SEEDING, + T_EXTENSION, + T_SAM, +}; + +int display_stats(int); + +#endif \ No newline at end of file diff --git a/qualfa2fq.pl b/qualfa2fq.pl new file mode 100755 index 0000000..2fcb280 --- /dev/null +++ b/qualfa2fq.pl @@ -0,0 +1,27 @@ +#!/usr/bin/env perl + +use strict; +use warnings; + +die("Usage: qualfa2fq.pl \n") if (@ARGV != 2); + +my ($fhs, $fhq, $q); +open($fhs, ($ARGV[0] =~ /\.gz$/)? "gzip -dc $ARGV[0] |" : $ARGV[0]) || die; +open($fhq, ($ARGV[1] =~ /\.gz$/)? "gzip -dc $ARGV[1] |" : $ARGV[1]) || die; + +$/ = ">"; <$fhs>; <$fhq>; $/ = "\n"; +while (<$fhs>) { + $q = <$fhq>; + print "\@$_"; + $/ = ">"; + $_ = <$fhs>; $q = <$fhq>; + chomp; chomp($q); + $q =~ s/\s*(\d+)\s*/chr($1+33)/eg; + print $_, "+\n"; + for (my $i = 0; $i < length($q); $i += 60) { + print substr($q, $i, 60), "\n"; + } + $/ = "\n"; +} + +close($fhs); close($fhq); diff --git a/rle.c b/rle.c new file mode 100644 index 0000000..221e1cd --- /dev/null +++ b/rle.c @@ -0,0 +1,191 @@ +#include +#include +#include +#include +#include "rle.h" + +const uint8_t rle_auxtab[8] = { 0x01, 0x11, 0x21, 0x31, 0x03, 0x13, 0x07, 0x17 }; + +// insert symbol $a after $x symbols in $str; marginal counts added to $cnt; returns the size increase +int rle_insert_cached(uint8_t *block, int64_t x, int a, int64_t rl, int64_t cnt[6], const int64_t ec[6], int *beg, int64_t bc[6]) +{ + uint16_t *nptr = (uint16_t*)block; + int diff; + + block += 2; // skip the first 2 counting bytes + if (*nptr == 0) { + memset(cnt, 0, 48); + diff = rle_enc1(block, a, rl); + } else { + uint8_t *p, *end = block + *nptr, *q; + int64_t pre, z, l = 0, tot, beg_l; + int c = -1, n_bytes = 0, n_bytes2, t = 0; + uint8_t tmp[24]; + beg_l = bc[0] + bc[1] + bc[2] + bc[3] + bc[4] + bc[5]; + tot = ec[0] + ec[1] + ec[2] + ec[3] + ec[4] + ec[5]; + if (x < beg_l) { + beg_l = 0, *beg = 0; + memset(bc, 0, 48); + } + if (x == beg_l) { + p = q = block + (*beg); z = beg_l; + memcpy(cnt, bc, 48); + } else if (x - beg_l <= ((tot-beg_l)>>1) + ((tot-beg_l)>>3)) { // forward + z = beg_l; p = block + (*beg); + memcpy(cnt, bc, 48); + while (z < x) { + rle_dec1(p, c, l); + z += l; cnt[c] += l; + } + for (q = p - 1; *q>>6 == 2; --q); + } else { // backward + memcpy(cnt, ec, 48); + z = tot; p = end; + while (z >= x) { + --p; + if (*p>>6 != 2) { + l |= *p>>7? (int64_t)rle_auxtab[*p>>3&7]>>4 << t : *p>>3; + z -= l; cnt[*p&7] -= l; + l = 0; t = 0; + } else { + l |= (*p&0x3fL) << t; + t += 6; + } + } + q = p; + rle_dec1(p, c, l); + z += l; cnt[c] += l; + } + *beg = q - block; + memcpy(bc, cnt, 48); + bc[c] -= l; + n_bytes = p - q; + if (x == z && a != c && p < end) { // then try the next run + int tc; + int64_t tl; + q = p; + rle_dec1(q, tc, tl); + if (a == tc) + c = tc, n_bytes = q - p, l = tl, z += l, p = q, cnt[tc] += tl; + } + if (z != x) cnt[c] -= z - x; + pre = x - (z - l); p -= n_bytes; + if (a == c) { // insert to the same run + n_bytes2 = rle_enc1(tmp, c, l + rl); + } else if (x == z) { // at the end; append to the existing run + p += n_bytes; n_bytes = 0; + n_bytes2 = rle_enc1(tmp, a, rl); + } else { // break the current run + n_bytes2 = rle_enc1(tmp, c, pre); + n_bytes2 += rle_enc1(tmp + n_bytes2, a, rl); + n_bytes2 += rle_enc1(tmp + n_bytes2, c, l - pre); + } + if (n_bytes != n_bytes2 && end != p + n_bytes) // size changed + memmove(p + n_bytes2, p + n_bytes, end - p - n_bytes); + memcpy(p, tmp, n_bytes2); + diff = n_bytes2 - n_bytes; + } + return (*nptr += diff); +} + +int rle_insert(uint8_t *block, int64_t x, int a, int64_t rl, int64_t cnt[6], const int64_t ec[6]) +{ + int beg = 0; + int64_t bc[6]; + memset(bc, 0, 48); + return rle_insert_cached(block, x, a, rl, cnt, ec, &beg, bc); +} + +void rle_split(uint8_t *block, uint8_t *new_block) +{ + int n = *(uint16_t*)block; + uint8_t *end = block + 2 + n, *q = block + 2 + (n>>1); + while (*q>>6 == 2) --q; + memcpy(new_block + 2, q, end - q); + *(uint16_t*)new_block = end - q; + *(uint16_t*)block = q - block - 2; +} + +void rle_count(const uint8_t *block, int64_t cnt[6]) +{ + const uint8_t *q = block + 2, *end = q + *(uint16_t*)block; + while (q < end) { + int c; + int64_t l; + rle_dec1(q, c, l); + cnt[c] += l; + } +} + +void rle_print(const uint8_t *block, int expand) +{ + const uint16_t *p = (const uint16_t*)block; + const uint8_t *q = block + 2, *end = block + 2 + *p; + while (q < end) { + int c; + int64_t l, x; + rle_dec1(q, c, l); + if (expand) for (x = 0; x < l; ++x) putchar("$ACGTN"[c]); + else printf("%c%ld", "$ACGTN"[c], (long)l); + } + putchar('\n'); +} + +void rle_rank2a(const uint8_t *block, int64_t x, int64_t y, int64_t *cx, int64_t *cy, const int64_t ec[6]) +{ + int a; + int64_t tot, cnt[6]; + const uint8_t *p; + + y = y >= x? y : x; + tot = ec[0] + ec[1] + ec[2] + ec[3] + ec[4] + ec[5]; + if (tot == 0) return; + if (x <= (tot - y) + (tot>>3)) { + int c = 0; + int64_t l, z = 0; + memset(cnt, 0, 48); + p = block + 2; + while (z < x) { + rle_dec1(p, c, l); + z += l; cnt[c] += l; + } + for (a = 0; a != 6; ++a) cx[a] += cnt[a]; + cx[c] -= z - x; + if (cy) { + while (z < y) { + rle_dec1(p, c, l); + z += l; cnt[c] += l; + } + for (a = 0; a != 6; ++a) cy[a] += cnt[a]; + cy[c] -= z - y; + } + } else { +#define move_backward(_x) \ + while (z >= (_x)) { \ + --p; \ + if (*p>>6 != 2) { \ + l |= *p>>7? (int64_t)rle_auxtab[*p>>3&7]>>4 << t : *p>>3; \ + z -= l; cnt[*p&7] -= l; \ + l = 0; t = 0; \ + } else { \ + l |= (*p&0x3fL) << t; \ + t += 6; \ + } \ + } \ + + int t = 0; + int64_t l = 0, z = tot; + memcpy(cnt, ec, 48); + p = block + 2 + *(const uint16_t*)block; + if (cy) { + move_backward(y) + for (a = 0; a != 6; ++a) cy[a] += cnt[a]; + cy[*p&7] += y - z; + } + move_backward(x) + for (a = 0; a != 6; ++a) cx[a] += cnt[a]; + cx[*p&7] += x - z; + +#undef move_backward + } +} diff --git a/rle.h b/rle.h new file mode 100644 index 0000000..40d9a02 --- /dev/null +++ b/rle.h @@ -0,0 +1,72 @@ +#ifndef RLE6_H_ +#define RLE6_H_ + +#include +#include "utils.h" +#ifdef __cplusplus + +extern "C" { +#endif + + int rle_insert_cached(uint8_t *block, int64_t x, int a, int64_t rl, int64_t cnt[6], const int64_t ec[6], int *beg, int64_t bc[6]); + int rle_insert(uint8_t *block, int64_t x, int a, int64_t rl, int64_t cnt[6], const int64_t end_cnt[6]); + void rle_split(uint8_t *block, uint8_t *new_block); + void rle_count(const uint8_t *block, int64_t cnt[6]); + void rle_rank2a(const uint8_t *block, int64_t x, int64_t y, int64_t *cx, int64_t *cy, const int64_t ec[6]); + #define rle_rank1a(block, x, cx, ec) rle_rank2a(block, x, -1, cx, 0, ec) + + void rle_print(const uint8_t *block, int expand); + +#ifdef __cplusplus +} +#endif + +/****************** + *** 43+3 codec *** + ******************/ + +extern const uint8_t rle_auxtab[8]; + +#define RLE_MIN_SPACE 18 +#define rle_nptr(block) ((uint16_t*)(block)) + +// decode one run (c,l) and move the pointer p +#define rle_dec1(p, c, l) do { \ + (c) = *(p) & 7; \ + if (LIKELY((*(p)&0x80) == 0)) { \ + (l) = *(p)++ >> 3; \ + } else if (LIKELY(*(p)>>5 == 6)) { \ + (l) = (*(p)&0x18L)<<3L | ((p)[1]&0x3fL); \ + (p) += 2; \ + } else { \ + int n = ((*(p)&0x10) >> 2) + 4; \ + (l) = *(p)++ >> 3 & 1; \ + while (--n) (l) = ((l)<<6) | (*(p)++&0x3fL); \ + } \ + } while (0) + +static inline int rle_enc1(uint8_t *p, int c, int64_t l) +{ + if (l < 1LL<<4) { + *p = l << 3 | c; + return 1; + } else if (l < 1LL<<8) { + *p = 0xC0 | l >> 6 << 3 | c; + p[1] = 0x80 | (l & 0x3f); + return 2; + } else if (l < 1LL<<19) { + *p = 0xE0 | l >> 18 << 3 | c; + p[1] = 0x80 | (l >> 12 & 0x3f); + p[2] = 0x80 | (l >> 6 & 0x3f); + p[3] = 0x80 | (l & 0x3f); + return 4; + } else { + int i, shift = 36; + *p = 0xF0 | l >> 42 << 3 | c; + for (i = 1; i < 8; ++i, shift -= 6) + p[i] = 0x80 | (l>>shift & 0x3f); + return 8; + } +} + +#endif diff --git a/rope.c b/rope.c new file mode 100644 index 0000000..3d85981 --- /dev/null +++ b/rope.c @@ -0,0 +1,318 @@ +#include +#include +#include +#include +#include +#include "rle.h" +#include "rope.h" + +/******************* + *** Memory Pool *** + *******************/ + +#define MP_CHUNK_SIZE 0x100000 // 1MB per chunk + +typedef struct { // memory pool for fast and compact memory allocation (no free) + int size, i, n_elems; + int64_t top, max; + uint8_t **mem; +} mempool_t; + +static mempool_t *mp_init(int size) +{ + mempool_t *mp; + mp = calloc(1, sizeof(mempool_t)); + mp->size = size; + mp->i = mp->n_elems = MP_CHUNK_SIZE / size; + mp->top = -1; + return mp; +} + +static void mp_destroy(mempool_t *mp) +{ + int64_t i; + for (i = 0; i <= mp->top; ++i) free(mp->mem[i]); + free(mp->mem); free(mp); +} + +static inline void *mp_alloc(mempool_t *mp) +{ + if (mp->i == mp->n_elems) { + if (++mp->top == mp->max) { + mp->max = mp->max? mp->max<<1 : 1; + mp->mem = realloc(mp->mem, sizeof(void*) * mp->max); + } + mp->mem[mp->top] = calloc(mp->n_elems, mp->size); + mp->i = 0; + } + return mp->mem[mp->top] + (mp->i++) * mp->size; +} + +/*************** + *** B+ rope *** + ***************/ + +rope_t *rope_init(int max_nodes, int block_len) +{ + rope_t *rope; + rope = calloc(1, sizeof(rope_t)); + if (block_len < 32) block_len = 32; + rope->max_nodes = (max_nodes+ 1)>>1<<1; + rope->block_len = (block_len + 7) >> 3 << 3; + rope->node = mp_init(sizeof(rpnode_t) * rope->max_nodes); + rope->leaf = mp_init(rope->block_len); + rope->root = mp_alloc(rope->node); + rope->root->n = 1; + rope->root->is_bottom = 1; + rope->root->p = mp_alloc(rope->leaf); + return rope; +} + +void rope_destroy(rope_t *rope) +{ + mp_destroy(rope->node); + mp_destroy(rope->leaf); + free(rope); +} + +static inline rpnode_t *split_node(rope_t *rope, rpnode_t *u, rpnode_t *v) +{ // split $v's child. $u is the first node in the bucket. $v and $u are in the same bucket. IMPORTANT: there is always enough room in $u + int j, i = v - u; + rpnode_t *w; // $w is the sibling of $v + if (u == 0) { // only happens at the root; add a new root + u = v = mp_alloc(rope->node); + v->n = 1; v->p = rope->root; // the new root has the old root as the only child + memcpy(v->c, rope->c, 48); + for (j = 0; j < 6; ++j) v->l += v->c[j]; + rope->root = v; + } + if (i != u->n - 1) // then make room for a new node + memmove(v + 2, v + 1, sizeof(rpnode_t) * (u->n - i - 1)); + ++u->n; w = v + 1; + memset(w, 0, sizeof(rpnode_t)); + w->p = mp_alloc(u->is_bottom? rope->leaf : rope->node); + if (u->is_bottom) { // we are at the bottom level; $v->p is a string instead of a node + uint8_t *p = (uint8_t*)v->p, *q = (uint8_t*)w->p; + rle_split(p, q); + rle_count(q, w->c); + } else { // $v->p is a node, not a string + rpnode_t *p = v->p, *q = w->p; // $v and $w are siblings and thus $p and $q are cousins + p->n -= rope->max_nodes>>1; + memcpy(q, p + p->n, sizeof(rpnode_t) * (rope->max_nodes>>1)); + q->n = rope->max_nodes>>1; // NB: this line must below memcpy() as $q->n and $q->is_bottom are modified by memcpy() + q->is_bottom = p->is_bottom; + for (i = 0; i < q->n; ++i) + for (j = 0; j < 6; ++j) + w->c[j] += q[i].c[j]; + } + for (j = 0; j < 6; ++j) // compute $w->l and update $v->c + w->l += w->c[j], v->c[j] -= w->c[j]; + v->l -= w->l; // update $v->c + return v; +} + +int64_t rope_insert_run(rope_t *rope, int64_t x, int a, int64_t rl, rpcache_t *cache) +{ // insert $a after $x symbols in $rope and the returns rank(a, x) + rpnode_t *u = 0, *v = 0, *p = rope->root; // $v is the parent of $p; $u and $v are at the same level and $u is the first node in the bucket + int64_t y = 0, z = 0, cnt[6]; + int n_runs; + do { // top-down update. Searching and node splitting are done together in one pass. + if (p->n == rope->max_nodes) { // node is full; split + v = split_node(rope, u, v); // $v points to the parent of $p; when a new root is added, $v points to the root + if (y + v->l < x) // if $v is not long enough after the split, we need to move both $p and its parent $v + y += v->l, z += v->c[a], ++v, p = v->p; + } + u = p; + if (v && x - y > v->l>>1) { // then search backwardly for the right node to descend + p += p->n - 1; y += v->l; z += v->c[a]; + for (; y >= x; --p) y -= p->l, z -= p->c[a]; + ++p; + } else for (; y + p->l < x; ++p) y += p->l, z += p->c[a]; // then search forwardly + assert(p - u < u->n); + if (v) v->c[a] += rl, v->l += rl; // we should not change p->c[a] because this may cause troubles when p's child is split + v = p; p = p->p; // descend + } while (!u->is_bottom); + rope->c[a] += rl; // $rope->c should be updated after the loop as adding a new root needs the old $rope->c counts + if (cache) { + if (cache->p != (uint8_t*)p) memset(cache, 0, sizeof(rpcache_t)); + n_runs = rle_insert_cached((uint8_t*)p, x - y, a, rl, cnt, v->c, &cache->beg, cache->bc); + cache->p = (uint8_t*)p; + } else n_runs = rle_insert((uint8_t*)p, x - y, a, rl, cnt, v->c); + z += cnt[a]; + v->c[a] += rl; v->l += rl; // this should be after rle_insert(); otherwise rle_insert() won't work + if (n_runs + RLE_MIN_SPACE > rope->block_len) { + split_node(rope, u, v); + if (cache) memset(cache, 0, sizeof(rpcache_t)); + } + return z; +} + +static rpnode_t *rope_count_to_leaf(const rope_t *rope, int64_t x, int64_t cx[6], int64_t *rest) +{ + rpnode_t *u, *v = 0, *p = rope->root; + int64_t y = 0; + int a; + + memset(cx, 0, 48); + do { + u = p; + if (v && x - y > v->l>>1) { + p += p->n - 1; y += v->l; + for (a = 0; a != 6; ++a) cx[a] += v->c[a]; + for (; y >= x; --p) { + y -= p->l; + for (a = 0; a != 6; ++a) cx[a] -= p->c[a]; + } + ++p; + } else { + for (; y + p->l < x; ++p) { + y += p->l; + for (a = 0; a != 6; ++a) cx[a] += p->c[a]; + } + } + v = p; p = p->p; + } while (!u->is_bottom); + *rest = x - y; + return v; +} + +void rope_rank2a(const rope_t *rope, int64_t x, int64_t y, int64_t *cx, int64_t *cy) +{ + rpnode_t *v; + int64_t rest; + v = rope_count_to_leaf(rope, x, cx, &rest); + if (y < x || cy == 0) { + rle_rank1a((const uint8_t*)v->p, rest, cx, v->c); + } else if (rest + (y - x) <= v->l) { + memcpy(cy, cx, 48); + rle_rank2a((const uint8_t*)v->p, rest, rest + (y - x), cx, cy, v->c); + } else { + rle_rank1a((const uint8_t*)v->p, rest, cx, v->c); + v = rope_count_to_leaf(rope, y, cy, &rest); + rle_rank1a((const uint8_t*)v->p, rest, cy, v->c); + } +} + +/********************* + *** Rope iterator *** + *********************/ + +void rope_itr_first(const rope_t *rope, rpitr_t *i) +{ + memset(i, 0, sizeof(rpitr_t)); + i->rope = rope; + for (i->pa[i->d] = rope->root; !i->pa[i->d]->is_bottom;) // descend to the leftmost leaf + ++i->d, i->pa[i->d] = i->pa[i->d - 1]->p; +} + +const uint8_t *rope_itr_next_block(rpitr_t *i) +{ + const uint8_t *ret; + assert(i->d < ROPE_MAX_DEPTH); // a B+ tree should not be that tall + if (i->d < 0) return 0; + ret = (uint8_t*)i->pa[i->d][i->ia[i->d]].p; + while (i->d >= 0 && ++i->ia[i->d] == i->pa[i->d]->n) i->ia[i->d--] = 0; // backtracking + if (i->d >= 0) + while (!i->pa[i->d]->is_bottom) // descend to the leftmost leaf + ++i->d, i->pa[i->d] = i->pa[i->d - 1][i->ia[i->d - 1]].p; + return ret; +} + +/*********** + *** I/O *** + ***********/ + +void rope_print_node(const rpnode_t *p) +{ + if (p->is_bottom) { + int i; + putchar('('); + for (i = 0; i < p->n; ++i) { + uint8_t *block = (uint8_t*)p[i].p; + const uint8_t *q = block + 2, *end = block + 2 + *rle_nptr(block); + if (i) putchar(','); + while (q < end) { + int c = 0; + int64_t j, l; + rle_dec1(q, c, l); + for (j = 0; j < l; ++j) putchar("$ACGTN"[c]); + } + } + putchar(')'); + } else { + int i; + putchar('('); + for (i = 0; i < p->n; ++i) { + if (i) putchar(','); + rope_print_node(p[i].p); + } + putchar(')'); + } +} + +void rope_dump_node(const rpnode_t *p, FILE *fp) +{ + int16_t i, n = p->n; + uint8_t is_bottom = p->is_bottom; + fwrite(&is_bottom, 1, 1, fp); + fwrite(&n, 2, 1, fp); + if (is_bottom) { + for (i = 0; i < n; ++i) { + fwrite(p[i].c, 8, 6, fp); + fwrite(p[i].p, 1, *rle_nptr(p[i].p) + 2, fp); + } + } else { + for (i = 0; i < p->n; ++i) + rope_dump_node(p[i].p, fp); + } +} + +void rope_dump(const rope_t *r, FILE *fp) +{ + fwrite(&r->max_nodes, 4, 1, fp); + fwrite(&r->block_len, 4, 1, fp); + rope_dump_node(r->root, fp); +} + +rpnode_t *rope_restore_node(const rope_t *r, FILE *fp, int64_t c[6]) +{ + uint8_t is_bottom, a; + int16_t i, n; + rpnode_t *p; + fread(&is_bottom, 1, 1, fp); + fread(&n, 2, 1, fp); + p = mp_alloc(r->node); + p->is_bottom = is_bottom, p->n = n; + if (is_bottom) { + for (i = 0; i < n; ++i) { + uint16_t *q; + p[i].p = mp_alloc(r->leaf); + q = rle_nptr(p[i].p); + fread(p[i].c, 8, 6, fp); + fread(q, 2, 1, fp); + fread(q + 1, 1, *q, fp); + } + } else { + for (i = 0; i < n; ++i) + p[i].p = rope_restore_node(r, fp, p[i].c); + } + memset(c, 0, 48); + for (i = 0; i < n; ++i) { + p[i].l = 0; + for (a = 0; a < 6; ++a) + c[a] += p[i].c[a], p[i].l += p[i].c[a]; + } + return p; +} + +rope_t *rope_restore(FILE *fp) +{ + rope_t *r; + r = calloc(1, sizeof(rope_t)); + fread(&r->max_nodes, 4, 1, fp); + fread(&r->block_len, 4, 1, fp); + r->node = mp_init(sizeof(rpnode_t) * r->max_nodes); + r->leaf = mp_init(r->block_len); + r->root = rope_restore_node(r, fp, r->c); + return r; +} diff --git a/rope.h b/rope.h new file mode 100644 index 0000000..843a408 --- /dev/null +++ b/rope.h @@ -0,0 +1,58 @@ +#ifndef ROPE_H_ +#define ROPE_H_ + +#include +#include + +#define ROPE_MAX_DEPTH 80 +#define ROPE_DEF_MAX_NODES 64 +#define ROPE_DEF_BLOCK_LEN 512 + +typedef struct rpnode_s { + struct rpnode_s *p; // child; at the bottom level, $p points to a string with the first 2 bytes giving the number of runs (#runs) + uint64_t l:54, n:9, is_bottom:1; // $n and $is_bottom are only set for the first node in a bucket + int64_t c[6]; // marginal counts +} rpnode_t; + +typedef struct { + int32_t max_nodes, block_len; // both MUST BE even numbers + int64_t c[6]; // marginal counts + rpnode_t *root; + void *node, *leaf; // memory pool +} rope_t; + +typedef struct { + const rope_t *rope; // the rope + const rpnode_t *pa[ROPE_MAX_DEPTH]; // parent nodes + int ia[ROPE_MAX_DEPTH]; // index in the parent nodes + int d; // the current depth in the B+-tree +} rpitr_t; + +typedef struct { + int beg; + int64_t bc[6]; + uint8_t *p; +} rpcache_t; + +#ifdef __cplusplus +extern "C" { +#endif + + rope_t *rope_init(int max_nodes, int block_len); + void rope_destroy(rope_t *rope); + int64_t rope_insert_run(rope_t *rope, int64_t x, int a, int64_t rl, rpcache_t *cache); + void rope_rank2a(const rope_t *rope, int64_t x, int64_t y, int64_t *cx, int64_t *cy); + #define rope_rank1a(rope, x, cx) rope_rank2a(rope, x, -1, cx, 0) + + void rope_itr_first(const rope_t *rope, rpitr_t *i); + const uint8_t *rope_itr_next_block(rpitr_t *i); + + void rope_print_node(const rpnode_t *p); + void rope_dump(const rope_t *r, FILE *fp); + rope_t *rope_restore(FILE *fp); + +#ifdef __cplusplus +} +#endif + +#endif diff --git a/run.sh b/run.sh new file mode 100755 index 0000000..4ae04ee --- /dev/null +++ b/run.sh @@ -0,0 +1,14 @@ +thread=128 + +n1=~/data/dataset/real/D1/n1.fq.gz +n2=~/data/dataset/real/D1/n2.fq.gz + +reference=~/data/fmt_ref/human_g1k_v37_decoy.fasta + +out=./out.sam + +time ./fastbwa mem -t $thread -M -R @RG\\tID:normal\\tSM:normal\\tPL:illumina\\tLB:normal\\tPG:bwa \ + $reference \ + $n1 \ + $n2 \ + -o $out -2 diff --git a/scalar_sse.h b/scalar_sse.h new file mode 100644 index 0000000..9c2c326 --- /dev/null +++ b/scalar_sse.h @@ -0,0 +1,119 @@ +#ifndef SCALAR_SSE_H +#define SCALAR_SSE_H + +#include +#include +#include + +typedef union m128i { + uint8_t u8[16]; + int16_t i16[8]; +} __m128i; + +static inline __m128i _mm_set1_epi32(int32_t n) { + assert(n >= 0 && n <= 255); + __m128i r; memset(&r, n, sizeof r); return r; +} + +static inline __m128i _mm_load_si128(const __m128i *ptr) { __m128i r; memcpy(&r, ptr, sizeof r); return r; } +static inline void _mm_store_si128(__m128i *ptr, __m128i a) { memcpy(ptr, &a, sizeof a); } + +static inline int m128i_allzero(__m128i a) { + static const char zero[] = "\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0\0"; + return memcmp(&a, zero, sizeof a) == 0; +} + +static inline __m128i _mm_slli_si128(__m128i a, int n) { + int i; + memmove(&a.u8[n], &a.u8[0], 16 - n); + for (i = 0; i < n; i++) a.u8[i] = 0; + return a; +} + +static inline __m128i _mm_adds_epu8(__m128i a, __m128i b) { + int i; + for (i = 0; i < 16; i++) { + uint16_t aa = a.u8[i]; + aa += b.u8[i]; + a.u8[i] = (aa < 256)? aa : 255; + } + return a; +} + +static inline __m128i _mm_max_epu8(__m128i a, __m128i b) { + int i; + for (i = 0; i < 16; i++) + if (a.u8[i] < b.u8[i]) a.u8[i] = b.u8[i]; + return a; +} + +static inline uint8_t m128i_max_u8(__m128i a) { + uint8_t max = 0; + int i; + for (i = 0; i < 16; i++) + if (max < a.u8[i]) max = a.u8[i]; + return max; +} + +static inline __m128i _mm_set1_epi8(int8_t n) { __m128i r; memset(&r, n, sizeof r); return r; } + +static inline __m128i _mm_subs_epu8(__m128i a, __m128i b) { + int i; + for (i = 0; i < 16; i++) { + int16_t aa = a.u8[i]; + aa -= b.u8[i]; + a.u8[i] = (aa >= 0)? aa : 0; + } + return a; +} + +static inline __m128i _mm_adds_epi16(__m128i a, __m128i b) { + int i; + for (i = 0; i < 8; i++) { + int32_t aa = a.i16[i]; + aa += b.i16[i]; + a.i16[i] = (aa < 32768)? aa : 32767; + } + return a; +} + +static inline __m128i _mm_cmpgt_epi16(__m128i a, __m128i b) { + int i; + for (i = 0; i < 8; i++) + a.i16[i] = (a.i16[i] > b.i16[i])? 0xffff : 0x0000; + return a; +} + +static inline __m128i _mm_max_epi16(__m128i a, __m128i b) { + int i; + for (i = 0; i < 8; i++) + if (a.i16[i] < b.i16[i]) a.i16[i] = b.i16[i]; + return a; +} + +static inline __m128i _mm_set1_epi16(int16_t n) { + __m128i r; + r.i16[0] = r.i16[1] = r.i16[2] = r.i16[3] = + r.i16[4] = r.i16[5] = r.i16[6] = r.i16[7] = n; + return r; +} + +static inline int16_t m128i_max_s16(__m128i a) { + int16_t max = -32768; + int i; + for (i = 0; i < 8; i++) + if (max < a.i16[i]) max = a.i16[i]; + return max; +} + +static inline __m128i _mm_subs_epu16(__m128i a, __m128i b) { + int i; + for (i = 0; i < 8; i++) { + int32_t aa = a.i16[i]; + aa -= b.i16[i]; + a.i16[i] = (aa >= 0)? aa : 0; + } + return a; +} + +#endif diff --git a/utils.c b/utils.c new file mode 100644 index 0000000..5cdf32f --- /dev/null +++ b/utils.c @@ -0,0 +1,455 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#define FSYNC_ON_FLUSH + +#include +#include +#include +#include +#include +#include +#ifdef FSYNC_ON_FLUSH +#include +#include +#include +#endif +#include +#include +#include + +#include "ksort.h" +#include "kvec.h" +#include "utils.h" +#include "yarn.h" +#include "khash.h" +#define pair64_lt(a, b) ((a).x < (b).x || ((a).x == (b).x && (a).y < (b).y)) +KSORT_INIT(128, pair64_t, pair64_lt) +KSORT_INIT(64, uint64_t, ks_lt_generic) + +#include "kseq.h" +KSEQ_INIT2(, gzFile, err_gzread) + +/******************** + * System utilities * + ********************/ + +FILE *err_xopen_core(const char *func, const char *fn, const char *mode) +{ + FILE *fp = 0; + if (strcmp(fn, "-") == 0) + return (strstr(mode, "r"))? stdin : stdout; + if ((fp = fopen(fn, mode)) == 0) { + err_fatal(func, "fail to open file '%s' : %s", fn, strerror(errno)); + } + return fp; +} + +FILE *err_xreopen_core(const char *func, const char *fn, const char *mode, FILE *fp) +{ + if (freopen(fn, mode, fp) == 0) { + err_fatal(func, "fail to open file '%s' : %s", fn, strerror(errno)); + } + return fp; +} + +gzFile err_xzopen_core(const char *func, const char *fn, const char *mode) +{ + gzFile fp; + if (strcmp(fn, "-") == 0) { + fp = gzdopen(fileno((strstr(mode, "r"))? stdin : stdout), mode); + /* According to zlib.h, this is the only reason gzdopen can fail */ + if (!fp) err_fatal(func, "Out of memory"); + return fp; + } + if ((fp = gzopen(fn, mode)) == 0) { + err_fatal(func, "fail to open file '%s' : %s", fn, errno ? strerror(errno) : "Out of memory"); + } + return fp; +} + +void err_fatal(const char *header, const char *fmt, ...) +{ + va_list args; + va_start(args, fmt); + fprintf(stderr, "[%s] ", header); + vfprintf(stderr, fmt, args); + fprintf(stderr, "\n"); + va_end(args); + exit(EXIT_FAILURE); +} + +void err_fatal_core(const char *header, const char *fmt, ...) +{ + va_list args; + va_start(args, fmt); + fprintf(stderr, "[%s] ", header); + vfprintf(stderr, fmt, args); + fprintf(stderr, " Abort!\n"); + va_end(args); + abort(); +} + +void _err_fatal_simple(const char *func, const char *msg) +{ + fprintf(stderr, "[%s] %s\n", func, msg); + exit(EXIT_FAILURE); +} + +void _err_fatal_simple_core(const char *func, const char *msg) +{ + fprintf(stderr, "[%s] %s Abort!\n", func, msg); + abort(); +} + +size_t err_fwrite(const void *ptr, size_t size, size_t nmemb, FILE *stream) +{ + size_t ret = fwrite(ptr, size, nmemb, stream); + if (ret != nmemb) + _err_fatal_simple("fwrite", strerror(errno)); + return ret; +} + +size_t err_fread_noeof(void *ptr, size_t size, size_t nmemb, FILE *stream) +{ + size_t ret = fread(ptr, size, nmemb, stream); + if (ret != nmemb) + { + _err_fatal_simple("fread", ferror(stream) ? strerror(errno) : "Unexpected end of file"); + } + return ret; +} + +uint64_t fread_fix(FILE *fp, uint64_t size, void *a) +{ // Mac/Darwin has a bug when reading data longer than 2GB. This function fixes this issue by reading data in small chunks + // const int bufsize = 0x1000000; // 16M block + const int bufsize = 0x4000000; // 64M block + uint64_t offset = 0; + while (size) + { + int x = bufsize < size ? bufsize : size; + if ((x = err_fread_noeof(a + offset, 1, x, fp)) == 0) + break; + size -= x; + offset += x; + } + return offset; +} + +typedef struct { + pthread_t tid; + void *buf[2]; + volatile int readSize[2]; + uint64_t getIdx; + uint64_t putIdx; + volatile int finish; + lock_t *mtx; +} FileKV; + +KHASH_MAP_INIT_INT64(fkv, FileKV); +static khash_t(fkv) *fHash = 0; + +#define USE_ASYNC_READ + +int err_gzread(gzFile file, void *ptr, unsigned int len) +{ + int ret = 0; + PROF_START(read); +#ifndef USE_ASYNC_READ + ret = gzread(file, ptr, len); +#else + khiter_t k = kh_get(fkv, fHash, (int64_t)file); + FileKV *val = &kh_value(fHash, k); + POSSESS(val->mtx); + WAIT_FOR(val->mtx, NOT_TO_BE, 0); // + RELEASE(val->mtx); + + int curIdx = val->getIdx % 2; + if (val->finish) { + if (val->getIdx < val->putIdx) { + ret = val->readSize[curIdx]; + if (ret > 0) memcpy(ptr, val->buf[curIdx], ret); + ++val->getIdx; + return ret; + } + return 0; + } + ret = val->readSize[curIdx]; + memcpy(ptr, val->buf[curIdx], ret); + + POSSESS(val->mtx); + ++val->getIdx; + TWIST(val->mtx, BY, -1); +#endif + PROF_END(gprof[G_read_seq], read); + + if (ret < 0) + { + int errnum = 0; + const char *msg = gzerror(file, &errnum); + _err_fatal_simple("gzread", Z_ERRNO == errnum ? strerror(errno) : msg); + } + + return ret; +} + +static int64_t kBufSize = 16777216; + +static void *async_gzread(void *data) { + gzFile file = (gzFile)data; + khiter_t k = kh_get(fkv, fHash, (int64_t)file); + FileKV *val = &kh_value(fHash, k); + + int ret = 0; + while (1) { + POSSESS(val->mtx); + WAIT_FOR(val->mtx, NOT_TO_BE, 2); // + RELEASE(val->mtx); + + int curIdx = val->putIdx % 2; + ret = gzread(file, val->buf[curIdx], kBufSize); + val->readSize[curIdx] = ret; + + if (ret <= 0) { + POSSESS(val->mtx); + val->finish = 1; + TWIST(val->mtx, BY, 1); + break; + } + + POSSESS(val->mtx); + val->putIdx += 1; + TWIST(val->mtx, BY, 1); + } + + return NULL; +} + +int start_async_read(gzFile file) { + int ret = 0; +#ifdef USE_ASYNC_READ + if (fHash == 0) { + fHash = kh_init(fkv); + } + khiter_t k = kh_put(fkv, fHash, (int64_t)file, &ret); + kh_key(fHash, k) = (int64_t)file; + FileKV *fv = &kh_value(fHash, k); + + fv->mtx = NEW_LOCK(0); + fv->getIdx = fv->putIdx = fv->finish = 0; + fv->readSize[0] = fv->readSize[1] = 0; + fv->buf[0] = malloc(kBufSize); + fv->buf[1] = malloc(kBufSize); + ret = pthread_create(&fv->tid, 0, async_gzread, file); +#endif + return ret; +} + +int stop_async_read(gzFile file) { +#ifdef USE_ASYNC_READ + khiter_t k = kh_get(fkv, fHash, (int64_t)file); + FileKV *val = &kh_value(fHash, k); + pthread_join(val->tid, 0); +#endif + return 0; +} + +int err_fseek(FILE *stream, long offset, int whence) +{ + int ret = fseek(stream, offset, whence); + if (0 != ret) + { + _err_fatal_simple("fseek", strerror(errno)); + } + return ret; +} + +long err_ftell(FILE *stream) +{ + long ret = ftell(stream); + if (-1 == ret) + { + _err_fatal_simple("ftell", strerror(errno)); + } + return ret; +} + +int err_printf(const char *format, ...) +{ + va_list arg; + int done; + va_start(arg, format); + done = vfprintf(stdout, format, arg); + int saveErrno = errno; + va_end(arg); + if (done < 0) _err_fatal_simple("vfprintf(stdout)", strerror(saveErrno)); + return done; +} + +int err_fprintf(FILE *stream, const char *format, ...) +{ + va_list arg; + int done; + va_start(arg, format); + done = vfprintf(stream, format, arg); + int saveErrno = errno; + va_end(arg); + if (done < 0) _err_fatal_simple("vfprintf", strerror(saveErrno)); + return done; +} + +int err_fputc(int c, FILE *stream) +{ + int ret = putc(c, stream); + if (EOF == ret) + { + _err_fatal_simple("fputc", strerror(errno)); + } + + return ret; +} + +int err_fputs(const char *s, FILE *stream) +{ + int ret = fputs(s, stream); + if (EOF == ret) + { + _err_fatal_simple("fputs", strerror(errno)); + } + + return ret; +} + +int err_puts(const char *s) +{ + int ret = puts(s); + if (EOF == ret) + { + _err_fatal_simple("puts", strerror(errno)); + } + + return ret; +} + +int err_fflush(FILE *stream) +{ + int ret = fflush(stream); + if (ret != 0) _err_fatal_simple("fflush", strerror(errno)); + +#ifdef FSYNC_ON_FLUSH + /* Calling fflush() ensures that all the data has made it to the + kernel buffers, but this may not be sufficient for remote filesystems + (e.g. NFS, lustre) as an error may still occur while the kernel + is copying the buffered data to the file server. To be sure of + catching these errors, we need to call fsync() on the file + descriptor, but only if it is a regular file. */ + { + struct stat sbuf; + if (0 != fstat(fileno(stream), &sbuf)) + _err_fatal_simple("fstat", strerror(errno)); + + if (S_ISREG(sbuf.st_mode)) + { + if (0 != fsync(fileno(stream))) + _err_fatal_simple("fsync", strerror(errno)); + } + } +#endif + return ret; +} + +int err_fclose(FILE *stream) +{ + int ret = fclose(stream); + if (ret != 0) _err_fatal_simple("fclose", strerror(errno)); + return ret; +} + +int err_gzclose(gzFile file) +{ + int ret = gzclose(file); + if (Z_OK != ret) + { + _err_fatal_simple("gzclose", Z_ERRNO == ret ? strerror(errno) : zError(ret)); + } + + return ret; +} + +/********* + * Timer * + *********/ + +double cputime(void) +{ + struct rusage r; + getrusage(RUSAGE_SELF, &r); + return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec); +} + +double realtime(void) +{ + struct timeval tp; + struct timezone tzp; + gettimeofday(&tp, &tzp); + return tp.tv_sec + tp.tv_usec * 1e-6; +} + +uint64_t realtime_msec(void) +{ + struct timeval tv; + gettimeofday(&tv, NULL); + return (uint64_t)1000 * (tv.tv_sec + ((1e-6) * tv.tv_usec)); +} + +long peakrss(void) +{ + struct rusage r; + getrusage(RUSAGE_SELF, &r); +#ifdef __linux__ + return r.ru_maxrss * 1024; +#else + return r.ru_maxrss; +#endif +} + +int memcpy_bwamem(void *dest, size_t dmax, const void *src, size_t smax, char *file_name, int line_num) +{ +#define RSIZE_MAX_MEM (256UL << 20) /* 256MB */ + if (dmax < smax) + { + fprintf(stderr, "[%s: %d] src size is lager than dest size.(src: %ld; dest: %ld)\n", file_name, line_num, smax, dmax); + exit(EXIT_FAILURE); + } + int64_t bytes_copied; + for (bytes_copied = 0; bytes_copied < smax; bytes_copied += RSIZE_MAX_MEM) + { + int64_t bytes_remaining = smax - bytes_copied; + int64_t bytes_to_copy = (bytes_remaining > RSIZE_MAX_MEM) ? RSIZE_MAX_MEM : bytes_remaining; + memcpy((char *)dest + bytes_copied, (const char *)src + bytes_copied, bytes_to_copy); + } + return 0; +} \ No newline at end of file diff --git a/utils.h b/utils.h new file mode 100644 index 0000000..ddf81b9 --- /dev/null +++ b/utils.h @@ -0,0 +1,158 @@ +/* The MIT License + + Copyright (c) 2018- Dana-Farber Cancer Institute + 2009-2018 Broad Institute, Inc. + 2008-2009 Genome Research Ltd. (GRL) + + Permission is hereby granted, free of charge, to any person obtaining + a copy of this software and associated documentation files (the + "Software"), to deal in the Software without restriction, including + without limitation the rights to use, copy, modify, merge, publish, + distribute, sublicense, and/or sell copies of the Software, and to + permit persons to whom the Software is furnished to do so, subject to + the following conditions: + + The above copyright notice and this permission notice shall be + included in all copies or substantial portions of the Software. + + THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, + EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF + MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND + NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS + BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN + ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN + CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + SOFTWARE. +*/ +#ifndef LH3_UTILS_H +#define LH3_UTILS_H + +#include +#include +#include +#include +#include "profiling.h" + +#undef MAX +#undef MIN +#define MAX(x, y) ((x) > (y) ? (x) : (y)) +#define MIN(x, y) ((x) < (y) ? (x) : (y)) + +#ifdef __GNUC__ +#define LIKELY(x) __builtin_expect((x), 1) +#define UNLIKELY(x) __builtin_expect((x), 0) +#else +#define LIKELY(x) (x) +#define UNLIKELY(x) (x) +#endif + +#ifdef __GNUC__ +// Tell GCC to validate printf format string and args +#define ATTRIBUTE(list) __attribute__ (list) +#else +#define ATTRIBUTE(list) +#endif + +#define err_fatal_simple(msg) _err_fatal_simple(__func__, msg) +#define err_fatal_simple_core(msg) _err_fatal_simple_core(__func__, msg) + +#define xopen(fn, mode) err_xopen_core(__func__, fn, mode) +#define xreopen(fn, mode, fp) err_xreopen_core(__func__, fn, mode, fp) +#define xzopen(fn, mode) err_xzopen_core(__func__, fn, mode) + +#define xassert(cond, msg) if ((cond) == 0) _err_fatal_simple_core(__func__, msg) + +#if defined(__GNUC__) && __GNUC__ < 11 && !defined(__clang__) +#if defined(__i386__) +static inline unsigned long long __rdtsc(void) +{ + unsigned long long int x; + __asm__ volatile(".byte 0x0f, 0x31" : "=A"(x)); + return x; +} +#elif defined(__x86_64__) +static inline unsigned long long __rdtsc(void) +{ + unsigned hi, lo; + __asm__ __volatile__("rdtsc" : "=a"(lo), "=d"(hi)); + return ((unsigned long long)lo) | (((unsigned long long)hi) << 32); +} +#endif +#endif + +#define log_file(fd, M, ...) \ + fprintf(fd, M "\n", ##__VA_ARGS__); \ + fflush(fd) + +typedef struct { + uint64_t x, y; +} pair64_t; + +typedef struct { size_t n, m; uint64_t *a; } uint64_v; +typedef struct { size_t n, m; uint32_t *a; } uint32_v; +typedef struct { size_t n, m; pair64_t *a; } pair64_v; + +typedef struct { size_t m; uint8_t *addr; } buf_t; + +#ifdef __cplusplus +extern "C" { +#endif + + void err_fatal(const char *header, const char *fmt, ...) ATTRIBUTE((noreturn)); + void err_fatal_core(const char *header, const char *fmt, ...) ATTRIBUTE((noreturn)); + void _err_fatal_simple(const char *func, const char *msg) ATTRIBUTE((noreturn)); + void _err_fatal_simple_core(const char *func, const char *msg) ATTRIBUTE((noreturn)); + FILE *err_xopen_core(const char *func, const char *fn, const char *mode); + FILE *err_xreopen_core(const char *func, const char *fn, const char *mode, FILE *fp); + gzFile err_xzopen_core(const char *func, const char *fn, const char *mode); + size_t err_fwrite(const void *ptr, size_t size, size_t nmemb, FILE *stream); + size_t err_fread_noeof(void *ptr, size_t size, size_t nmemb, FILE *stream); + uint64_t fread_fix(FILE *fp, uint64_t size, void *a); + + int err_gzread(gzFile file, void *ptr, unsigned int len); + int err_fseek(FILE *stream, long offset, int whence); +#define err_rewind(FP) err_fseek((FP), 0, SEEK_SET) + long err_ftell(FILE *stream); + int err_fprintf(FILE *stream, const char *format, ...) + ATTRIBUTE((format(printf, 2, 3))); + int err_printf(const char *format, ...) + ATTRIBUTE((format(printf, 1, 2))); + int err_fputc(int c, FILE *stream); +#define err_putchar(C) err_fputc((C), stdout) + int err_fputs(const char *s, FILE *stream); + int err_puts(const char *s); + int err_fflush(FILE *stream); + int err_fclose(FILE *stream); + int err_gzclose(gzFile file); + + double cputime(void); + double realtime(void); + uint64_t realtime_msec(void); + long peakrss(void); + + void ks_introsort_64 (size_t n, uint64_t *a); + void ks_introsort_128(size_t n, pair64_t *a); + + int memcpy_bwamem(void *dest, size_t dmax, const void *src, size_t smax, char *file_name, int line_num); + + int start_async_read(gzFile file); + int stop_async_read(gzFile file); + +#ifdef __cplusplus +} +#endif + +static inline uint64_t hash_64(uint64_t key) +{ + key += ~(key << 32); + key ^= (key >> 22); + key += ~(key << 13); + key ^= (key >> 8); + key += (key << 3); + key ^= (key >> 15); + key += ~(key << 27); + key ^= (key >> 31); + return key; +} + +#endif diff --git a/xa2multi.pl b/xa2multi.pl new file mode 100755 index 0000000..fff50fd --- /dev/null +++ b/xa2multi.pl @@ -0,0 +1,25 @@ +#!/usr/bin/env perl + +use strict; +use warnings; + +while (<>) { + if (/\tXA:Z:(\S+)/) { + my $l = $1; + print; + my @t = split("\t"); + while ($l =~ /([^,;]+),([-+]\d+),([^,]+),(\d+);/g) { + my $mchr = ($t[6] eq $1)? '=' : $t[6]; # FIXME: TLEN/ISIZE is not calculated! + my $seq = $t[9]; + my $phred = $t[10]; + # if alternative alignment has other orientation than primary, + # then print the reverse (complement) of sequence and phred string + if ((($t[1]&0x10)>0) xor ($2<0)) { + $seq = reverse $seq; + $seq =~ tr/ACGTacgt/TGCAtgca/; + $phred = reverse $phred; + } + print(join("\t", $t[0], 0x100|($t[1]&0x6e9)|($2<0?0x10:0), $1, abs($2), 0, $3, @t[6..7], 0, $seq, $phred, "NM:i:$4"), "\n"); + } + } else { print; } +} diff --git a/yarn.c b/yarn.c new file mode 100644 index 0000000..254ba62 --- /dev/null +++ b/yarn.c @@ -0,0 +1,398 @@ +/* yarn.c -- generic thread operations implemented using pthread functions + * Copyright (C) 2008, 2011, 2012, 2015, 2018, 2019, 2020 Mark Adler + * Version 1.7 12 Apr 2020 Mark Adler + * For conditions of distribution and use, see copyright notice in yarn.h + */ + +/* Basic thread operations implemented using the POSIX pthread library. All + pthread references are isolated within this module to allow alternate + implementations with other thread libraries. See yarn.h for the description + of these operations. */ + +/* Version history: + 1.0 19 Oct 2008 First version + 1.1 26 Oct 2008 No need to set the stack size -- remove + Add yarn_abort() function for clean-up on error exit + 1.2 19 Dec 2011 (changes reversed in 1.3) + 1.3 13 Jan 2012 Add large file #define for consistency with pigz.c + Update thread portability #defines per IEEE 1003.1-2008 + Fix documentation in yarn.h for yarn_prefix + 1.4 19 Jan 2015 Allow yarn_abort() to avoid error message to stderr + Accept and do nothing for NULL argument to free_lock() + 1.5 8 May 2018 Remove destruct() to avoid use of pthread_cancel() + Normalize the code style + 1.6 3 Apr 2019 Add debugging information to fail() error messages + 1.7 12 Apr 2020 Fix use after free bug in ignition() + */ + +// For thread portability. +#define _XOPEN_SOURCE 700 +#define _POSIX_C_SOURCE 200809L +#define _THREAD_SAFE + +// Use large file functions if available. +#define _FILE_OFFSET_BITS 64 + +// External libraries and entities referenced. +#include // fprintf(), stderr +#include // exit(), malloc(), free(), NULL +#include // pthread_t, pthread_create(), pthread_join(), + // pthread_attr_t, pthread_attr_init(), pthread_attr_destroy(), + // PTHREAD_CREATE_JOINABLE, pthread_attr_setdetachstate(), + // pthread_self(), pthread_equal(), + // pthread_mutex_t, PTHREAD_MUTEX_INITIALIZER, pthread_mutex_init(), + // pthread_mutex_lock(), pthread_mutex_unlock(), pthread_mutex_destroy(), + // pthread_cond_t, PTHREAD_COND_INITIALIZER, pthread_cond_init(), + // pthread_cond_broadcast(), pthread_cond_wait(), pthread_cond_destroy() +#include // EPERM, ESRCH, EDEADLK, ENOMEM, EBUSY, EINVAL, EAGAIN + +// Interface definition. +#include "yarn.h" + +// Constants. +#define local static // for non-exported functions and globals + +// Error handling external globals, resettable by application. +char *yarn_prefix = (char*)"yarn"; +void (*yarn_abort)(int) = NULL; + + +// Immediately exit -- use for errors that shouldn't ever happen. +local void fail(int err, char const *file, long line, char const *func) { + fprintf(stderr, "%s: ", yarn_prefix); + switch (err) { + case EPERM: + fputs("already unlocked", stderr); + break; + case ESRCH: + fputs("no such thread", stderr); + break; + case EDEADLK: + fputs("resource deadlock", stderr); + break; + case ENOMEM: + fputs("out of memory", stderr); + break; + case EBUSY: + fputs("can't destroy locked resource", stderr); + break; + case EINVAL: + fputs("invalid request", stderr); + break; + case EAGAIN: + fputs("resource unavailable", stderr); + break; + default: + fprintf(stderr, "internal error %d", err); + } + fprintf(stderr, " (%s:%ld:%s)\n", file, line, func); + if (yarn_abort != NULL) + yarn_abort(err); + exit(err); +} + +// Memory handling routines provided by user. If none are provided, malloc() +// and free() are used, which are therefore assumed to be thread-safe. +typedef void *(*malloc_t)(size_t); +typedef void (*free_t)(void *); +local malloc_t my_malloc_f = malloc; +local free_t my_free = free; + +// Use user-supplied allocation routines instead of malloc() and free(). +void yarn_mem(malloc_t lease, free_t vacate) { + my_malloc_f = lease; + my_free = vacate; +} + +// Memory allocation that cannot fail (from the point of view of the caller). +local void *my_malloc(size_t size, char const *file, long line) { + void *block; + + if ((block = my_malloc_f(size)) == NULL) + fail(ENOMEM, file, line, "malloc"); + return block; +} + +// -- Lock functions -- + +struct lock_s { + pthread_mutex_t mutex; + pthread_cond_t cond; + long value; +}; + +lock_t *new_lock_(long initial, char const *file, long line) { + lock_t *bolt = (lock_t *)my_malloc(sizeof(struct lock_s), file, line); + int ret = pthread_mutex_init(&(bolt->mutex), NULL); + if (ret) + fail(ret, file, line, "mutex_init"); + ret = pthread_cond_init(&(bolt->cond), NULL); + if (ret) + fail(ret, file, line, "cond_init"); + bolt->value = initial; + return bolt; +} + +void possess_(lock_t *bolt, char const *file, long line) { + int ret = pthread_mutex_lock(&(bolt->mutex)); + if (ret) + fail(ret, file, line, "mutex_lock"); +} + +void release_(lock_t *bolt, char const *file, long line) { + int ret = pthread_mutex_unlock(&(bolt->mutex)); + if (ret) + fail(ret, file, line, "mutex_unlock"); +} + +void twist_(lock_t *bolt, enum twist_op op, long val, + char const *file, long line) { + if (op == TO) + bolt->value = val; + else if (op == BY) + bolt->value += val; + int ret = pthread_cond_broadcast(&(bolt->cond)); + if (ret) + fail(ret, file, line, "cond_broadcast"); + ret = pthread_mutex_unlock(&(bolt->mutex)); + if (ret) + fail(ret, file, line, "mutex_unlock"); +} + +#define until(a) while(!(a)) + +void wait_for_(lock_t *bolt, enum wait_op op, long val, + char const *file, long line) { + switch (op) { + case TO_BE: + until (bolt->value == val) { + int ret = pthread_cond_wait(&(bolt->cond), &(bolt->mutex)); + if (ret) + fail(ret, file, line, "cond_wait"); + } + break; + case NOT_TO_BE: + until (bolt->value != val) { + int ret = pthread_cond_wait(&(bolt->cond), &(bolt->mutex)); + if (ret) + fail(ret, file, line, "cond_wait"); + } + break; + case TO_BE_MORE_THAN: + until (bolt->value > val) { + int ret = pthread_cond_wait(&(bolt->cond), &(bolt->mutex)); + if (ret) + fail(ret, file, line, "cond_wait"); + } + break; + case TO_BE_LESS_THAN: + until (bolt->value < val) { + int ret = pthread_cond_wait(&(bolt->cond), &(bolt->mutex)); + if (ret) + fail(ret, file, line, "cond_wait"); + } + } +} + +long peek_lock(lock_t *bolt) { + return bolt->value; +} + +void free_lock_(lock_t *bolt, char const *file, long line) { + if (bolt == NULL) + return; + int ret = pthread_cond_destroy(&(bolt->cond)); + if (ret) + fail(ret, file, line, "cond_destroy"); + ret = pthread_mutex_destroy(&(bolt->mutex)); + if (ret) + fail(ret, file, line, "mutex_destroy"); + my_free(bolt); +} + +// -- Thread functions (uses the lock_t functions above) -- + +struct thread_s { + pthread_t id; + int done; // true if this thread has exited + thread *next; // for list of all launched threads +}; + +// List of threads launched but not joined, count of threads exited but not +// joined (incremented by ignition() just before exiting). +local lock_t threads_lock = { + PTHREAD_MUTEX_INITIALIZER, + PTHREAD_COND_INITIALIZER, + 0 // number of threads exited but not joined +}; +local thread *threads = NULL; // list of extant threads + +// Structure in which to pass the probe and its payload to ignition(). +struct capsule { + void (*probe)(void *); + void *payload; + char const *file; + long line; +}; + +// Mark the calling thread as done and alert join_all(). +local void reenter(void *arg) { + struct capsule *capsule = (struct capsule *)arg; + + // find this thread in the threads list by matching the thread id + pthread_t me = pthread_self(); + possess_(&(threads_lock), capsule->file, capsule->line); + thread **prior = &(threads); + thread *match; + while ((match = *prior) != NULL) { + if (pthread_equal(match->id, me)) + break; + prior = &(match->next); + } + if (match == NULL) + fail(ESRCH, capsule->file, capsule->line, "reenter lost"); + + // mark this thread as done and move it to the head of the list + match->done = 1; + if (threads != match) { + *prior = match->next; + match->next = threads; + threads = match; + } + + // update the count of threads to be joined and alert join_all() + twist_(&(threads_lock), BY, +1, capsule->file, capsule->line); + + // free the capsule resource, even if the thread is cancelled (though yarn + // doesn't use pthread_cancel() -- you never know) + my_free(capsule); +} + +// All threads go through this routine. Just before a thread exits, it marks +// itself as done in the threads list and alerts join_all() so that the thread +// resources can be released. Use a cleanup stack so that the marking occurs +// even if the thread is cancelled. +local void *ignition(void *arg) { + struct capsule *capsule = (struct capsule *)arg; + + // run reenter() before leaving + pthread_cleanup_push(reenter, arg); + + // execute the requested function with argument + capsule->probe(capsule->payload); + + // mark this thread as done, letting join_all() know, and free capsule + pthread_cleanup_pop(1); + + // exit thread + return NULL; +} + +// Not all POSIX implementations create threads as joinable by default, so that +// is made explicit here. +thread *launch_(void (*probe)(void *), void *payload, + char const *file, long line) { + // construct the requested call and argument for the ignition() routine + // (allocated instead of automatic so that we're sure this will still be + // there when ignition() actually starts up -- ignition() will free this + // allocation) + struct capsule *capsule = (struct capsule *)my_malloc(sizeof(struct capsule), file, line); + capsule->probe = probe; + capsule->payload = payload; + capsule->file = file; + capsule->line = line; + + // assure this thread is in the list before join_all() or ignition() looks + // for it + possess_(&(threads_lock), file, line); + + // create the thread and call ignition() from that thread + thread *th = (thread *)my_malloc(sizeof(struct thread_s), file, line); + pthread_attr_t attr; + int ret = pthread_attr_init(&attr); + if (ret) + fail(ret, file, line, "attr_init"); + ret = pthread_attr_setdetachstate(&attr, PTHREAD_CREATE_JOINABLE); + if (ret) + fail(ret, file, line, "attr_setdetachstate"); + ret = pthread_create(&(th->id), &attr, ignition, capsule); + if (ret) + fail(ret, file, line, "create"); + ret = pthread_attr_destroy(&attr); + if (ret) + fail(ret, file, line, "attr_destroy"); + + // put the thread in the threads list for join_all() + th->done = 0; + th->next = threads; + threads = th; + release_(&(threads_lock), file, line); + return th; +} + +void join_(thread *ally, char const *file, long line) { + // wait for thread to exit and return its resources + int ret = pthread_join(ally->id, NULL); + if (ret) + fail(ret, file, line, "join"); + + // find the thread in the threads list + possess_(&(threads_lock), file, line); + thread **prior = &(threads); + thread *match; + while ((match = *prior) != NULL) { + if (match == ally) + break; + prior = &(match->next); + } + if (match == NULL) + fail(ESRCH, file, line, "join lost"); + + // remove thread from list and update exited count, free thread + if (match->done) + threads_lock.value--; + *prior = match->next; + release_(&(threads_lock), file, line); + my_free(ally); +} + +// This implementation of join_all() only attempts to join threads that have +// announced that they have exited (see ignition()). When there are many +// threads, this is faster than waiting for some random thread to exit while a +// bunch of other threads have already exited. +int join_all_(char const *file, long line) { + // grab the threads list and initialize the joined count + int count = 0; + possess_(&(threads_lock), file, line); + + // do until threads list is empty + while (threads != NULL) { + // wait until at least one thread has reentered + wait_for_(&(threads_lock), NOT_TO_BE, 0, file, line); + + // find the first thread marked done (should be at or near the top) + thread **prior = &(threads); + thread *match; + while ((match = *prior) != NULL) { + if (match->done) + break; + prior = &(match->next); + } + if (match == NULL) + fail(ESRCH, file, line, "join_all lost"); + + // join the thread (will be almost immediate), remove from the threads + // list, update the reenter count, and free the thread + int ret = pthread_join(match->id, NULL); + if (ret) + fail(ret, file, line, "join"); + threads_lock.value--; + *prior = match->next; + my_free(match); + count++; + } + + // let go of the threads list and return the number of threads joined + release_(&(threads_lock), file, line); + return count; +} \ No newline at end of file diff --git a/yarn.h b/yarn.h new file mode 100644 index 0000000..ab5d31e --- /dev/null +++ b/yarn.h @@ -0,0 +1,139 @@ +/* yarn.h -- generic interface for thread operations + * Copyright (C) 2008, 2011, 2012, 2015, 2018, 2019, 2020 Mark Adler + * Version 1.7 12 Apr 2020 Mark Adler + */ + +/* + This software is provided 'as-is', without any express or implied + warranty. In no event will the author be held liable for any damages + arising from the use of this software. + + Permission is granted to anyone to use this software for any purpose, + including commercial applications, and to alter it and redistribute it + freely, subject to the following restrictions: + + 1. The origin of this software must not be misrepresented; you must not + claim that you wrote the original software. If you use this software + in a product, an acknowledgment in the product documentation would be + appreciated but is not required. + 2. Altered source versions must be plainly marked as such, and must not be + misrepresented as being the original software. + 3. This notice may not be removed or altered from any source distribution. + + Mark Adler + madler@alumni.caltech.edu + */ + +/* Basic thread operations + + This interface isolates the local operating system implementation of threads + from the application in order to facilitate platform independent use of + threads. All of the implementation details are deliberately hidden. + + Assuming adequate system resources and proper use, none of these functions + can fail. As a result, any errors encountered will cause an exit() to be + executed, or the execution of your own optionally-provided abort function. + + These functions allow the simple launching and joining of threads, and the + locking of objects and synchronization of changes of objects. The latter is + implemented with a single lock_t type that contains an integer value. The + value can be ignored for simple exclusive access to an object, or the value + can be used to signal and wait for changes to an object. + + -- Arguments -- + + thread *thread; identifier for launched thread, used by join + void probe(void *); pointer to function "probe", run when thread starts + void *payload; single argument passed to the probe function + lock_t *lock_t; a lock_t with a value -- used for exclusive access to + an object and to synchronize threads waiting for + changes to an object + long val; value to set lock_t, increment lock_t, or wait for + int n; number of threads joined + + -- Thread functions -- + + thread = launch(probe, payload) - launch a thread -- exit via probe() return + join(thread) - join a thread and by joining end it, waiting for the thread + to exit if it hasn't already -- will free the resources allocated by + launch() (don't try to join the same thread more than once) + n = join_all() - join all threads launched by launch() that are not joined + yet and free the resources allocated by the launches, usually to clean + up when the thread processing is done -- join_all() returns an int with + the count of the number of threads joined (join_all() should only be + called from the main thread, and should only be called after any calls + of join() have completed) + + -- Lock functions -- + + lock_t = new_lock(val) - create a new lock_t with initial value val (lock_t is + created in the released state) + possess(lock_t) - acquire exclusive possession of a lock_t, waiting if necessary + twist(lock_t, [TO | BY], val) - set lock_t to or increment lock_t by val, signal + all threads waiting on this lock_t and then release the lock_t -- must + possess the lock_t before calling (twist releases, so don't do a + release() after a twist() on the same lock_t) + wait_for(lock_t, [TO_BE | NOT_TO_BE | TO_BE_MORE_THAN | TO_BE_LESS_THAN], val) + - wait on lock_t value to be, not to be, be greater than, or be less than + val -- must possess the lock_t before calling, will possess the lock_t on + return but the lock_t is released while waiting to permit other threads + to use twist() to change the value and signal the change (so make sure + that the object is in a usable state when waiting) + release(lock_t) - release a possessed lock_t (do not try to release a lock_t that + the current thread does not possess) + val = peek_lock(lock_t) - return the value of the lock_t (assumes that lock_t is + already possessed, no possess or release is done by peek_lock()) + free_lock(lock_t) - free the resources allocated by new_lock() (application + must assure that the lock_t is released before calling free_lock()) + + -- Memory allocation --- + + yarn_mem(better_malloc, better_free) - set the memory allocation and free + routines for use by the yarn routines where the supplied routines have + the same interface and operation as malloc() and free(), and may be + provided in order to supply thread-safe memory allocation routines or + for any other reason -- by default malloc() and free() will be used + + -- Error control -- + + yarn_prefix - a char pointer to a string that will be the prefix for any + error messages that these routines generate before exiting -- if not + changed by the application, "yarn" will be used + yarn_abort - an external function that will be executed when there is an + internal yarn error, due to out of memory or misuse -- this function + may exit to abort the application, or if it returns, the yarn error + handler will exit (set to NULL by default for no action) + */ + +extern char *yarn_prefix; +extern void (*yarn_abort)(int); + +void yarn_mem(void *(*)(size_t), void (*)(void *)); + +typedef struct thread_s thread; +thread *launch_(void (*)(void *), void *, char const *, long); +#define LAUNCH(a, b) launch_(a, b, __FILE__, __LINE__) +void join_(thread *, char const *, long); +#define JOIN(a) join_(a, __FILE__, __LINE__) +int join_all_(char const *, long); +#define JOIN_ALL() join_all_(__FILE__, __LINE__) + +typedef struct lock_s lock_t; +lock_t *new_lock_(long, char const *, long); +#define NEW_LOCK(a) new_lock_(a, __FILE__, __LINE__) +void possess_(lock_t *, char const *, long); +#define POSSESS(a) possess_(a, __FILE__, __LINE__) +void release_(lock_t *, char const *, long); +// #define release(a) release_(a, __FILE__, __LINE__) +#define RELEASE(a) release_(a, __FILE__, __LINE__) +enum twist_op { TO, BY }; +void twist_(lock_t *, enum twist_op, long, char const *, long); +#define TWIST(a, b, c) twist_(a, b, c, __FILE__, __LINE__) +enum wait_op { + TO_BE, /* or */ NOT_TO_BE, /* that is the question */ + TO_BE_MORE_THAN, TO_BE_LESS_THAN }; +void wait_for_(lock_t *, enum wait_op, long, char const *, long); +#define WAIT_FOR(a, b, c) wait_for_(a, b, c, __FILE__, __LINE__) +long peek_lock(lock_t *); +void free_lock_(lock_t *, char const *, long); +#define FREE_LOCK(a) free_lock_(a, __FILE__, __LINE__)